US010731168B2
(12 ) United States Patent ( 10 ) Patent No.: US 10,731,168 B2 Landowski et al. (45 ) Date of Patent: * Aug. 4 , 2020
( 54 ) PROTEASE DEFICIENT FILAMENTOUS (2013.01 ) ; CO7K 2317/622 (2013.01 ) ; COOK FUNGAL CELLS AND METHODS OF USE 2317/94 (2013.01 ) ; YO2P 20/52 (2015.11 ) THEREOF (58 ) Field of Classification Search ( 71) Applicant: GLYKOS FINLAND OY , Helsinki None (FI ) See application file for complete search history . ( 72 ) Inventors : Christopher Landowski, Helsinki (FI ) ; Anne Huuskonen , Helsinki (FI ) ; ( 56 ) References Cited Juhani Saarinen , Helsinki (FI ) ; Ann U.S. PATENT DOCUMENTS Westerholm - Parvinen , Kirkkonummi (FI ) ; Anne Kanerva , Helsinki (FI ) ; 4,758,512 A 7/1988 Goldberg et al. 5,674,728 A 10/1997 Buxton et al. Jari Natunen , Vantaa (FI ) ; Anna - Liisa 5,693,520 A 12/1997 Branner et al. Hänninen , Helsinki (FI ) ; Noora 5,756,338 A 5/1998 Buxton et al. Salovuori, Helsinki ( FI) ; Merja 5,776,730 A 7/1998 Stuart Penttilä , Helsinki (FI ) ; Markku 5,821,104 A 10/1998 Holm et al. Saloheimo, Helsinki (FI ) 5,840,570 A 11/1998 Berka et al . 5,846,802 A 12/1998 Buxton et al. 5,968,774 A 10/1999 Lehmbeck ( 73 ) Assignee : GLYKOS FINLAND OY , Helsinki 5,989,889 A 11/1999 Rey et al. (FI ) 6,013,452 A 1/2000 Christensen et al. 6,013,489 A 1/2000 Musters et al. ( * ) Notice : Subject to any disclaimer , the term of this 6,025,185 A 2/2000 Christensen et al. patent is extended or adjusted under 35 6,291,209 B1 9/2001 Lehmbeck 6,352,841 B1 3/2002 Lehmbeck U.S.C. 154 (b ) by 6 days . 6,509,171 B1 1/2003 Berka et al . This patent is subject to a terminal dis 6,806,062 B1 10/2004 Hjort et al. claimer . 7,122,330 B2 10/2006 Emalfarb et al. 7,163,804 B1 1/2007 Royer et al. 7,198,938 B2 4/2007 Shuster et al. ( 21) Appl. No .: 16 /251,194 7,303,877 B2 12/2007 Connelly et al. 7,323,327 B2 1/2008 Edens et al. ( 22 ) Filed : Jan. 18 , 2019 7,691,621 B2 4/2010 Wang 7,771,971 B2 8/2010 Connelly et al. (65 ) Prior Publication Data 7,794,974 B2 9/2010 Peij et al. 7,858,360 B2 12/2010 Hansen et al . US 2019/0233831 A1 Aug. 1 , 2019 (Continued ) Related U.S. Application Data FOREIGN PATENT DOCUMENTS (63 ) Continuation of application No. 15/ 375,635 , filed on Dec. 12 , 2016 , now Pat. No. 10,240,159 , which is a EP 1 266 011 B1 5/2010 continuation of application No. 14 /370,255 , filed as WO 1997/012045 A1 4/1997 application No. PCT/ EP2013 / 050126 on Jan. 4 , 2013 , (Continued ) now Pat . No. 9,567,596 . OTHER PUBLICATIONS (60 ) Provisional application No. 61/ 583,559 , filed on Jan. 5 , 2012 . Mäntylä et al . Cloning of the aspartic protease gene of Trichoderma reesei. Proc. Second Eur. Conf. on FungalGenetics , Apr. 29 -May 1, (51 ) Int. Cl. 1994 , Book of Abstracts ( 1994 ) . C12N 15/80 ( 2006.01 ) CO7K 16/28 (2006.01 ) (Continued ) COZK 16/00 ( 2006.01) COZK 14/65 ( 2006.01 ) Primary Examiner Suzanne M Noakes CO7K 14/61 ( 2006.01 ) CO7K 14/56 ( 2006.01 ) Assistant Examiner Jae W Lee C12N 9/58 (2006.01 ) ( 74 ) Attorney , Agent, or Firm — Patrick J. Halloran C12P 21/02 ( 2006.01 ) C12P 21/00 ( 2006.01 ) (52 ) U.S. CI. (57 ) ABSTRACT CPC C12N 15/80 (2013.01 ) ; C07K 14/56 ( 2013.01 ); CO7K 14/61 (2013.01 ) ; CO7K 14/65 The present disclosure relates to compositions and methods (2013.01 ) ; COOK 16/00 (2013.01 ) ; CO7K useful for the production of heterologous proteins in fila 16/2887 ( 2013.01 ) ; C12N 9/58 ( 2013.01) ; mentous fungal cells . C12P 21/005 (2013.01 ) ; C12P 21/02 (2013.01 ) ; CO7K 2317/14 ( 2013.01) ; CO7K 2317/24 (2013.01 ) ; CO7K 2317/41 (2013.01 ) ; 16 Claims, 46 Drawing Sheets CO7K 2317/55 (2013.01 ) ; CO7K 2317/569 Specification includes a Sequence Listing . US 10,731,168 B2 Page 2
( 56 ) References Cited Kubicek , et al . UniProt G9P169 ( 2012 ) . Kubicek , et al. UniProt G9N7YO ( 2012 ) . U.S. PATENT DOCUMENTS Kubicek , et al . UniProt G9MY25 ( 2012 ) . Kubicek , et al. UniProt G9NLJ5 (2012 ) . 7,968,312 B2 6/2011 Sagt et al. LONG , et al . UniProt 12EC22 (2012 ) . 7,977,067 B2 7/2011 Power et al. 8,017,341 B2 9/2011 Nikolaev et al . Suarez , et al. UniProt A4V8W6 ( 2007 ) . 8,119,171 B2 2/2012 Lopez et al. Viterbo , et al. UniProt Q64HWO ( 2004 ) . 8,288,517 B2 10/2012 Clarkson et al. Roberts et al. , “ Heterologous Gene Expression in Aspergillus Niger: 8,389,269 B2 3/2013 Sagt et al. a Glucoamylase- Porcine Pancreatic Prophospholipase A2 Fusion 8,426,164 B2 4/2013 Hjort et al . Protein is Secreted and Processed to Yield Mature Enzyme” , Gene. , 8,450,098 B2 5/2013 Kim et al . 122 , 1992 , pp . 155-161 . 8,633,010 B2 1/2014 Lehmbeck et al. Sharma et al. , “ Approaches for Refining Heterologous Protein 8,647,856 B2 2/2014 Shasky et al . Production in Filamentous Fungi” , World J Microbiol Biotechnol, 8,680,252 B2 3/2014 Emalfarb et al. 25 , 2009 , pp . 2083-2094 . 8,716,004 B2 5/2014 Wang Sharon et al ., “ Transcription Factor PrtT Controls Expression of 8,741,654 B2 6/2014 Bodie et al . Multiple Secreted Proteases in the Human Pathogenic Mold Aspergil 8,812,247 B2 8/2014 Roubos et al. lus Fumigatus” , Infection and Immunity , vol. 77, No. 9 , Sep. 2009 , 8,916,363 B2 12/2014 Gusakov et al. 9,175,296 B2 11/2015 Punt et al. pp . 4051-4060 . 9,862,956 B2 * 1/2018 Emalfarb C12N 15/80 Simkovic et al. , “ Induction of Secretion of Extracellular Proteases 2004/0018573 Al 1/2004 Power et al . from Trichoderma Viride ” , Acta Chimica Slovaca , vol. 1 , No. 1 , 2008/0206816 A1 8/2008 Idiris et al. 2008 , pp . 250-264 . 2009/0176219 Al 7/2009 Parenicova et al. Sims et al. , “ Glutamic Protease Distribution is Limited to Filamen 2009/0221030 A1 9/2009 Bao et al . tous Fungi ” , FEMS Microbiology Letters , 239 , 2004 , pp . 95-101. 2009/0253173 A1 10/2009 Wang Sriranganadane et al. , “ Secreted Glutamic Protease Rescues Aspartic 2009/0275079 Al 11/2009 Edens et al. Protease Pep Deficiency in Aspergillus Fumigatus During Growth 2011/0111977 Al 5/2011 Retallack in Acidic Protein Medium ” , Microbiology, 157 , 2011, pp . 1541 2011/0283422 A1 11/2011 Nelson et al. 1550 . 2011/0294191 A1 12/2011 Wang 2012/0030839 A1 2/2012 Emalfarb et al . Suárez et al. ,“ Characterization of Genes Encoding Novel Peptidases 2012/0107856 A1 5/2012 Punt et al. in the Biocontrol Fungus Trichoderma Harzianum CECT 2413 2012/0149064 Al 6/2012 Wang et al. Using the TrichoEST FunctionalGenomics Approach ” , Curr Genet , 2012/0213728 A1 8/2012 Meehl et al . 51, 2007 , pp . 331-342 . 2012/0231502 A1 9/2012 Hamilton et al. Uusitalo et al. , Enzyme Production by Recombinant Trichoderma 2012/0232007 A1 9/2012 Bobrowicz et al. Reesei Strains. Journal of Biotechnology, 17 , 1991, pp . 35-50 . 2012/0276075 A1 11/2012 Monod et al. Van Den Hombergh et al. , “New Protease Mutants in Aspergillus 2012/0288892 Al 11/2012 Maiyuran et al . Niger Result in Strongly Reduced in Vitro Degradation of Target 2012/0328626 A1 12/2012 Sethuraman et al. Proteins ; Genetical and Biochemical Characterization of Seven 2013/0011875 Al 1/2013 Meehl et al. Complementation Groups” , Curr Genet, 28 , 1995 , pp . 299-308 . 2013/0084608 Al 4/2013 Szabo et al . Van Den Hombergh et al. , “ Improve the Efficiency of Protein 2014/0212977 Al 7/2014 Yaver et al. Expression in Fungi ” , Cherntech 26 , Feb. 1996 , pp . 30-37 . 2015/0337279 Al 11/2015 Zhang et al. Van Den Hombergh et al ., “ Aspergillus as a Host for Heterologous Protein Production : The Problem of Proteases ” , Tibtech , vol. 15 , FOREIGN PATENT DOCUMENTS Jul . 1997 , pp . 256-263 . Van Den Hombergh et al ., “ Production of the Homologous Pectin WO 1997/046689 A1 12/1997 WO 2000/046375 A2 8/2000 Lyase B Protein in Six Genetically Defined Protease -Deficient WO 2004/067709 A2 8/2004 Aspergillus Niger Mutant Stains” , Curr Genet , vol. 32 , Jul. 1997 , WO 2005/087922 A1 9/2005 pp . 73-81 . WO 2011075677 A2 6/2011 Van Kuyk et al ., " Analysis of Two Aspergillus Nidulans Genes WO 2012021883 A2 2/2012 Encoding Extracellular Proteases ” , Fungal Genetics and Biology , WO 2012024662 A2 2/2012 vol . 29 , Apr. 2000 , pp . 201-210 . WO 2012048334 A2 4/2012 Vázquez -Laslop et al. , " Characterization of a Vacuolar Protease in WO 2012061382 A2 5/2012 Neurospora Crassa and the Use ofGene Riping to Generate Protease WO 2013048661 A2 4/2013 Deficient Strains” , The Journal of Biological Chemistry , vol. 271, No. 36 , Sep. 1996 , pp . 21944-21949 . Vinterová et al ., “ Evidence for the Presence of Proteolytically OTHER PUBLICATIONS Active Secreted Aspartic Proteinase of Candida Parapsilosis in the Cell Wall ” , Protein Science , vol. 20 , Dec. 2011, pp . 2004-2012 . Berka et al. Comparative genomic analysis of the thermophilic Wang et al. , “ Bioprocessing Strategies to Improve Heterologous biomass- degrading fungi Myceliophthora thermophila and Thielavia Protein Production in Filamentous Fungal Fermentations” , Biotech terrestris . Nat Biotechnol. Oct. 2 , 2011; 29 ( 10 ) : 922-7 . nology Advances , vol . 23, Mar. 2005 , pp . 115-129 . Berka et al. ( 2011) UniProt G2Q4X9 . Wang et al. , “ Isolation of Four Pepsin - Like Protease Genes from Berka et al . (2011 ) UniProt G2Q6Z6 . Aspergillus Niger and Analysis of the Effect of Disruptions on Berka et al . (2011 ) UniProt G2Q8V1. Heterologous Laccase Expression ” , Fungal Genetics and Biology , Berka et al. (2011 ) UniProt G2Q925 . vol. 45 , Jan. 2008 , pp . 17-27 . Berka et al. ( 2011) UniProt G2QCB6 . Xu et al. , “ Increased Heterologous Protein Production in Aspergil Berka et al . ( 2011) UniProt G2QFE7 . lus Niger Fermentation through Extracellular Proteases Inhibition Berka et al . (2011 ) UniProt G2QK78 . by Pelleted Growth ” , Biotechnol Prog. , vol. 16 , No. 2 , Mar. - Apr. Martinez et . al (2008 ) UniProt GORH05 . 2000 , pp . 222-227 . Martinez et. al ( 2008 ) UniProt GORIW3. Yan et al ., " Cloning and Heterologous Expression of SS10 , A Martinez et. al ( 2008 ) UniProt GORRHO. Subtilisin -Like Protease Displaying Antifungal Activity from Martinez et . al (2008 ) UniProt GORRK1. Trichoderma Harzianum ” , FEMS Microbiology Letters , vol. 290 , Martinez et. al (2008 ) UniProt GORVKO . Jan. 2009, pp . 54-61 . Kubicek , et al. UniProt G9ML58 (2012 ) . Zhu et al ., “ Improved Heterologous Protein Production by a Tripeptidyl Kubicek , et al. UniProt G9MS93 (2012 ). Peptidase Gene ( Aosedd ) Disruptant of the Filamentous Fungus US 10,731,168 B2 Page 3
( 56 ) References Cited Delgado -Jarana et al ., " Overproduction of Beta - 1,6 - glucanase in Trichoderma Harzianum is Controlled by Extracellular Acidic Proteases OTHER PUBLICATIONS and pH ” , Biochimca et Biophysica Acta , 1481( 2 ) , Sep. 29, 2000, pp . 289-296 . Aspergillus Oryzae ” , The Journal of General and Applied Micro Delgado - Jarana et al. , “ Aspartyl Protease from Trichoderma Harzianum biology, vol. 58 , 2012 , pp . 199-209 . CECT 2413 : Cloning and Characterization ” Microbiology, 148 (Pt Zhu et al. , “ Further Enhanced Production of Heterologous Proteins 5 ) , May 2002 , pp . 1305-1315 . by Double -Gene Disruption (AAosedD AAovps10 ) in a Hyper Diener et al. , “ Characterization of the Protein Processing and Producing Mutant of Aspergillus Oryzae ” , Applied Microbiology Secretion Pathways in a Comprehensive Set of Expressed Sequence and Biotechnology , vol. 97, 2013, pp . 6347-6357 . Tags from Trichoderma reesei” , FEMS Microbiology Letters , 230 ( 2 ) , Kubicek , et al . Uniprot G9MUE5, XP_013956131 ( Feb. 22 , 2012 ). Jan. 30 , 2004 , pp . 275-282 . Dienes et al. , “ Identification of a trypsin - like Serine Protease from Kubicek , et al. Uniprot G9NC88 , XP_013949516 (Feb. 22 , 2012 ). Trichoderma reesei QM9414” , Enzyme and Microbial Technology, Kubicek , et al . Uniprot G9NQ54 , XP_013945396 (Feb. 22, 2012 ) . vol . 40 , Issue 5 , Apr. 3 , 2007, pp . 1087-1094 . Kubicek , et al. Uniprot G9P711 , XP_013939835 (Feb. 22 , 2012 ) . Durand -Poussereau et al. , " Characterization of a Protease Deficient Martinez , et al. Uniprot GOROK1, XP_006961397 (Oct. 19, 2011 ) . Strain ofPenicillium RoquefortiGenerated by Heterologous Plasmid Fujinaga et al. , “ The Molecular Structure and Catalytic Mechanism Integration : Potential use for Protein Production ” , Journal of Bio of a Novel Carboxyl Peptidase from Scytalidium Lignicolum ” , Proc technology , 51 ( 1 ), Oct. 18 , 1996 , pp . 97-105 . Natl Acad Sci USA , vol. 101, No. 10 , Mar. 9, 2004 , pp . 3364-3369 . Edens et al. , “ Extracellular Prolyl Endoprotease from Aspergillus Idiris , et al. Enhanced productivity of protease -sensitive heterologous Niger and its use in the Debittering of Protein Hydrolysates ” , proteins by disruption of multiple protease genes in the fission yeast Journal of Agricultural and Food Chemistry , 53 ( 20 ), Oct. 5, 2005 , Schizosaccharomyces pombe . Appl. Microbiol. Biotech . 73 : 404 pp . 7950-7957 . 420 (2006 ) . Eneyskaya et al. , “ Acid protease from Trichoderma reesei: Limited Idiris, et al . Construction of a protease- deficient strain set for the Proteolysis of Fungal Carbohydrases” , Applied Microbiology and fission yeast Schizosaccharomyces pombe , useful for effective pro Biotechnology, vol . 52, Issue 52 , Aug. 1999 , pp . 226-231 . duction of protease - sensitive heterologous proteins. Yeast , 23 ( 1 ) : Foreman et al. , “ Transcriptional Regulation of Biomass -degrading 83-99 (2006 ). Enzymes in the Filamentous Fungus Trichoderma reesei” , Journal Kataoka et al. , “ Catalytic residues and substrate specificity of of Biological Chemistry , vol. 278 , No. 34 , Aug. 22 , 2003 , pp . scytalidoglutamic peptidase , the first member of the eqolisin in 31988-31997 . family (G1 ) of peptidases” , FEBS Letters , 579 ( 14 ) , Jun . 6 , 2005 , pp . Frenken et al ., “ Recent Advances in the Large - scale Production of 2991-2994 . Antibody Fragments using Lower Eukaryotic Microorganisms” , Kubicek , et al . Comparative genome sequence analysis underscores Research in Immunology, vol. 149, Issue 6 , Jul. 1998 , pp . 589-599 . mycoparasitism as the ancestral life style of Trichoderma . Genome Gagnon - Arsenault et al. , “ Fungal Yapsins and Cell Wall : a Unique Biol. 12 :R40.1 -R40.15 ( 2011) . Family of Aspartic Peptidases for a Distinctive Cellular Function ” , Oda , K. Scytalidopepsin B. Handbook of Proteolytic Enzymes, 2nd FEMS Yeast Research , 6 ( 7 ) , Nov. 2006 , pp . 966-978 . Ed. (2004 ). Gouka et al. , “ Efficient Production of Secreted Proteins by Aspergil Rolland , et al. pH controls both transcription and post -translational lus: Progress, Limitations and Prospects ” , Applied Microbiology processing of the protease BcACP1 in the phytopathogenic fungus and Biotechnology, vol. 47 , Issue 1 , Jan. 1997 , pp . 1-11 . Botrytis cinerea. Microbiol . 155 : 2097-2105 ( 2009 ) . Haab et al ., “ Formation of the Extracellular Proteases from Trichoderma Takahashi, K. Aspergillopepsin II. Handbook of Proteolytic Enzymes , reesei QM 9414 Involved in Cellulase Degradation ” , Journal of 2nd Ed . ( 2004 ) . Biotechnology, vol. 16 , Issue 3-4 , Nov. 1990 , pp . 187-198 . Yabuki, et al . Identification of a glutamine residue essential for Hagspiel et al. , “ Protease Activity and Proteolytic Modification of catalytic activity of asperfilloglutamic peptidase by site -directed cellulases from a Trichoderma reesei QM 9414 selectant” , Applied mutagenesis . FEBS Letter , 569: 161-4 (2004 ) . Microbiology and Biotechnology , vol. 32 , Issue 1 , Nov. 1989 , pp . Kubicek , et al. UniProt G9NTYO ( 2012 ). 61-67. Viterbo , et al. UniProt Q64HWO (2004 ) . Huang et al. , “ Identification of a Glutamic Acid and an Aspartic Van Den Hombergh et al. , “ Improve the Efficiency of Protein Acid Residue Essential for Catalytic Activity of Aspergillopepsin II , Expression in Fungi ” , Chemtech 26 , Feb. 1996 , pp . 30-37 . a non -pepsin type Acid Proteinase” , The Journal of Biological Van Den Hombergh et al. , “ Production of the Homologous Pectin Chemistry, vol. 275 , No. 34 , Aug. 25, 2000 , pp . 26607-26614 . Lyase B Protein in Six Genetically Defined Protease -Deficient Inoue et al ., “ The Gene and Deduced Protein Sequences of the Aspergillus Niger Mutant Strains” , Curr Genet , vol. 32 , Jul . 1997 , Zymogen of Aspergillus Niger acid Proteinase A ” , The Journal of pp . 73-81. Biological Chemistry , vol. 266 , No. 29 , Oct. 15, 1991, pp . 19484 Adav et al. , “ Proteomic Analysis of pH and Strains Dependent 19489 . Protein Secretion of Trichoderma Reesei ” , J Proteome Res ., ( 10 ) 10 , Janas, “ Production of Extracellular Enzymes by Low -protease Mutants Oct. 7 , 2011 , pp . 4579-4596 . of Trichoderma reesei ” , Technologia Alimentaria , Issue 2 ( 2 ) , 2003, Archer et al. , “ Proteolytic Degradation of Heterologous Proteins pp . 103-114 . Expressed in Aspergillus Niger” , Biotechnology Letters , vol. 14 , Jarai et al ., “ Cloning and Characterization of the pepE Gene of Issue 5 , May 5 , 1992 , pp . 357-362 . Aspergillus Niger Encoding a new Aspartic Protease and Regulation Behnsen et al. , “ Secreted Aspergillus Fumigatus Protease Alpl of pepE and pepC ” , Gene ., 145 ( 2 ) , Aug. 1994 , pp . 171-178 . Degrades Human Complement Proteins C3 , C4 , and C5 ” , Infect Jin et al ., “ Double Disruption of the Proteinase Genes , tppA and Immun ., 78 ( 8 ), Aug. 2010 , pp . 3585-3594 . pep? , Increases the Production Level of Human Lysozyme by Berka et al. , “Molecular Cloning and Deletion of the Gene Encoding Aspergillus Oryzae” , Applied Microbiology and Biotechnology , Aspergillopepsin a from Aspergillus Awamori” , Gene ., 86 ( 2 ) , Feb. vol. 76 , Issue 5 , Oct. 2007, pp . 1059-1068 . 14 , 1990 , pp . 153-162 . Kakimori et al ., “ Nucleotide Sequence of the Gene Encoding Broekhuijsen et al ., “ Secretion of Heterologous Proteins by Aspergil Pepstatin - insensitive Acid Protease B , Scytalidopepsin B , of Scytalidium lus Niger: Production of Active Human Interleukin - 6 in a Protease Lignicolum ” , Bioscience Biotechnology and Biochemistry , 60 ( 7 ) , Deficient Mutant by KEX2- like Processing of a Glucoamylase- hIL6 1996 , pp . 1210-1211. Fusion Protein ” , Journal of Biotechnology, 31 (2 ), Nov. 1993, pp . Kimura et al ., “Monitoring Global Gene Expression of Proteases 135-145 . and Improvement of Human Lysozyme Production in the nptB gene Dal Degan et al. , " Purification and Characterization of two Serine disruptant of Aspergillus oryzae” Bioscience, Biotechnology, and Carboxypeptidases from Aspergillus Niger and their use in C - ter Biochemistry , vol. 72 , Issue 2 , Feb. 2008 , pp . 499-505 . minal Sequencing of Proteins and Peptide Synthesis” , Applied and Kruszewska , " Heterologous expression of genes in filamentous Environment Microbiology , 58 ( 7 ) , Jul. 1992, pp . 2144-2152 . fungi” , Acta Biochimica Polonica , vol. 46 , No. 1 , 1999 , 181-195 . US 10,731,168 B2 Page 4
( 56 ) References Cited O'Donoghue et al. , “ Inhibition of a Secreted Glutamic Peptidase Prevents Growth of the Fungus Talaromyces Emersonii” , Journal of OTHER PUBLICATIONS Biological Chemistry , vol. 283. No. 43 , Oct. 24 , 2008 , pp . 29186 29195 . Liu et al. , “ A new Serine Protease Gene from TrichodermaHarzianum is Expressed in Saccharomyces Cerevisiae ” , Prikl Biokhim Mikrobiol ., Pillai et al. , “ Crystal Structure of Scytalidoglutamic Peptidase with 45 ( 1 ) , Jan.- Feb . 2009 , pp . 28-32 . its First Potent Inhibitor Provides Insights into Substrate Specificity Lu et al. , “Molecular Cloning of a cDNA for Proctase B from and Catalysis ” , Journal of Molecular Biology , vol. 365, Issue 2 , Aspergillus Niger Var .Macrosporus and Sequence Comparison with 2007, pp . 343-361. Other Aspergillopepsins I” , Bioscience, Biotechnology, and Bio Pozo et al. , “ Functional Analysis of tvspl, a Serine Protease chemistry , 59 ( 5 ) , 1995 , pp . 954-955 . Encoding Gene in the Biocontrol Agent Trichoderma Virens” , Lubertozzi et al. , “ Developing Aspergillus as a Host for Heterologous Fungal Genetics and Biology , 41, 2004 , pp . 336-348 . Expression " , Biotechnology Advances , 27 ( 1 ) , Jan.- Feb . 2009 , pp . Reichard et al. , “Molecular Cloning and Sequencing of the Gene 53-75 . Encoding an Extracellular Aspartic Proteinase from Aspergillus Maita et al. , " Complete Amino Acid Sequence of Scytalidium Fumigatus” , FEMS Microbioly Letters , 130 , 1995 , pp . 69-74 . Lignicolum Acid Protease B ” , Journal of Biochemistry , 95 ( 2 ) , Feb. Reichard et al. , “Molecular Cloning and Targeted Deletion of PEP2 1984 , pp . 465-475 . Which Encodes a Novel Aspartic Proteinase from Aspergillus Margolles -Clark et al. , “ Improved Production of Trichoderma Harzianum Fumigatus” , Int. J. Med . Microbiol. , 290 , 2000 , pp . 85-96 . Endochitinase by Expression in Trichoderma Reesei ” , Applied and Reichard et al. , “ Sedolisins , a New Class of Secreted Proteases from Environmental Microbiology, vol . 2 , No. 6 , Jun . 1996 , pp . 2145 Aspergillus Fumigatus with Endoprotease or Tripeptidyl- Peptidase 2151 . Activity at acidic pHs” , Applied and Environmental Microbiology, Maruyama et al. , “Multiple Gene Disruptions by Marker Recycling vol. 72 , No. 3 , Mar. 2006 , pp . 1739-1748 . with Highly Efficient Gene - Targeting Background (DeltaligD ) in Ahamed , et al. Chymostatin can combine with pepstatin to eliminate Aspergillus Oryzae” , Biotechnol Letters , vol . 30 , Issue 10 , Oct. extracellular protease activity in cultures of Aspergillus niger NRRL 2008 , pp . 1811-1817 . 3. J. Ind . Microbiol. Biotechnol . 34 : 165-169 ( 2007 ). Mattern et al. , “ Isolation and Characterization of Mutants of Aspergil Baldwin , et al. Develop Systems for Manufacturing 100,000,000 lus Niger Deficient in Extracellular Proteases " ., Molecular and General Genetics MGG , vol . 234 , Issue 2 , Aug. 1992, pp . 332-336 . Doses of an Emergency Pharmaceutical ( e.g. Vaccine or Monoclo Moralejo et al. , “ Thaumatin Production in Aspergillus Awamori by nal Antibody) Within 2 Months of Product Identification , Genencor Use of Expression Cassettes with Strong Fungal Promoters and International ( Jun . 6 , 2009 ) . High Gene Dosage” , Applied and Environmental Microbiology, vol. Hintz et al ., Improved gene expression in Aspergillus nidulans. Can . 65 No. 3 , Mar. 1999 , pp . 1168-1174 . Jo . Bot . 73 (Supp . 1 ) : S876 - S884 ( 1995 ) . Moralejo et al ., “ Overexpression and Lack of Degradation of Idiris , et al. Enhanced protein secretion from multiprotease- deficient Thaumatin in an Aspergillopepsin A - Defective Mutant of Aspergil fission yeast by modification of its vacuolar protein sorting pathway . lus Awamori Containing an Insertion in the pepA gene ”, Applied Appl . Microbiol . Biotechnol. 85 : 667-677 (2010 ) . Microbiology and Biotechnology , vol. 54 , Issue 6 , Dec. 2000 , pp . Krysan , et al . Yapsins are a family of aspartyl proteases required for 772-777 . cell wall integrity in Saccharomyces cerevisiae. Eukaryotic Cell . Moralejo et al ., “ Silencing of the Aspergillopepsin B ( pepB ) Gene 4 ( 8 ) : 1364-1374 ( 2005 ) . of Aspergillus Awamori by Antisense RNA Expression or Protease Kuroda , et al. Antibody expression in protease -deficient strains of Removal by Gene Disruption Results in a Large Increase in Thaumatin the methlotrophic yeast ogataea minuta . FEMS Yeast Res. 7 : Production ” , Applied and Environmental Microbiology, vol. 68 , No. 1307-1316 (2007 ) . 7 , Jul. 2002 , pp . 3550-3559 . Martinez, et al . Genome sequencing and analysis of the biomass Morya et al. , “ In Silico Characterization of Alkaline Proteases from degrading fungus Trichoderma reesei ( syn . Hypocrea jecorina ). Different Species of Aspergillus” , Applied Biochemistry and Bio Nature Biotech . 26 ( 5 ) : 553-560 (2008 ) . technology, vol . 166 , Issue 1, Jan. 2012, pp . 243-257 . Martinez , et al . Uniprot GORG34 , XP002712642 (Oct. 19 , 2011 ) . Mäntylä et al. , “ Industrial mutants and recombinant strains of Martinez , et al . Uniprot GORIW3, XP002712643 (Oct. 19 , 2011 ) . Trichoderma reesei” , In : Trichoderma and Gliocladium , vol . 2 , Martinez , et al. Uniprot GORHO5, XP002712644 ( Oct. 19 , 2011 ). 1998 , pp . 291-309 . Martinez , et al . Uniprot GORSP8, XP002712645 ( Oct. 19 , 2011) . Nascimento et al ., “ Statistical Coupling Analysis of Aspartic Proteinases Martinez , et al. Uniprot GORVKO , XP002712646 (Oct. 19 , 2011) . Based on Crystal Structures of the Trichoderma Reesei Enzyme and Martinez , et al . Uniprot GORSTO , XP002712647 ( Oct. 19 , 2011 ). its Complex with Pepstatin A ” , Journal of Molecular Biology, vol. Van Den Hobergh , et al. Disruption of three acid proteases in 382 , Issue 3 , Oct. 10. 2008 , pp . 763-778 . Aspergillus niger. Eur. J. Biochem . 247 : 605-613 ( 1997 ) . Nemoto et al. , “ Isolation of Aspergillus Oryzae Mutants for Heterologous Yoon , et al. Construction of quintuple protease gene disruptant for Protein Production from a Double Proteinase Gene Disruptant” heterologous protein production in aspergillus oryzae. Appl. Microbiol . Applied Microbiology and Biotechnology, vol . 82, Issue 6 , Apr. Biotechnol. 82 : 691-701 ( 2009 ) . 2009 , pp . 1105-1114 . Yoon , et al. Disruption of ten protease genes in the filamentous Oda et al ., “ Nucleotide Sequence of the Gene Encoding the Pre fungus aspergillus oryzae highly improvesproduction of heterologous cursor Protein of Pepstatin Insensitive Acid Protease B , Scytalidopepsin proteins. Appl. Microbiol . Biotechnol. (Oct. 19 , 2010 ) . B , from Scytalidium Lignicolum ” , Bioscience , Biotechnology , and Biochemistry , 62 ( 8 ), Aug. 1998 , pp . 1637-1639 . * cited by examiner U.S. Patent Aug. 4 , 2020 Sheet 1 of 46 US 10,731,168 B2
FIG . 1 F1 F2 F3 104 KD 94 KD
51 KD
36 KD
28 KD pepstatin A fractions
FIG . 2 F3+pepstatin F3 561 U.S. Patent Aug. 4 , 2020 Sheet 2 of 46 US 10,731,168 B2
FIG . 3A FIG . 3B
9-20A-2 9-25A-2 9-35A-1 9-37A-1 9-37A-2 9.38A-1 9-38A-2 M127 9-204-1 9-254-1 Q-35A2 ctri M127 9-6A 9-20A 9-25A 9-35A 9-37A 9-38A 9-191A
FIG . 3C ctrl M127 9-6A 9-20A 9-25A 9-35A 9-37A 9-38A 9-191A
Generation of single protease deletion strains M181 and M195 M181 = repurified clone 9-20A - 1 ( i.e. originating from 9-20A ) M195 = repurified clone 9-35A - 1 (i.e. originating from 9-35A ) Expected signals : A ) pep1 ORF : > 8 kb from parent M127 , no signal from transformants B ) pep15'flank : > 8 kb from parentM127 , 4 kb from transformants C ) pep1 3'flank : > 8 kb from parentM127 , 4.2 kb from transformants U.S. Patent Aug. 4 , 2020 Sheet 3 of 46 US 10,731,168 B2
FIG . 4A FIG . 4B FIG . 4C
Generation of rituximab , pep1 deletion strain M182 M182 = 11-1A M169 , parent = Rx25A 1 Expected signals : A ) pep1 ORF : > 8 kb from parent M169 , no signal from transformants B ) bar. 1.0+ 1.7 kb from transformants , 3.1 kb from PTTV41, nothing from M169 C ) bar, 1.8 +2.8 kb from transformants , 3.1 kb from PTTV41, nothing from M169 U.S. Patent Aug. 4 , 2020 Sheet 4 of 46 US 10,731,168 B2
FIG . 5 Idadi ????1 control 104 KD 94 KD
51 KD
36 KD 28 KD 19 KD
FIG , 6A FIG . 6B
206A(M455 ) 98A Rxstd 98A M169-2Rx std
104 KD 94 KD 104 KD 94 KD 51 KD 36 KD 51 KD 25 KD 36 KD 19 KD 25 KD 19 KD light chain heavy chain U.S. Patent Aug. 4 , 2020 Sheet 5 of 46 US 10,731,168 B2
FIG . 7
0.39 0.38 0.37 0.36 0.35 Proteaseactivity 0.34 0.33 0.32 0.31 M169 M169-2 98A 16A 198Ail 2014 206A
FIG . SA FIG , 8B FIG , 8C PH 5.5 pH 4.5 PH 4.5
How ded pep3 pep7 25 KD mock edad 20 KD 50 KD 15 KD 38 KD 10 KD 25 KD 20KD 15 KD MAB01 heavy chain MAB01 heavy chain native GF1 U.S. Patent Aug. 4 , 2020 Sheet 6 of 46 US 10,731,168 B2
FIG . 9
f2 f3 f4 f5
50 KD 38 KD 42 KD 25 KD NIE 25 KD
FIG . 10
50 KD !T 38 KD 25 KD + SIP SIP pH 4.0 pH 5.5 U.S. Patent Aug. 4 , 2020 Sheet 7 of 46 US 10,731,168 B2
FIG . 11
14 1 hour 12 2 hours 3 hours 10 8 IT activityprotease 6 4 2 0 control sip lippepstatin aa sbtichymostatin U.S. Patent Aug. 4 , 2020 Sheet 8 of 46 US 10,731,168 B2
FIG , 12A MAB01 heavy chain
std ? slp2 ? slp3 ? gap1 ? slpt control
FIG . 128 MAB01 light chain
std ? slp2 ? slp3 ngap1 ? slp1 control
.5
.
...... 2 . .. .. U.S. Patent Aug. 4 , 2020 Sheet 9 of 46 US 10,731,168 B2
FIG . 13
3 heaw chain light chain 2.5
2 foldimprovement 1.5 wand
0.5
0 Aslpt Asip2 Asip3 Agap1 U.S. Patent Aug. 4 , 2020 Sheet 10 of 46 US 10,731,168 B2
FIG . 14A
ng50VABO1 M244ctrla M244ctrlb PTTV145 Mw kDa Mwstd 27A 29A 31A 32A 38A 41A 42A 43A 44A 45A 46A 47A HC 250 150 100 75 50 37 25 20 15
FIG . 14B LC U.S. Patent Aug. 4 , 2020 Sheet 11 of 46 US 10,731,168 B2B
FIG . 15
pH4.0,0 minPH 4.5 ,0min PH 5.0 ,0min pH 5.5 ,0min pH 40 ,20 hpH 45 ,20 h pH 5.0 ,20 hpH 5.5 , 20 h
250 150 100 75 50 38 25 20 15
min 20 h
FIG . 16
F4Omin F420h F420h+PMSF IgG only U.S. Patent Aug. 4 , 2020 Sheet 12 of 46 US 10,731,168 B2
FIG . 17 purified fractions supernatant N
104 KD 94 KD
52 KD
36 KD
28 kD
20 KD U.S. Patent Aug. 4 , 2020 Sheet 13 of 46 US 10,731,168 B2
FIG . 18A FIG , 18B M196a M1966 16-5AA 16-5BA 16-11AA 16-11BA 16-71AA 16-71BA 16-75AA 16-75BA PTTV72 M196a M196b 16-5AA 16-5BA 16-11AA 16-11BA 16-71AA 16-71BA 16-75AA 16-75BA
FIG . 18C Generation of double protease deletion strain M219 9961W M219 = 16-5AA ZALD M196a 16-5AA 16-5BA 16-11AA 16-11BA 16-71AA 16-718A 16-75AA 16-75BA M196a , M196b = pyr4- ofM195 Expected signals : A ) tsp1 ORF : 6.4 kb from parent M196 , no signal from transformants B ) tsp1 5 ' flank : 3.9 kb from transformants , > 8 kb from M196 , 3.9 kb from PTTV72 C ) tsp1 3 ' flank : 2.8 kb from transformants , > 8 kb from M196 , 3.9 kb from PTTV72 U.S. Patent Aug. 4 , 2020 Sheet 14 of 46 US 10,731,168 B2
FIG . 19A FIG . 19B FIG . 190
ctrl
Generation of pepitsp2 deletion strain M194 ( for MAB01 transformations ) M194 = 13-172D M181 parent Expected signals : A ) tsp1 ORF : kb from parentM181 , no signal from transformants B ) bar. 1.4 + 2.5 kb from transformants , 2.9 kb from PTT142 , nothing from M181 C ) bar. 1.9 * 3.2 kb from transformants , 2.9 kb from PTT142 , nothing from M181 U.S. Patent Aug. 4 , 2020 Sheet 15 of 46 US 10,731,168 B2
FIG . 20
0.58 Normalizedtotalproteaseactivity 0.490 0.310
0.2 0.130 0.100 0.063 0.055
A2 A3 A6
FIG . 21A FIG . 21B
118 KD 97 KD 7 23
54 KD
N 12 13 U.S. Patent Aug. 4 , 2020 Sheet 16 of 46 US 10,731,168 B2
FIG . 22
5
? ***
cf3 f1 f2 f3 14
75 KD 50 KD 37 KD
25kD 20kD U.S. Patent Aug. 4 , 2020 Sheet 17 of 46 US 10,731,168 B2
FIG . 23 UUA cf3 cf4
5 KD 50 kO 3.KD 25 KD 20 KO
FIG . 24
94 KD 50 KD 37 KD 25 KD 20 KD buffer 0??? overnight U.S. Patent Aug. 4 , 2020 Sheet 18 of 46 US 10,731,168 B2
FIG . 25A Rituximab heavy chain yoou gdis Sodjsmock2 slp7 butter
50 KD 38 KD 25 KD
FIG . 25B MAB01 heavy chain mock slps Slp6 mock2 Zdjs buffer
50 KD 38 kD 25 KD U.S. Patent Aug. 4 , 2020 Sheet 19 of 46 US 10,731,168 B2
FIG . 26A FIG . 268 FIG . 26C slp1 ORF probe 5 ' probe 3 ' probe Marker M219 M228 18-5A 18-7A 18-31A 18-38A 18-53A Marker PTT1126 M219 M228 18-5A 18-7A 18-31A 18-38A 18-53A Marker PTTV126 M219 M228 18-5A 18-7A 18-31A 18-38A 18-53A
6000 0008
3500 4000 3000 3600 *** 3000 2500 2500 ----- 1500 1500 U.S. Patent Aug. 4 , 2020 Sheet 20 of 46 US 10,731,168 B2
FIG . 27
Apep1 Apept Atsp1 M124 wt Apept Atspt Asip1
100 KD sip1
50 KD
38 KD tsp1 28 kD
FIG . 28
0.4
0.25 totalproteaseactivity 0.15
0.1
3 day 5 day 7 day 3 day 5 day 3 day 5 day 7 day 5 day 7 day ????1 Apep1 Atsp1 Apept Atsp1 Aslpt IlM124 wt U.S. Patent Aug. 4 , 2020 Sheet 21 of 46 US 10,731,168 B2
FIG . 29A FIG . 298 FIG , 290 gap 1 ORF probe gap1 5 ' probe gap13' probe M2772A M2772A 2AM277 Marker 3A 5A 9A 21A 31A 37A 52A Marker PrTV117 SA 9A 21A 31A 37A 52A Marker PTTV117 3A 5A GA 9A 21A 31A 37A 52A 10000 10000
*
1500
...! + ... U.S. Patent Aug. 4 , 2020 Sheet 22 of 46 US 10,731,168 B2
FIG . 30
180 160 1.40 120 100 activityprotease 80 60 M124 40 M277 20 M307
1 2 3 4 6 total protein (mg / ml )
FIG . 31
100
80 bio491 triple deletion 60 unitsFL 40 bio 492 quadruple deletion 20
0 1 2 5 6 7 8 Day U.S. Patent Aug. 4 , 2020 Sheet 23 of 46 US 10,731,168 B2
FIG . 32A FIG . 32B FIG . 320 GAP2 5 ' flank probe 3 ' flank probe ORF probe M307 30A PTTV145 M307 30A PTTV145 M307 304 10 kb 10 kb 10 kb 8 8 8 6 6 6 5 5 or
4:32 4 4 . 3.5 3.5 3.5 3 3 3 2.5 "!! .. 2.5 2.5
2 2 2
Generation of quintuple protease deletion strain M369, clone 7-30A - M369 Expected signals : - A , gap2 ORF : 4,9 kb from parent (M307 ) , no signals from transformant - B , gap2 5'flank : 4.9 kb from parent, 2.3 kb from transformant, 2.3 kb from plasmid control PTTV145 -C , gap2 3'flank : 4.9 kb from parent, 3.8 kb from transformants , 3.8 kb from plasmid control pTTV145 U.S. Patent Aug. 4 , 2020 Sheet 24 of 46 US 10,731,168 B2
FIG . 32D FIG . 32E loopouts loopouts Mwstd Mwsta PTTV145 M307 M369 6 13 14 16 18 20 PTTV145 M307 M369 o
:11
Generation of pyr4- from the quintuple protease deletion strain M369, resulting strain M381 (clone 14 ) M307 = 4 - fold del strain , M369 = 5 - fold del strain Expected signals : - D ) gap2 5'flank : 1.5 kb from all strains , 4.1 kb from plasmid control PTTV145 - E ) gap2 3'flank : 3.6 kb from M307, 2.7 kb from M369 + loopout clones , 3.8 kb from plasmid control PTTV145 U.S. Patent Aug. 4 , 2020 Sheet 25 of 46 US 10,731,168 B2
FIG . 33 U.S. Patent Aug. 4 , 2020 Sheet 26 of 46 US 10,731,168 B2
FIG . 34A FIG . 34B 25-76A-a -a25-120A 25-120A-b M307 M369 25-10A 25-10B 25-44B 25-76A 25-76B 25-97A 25-97B 25.120A M307 M369 25-44B-a 25-44B-b 25-76A-b
T.T:! ve .. .
WA ROSSI
Generation of 6 - fold protease deletion strains M396 and M400 M396 25-120A M400 = 25-120A - a , i.e. repurified clone from M396 Expected signals : - Aa & Ab ) pep4 ORF : 6.3 kb from M307 and M369 , no signals from transformants U.S. Patent Aug. 4 , 2020 Sheet 27 of 46 US 10,731,168 B2
FIG . 34C FIG . 34D PTTV181 M307 M369 25-10A 25-10B 25-44B 25-76A 25-76B 25-97A 25-97B 25-120A PTTV181 M307 M369 25-10A 25-10B 25-446 25-76A 25.76B 25-97A 25-978 25-120A
Generation of 6 - fold protease deletion strains M396 and M400 M396 25-120A Expected signals : - B ) pep4 5 ' flank : 6.3 kb from M307 and M369 , 4.8 kb from transformants , 4.0 kb from prTv181 - C ) pep4 3 ' flank : 6.3 kb from M307 and M369 , 2.1 kb from transformants , 4.0 kb from PTTV181 U.S. Patent Aug. 4 , 2020 Sheet 28 of 46 US 10,731,168 B2
FIG . 34E
25-44B-a 25.44B-b 25-76A-a 25-76A-D 25-120A-a 25-120A-b 25-44B-16 1725-44B- 25-44B-19 25-76A-31 25-76A-33 25-76A-35 25-120A-61 25-120A-62 25-120A-64 25-120A-65 M307 M369 25-448-20 25-76A-32
Generation of pyr4- from 6 - fold protease deletion strains M396 M396 ~ 25-120A ( > repurified clone 25-120A -a = M400 ) Expected signals : - D ) pep4 3 ' flank: 6.3 kb from M307 and M369, 2.1 kb from repurified transformants , 4.9 kb from the loopout clones U.S. Patent Aug. 4 , 2020 Sheet 29 of 46 US 10,731,168 B2
FIG . 35
untreated chymostatin SBTI SBTV/ chymostatin 118 KD 97 KD
54 KD 37 KD 29 KD 17 KD 19h 19h 19h 19h
FIG . 36A FIG . 36B Heavy chain Light chain
104 KD 94 KD 51 KD 36 KD 28 KD
control 100 ug/ ml 500 ug/ ml control 100 ug/ ml 500 ug /ml U.S. Patent Aug. 4 , 2020 Sheet 30 of 46 US 10,731,168 B2
FIG . 37A FIG . 37B Light chain D Heavy chain
51 KD 36 KD 28 KD 19 KD
control chymostatin pepstatin A control chymostatin pepstatin A
FIG . 38
Affinity chromatography Gel filtration analysis of 3 ml 1/10 diluted M304 total affinity purified day 6 culture MABO1: 70 % of full - sizo supernatant: 1160 mg/ l antibody elutng in 12.0 iptalMA801 ml ; 800 mg /l . ?
A xmuringan 10.6 ; U.S. Patent Aug. 4 , 2020 Sheet 31 of 46 US 10,731,168 B2
FIG , 39A Apep1 M124 bio376b HC 206 KD
118 KD 97 KD
54 KD 37 KO 29 KD MAB01 MAB02 rituximab MAB01 MABO2 rituximab MAB01 MABO2 rituximab
FIG . 39B
Apep1 M124 bio376b
206 KD LC 718 KD 97 KD
54 KO 37 KD 29 KD MAB01 MABO2 rituximab MAB01 2 mg/ ml large shake flask supernatant (Apep1 and M124 ); 2 mg/ ml fed batch fermentation supernatant; 18 hour incubation at 37 ° C at pH 5.5 U.S. Patent Aug. 4 , 2020 Sheet 32 of 46 US 10,731,168 B2
FIG . 40
Atsp1 improves the rituximab heavy chain production levels on day 5 .
parentlanestrains2 and .3. 1 4 5 6 7 8
***
Lanes : 1) 50 ng Rx control, 2 & 3 ) parental strain Rx 25A Atsp1 4 ) 12-2A , 5 ) 12-16A , 6 ) 12-19A , 7 ) 12-20A , 8 ) 12-34A
transformants in lane 4 and 5 , clearly show more heavy chain than in lane 2 and 3 . U.S. Patent Aug. 4 , 2020 Sheet 33 of 46 US 10,731,168 B2
MAB01 heavy chain degradation is reduced in triple deletion strain supernatant M277
FIG . 41A bufferOIN M277 0min
Daysupernatants 5 FIG . 418 buller0minbuffer OIN M2770 minLIZEN 141LIZON NO M1240 minM1241 hr TZWN NO
Day 7 supernatants 4 - fold more heavy chain on day any Supernatants diluted to 6 mg/ ml , spiked with MAB01 0.05 mg/ ml , and incubated at 370C . M277 is Apep1 Atspi Aslp1; M124 is full protease containing control strain . U.S. Patent Aug. 4 , 2020 Sheet 34 of 46 US 10,731,168 B2
FIG . 42A FIG , 42B
buffer Jaung bufier 37 KD 250 ht 20 KD IFNO2b wili15 KD
20 hours 20 hours
FIG , 420
Super+pepsiatin super +ASBTI super+pepstatin A buifer. supernatant buifer Supernatant super+SBT ?? ?? ??? ?? ?? ?? 38 KB 15 KO
tire 20 hours U.S. Patent Aug. 4 , 2020 Sheeteet 35 of 46 US 10,731,168 B2B
FIG . 43 bufferPH 4.0 Supernatant super+pepstatin SuperA +SBT 250 KDK 150 KD 100 KD 75 KD
37 KD SZ 20 KD
FIG . 44
BSA0.25%SP 50 M/ SBT102 moim pepslalinabeatis !SBT10.2 mg/ m pepslaloSIPAbeads 50 pepstatin UMSETI0.2 anymostatin A5 UMmglen 25 SBTI AM 0,2 mgimuBSA pepslatin02526cilymostatin A20 MM BSA0.255WM SP 50KN controlSBT102 ingmi BSA0.25 %control SBT10.05 mgimi LIP50 AM BBI0.1mumi controlHGH 23 ng 250 km SO KD 100 %
QUOS 37 KD
20 KD
human growth hormone U.S. Patent Aug. 4 , 2020 Sheet 36 of 46 US 10,731,168 B2
FIG . 45 pep11Treesel121306 pep1Treesei74156SEQ1pepMthermophila367036210 |refXP_003667387.1 pepNcrassa85110723SEQ15 ]ref XP_963600.1 pepMthermophila367030924 | ref XP 003664745.1 pep2Treesei53961SEQ182pepNcrassa85111370 |ref ] XP_963904.1 pep?oryzae94730408SEQ7 |sp |Q06902.2 peppchrysogenum255953325 {refXP 002567415.1 pepAniger350639535| gb |EHA27889.1 pepAnidulans67541436 |ref XP 664492.1 pep5Treesei81004SEQ58 pepMthermophila367019798pep3Treesel121133SEQ17 |ref ]XP_003659184.1 pepNcrassa85102020SEQ34 |ref { XP_961260.1 pepMthermophila367025909 /ref ]XP 003662239.1 peppchrysogenum255947264pepAniger317025164SEQ22 ]ref { XP 002564399.1 pep?oryzae3918701231gb |EIT79311.1 pep4Treese177579SEQ37 pepMthermophila367031892 /ref / XP 003665229.1 pepNcrassa85094599SEQ57 | ref{ XP 959917,1 pepAniger145232965SEQ41] ref{ XP 001399855,1 pep?oryzae169770745| ref ]XP_001819842.1 pepAnidulans67524891| refXP 660507,1 pep7Treesei58669SEQ186pepPchrysogenum255936729 | ref {XP 002559391.1 pepMthermophila347009870g 367026634SEQ195AE057356,1 pepNcrassa85090078SEQ196| ref XP 958247.1 pepNcrassa85096825 refXP 960328.1 pepAnidulans67522232 ]ref XP_6591771 pepAniger350630464 |gb | EHA18836.1 pep?oryzae317138074 | ref{ XP 001816654.21 peppchrysogenum255931549] ref { XP_002557331.1 pep?oryzae 169776867 ref] XP 001822899.1 pepAniger350636027 |gb | EHA24387.1 pepAnidulans67540634 /ref / XP 664091.1 pep8Treesei 122076 pepMthermophila367019224 ref| XP 003658897.1 pepNcrassa85117939| ref { XP_965343.1 pep 12Treesei119876 pepNcrassa85113736 ref |XP 964574.1 pepMthermophila367021386| ref ] XP 003659978.1 U.S. Patent Aug. 4 , 2020 Sheet 37 of 46 US 10,731,168 B2
FIG . 46
sip2Treesei123244prksf3SEQ98 sipMthermophila367021472| ref ] XP 003660021.1 sipAniger145237646{ ref XP_001391470.1 sipAoryzae 169780712] ref } XP_001824820.1 sipPchrysogenum255955889 |ref } XP_002568697.1 sipAnidulans259489544/ tpe | CBF89903.1 slpNcrassa85084841 slpMthermophila367026259| refXP_003662414.1 slp3Treesei 123234prtBCISEQIDNO166 slpfchrysogenum62816282/ emb | CA /38757.2 slpAnidulans67538776 |ref ] XP_663162.1 sipAoryzae 169771349 |ref |XP_001820144.1 slpAniger470729 |gb |AAA32703.1 sip6Treesei 121495prtF sipNcrassa85090020 ]refixP_958219.1 sip5Treesei64719_prkprtjsf4SEQ200 sipNcrassa85094084SEQ209 {ref |XP 959818.1 sipMthermophila367032200 |ref |XP_003665383.1 sip8Treesei58698prtASEQ240 pyrorth Treesei57433 pyrprtM Treesei35726 slp1Treesei51365_PyrprtKSEQ82 slpMthermophila367029081| ref | XP_003663824.1 sipNcrassa85086707SEQ95 ]ref ] XP_957734.1 pyrother_Treesei 109276 pyrprtG_Treesei60791 U.S. Patent Aug. 4 , 2020 Sheet 38 of 46 US 10,731,168 B2
FIG . 47
gap2Mthermophila367030275 refpXP_003664421.1 gap1Treesei69555SEQ118 gapMthermophila367026504 ref {XP 003662536.1 gapPchrysogenum 255940586SEQ128 {ref { XP 002561062.1 gapAniger145251555 gapAnidulans67901056 gapAniger131056 |sp |P24665.1 gapPchrysogenum 255930123 |ref ] XP_002556621.1 gapAoryzae317150886 |ref { XP_001823778.2 gapAniger 145236956] ref ]XP_001391125,1 gapAoryzae 169772955| ref | XP 001820946.1 gapAniger145249222 |reffXP_001400950.1 gapPchrysogenum255955319?ref ]XP 002568412.1 gapAoryzae 169785367| refXP 001827144.1 gapAoryzae3918639741gb?EIT73273,1 gap2Treesei 106661SEQ129 gapAnidulans67525839 ref | XP 660981.1 gapNcrassa85097968 |refXP 960546.1 gapMthermophila367019352| reffXP 003658961.1 gapMthermophila367024513 ]reffXP 003661541.1 U.S. Patent Aug. 4 , 2020 Sheet 39 of 46 US 10,731,168 B2
FIG . 48
sed?Anidulans67525125 { ref} XP 660624,1 sip7Treesei123865SEQ231 sedMthermophila36702493591347009020SEQ236XP_003661752.7 sedAnidulans67541991/ ref ] XP_664763,1 sedPchrysogenum255933786 |reflXP_002558272.1 sedAoryzae169782882 |ref { XP_001825903.1 sedBAfumigatus42820807 }emb?CAE17674.1 sedBAniger145249068 |reffXP 001400873.1 sedNcrassa85109979 |ref ] xp_963178.1 sedAniger317036543{ refpXP_001397538.2 sed?Afumigatus42820811lemb} CAE46473.1 sedcAoryzae 238484583{ ref ] XP_002373530.1 sedCPchrysogenum255944351| ref }XP_002562943.1 top1TreeseiSEQ145 sedDAaryzae 169776800SEQ149 ]ref { XP 001822866.1 sedDAniger 145236399SEQ150] ref XP_001390847.1 sedDAfumigatus42820809 [ emb |CAE17675,1 sedANcrassa85090428 ]ref } XP 958412.1 sedAAfumigatus46309081lemb?CAE51075.1 sedAAoryzae 169772733 |ref |XP_001820835.1 sedAAniger45243152 [ref {XP 001394118.1 sedAPchrysogenum255946523 {ref ]XP_002564029.1 sedAAnidulans67542075( refpXP 664805.1 sedAPchrysogenum255950094 [ref }XP 002565814.1 aorsinAoryzae21321299 /dbj BAB97387.1 sedAMthermophila367028811 ref} XP_003663689.1 sedEAfumigatus 1295566191gb {EAL86850.2 sedENcrassa85105406 ref| XP_961957,1 U.S. Patent Aug. 4 , 2020 Sheet 40 of 46 US 10,731,168 B2
FIG . 49A
pre
PTTV67 ILCO PTTV99
FIG . 49B TITI LC xxx cohifbazt CBHI
CBHI Pmel PTTV223 Amds
3 flank
Pmel U.S. Patent Aug. 4 , 2020 Sheet 41 of 46 US 10,731,168 B2
FIG . 50A MWstd Mwstd kDa 4 5 6 7 8 9 10 11 4 5 6 7 8 250
75 50 37 25 20
FIG . SOB 4 5 6 7 8 9
150 KD
75 KD
25 KD 20 km U.S. Patent Aug. 4 , 2020 Sheet 42 of 46 US 10,731,168 B2
FIG . 51 Bio00477bday8 Mwstd M304 stdMw Mw KDa 5 6 8
75 50
25 20 250 150 100 75 50 37 25 20 15 U.S. Patent Aug. 4 , 2020 Sheet 43 of 46 US 10,731,168 B2
FIG . 52
3.000
gpdA promoter
pyr marker Vad
PTTV204 vector oooo 11,192 bp 04
5 U.S. Patent Aug. 4 ,2020 Sheet 44 of 46 US 10,731.168 B2
FIG.53
?? 22 ??
?
Targets Targets sp2 , sip3, Targets large slp2 only $ 25, SpS strain sequence of slo2 U.S. Patent Aug. 4 , 2020 Sheet 45 of 46 US 10,731,168 B2
FIG . 54A
M401
Day3sup4ul Day 3 sup2ul Day 3 sup1ul 150 KD 100 KD IFN-a2B50 ngIFN -a 2B 100 ng IFN -a2B 200 ngIFN -a2B 400 ng 75 KD 47.8 50 KD mga 37 KD 25 KD 20 KD 15 KD 10 kD 51.9 mg/
FIG . 54B
M577 M652
150 KD
100 KD 75 KO FN-4h 100ng 50 KD
37 KD
25 KD 20 KD 15 ko 10 KD U.S. Patent Aug. 4 , 2020 Sheet 46 of 46 US 10,731,168 B2
FIG . 55
M577 M652
Day4sup0,1 ul Day4sup0,05 ul Day3sup0,1 g Day3sup0,05 ul 150 KD
100 KD 75 KD
IFN-a2B50 ng IFN-a2B100 ng IFN-a2B200 ng 50 KD
37 KD
25 KD 20 KD 15 KD 10 KDE US 10,731,168 B2 1 2 PROTEASE DEFICIENT FILAMENTOUS reduced or no detectable activity of at least three proteases , FUNGAL CELLS AND METHODS OF USE and having a recombinant polynucleotide encoding a heter THEREOF ologous polypeptide that is produced at increased levels . Further described herein are methods of improving heter CROSS -REFERENCE TO RELATED 5 ologous polypeptide stability and methods of making het APPLICATIONS erologous polypeptides in which the proteases do not have This application is a continuation application of U.S. Ser . the reduced activity . No. 15 / 375,635 filed on Dec. 12 , 2016 , now U.S. Pat. No. Thus one aspect includes filamentous fungal cells having 10,240,159, which is a continuation application of U.S. Ser. reduced or no detectable activity of at least three proteases, No. 14/ 370,255 filed Jul. 2 , 2014 , now U.S. Pat . No. 10 encodingwhere the acell heterologous further contains polypeptide a recombinant produced polynucleotide at a level of 9,567,596 , which was filed under 35 U.S.C. $ 371 and at least 2 - fold higher than the production level of the claims priority to International Application No. PCT/ polypeptide in a corresponding parental filamentous fungal EP2013 /050126 filed Jan. 4 , 2013 which claims the benefit cell in which the proteases do not have the reduced activity . of2012 U.S. , which Provisional are hereby Application incorporated No. 61 by /583,559 reference filed in Jan. their 5 , 15 In certain embodiments ,when the cell is an Aspergillus cell, the total protease activity is reduced to 50 % or less of the entirety into this application . total protease activity of the corresponding parental Asper FIELD OF THE INVENTION gillus cell in which the protease do nothave reduced activity . In other embodiments , the total protease activity of the The present disclosure relates to compositions and meth- 20 filamentous fungal cell is reduced to 49 % or less , 31 % or ods useful for the production of heterologous proteins in less , of the total protease activity of the corresponding filamentous fungal cells . parental filamentous fungal cell in which the proteases do not have the reduced activity . BACKGROUND In certain embodiments , the expression level of the at 25 least three proteases is reduced or eliminated . In certain Posttranslational modification of eukaryotic proteins , par embodiments , genes encoding the three proteases each com ticularly therapeutic proteins such as immunoglobulins, is prise a mutation that reduces or eliminates the corresponding often necessary for proper protein folding and function . protease activity . In certain embodiments thatmay be com Because standard prokaryotic expression systems lack the bined with the preceding embodiments , the three protease propertive expression machinery systems necessary have for to such be modificationsused in production, alterna of 30 encoding genes are pep1, tsp1, and slpí. In other embodi these therapeutic proteins . Even where eukaryotic proteins ments , the three protease encoding genes are gap1 , slpl , and do not have posttranslational modifications, prokaryotic pep1 . expression systems often lack necessary chaperone proteins In certain embodi nts , the fungal cells have reduced or required for proper folding . Yeast and fungi are attractive no detectable activity of four endogenous proteases ; genes options for expressing proteins as they can be easily grown 35 encoding the four proteases each comprise a mutation that at a large scale in simple media , which allows low produc reduces or eliminates the corresponding protease activity . In tion costs , and yeast and fungi have posttranslational certain embodiments that may be combined with the pre machinery and chaperones that perform similar functions as ceding embodiments , the four protease encoding genes are found in mammalian cells . Moreover, tools are available to pep1 , tsp1, slpl , and gapl . manipulate the relatively simple genetic makeup of yeast 40 In certain embodiments that may be combined with the and fungal cells as well as more complex eukaryotic cells preceding embodiments , the three or four protease encoding such as mammalian or insect cells ( De Pourcq et al. , Appl genes are selected from pep1, pep2 , pep3 , pep4 , pep5 , pep8 , Microbiol Biotechnol, 87 ( 5 ) : 1617-31 ) . Despite these pep11, pep12, tsp1, slp1 , slp2, slp3 , slp7, gapl, and gap2 . In advantages , many therapeutic proteins are still being pro certain embodiments that may be combined with the pre ducedteins with in mammalian posttranslational cells , whichmodifications produce most therapeutic resembling pro- 45 ceding embodiments , the three or four protease encoding the native human proteins , whereas the posttranslational genes are selected from pep1, pep3 , pep4 , tsp1, slp1, slp2 , modifications naturally produced by yeast and fungi often gapl , and gap2 . In certain embodiments , the three or four differ from that found in mammalian cells . protease encoding genes are selected from pep1, pep2, pep3 , To address this deficiency, new strains of yeast and fungi pep4 , pep5 , gapl, gap2 , slpl , slp2 , and tspl . are being developed that produce posttranslational modifi 50 In other embodiments , the fungal cells have reduced or no cations that more closely resemble those found in native detectable activity of five endogenous proteases; genes human proteins . Thus, there has been renewed interest in encoding the five proteases each comprise a mutation that using yeast and fungal cells to express more complex reduces or eliminates the corresponding protease activity . In proteins. However , due to the industry's focus on mamma certain embodiments that may be combined with the pre lian cell culture technology for such a long time, the fungal 55 ceding embodiments , the five protease encoding genes are cell expression systems such as Trichoderma are not as well pep1, tsp1, slp1, gapl , and pep4 . In other embodiments , the established as mammalian cell culture and therefore suffer five protease encoding genes are pep1, tsp1, slp1 , gap1, and from drawbacks when expressing mammalian proteins. gap2 Thus, a need remains in the art for improved filamentous In certain embodiments , the fungal cells have reduced or fungal cells , such as Trichoderma fungus cells , that can 60 no detectable activity of six endogenous proteases ; genes stably produce heterologous proteins , such as immuno encoding the six proteases each comprise a mutation that globulins , preferably at high levels of expression . reduces or eliminates the corresponding protease activity . In certain embodiments , the cell has six protease encoding SUMMARY genes, each of which comprise a mutation that reduces or 65 eliminates the corresponding protease activity , and the six Described herein are compositions including filamentous protease encoding genes are pep1, tspl , slp1, gap1, gap2, fungal cells , such as Trichoderma fungal cells having and pep4 . US 10,731,168 B2 3 4 In certain embodiments that may be combined with the embodiments , the fungal cell has a point mutation in the preceding embodiments , the fungal cells have three to six portion of the gene encoding the catalytic domain of the proteases having reduced or no detectable activity each of protease . the three to six proteases selected from pep1 , pep2 , pep3 , In other embodiments , the reduction or elimination of pep4 , pep5 , tspl , slpl , slp2 , slp3 , gap1, and gap2 . 5 protease activity of one or more proteases results from RNAi In certain embodiments that may be combined with the constructs specific for i ) one protease or ii ) two or more preceding embodiments , the cell has seven protease encod proteases selected from the group consisting of a pep -type , ing genes, each of which comprise a mutation that reduces protease , a trypsin -like serine protease , a gap -type protease, a sedolisin protease and a sip - type , protease . In certain orseven eliminates protease the encoding corresponding genes areprotease pep1, tsp1activity, sip1 , and , gap1 the, 10 embodiments , RNAi constructs are specific for slp2 , slp3, gap2 , pep4 , and pep 3 . slp5 and / or slp6 . In certain embodiments that may be combined with the In certain embodiments that may be combined with the preceding embodiments , the cell has eight protease encoding preceding embodiments , the fungal cell further contains an genes , each of which comprise a mutation that reduces or 15 N -acetylglucosaminyltransferase III catalyticcatalytic domain .and In ceran eliminates the corresponding protease activity , and the eight tain embodiments , the N - acetylglucosaminyltransferase I protease encoding genes are pep1, tsp1, slpl , gapl, gap2 , catalytic domain and the N -acetylglucosaminyltransferase II pep4 , pep3 , and pep5 . catalytic domain are encoded by a polynucleotide . In certain In certain embodiments that may be combined with the embodiments , the N -acetylglucosaminyltransferase I cata proteasepreceding having embodiments reduced , theactivity fungal , the cell gene has encodingan additional the 20 Nlytic -acetylglucosaminyltransferase domain is encoded by a first II polynucleotidecatalytic domain and theis additional protease comprises a mutation that reduces or encoded by a second polynucleotide . In certain embodi eliminates the corresponding protease activity, and the addi ments that may be combined with the preceding embodi tional protease is selected from pep7 , pep8, pep11, pep12 , ments , the fungal cell further contains a polynucleotide tppl, gap2 , slp3 , slp5 , slpó , slp7 , and slp8 . 25 encoding a mannosidase II and /or a galactosyl transferase . In In certain embodiments that may be combined with the certain embodiments , the fungal cell contains enzymes preceding embodiments , the heterologous polypeptide is a selected from the group consisting of ocl, 2 mannosidase , mammalian polypeptide. In certain embodiments , themam N - acetylglucosaminyltransferase I, N -acetylglucosaminyl malian polypeptide is glycosylated . transferase II, mannosidase II and /or galactosyltransferase, In certain embodiments, the mammalian polypeptide is 30 said enzymes further comprising a targeting peptide, for selected from an immunoglobulin , an antibody and their example a heterologous targeting peptide for proper local antigen -binding fragments , a growth factor, an interferon , a ization of the corresponding enzyme. In certain embodi cytokine, and an interleukin . In certain embodir ats, the ments , the targeting peptide is selected from SEQ ID NOs: mammalian polypeptide is an immunoglobulin or an anti 589-594 . body. In certain embodiments , the mammalian polypeptide 35 In certain embodiments that may be combined with the is selected from insulin - like growth factor 1 ( IGF1) , human preceding embodiments, the fungal cell is a Trichoderma growth hormone (hGH ) , and interferon alpha 2b ( IFNa2b ) . fungal cell, a Myceliophthora fungal cell, an Aspergillus In certain embodiments that may be combined with the fungal cell , a Neurospora fungal cell, a Fusarium or Peni preceding embodiments , the heterologous polypeptide is a cilium fungal cell , or a Chrysosporium fungal cell . In certain non -mammalian polypeptide. In certain embodiments , the 40 embodiments that may be combined with the preceding non -mammalian polypeptide is an aminopeptidase , amylase , embodiments , the fungal cell is Trichoderma reesei. carbohydrase, carboxypeptidase, catalase , cellulase, chiti In certain embodiments that may be combined with the nase , cutinase , deoxyribonuclease , esterase , alpha - galacto preceding embodiments , the fungal cell is wild type for pep4 sidase , beta - galactosidase, glucoamylase , alpha -glucosi protease . dase , beta -glucosidase , invertase, laccase , lipase , mutanase , 45 Another aspect includes methods of improving heterolo oxidase , pectinolytic enzyme, peroxidase, phospholipase , gous polypeptide stability , by : a ) providing the filamentous phytase, polyphenoloxidase , proteolytic enzyme, ribonu fungal cell of any of the preceding embodiments ; and b ) clease , transglutaminase or xylanase . culturing the cell such that the heterologous polypeptide is In certain embodiments that may be combined with the expressed , where the heterologous polypeptide has preceding embodiments , the fungal cell further contains 50 increased stability compared to the heterologous polypep reduced or no detectable activity of ALG3, a mannosyltrans tide produced in a corresponding parental filamentous fungal ferase enzyme. In certain embodiments , the gene encoding cell in which the proteases do not have reduced activity , for ALG3 contains a mutation that reduces or eliminates the example , as not containing the mutations of the genes corresponding activity . In certain embodiments that may be encoding the proteases . Another aspect includes methods of combined with the preceding embodiments, the fungal cell 55 making a heterologous polypeptide , by: a ) providing the further contains a polynucleotide encoding an a - 1,2 -man filamentous fungal cell of any of the preceding embodi nosidase . ments ; b ) culturing the host cell such that the heterologous In certain embodiments that may be combined with the polypeptide is expressed ; and c) purifying the heterologous preceding embodiments , the fungal cell has a mutation that polypeptide. In certain embodiments that may be combined reduces the expression of a protease desired to have reduced 60 with the preceding embodiments , the filamentous fungal cell activity . In certain embodiments that may be combined with further contains a carrier protein . In certain embodiments , the preceding embodiments , the mutation is a deletion the carrier protein is CBH1 . In certain embodiments that within the gene encoding the protease. In certain embodi may be combined with the preceding embodiments , the ments that may be combined with the preceding embodi culturing is in a medium comprising a protease inhibitor. In ments , the mutation is a deletion of the portion of the gene 65 certain embodiments , the culturing is in a medium having encoding the catalytic domain of the protease . In certain one or two protease inhibitors selected from SBT1 and embodiments that may be combined with the preceding chymostatin . In certain embodiments , the heterologous US 10,731,168 B2 5 6 polypeptide produced according to the method is a glyco such mutation are pep1, tsp1, slp1 , gap1, and gap2. In sylated mammalian polypeptide and at least 10 % , at least certain embodiments , the Trichoderma fungal cell has six 20 % , at least 30 % , at least 40 % , at least 50 % , at least 60 % , protease encoding genes , each of which comprise a mutation at least 70 % , at least 80 % , at least 90 % , or 100 % (mole % ) that reduces or eliminates the corresponding protease activ of the total N -glycans of the polypeptide consists of 5 ity , and the six protease encoding genes with such mutation Man ,GlcNAc2 N - glycan . In other embodiments , the heter are pep1, tspl, slpl, gapl, gap2 , and pep4 . In certain ologous polypeptide produced according to the method is a embodiments that may be combined with the preceding glycosylated mammalian polypeptide and at least 10 % , at embodiments , the Trichoderma fungal cell has seven pro least 20 % , at least 30 % , at least 40 % , at least 50 % , at least tease encoding genes, each of which comprise a mutation 60 % , at least 70 % , at least 80 % , at least 90 % , or 100 % (mole 10 that reduces or eliminates the corresponding protease activ % ) of the total N - glycans of the polypeptide consists of ity , and the seven protease encoding genes are pep1 , tsp1 , complex N - glycan . In certain embodiments , the heterolo slp1, gap1, gap2 , pep4 , and pep3 . In certain embodiments gous polypeptide produced according to the method is a that may be combined with the preceding embodiments, the glycosylated mammalian polypeptide and at least 10 % , at Trichoderma fungal cell has eight protease encoding genes, least 20 % , at least 30 % , at least 40 % , at least 50 % , at least 15 each of which comprise a mutation that reduces the corre 60 % , at least 70 % , at least 80 % , at least 90 % , or 100 % (mole sponding protease activity , and the eight protease encoding % ) of the total N -glycans of the polypeptide consists of genes with such mutation are pep1 , tsp1, slp1, gap1, gap2 , hybrid N - glycan . In certain embodiments , the heterologous pep4 , pep3 , and pep5 . polypeptide produced according to the method is a glyco In certain embodiments that may be combined with the sylated mammalian polypeptide and at least 10 % , at least 20 preceding embodiments , the Trichoderma fungal cell further 20 % , at least 30 % , at least 40 % , at least 50 % , at least 60 % , contains reduced or no detectable activity of one or more at least 70 % , at least 80 % , at least 90 % , or 100 % (mole % ) additional proteases. In certain embodiments , the expression of the total N - glycans of the polypeptide consists of G1 or level of the one or more additional proteases in the G2 N - glycan . Another aspect includes the heterologous Trichoderma fungal cell is reduced or eliminated . In certain polypeptides obtainable by the methods as described above . 25 embodiments , genes encoding the one or more additional Another aspect includes Trichoderma fungal cells having protease in the Trichoderma fungal cell each have a muta reduced or no detectable activity of at least three proteases tion that reduces or eliminates the corresponding protease selected from pep1, pep2, pep3 , pep4, pep5 , tsp1, slp1, slp2 , activity . In certain embodiments that may be combined with gapl, and gap2 , where the cell further contains a recombi the preceding embodiments , the one or more additional nant polynucleotide encoding a mammalian polypeptide 30 protease encoding genes are selected from pep7 , pep8 , produced at a level of at least 2 - fold higher than the pep11 , pep12 , tppl, gap2 , slp3, slp5 , slp6 , slp7 , and slp8 . production level of the polypeptide in a corresponding In certain embodiments that may be combined with the parental Trichoderma fungal cell . preceding embodiments , the Trichoderma fungal cell further In certain embodiments , the expression level of the at contains reduced or no detectable activity of ALG3. In least three proteases is reduced or eliminated in the 35 certain embodiments , the gene encoding ALG3 in the Trichoderma fungal cell. In certain embodiments , genes Trichoderma fungal cell contains a mutation that reduces or encoding the at least three proteases each comprise a muta eliminates the corresponding activity . In certain embodi tion that reduces or eliminates the corresponding protease ments that may be combined with the preceding embodi activity in the Trichoderma fungal cell . In certain embodi ments , the Trichoderma fungal cell further contains a poly ments , the Trichoderma fungal cell includes three protease 40 nucleotide encoding an a - 1,2 -mannosidase . In certain encoding genes with a mutation that reduces or eliminates embodiments that may be combined with the preceding protease activity , which are selected from gapl, slp1, and embodiments , the mutation reduces or eliminates the expres pep1. In certain embodiments that may be combined with sion of the gene in the Trichoderma fungal cell. In certain the preceding embodiments , the mammalian polypeptide in embodiments that may be combined with the preceding the Trichoderma fungal cell is an antibody, or their antigen- 45 embodiments , the mutation is a deletion of the gene in the binding fragments , or an immunoglobulin , and the at least Trichoderma fungal cell. In certain embodiments that may three proteases are selected from pep1, pep3 , pep4 , tsp1, be combined with the preceding embodiments , the mutation slp1, slp2 , gapl, and gap2 . In certain embodiments , the is a deletion of the portion of the gene encoding the catalytic Trichoderma fungal cell contains four protease encoding domain of the protease in the Trichoderma fungal cell. In genes , each of which comprise a mutation that reduces or 50 certain embodiments that may be combined with the pre eliminates the corresponding protease activity , and the four ceding embodiments , the mutation is a point mutation in the protease encoding genes with such mutation are pep1, tsp1, portion of the gene encoding the catalytic domain of the slp1, and gapl. In certain embodiments , the Trichoderma protease in the Trichoderma fungal cell . In certain embodi fungal cell has five protease encoding genes , each of which ments that may be combined with the preceding embodi comprise a mutation that reduces or eliminates the corre- 55 ments , the Trichoderma fungal cell further contains a sponding protease activity, and the five protease encoding N -acetylglucosaminyltransferase I catalytic domain and an genes with such mutation are pepl , tsp1, slp1, gapl , and N -acetylglucosaminyltransferase II catalytic domain . In cer pep4 . In certain embodiments that may be combined with tain embodiments , the N -acetylglucosaminyltransferase I the preceding embodiments , the mammalian polypeptide in catalytic domain and the N - acetylglucosaminyltransferase II the Trichoderma fungal cell is a growth factor , interferon , 60 catalytic domain are encoded by a polynucleotide of the cytokine, or interleukin , and the three proteases with Trichoderma fungal cell . In certain embodiments , the reduced activity are selected from pep1, pep2 , pep3, pep4 , N -acetylglucosaminyltransferase I catalytic domain is pep5 , pep8 , pep11, pep12 , gapl , gap2 , slpl , slp2 , sip7 , and encoded by a first polynucleotide and the N -acetylglu tspl. In certain embodiments , the Trichoderma fungal cell cosaminyltransferase II catalytic domain is encoded by a has five protease encoding genes , each ofwhich comprise a 65 second polynucleotide of the Trichoderma fungal cell. In mutation that reduces or eliminates the corresponding pro certain embodiments that may be combined with the pre tease activity , and the five protease encoding genes with ceding embodiments , the Trichoderma fungal cell further US 10,731,168 B2 7 8 contains a polynucleotide encoding a mannosidase II . In FIGS. 6A - B depict an immunoblot illustrating that delet certain embodiments , the proteases each have at least 70 % , ing pep2 protease from the rituximab production strain MI at least 75 % , at least 80 % , at least 85 % , at least 90 % , at least 69 improved the (FIG . 6A ) light and (FIG . 6B ) heavy chain or95 % 100, at % least sequence 96 % , at identityleast 97 %to , atan least amino 98 % acid, at leastsequence 99 % , 5 productionrepresenting in the transformant light chain fragment206A ( strain at 18 M455 kD and ) . Thethe bandsheavy chain fragment at 38 kD were more intense in strain M455 selected from SEQ ID NOs: 1 , 17, 37 , 58 , 66 , 82 , 98 , 118 , compared to the parent strain M169 . 129 , 166 , and 182. In certain embodiments , the total pro FIG . 7 graphically depicts the protease activity of super tease activity in the Trichoderma fungal cell is reduced to natant from the rituximab production strain M169 and the 49 % or less , 31 % or less of the total protease activity of the 10 pep2 protease deletion transformants 98A , 116A , 198A , 201 corresponding Trichoderma parental cell in which the pro A , and 206A (M455 ). Transformants 116A , 198A , and 206A teases do not have the reduced activity . In certain embodi show reduced protease activity against casein compared to ments that may be combined with the preceding embodi their parent strain Ml 69 . ments , the cell further contains a recombinant polynucleotide encoding a mammalian polypeptide pro- 15 proteaseFIGS . activity 8A - C depict of PEP3 an immunoblotand PEP7 on showing MAB01 the heavy effects chain of duced at a level of at least 2 - fold higher than the production and native IGF - 1 . FIG . 8A depicts the effects of protease level of the polypeptide in a corresponding parental activity on MAB01 at pH 5.5 . FIG . 8B depicts the effects of Trichoderma fungal cell. In certain embodiments that may protease activity on MAB01 at pH 4.5 . FIG . 8C depicts the be combined with the preceding embodiments, the mamma effects of protease activity on native IGF - 1 at pH 4.5 . lian polypeptide is produced in a full length version at a level 20 FIG . 9 depicts a PAGE gel showing protease containing higher than the production level of the full- length version of fractions purified from SIP peptide affinity column . the polypeptide in a corresponding parental Trichoderma FIG . 10 depicts an immunoblot showing SIP protease fungal cell. activity on the MAB01 heavy chain . Another aspect includes methods of improving heterolo FIG . 11 graphically depicts protease activity against gous polypeptide stability , by : a ) providing the Trichoderma 25 casein with and without inhibitors . fungal cell of any of the preceding embodiments ; and b ) FIGS. 12A - B depict an immunoblot showing the levels of culturing the cell such that the heterologous polypeptide is MAB01 heavy and light chain production after deletion of expressed , where the heterologous polypeptide has each of slp1, slp2 , slp3, and gap1 proteases. FIG . 12A shows increased stability compared to a host cell not containing the MAB01 heavy chain production . FIG . 12B shows MAB01 mutations of the genes encoding the proteases . Another 30 light chain production . aspect includes methods of making a heterologous polypep FIG . 13 graphically depicts the fold improvement in tide , by : a ) providing the Trichoderma fungal cell of any of MAB01 heavy and light chain production after deletion of the preceding embodiments ; b ) culturing the host cell such each of slp1, slp2 , slp3 , and gapl proteases . Each bar that the heterologous polypeptide is expressed ; and c) puri represents the average from several of the clones shown in fying the heterologous polypeptide . In certain embodiments 35 FIG . 12 . that may be combined with the preceding embodiments , the FIGS. 14A - B depicts an immunoblot showing the levels filamentous fungal cell further contains a carrier protein . In of MAB01 production from the gap2 deletion strain M244 . certain embodiments , the carrier protein is CBH1. FIG . 14A shows production of MAB01 heavy chain (HC ) . FIG . 14B shows the production ofMAB01 light chain (LC ). DESCRIPTION OF THE FIGURES 40 FIG . 15 depicts an immunoblot showing the levels of MAB01 antibody after incubation with Pichia supernatant FIG . 1 depicts a PAGE gel showing fractions eluted from containing the GAP2 protease . affinity column purification of aspartic proteases. FIG . 16 depicts an immunoblot showing the level of FIG . 2 depicts a PAGE gel showing the results of incu protease degradation of human IgGl. bating IgG with aspartic proteases . 45 FIG . 17 depicts the results of an MAB02 antibody zymo FIGS . 3A - C depict Southern blot analysis showing the gram from affinity purification with an aminobenzamidine generation of single protease deletion strains M181 and column (purified fractions) , and from supernatant samples M195. M181 = repurified clone 9-20A - 1 ( i.e. originating ( supernatant ). from 9-20A ). M195 = repurified clone 935A -1 ( i.e. originat FIGS. 18A -C depict the generation of the Apep1 Atsp1 ing from 9-35A ). FIG . 3A depicts the expected signal of 50 double protease deletion strain M219. M219 = 16-5AA . pep1 ORF: > 8 kb from parent M127 , no signal from M1960 , M196b = pyr4- of M195 . FIG . 18A depicts the transformants . FIG . 3B depicts the expected signal of pep1 expected signal of tsp1 ORF : 6.4 kb from parent M196 . FIG . 5 ' flank : > 8 kb from parentM127 , 4 kb from transformants . 18B depicts the expected signal of tspl 5 ' flank : 3.9 kb from FIG . 3C depicts the expected signal of pep1 3 ' flank : > 8 kb transformants , > 8 kb from M196 , 3.9 kb from p?Tv72 . FIG . from parent M127 , 4.2 kb from transformants . 55 18C depicts the expected signal of tsp1 3' flank : 2.8 kb from FIGS. 4A - C depict Southern blot analysis showing the transformants , > 8 kb from M196 , 3.9 kb from p?Tv72 . generation of rituximab antibody in the pepl deletion strain FIGS. 19A - C depict Southern blot analysis showing the M182 . M182 = 11-1A . M169 , parent= Rx25A_1 . FIG . 4A generation of the Apep1 Atsp2 double deletion strain Ml 94 . depicts the expected signal of pep1 ORF: > 8 kb from parent FIG . 19A depicts the expected signal of tsp1 ORF: kb from M169 , no signal from transformants . FIG . 4B depicts the 60 parent M181. FIG . 19B depicts the expected signal of bar. expected signal of bar. 1.0 + 1.7 kb from transformants , 3.1 1.4 + 2.5 kb from transformants , 2.9 kb from p?Tv42 , noth kb from p?Tv41, nothing from M169 . FIG . 4C depicts the ing from Ml81. FIG . 19C depicts the expected signal of bar . expected signal of bar . 1.8 + 2.8 kb from transformants , 3.1 1.9 + 3.2 kb from transformants , 2.9 kb from p?Tv42, noth kb from PTTv41, nothing from M169 . ing from M181. FIG . 5 depicts a protein gel showing peak fractions from 65 FIG . 20 graphically depicts normalized protease activity aspartic protease purifications of a pep containing strain and data from culture supernatants from each of the protease Apepl strain . deletion supernatants and the parent strain M124 . Protease US 10,731,168 B2 9 10 activity was measured at pH 5.5 in first 5 strains and at pH from transformants , 3.8 kb from plasmid control p?Tv145 . 4.5 in the last three deletion strains. Protease activity is FIG . 32D depicts Southern blot analysis showing the gen against green fluorescent casein . The six protease deletion eration of the pyr4 , from the quintuple protease deletion strain has only 6 % of the wild type parent strain and the 7 strain M369 , resulting in strain M381 (clone 14 ). M307 = 4 protease deletion strain protease activity was about 40 % less 5 fold del strain , M369 = 5 - fild del strain . The expected signal than the 6 protease deletion strain activity . is gap2 5 ' flank : 1.5 kb from all strains, 4.1 kb from plasmid FIG . 21A depicts the results of an MAB02 zymogram control p?Tv145 . FIG . 32E depicts Southern blot analysis with aminobenzamidine purified fractions from fermenta showing the generation of the pyr4- from the quintuple tion supernatants . FIG . 21B depicts an SDS PAGE gel ( 7 % ) protease deletion strain M369 , resulting in strain M381 of aminobenzamidine purified fractions from fermentation 10 ( clone 14 ). The expected signal is gap2 3 ' flank : 3.6 kb from supernatants . M307 , 2.7 kb from M369 + loopout clones, 3.8 kb from FIG . 22 depicts the results of an MAB02 zymogram assay plasmid control p?Tv145 . with SBTI affinity purified fractions containing proteases . FIG . 33 graphically depicts the protease activity of day 5 The major proteolytic activities appear white , where the supernatants taken from shake flask cultures done with the protease has degraded the MAB02 antibody. Concentrated 15 4 protease deletion strain M307 , the 5 protease deletion fraction 3 (cf3 ) and unconcentrated fractions 1-4 (f1 - f4 ) strain M369 , and the 6 protease deletion transformants 10B , were run in the zymogram gel. 44B , 97A , 97B , and 120A . Fluorescent casein was incubated FIG . 23 depicts an SDS PAGE gel showing SBTI affinity with the diluted supernatants in citrate buffer pH 4.5 to purified fractions containing proteases. Concentrated frac detect protease activity. tions cf3 and cf4 are shown in the gel. 20 FIGS. 34A - E depict Southern blot analysis showing the FIG . 24 depicts an immunoblot showing the level of generation of the 6 - fold protease deletion strains M396 and rituximab heavy chain degradation by SBTI purified pro M400 . M396 = 25-120A . M400 = 25-120A - a , i.e. repurified teases . clone from M396 . FIG . 34A depicts the expected signal of FIGS. 25A - B depict an immunoblot showing the level of pep4 ORF : 6.3 kb from M307 and M369 , no signals from antibody degradation when incubated overnight with sub- 25 transformants . FIG . 34B depicts the expected signal of pep4 tilisin containing Pichia supernatants . FIG . 25A shows pro ORF : 6.3 kb from M307 and M369, no signals from trans tease degradation of rituximab heavy chain . FIG . 25B shows formants . FIG . 34C depicts the expected signal of pep4 5' protease degradation ofMAB01 heavy chain . flank : 6.3 kb from M307 and M369, 4.8 kb from transfor FIGS. 26A -C depict Southern blot analysis showing the mants , 4.0 kb from p?Tv181 . FIG . 34D depicts the expected generation of the triple protease deletion strain M277. FIG . 30 signal of pep4 3' flank : 6.3 kb from M307 and M369 , 2.1 kb 26A depicts the expected signal of slp1 ORF : 6.5 kb from from transformants , 4.0 kb from PTTv181. FIG . 34E depicts parents (M219 , M228 ) only . FIG . 26B depicts the expected Southern blot analysis showing the generation of pyr4 , from signal of slp1 5 ' flank : 6.5 kb from parents , 3.3 kb from 6 -fold protease deletion strains M396 . The expected signal transformants , 4.4 kb from plasmid control p?Tv126 . FIG . of is pep4 3 ' flank : 6.3 kb from M307 and M369 , 2.1 kb from 26C depicts the expected signal of slp1 3 ' flank : 6.5 kb from 35 repurified transformants , 4.9 kb from the loopout clones . parents , 2.3 kb from transformants , 4.4 kb from plasmid FIG . 35 depicts an immunoblot showing the amount of control prTv126 . rituximab heavy chain fragments created in vitro by super FIG . 27 depicts an MABO2 zymogram assay showing the natant proteases. activity of protease deletion strain supernatants . White FIGS. 36A - B depict an immunoblot showing degradation regions on the stained gel indicate an area of protease 40 of heavy chain and light chain by supernatant samples from activity . SBTI treated cultures and untreated controls . FIG . 36A FIG . 28 graphically depicts total protease activity of shows degradation of the heavy chain . FIG . 36B shows the protease deletion culture supernatants compared to wild type degradation of the light chain . M1 24 activity . FIGS. 37A -B depict an immunoblot showing the level of FIGS. 29A - C depict Southern blots analysis showing the 45 degradation of heavy chain and light chain by supernatant generation of the quadruple protease deletion strain M307 . samples from cultures treated with chymostatin and pepsta FIG . 29A depicts the expected signal of gapl ORF: 4 kb tin A , or from untreated control cultures. FIG . 37A shows the from parent (Mill 2A = M306 ) only . FIG . 29B depicts the degradation of the light chain . FIG . 37B shows degradation expected signal of gapl 5 ' flank : 5.5 kb from parent, 3.4 kb of the heavy chain . from transformants , 4.1 kb from plasmid control p?Tvl 17. 50 FIG . 38 depicts the process of purifying antibodies from FIG . 29C depicts the expected signal of gap1 3' flank : 5.5 kb T. reesei culture supernatants . from parent, 3.1 kb from transformants, 4.1 kb from plasmid FIG . 39A and FIG . 39B depicts an immunoblot showing control p?Tvl 17 . improved the stability of antibody heavy (HC ( FIG . 39A ) ) FIG . 30 graphically depicts total protease activity in triple and light chain ( LC (FIG . 39B )) from T. reesei cells con and quadruple deletion strains compared to wild type Ml 24 55 taining a deletion of the pep1 protease . Three model anti strain . bodies were tested in large shake flask supernatant ( Apep1 FIG . 31 graphically depicts protease activity over time and Ml 24 ) and fermentation supernatant (pH 5.5 ; 28 ° C .; 20 between the M304 triple deletion strain and the M371 g / L spent grain extract, 60 g / L lactose ). quadruple deletion strain . FIG . 40 depicts an immunoblot showing improved pro FIGS . 32A - E depict Southern blot analysis showing the 60 duction of the rituximab (Rx ) heavy chain from T. reesei generation of the quintuple protease deletion strain M369 , cells containing a deletion of the tspl protease . Transfor clone 7-30A = M369. FIG . 32A depicts the expected signal of mants 12-2 A and 12-16A clearly show more heavy chain gap2 ORF : 4.9 kb from parent (M307 ) , no signals from compared to the parent strain . transformant. FIG . 32B depicts the expected signal of gap2 FIGS. 41A - B depicts an immunoblot showing reduced 5 ' flank : 4.9 kb from parent, 2.3 kb from transformant, 2.3 65 MAB01 heavy chain degradation after overnight incubation kb from plasmid control p?Tv145 . FIG . 32C depicts the with supernatant from the triple protease deletion strain expected signal of gap2 3 ' flank : 4.9 kb from parent, 3.8 kb M277 . After overnight incubation in day 5 culture superna US 10,731,168 B2 11 12 tant, there was 2.5 - fold more heavy chain found in the triple determination of the relationships between sedolisins . The protease deletion supernatant compared to supernatant from abbreviations sedA / B / C / D / E in front of each protease are control strain Ml 24 , which has no protease deletions (FIG . based on Reichard et al. ( 2006 ) APPLIED AND ENVIRON 41A ) . When incubated in the 7 day culture supernatant, there MENTAL MICROBIOLOGY, Vol. 72 , p . 1739-1748 , FIG . was 4 - fold more heavy chain found in the triple protease 5 4 , from which BLAST search with A. fumigatus sedolisin the deletion supernatant compared to supernatant from control corresponding protease was retrieved . strain M1 24 ( FIG . 41B ) . FIG . 49A : Schematic drawings for the expression plas FIGS. 42A - C depicts a degradation study ofmodel pro mids p?Tv67 and p?Tv99 . The MAB01 heavy chain is teins. Undiluted supernatant from the 6 protease deletion contained within in the p?Tv67 vector and the light chain is strain was used at pH 4.2 for spiking in pure model proteins 10 contained within the p?Tv99 vector. FIG . 49B : Schematic ( 0.05 ug/ ml) . 50 mM sodium citrate pH 4.0 spiked with drawing for the expression vector p?Tv223 . The MAB01 model proteins ( 0.05 ug/ ml ) is shown as a buffer control. heavy and light chain is contained within the p?Tv223 The spiked supernatant and control were incubated for 20 vector. hours at 37 ° C. 10 ul of each sample was loaded into 18 % FIG . 50A : Western blot analysis MAB01 light and heavy SDS PAGE gels . The hGH ran at 22 kD (FIG . 42A ) , the 15 chain production in pH 5.2 in a fed batch fermentation of the IFNa2ß ran at 19.4 kD (FIG . 42B ), and the IGF1 ran at 7.5 MAB01 production strain M507 . The antibodies used were kD ( FIG . 42C ) . Sigma A3188 against the heavy chain (left blot) and Sigma FIG . 43 depicts stability testing of the MAB01 antibody A3813 against the light chain ( right blot) , both at 1 : 10,000 heavy chain in supernatants from the 6 protease deletion dilutions. Sample codes denote fermentation time in days . strain . The MAB01 antibody was present in undiluted super- 20 0.1 ul of supernatant was loaded into each lane in both blots . natant at 0.05 ug ul. 10 u? of each sample was loaded to a FIG . 50B : Western blot analysis ofMAB01 light and heavy 4-20 % SDS PAGE gel. The heavy chain was stable after a chain production in the fed batch fermentation of the 20 hour incubation at 37 ° C. in supernatant from the 6 MAB01 production strain M507 at pH 5.5 . The antibodies protease deletion strain at pH 4.2 . The heavy chain was used were Sigma A3188 against the heavy chain (blot to the detected with anti -heavy chain IgG AP conjugated antibody 25 left ) and Sigma A3813 against the light chain (blot to the ( Sigma # A3188 ) diluted 1 : 30,000 in TBST. The full length right) , both at 1 : 10,000 dilutions. Sample codes denote heavy chain ran at 50 kD on the gel. fermentation time in days. 0.1 ul of supernatant was loaded FIG . 44 depicts day 4 samples of human growth hormone into each lane in both blots . from 24 well cultures with and without inhibitors, and FIG . 51. Western blot analysis MAB01 light and heavy supplements. 12 ul of each supernatantwas loaded . Primary 30 chain production in strains M304 in the fed batch fermen antibody from Acris , catalog # AM00401PU - N mouse anti tation bio00503b at pH 5.5 . The antibodies used were Sigma hGH antibody ( diluted to 2 ug /ml in TBST ) and BioRad A3188 against the heavy chain and Sigma A3813 against the (# 170-6520 ) goat anti- mouse IgG AP conjugated secondary light chain . The day 8 from the M304 fermentation antibody diluted 1 : 10,000 . The hGH standard (200 ng ) , bio00477b was included as a control. Sample codes denote Abeam catalog # ab51232. The full length hGH protein runs 35 fermentation time in days. 0.1 ul of supernatant was loaded at 22 kD . in both blots . The uppermost immunoblot is the heavy chain FIG . 45 depicts a phylogeny of aspartic proteases of T. and lower immunoblot is the light chain . reesei, Myceliophthora thermophila , Neurospora crassa , FIG . 52. The p?Tv204 RNAi expression vector. Penicillium chrysogenum , Aspergillus oryzae, A. nidulans, FIG . 53 : Immunoblot detecting MAB01 heavy chain and A. niger . The alignment was created with ClustalOmega 40 production in strains expressing RNAi that knocks down ( http://www.ebi.ac.uk/Tools/msa/clustalo/) and the tree was slp2 expression . calculated using average distance with BLOSUM62 . FIG . 54A depicts quantification of the IFN - a 2b expres FIG . 46 depicts a phylogeny of subtilisin proteases of T. sion level from the day 3 sample of M401 fermentation . 1 reesei, Myceliophthora thermophila , Neurospora crassa , u1/ 2 u1/ 4 ul of supernatant were loaded to a 4-20 % SDS Penicillium chrysogenum , Aspergillus oryzae , A. nidulans, 45 PAGE gel . Immunoblotting was done with Abeam and A.niger . The alignment was created with ClustalOmega (# ab9386 ) anti -IFN - a 2b antibody diluted to 1 ug /ml in (http://www.ebi.ac.uk/Tools/msa/clustalo/ ) and the tree was TBST . The secondary antibody from Bio - rad (# 170-6520 ) calculated using average distance with BLOSUM62 . " pyr” goat anti -mouse IgG AP conjugated secondary antibody means pyrolysin , " prKsf3 ” means proteinase K , subfamily diluted 1: 5000 in TBST. The protein standards were loaded 3 ; prtA , prtK , prU , prtF , and prtBCI mean subfamilies as 50 on the gel corresponding 50 ng , 100 ng and 200 ng of full described in Bryant et al. ( 2009 ) BMC Evolutionary Biology length IFN - a 2b . Densitometric quantification was done 9 : 168 , doi: 10.1186 / 1471-2148-9-168 , FIG . 5 and addi with Totallab Quant TL100 software . For the quantification tional file no . 8 . 2 ug /ml sample was most representative . Full length IFN - a FIG . 47 depicts a phylogeny of glutamic proteases of T. 2b control ( 100 ng ) runs at 19.3 kD and carrier bound IFN - a reesei, Myceliophthora thermophila , Neurospora crassa, 55 2b at 70 kDa. Penicillium chrysogenum , Aspergillus oryzae, A. nidulans, FIG . 54B depicts immunoblot analysis for day 3-6 and A. niger. The alignment was created with Clustal Omega samples ofM577 and M652 fermentation cultures. 0.2 ul of (http://www.ebi.ac.uk/Tools/msa/clustalo/ ) and the tree was growth supernatant was loaded to a 4-20 % SDS PAGE gel . calculated using average distance with BLOSUM62 . Immunoblotting was done with Abeam ( # ab9386 ) anti FIG . 48 depicts a phylogeny of sedolisin proteases of T. 60 IFN - a 2b antibody diluted to 1 ug/ ml in TBST. The sec reesei , Myceliophthora thermophila, Neurospora crassa , ondary antibody from Bio -rad ( # 170-6520 ) goat anti- mouse Penicillium chrysogenum , Aspergillus oryzae , A. nidulans, IgG AP conjugated secondary antibody diluted 1 :5000 in and A. niger. The alignment was created with Clustal Omega TBST . Full length IFN -a 2b control ( 100 ng ) runs at 19.3 kD (http://www.ebi.ac.uk/Tools/msa/clustalo/ ) and the tree was and carrier bound IFN - a 2b at 70 kDa . calculated using average distance with BLOSUM62. As slp7 65 FIG . 55 depicts quantification of the IFN -a 2b expression resembles sedolisin proteases, it is included in the tree . level from the day 4 (M577 fermentation ) and day 3 ( M652 Aspergillus fumigatus sequences are included to aid the fermentation ) samples . 0.05 ul and 0.1 ul of supernatant US 10,731,168 B2 13 14 were loaded of each sample to a 4-20 % SDS PAGE gel. zation in terms of both quantity and quality of proteins Immunoblotting was done with Abeam (Hab9386 ) anti produced in filamentous fungal cells containing such dele IFN - a 2b antibody diluted to 1 ug /ml in TBST. The sec tions , and resulted in an increase in the production of full ondary antibody from Bio -rad (# 170-6520 ) goat anti -mouse length heterologous proteins in the cells . It was also found IgG AP conjugated secondary antibody diluted 1: 5000 in 5 that Trichoderma fungal cells engineered to reduce the TBST. The protein standards were loaded on the gel corre activity of at least three protease genes resulted in an sponding 50 ng , 100 ng and 200 ng of full length IFN - a 2b . unexpected , synergistic increase in the production of full Densitometric quantification was done with Totallab Quant length mammalian proteins , such as antibodies , therapeutic TL100 software . For the quantification 0.1 ul samples were protein or antibody variants such Fab or single domain most representative. Full length IFN - a 2b control (100 ng ) 10 antibodies . In other words, the amount of full length mam runs at 19.3 kD and carrier bound IFN - a 2b at 70 kDa. malian protein produced was greater than the sum of the amounts produced in Trichoderma fungal cells containing DETAILED DESCRIPTION only one or two protease gene deletions. Thus, in contrast to WO2011/ 075677 , the inventors have shown that production The present invention relates to improved methods of 15 of intact heterologous proteins in filamentous fungal cells , generating recombinant heterologous polypeptides in fila such as Trichoderma fungal cells , can be achieved by mentous fungal cells that have reduced or no activity of at reducing or eliminating the activity of at least three pro least three proteases. The present invention is based in part teases in the cells . upon the surprising discovery that reducing the activity of a Accordingly , certain aspects of the present disclosure specific combination of endogenous proteases in filamen- 20 provide filamentous fungal cells that produce increased tous fungal cells increases the expression and stability of a levels of a heterologous protein by having reduced or no variety of recombinantly expressed heterologous proteins, activity of at least three proteases , where the cell further such as immunoglobulins and growth factors . While others contains a recombinant polynucleotide encoding a heterolo have created Trichoderma fungal cells with one or more gous polypeptide produced at a level of at least 2 - fold higher proteases inactivated , they have not provided guidance as to 25 than the production level of the polypeptide in a correspond which proteases are most relevant to increasing the expres ing parental filamentous fungal cell in which the proteases sion and stability of specific types of proteins, such as do not have the reduced activity . In other words, the desired mammalian proteins. For example , WO2011/ 075677 dis increase in the level of the heterologous protein production closes certain proteases that can be knocked out in is determinable by comparing the production level of the Trichoderma and even discloses Trichoderma fungal cells 30 heterologous protein in a filamentous fungal cell having the that are deficient in multiple proteases. However, WO2011/ reduced activity of at least three proteases , to that of a 075677 does not provide any guidance regarding which of filamentous fungal cell which does not have such reduced the proteases have an adverse impact on the expression and activity , but is otherwise identical the cell exhibiting the stability of mammalian proteins, such as immunoglobulins increased level. or growth factors , as no examples of expression of any 35 Other aspects of the present disclosure provide methods mammalian proteins are described therein . Moreover , of improving heterologous polypeptide stability , by : a ) pro WO2011 /075677 only discloses heterologous expression of viding a filamentous fungal cell of the present disclosure a single fungal protein in each of three different fungal having reduced or no activity of at least three proteases , strains deficient in a single protease . Thus , one of skill in the where the cell further contains a recombinant polynucleotide art would likely read WO2011/ 075677 as teaching that 40 encoding a heterologous polypeptide; and b ) culturing the inactivating each single protease would be sufficient for cell such that the heterologous polypeptide is expressed , heterologous protein production . Yoon et al (2009 , Appl. where the heterologous polypeptide has increased stability Microbiol Biotechnol 82 : 691-701, 2010 : Appl. Microbiol compared to a host cell not containing the mutations of the Biotechnol DOI 10.1007 / s00253-010-2937-0 ) reported the genes encoding the proteases . construction of quintuple and ten fold protease gene disrup- 45 Still other aspects of the present disclosure provide meth tants for heterologous protein production in Aspergillus ods of making a heterologous polypeptide , by: a ) providing oryzae. The 10 protease disruptant cells improve the pro a filamentous fungal cell of the present disclosure having duction yield of chymosin by only 3.8 fold , despite the high reduced or no activity of at least three proteases, where the number of disrupted protease genes . Van den Hombergh et cell further contains a recombinant polynucleotide encoding al reported a triple protease gene disruptant of Aspergillus 50 a heterologous polypeptide; b ) culturing the host cell such niger. While the data show a reduction in protease activity , that the heterologous polypeptide is expressed ; and c ) puri there is no example of any mammalian protein production fying the heterologous polypeptide . described herein . Certain aspects of the present disclosure also provide Applicants have surprisingly shown that multiple pro Trichoderma fungal cells that produce increased levels of a teases are relevant to reduction of total protease activity , 55 mammalian polypeptide by having reduced or no activity of increasing production of heterologous proteins and stabiliz at least three proteases selected from pep1, pep2, pep3, ing the heterologous proteins after expression , in filamen pep4 , pep5, pep8 , pep11 , pep12 , tsp1, slp1, slp2 , gap1, and tous fungal cells , such as Trichoderma fungal cells . In gap2 , where the cell further contains a recombinant poly particular , the inventors have identified proteases that are nucleotide encoding a mammalian polypeptide produced at actually expressed in Trichoderma fungal cells ( as opposed 60 a level of at least 2- fold higher than the production level of to merely being coded for in the genome) by purifying these the polypeptide in a corresponding parental Trichoderma proteases and determining which have activities that are fungal cell in which the proteases do not have the reduced most relevant in degrading heterologous proteins, such as activity . In other words, the desired increase in the level of mammalian proteins . Additionally , the inventors confirmed the heterologous protein production is determinable by that deleting the genes responsible for the particular protease 65 comparing the production level of the heterologous protein activities achieved a substantial reduction in total protease in a Trichoderma fungal cell having the reduced activity of activity , which correlates to an increase in protein stabili at least three proteases, to that of a Trichoderma fungal cell US 10,731,168 B2 15 16 which does not have such reduced activity, but is otherwise by reducing or eliminating the activity of proteases in identical to the cell exhibiting the increased level. filamentous fungal cells that express a heterologous poly Other aspects of the present disclosure provide methods peptide, the stability of the expressed polypeptide is of improving mammalian polypeptide stability , by : a ) pro increased , resulting in an increased level of production of the viding a Trichoderma fungal cell of the present disclosure 5 polypeptide, and in some circumstances, improved quality having reduced activity of at least three proteases, where the of the produced polypeptide ( e.g. , full -length instead of cell further contains a recombinant polynucleotide encoding degraded ) . a mammalian polypeptide; and b ) culturing the cell such that Proteases including , without limitation , aspartic pro the mammalian polypeptide is expressed , where the mam teases , trypsin - like serine proteases , subtilisin proteases , malian polypeptide has increased stability compared to a 10 glutamic proteases , and sedolisin proteases . Such proteases host cell not containing the mutations of the genes encoding may be identified and isolated from filamentous fungal cells the proteases. and tested to determine whether reduction in their activity Further aspects of the present disclosure provide methods affects the production of a recombinant polypeptide from the of making a mammalian polypeptide, by : a ) providing a filamentous fungal cell . Methods for identifying and isolat Trichoderma fungal cell of the present disclosure having 15 ing proteases are well known in the art , and include, without reduced activity of at least three proteases , where the cell limitation , affinity chromatography, zymogram assays , and further contains a recombinant polynucleotide encoding a gel electrophoresis . An identified protease may then be mammalian polypeptide; b ) culturing the host cell such that tested by deleting the gene encoding the identified protease the mammalian polypeptide is expressed ; and c) purifying from a filamentous fungal cell that expresses a recombinant the mammalian polypeptide . 20 polypeptide, such a heterologous or mammalian polypep tide, and determining whether the deletion results in a Definitions decrease in total protease activity of the cell, for example , to a level of 49 % or less , or 31 % or less , of the total protease As used herein , an “ immunoglobulin ” refers to a multi activity of the corresponding parental filamentous fungal meric protein containing a heavy chain and a light chain 25 cell; and an increase in the level of production of the covalently coupled together and capable of specifically expressed recombinant polypeptide, for example two - fold combining with antigen . Immunoglobulin molecules are a higher than the production level in the corresponding paren large family of molecules that include several types of tal filamentous fungal cell . Methods for deleting genes, molecules such as IgM , IgD , IgG , IgA , and IgE . measuring total protease activity , and measuring levels of As used herein , an “ antibody ” refers to intact immuno- 30 produced protein are well known in the art and include the globulin molecules , as well as fragments thereof which are methods described herein . The “ corresponding parental fila capable of binding an antigen . These include hybrid ( chi mentous fungal cell” refers to the corresponding cell in meric ) antibody molecules (see , e.g., Winter et al. Nature which the proteases do not have reduced or eliminated 349 :293-99225 , 1991 ; and U.S. Pat. No. 4,816,567 226 ) ; activity . F (ab ') 2 and F ( ab ) fragments and Fv molecules ; non - covalent 35 Aspartic Proteases heterodimers [227 , 228 ] ; single -chain Fv molecules ( scFv ) Aspartic proteases are enzymes that use an aspartate ( see , e.g. , Huston et al. Proc . Natl . Acad . Sci. U.S.A. residue for hydrolysis of the peptide bonds in polypeptides 85 :5897-83 , 1988 ) ; dimeric and trimeric antibody fragment and proteins . Typically , aspartic proteases contain two constructs ; minibodies (see , e.g. , Pack et al . Biochem 31, highly -conserved aspartate residues in their active site which 1579-84 , 1992 ; and Cumber et al. J. Immunology 149B , 40 are optimally active at acidic pH . Aspartic proteases from 120-26 , 1992 ) ; humanized antibody molecules (see e.g. , eukaryotic organisms such as Trichoderma fungi include Riechmann et al. Nature 332 , 323-27 , 1988 ; Verhoeyan et al. pepsins, cathepsins , and renins. Such aspartic proteases have Science 239, 1534-36 , 1988; and GB 2,276,169) ; and any a two - domain structure , which is thought to arise from an functional fragments obtained from such molecules, as well ancestral gene duplication . Consistent with such a duplica as antibodies obtained through non -conventional processes 45 tion event, the overall fold of each domain is similar, though such as phage display . Preferably , the antibodies are mono the sequences of the two domains have begun to diverge. clonal antibodies. Methods of obtaining monoclonal anti Each domain contributes one of the catalytic aspartate bodies are well known in the art. residues . The active site is in a cleft formed by the two As used herein , a “ peptide” and a “ polypeptide” are amino domains of the aspartic proteases. Eukaryotic aspartic pro acid sequences including a plurality of consecutive polym- 50 teases further include conserved disulfide bridges, which can erized amino acid residues. For purpose of this invention , assist in identification of the polypeptides as being aspartic typically , peptides are those molecules including up to 50 acid proteases . amino acid residues, and polypeptides include more than 50 Nine aspartic proteases have been identified in amino acid residues . The peptide or polypeptide may include Trichoderma fungal cells : pep1 ( tre74156 ); pep2 (tre53961 ) ; modified amino acid residues, naturally occurring amino 55 pep3 ( trel21133 ) ; pep4 ( tre77579) , pep5 (tre81004 ) , and acid residues not encoded by a codon , and non -naturally pep7 ( tre58669 ), pep8 ( trel22076 ), pep11 ( trel21306 ) and occurring amino acid residues . As used herein , “ protein ” pep12 (trel 19876 ) . may refer to a peptide or a polypeptide of any size . Pep1 Proteases of the Invention Examples of suitable pepl proteases include, without The invention described herein relates to filamentous 60 limitation, Trichoderma reesei pep1 (SEQ ID NO : 1 ) , Hypo fungal cells , such as Trichoderma fungal cells , that produce crea lixii gil11558498 (SEQ ID NO : 2 ), Trichoderma increased levels of a heterologous polypeptide, such as a asperellum gil47027997 (SEQ ID NO : 3 ) , Trichoderma mammalian polypeptide , by having reduced or no detectable atroviride jgilTriat21297887 (SEQ ID NO : 4 ), Trichoderma activity of at least three proteases found in the cells . Such virens jgilTriviGv29_8_2181777 ( SEQ ID NO : 5 ), Aspergil proteases found in filamentous fungal cells that express a 65 lus fumigatus jgilTrire2lafm :Afu5g13300 (SEQ ID NO : 6 ) , heterologous polypeptide normally catalyze significant deg Aspergillus oryzae gi194730408 (SEQ ID NO : 7 ) , Metarhi radation of the expressed recombinant polypeptides. Thus, zium anisopliae gil322712783 (SEQ ID NO : 8 ), Gibberella US 10,731,168 B2 17 18 zeae gi146126795 (SEQ ID NO : 9 ) , Fusarium venenatum Botryotinia fuckeliana gill2002205 (SEQ ID NO : 29 ) , gil18448713 (SEQ ID NO : 10 ), Fusarium oxysporum Thielavia terrestris gil346997107 ( SEQ ID NO : 30 ) , Scle gil342879173 (SEQ ID NO : 11) , Grosmannia clavigera rotinia sclerotiorum gil156055954 (SEQ ID NO : 31) , gil320591399 (SEQ ID NO : 12 ), Verticillium alboatrum Chaetomium globosum gill 16197829 (SEQ ID NO : 32 ), gil302422750 (SEQ ID NO : 13 ) , Chaetomium globosum gill 5 Neurospora tetrasperma gil336472132 (SEQ ID NO : 33 ) , 16182964 (SEQ ID NO : 14 ) , Neurospora crassa Neurospora crassa gil85102020 (SEQ ID NO : 34 ) , Neosar gil85110723 (SEQ ID NO : 15 ), Neurospora tetrasperma torya fischeri gil119467426 (SEQ ID NO : 35 ), Penicillium gil336463990 (SEQ ID NO : 16 ), Myceliophthora thermo marneffei gil212534792 (SEQ ID NO : 36 ), M. thermophila phila gi367030924 (SEQ ID NO : 491) , Penicillium chryso gi367025909 (SEQ ID NO : 496 ) , P. chrysogenum genum gi255953325 (SEQ ID NO : 492 ), Aspergillus niger 10 gi255947264 (SEQ ID NO : 497 ), A. oryzae 391870123 gi350639535 (SEQ ID NO : 493 ) , Aspergillus nidulans (SEQ ID NO : 498 ), and homologs thereof . gi67541436 (SEQ ID NO : 494 ), and homologs thereof. Accordingly , in certain embodiments , a protease of the Accordingly , in certain embodiments , a protease of the present disclosure , typically a pep3 protease, has an amino present disclosure , typically a pep1 protease , has an amino acid sequence having 50 % or more identity ( e.g. 60 % , 65 % , acid sequence having 50 % or more identity (e.g. 60 % , 65 % , 15 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid sequence selected from SEQ ID NOs: 17-36 , SEQ ID sequence selected from SEQ ID NOs: 1-16 , SEQ ID NOs: NOs: 496-498 . In some embodiments , the protease has 100 % 491-494 . In some embodiments , the protease has 100 % identity to an amino acid sequence selected from SEQ ID identity to an amino acid sequence selected from SEQ ID 20 NOs: 17-36 , SEQ ID NOs: 496-498 . NOs : 1-16 , SEQ ID NOs :491-494 . In some embodiments , pep3 is T. reesei pep3 . The amino In some embodiments , pep1 is T. reesei pep1. The amino acid sequence encoded by T. reesei pep3 is set forth in SEQ acid sequence encoded by T. reesei pepl is set forth in SEQ ID NO : 17. In other embodiments , a protease of the present ID NO : 1. In other embodiments , a protease of the present disclosure has an amino acid sequence having 50 % or more disclosure has an amino acid sequence having 50 % or more 25 identity ( e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , identity ( e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or more ) to SEQ ID NO : 17. In further embodiments , the more ) to SEQ ID NO : 1. In further embodiments , the protease has 100 % identity to SEQ ID NO : 17 . protease has 100 % identity to SEQ ID NO : 1. Pep4 Pep2 30 Examples of suitable pep4 proteases include, without Examples of suitable pep2 proteases include , without limitation , Trichoderma reesei pep4 (SEQ ID NO : 37) , T. limitation , Trichoderma reesei pep2 (SEQ ID NO : 182 ) , T. virens jgilTriviGv29_8_2 (SEQ ID NO : 38 ), T. atroviride atroviride jgi \ Triat21142040 (SEQ ID NO : 183 ) , T. virens jgilTriat2 (SEQ ID NO : 39) , Trichoderma aureoviride jgilTriviGv29_8_2153481 (SEQ ID NO : 184 ) , Cordyceps gil193735605 (SEQ ID NO : 40 ) , Aspergillus niger militaris CM01 gi1346326575 (SEQ ID NO : 185 ), Neuro- 35 gil145232965 (SEQ ID NO : 41) , Aspergillus fumigatus spora crassa gi 85111370 (SEQ ID NO : 495 ), and homologs gil70999520 (SEQ ID NO : 42 ), Aspergillus clavatus thereof. gil121705756 (SEQ ID NO : 43 ) , Nectria haematococca Accordingly , in certain embodiments , a protease of the gil302899226 (SEQ ID NO : 44 ), Glomerella graminicola present disclosure , typically a pep2 protease , has an amino gi1310796316 (SEQ ID NO : 45 ), Cordyceps militaris acid sequence having 50 % or more identity { e.g. 60 % , 65 % , 40 gi1346322842 (SEQ ID NO : 46 ), Gibberella zede 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , gil46138535 (SEQ ID NO : 47 ) , Metarhizium anisopliae 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid gil322708430 (SEQ ID NO : 48 ) , Fusarium oxysporum sequence selected from SEQ ID NOs: 182-185 , SEQ ID gil342882947 ( SEQ ID NO : 49 ) , Metarhizium acridum NO : 495 . In some embodiments , the protease has 100 % gil322700747 (SEQ ID NO : 50 ) , Verticillium dahliae , identity to an amino acid sequence selected from SEQ ID 45 gil346973691 (SEQ ID NO : 51) , Botryotinia fuckeliana NOs: 182-185 , SEQ ID NO : 495 . gil154309857 (SEQ ID NO : 52 ), Chaetomium globosum In some embodiments , pep2 is T. reesei pep2 . The amino gil116203505 (SEQ ID NO : 53 ) , Thielavia terrestris acid sequence encoded by T. reesei pep2 is set forth in SEQ gil347001590 ( SEQ ID NO : 54 ), Magnaporthe oryzae ID NO : 182. In other embodiments , a protease of the present gil39973863 (SEQ ID NO : 55 ) , Tuber melanosporum disclosure has an amino acid sequence having 50 % or more 50 gil296417651 (SEQ ID NO : 56 ), Neurospora crassa identity { e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , gil85094599 (SEQ ID NO : 57) , M. thermophila 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or gi367031892 gi255947264 (SEQ ID NO : 499 ) , P. chryso more ) to SEQ ID NO : 182. In further embodiments , the genum gi255936729 gi255947264 (SEQ ID NO : 500 ), A. protease has 100 % identity to SEQ ID NO : 182 . oryzae gil69770745 gi255947264 (SEQ ID NO : 501 ), A. Pep3 55 nidulans gi67524891 gi255947264 (SEQ ID NO : 502 ), and Examples of suitable pep3 proteases include, without homologs thereof. limitation , Trichoderma reesei pep3 (SEQ ID NO : 17 ) , T. Accordingly , in certain embodiments , a protease of the atroviride jgilTriat2 (SEQ ID NO : 18) , T. virens, jgilTriv present disclosure , typically a pep4 protease , has an amino iGv29_8_2 (SEQ ID NO : 19 ) , Hypocrea lixii gill 45583125 acid sequence having 50 % or more identity { e.g. 60 % , 65 % , ( SEQ ID NO : 20 ), Trichoderma asperellum gil51860175 60 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , (SEQ ID NO : 21 ), Aspergillus niger gil317025164 (SEQ ID 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid NO : 22 ) , Aspergillus fumigatus gil159122534 (SEQ ID NO : sequence selected from SEQ ID NOs: 37-57 , SEQ ID 23) , Aspergillus niger gil134054572 (SEQ ID NO : 24 ) , NOs: 499-502 . In some embodiments , the protease has 100 % Cordyceps militaris , gil346318620 (SEQ ID NO : 25 ) , Glom identity to an amino acid sequence selected from SEQ ID erella graminicola gil310800156 (SEQ ID NO : 26 ), 65 NOs: 37-57 , SEQ ID NOs: 499-502 . Fusarium oxysporum gil342871221 (SEQ ID NO : 27) , In some embodiments , pep4 is T. reesei pep4 . The amino Grosmannia clavigera gil320591121 (SEQ ID NO : 28 ) , acid sequence encoded by T. reesei pep4 is set forth in SEQ US 10,731,168 B2 19 20 ID NO : 37. In other embodiments , a protease of the present 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or disclosure has an amino acid sequence having 50 % ormore more ) to SEQ ID NO : 186. In further embodiments , the identity { e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , protease has 100 % identity to SEQ ID NO : 186 . 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or Pep8 more ) to SEQ ID NO : 37. In further embodiments , the 5 Examples of suitable pep8 genes include , without limita protease has 100 % identity to SEQ ID NO : 37 . tion , Trichoderma reesei pep8 EGR48424 (SEQ ID NO : Pep5 507 ), Trichoderma virens EHK19238 (SEQ ID NO : 508 ), Examples of suitable pep5 genes include , without limita Trichoderma atroviride EHK40047 (SEQ ID NO : 509 ) , tion , Trichoderma reesei pep5 (SEQ ID NO : 58 ) , T. virens Neurospora tetrasperma EG053367 (SEQ ID NO : 510 ) , jgilTriviGv29_8_2 (SEQ ID NO : 59 ), T. atroviride 10 Myceliophthora thermophila XP_003658897 (SEQ ID NO : jgilTriat21277859 (SEQ ID NO : 60 ), Metarhizium acridum 511 ), Neurospora crassa XP_965343 (SEQ ID NO : 512 ) , gil322695806 (SEQ ID NO : 61) , Fusarium oxysporum Metarhizium anisopliae EFZ03501 (SEQ ID NO : 513 ), gil156071418 (SEQ ID NO : 62) , Cordyceps militaris Thielavia terrestris XP_003656869 (SEQ ID NO : 514 ) , gil346324830 (SEQ ID NO : 63 ) , Gibberella zeae Fusarium oxysporum EGU79769 (SEQ ID NO : 515 ) , and gil46124247 (SEQ ID NO : 64 ) , Verticillium dahliae 15 Gibberella zeae XP_381566 (SEQ ID NO : 516 ) , Magna gil346978752 (SEQ ID NO : 65 ) , M. thermophila porthe oryzae XP_003714540.1 (SEQ ID NO :517 ) , P. chry gi367019798 (SEQ ID NO : 503) , and homologs thereof. sogenum XP_002557331 (SEQ ID NO : 518 ) , A. oryzae Accordingly , in certain embodiments , a protease of the XP_001822899.1 (SEQ ID NO : 519 ) , A. nidulans present disclosure , typically a pep5 protease , has an amino XP_664091.1 (SEQ ID NO : 520 ) , A. niger EHA24387.1 acid sequence having 50 % or more identity { e.g. 60 % , 65 % , 20 (SEQ ID NO : 521) , and homologs thereof. 70 % , 75 % , 80 % , 85 % , 90 % , 91 % 92 % , 93 % , 94 % , 95 % , Accordingly , in certain embodiments , a protease of the 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid present disclosure , typically a pep8 protease , has an amino sequence selected from SEQ ID NOs: 58-65 , SEQ ID acid sequence having 50 % or more identity ( e.g. 60 % , 65 % , NO : 503 . In some embodiments , the protease has 100 % 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , identity to an amino acid sequence selected from SEQ ID 25 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid NOs : 58-65 , SEQ ID NO :503 . sequence selected from SEQ ID NOs: 507-521. In some In some embodiments , pep5 is T. reesei pep5 . The amino embodiments , the protease has 100 % identity to an amino acid sequence encoded by T. reesei pep5 is set forth in SEQ acid sequence selected from SEQ ID NOs: 507-521. ID NO : 58. In other embodiments , a protease of the present In some embodiments , pep8 is T. reesei pep8 . The amino disclosure has an amino acid sequence having 50 % or more 30 acid sequence encoded by T. reesei pep8 is set forth in SEQ identity { e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , ID NO : 507. In other embodiments , a protease of the present 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or disclosure has an amino acid sequence having 50 % ormore more ) to SEQ ID NO : 58. In further embodiments , the identity ( e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 1 % protease has 100 % identity to SEQ ID NO : 58 . 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or Pep 7 35 more ) to SEQ ID NO : 507. In further embodiments , the Examples of suitable pep7 genes include, without limita protease has 100 % identity to SEQ ID NO : 507 . tion , Trichoderma reesei pep7 (SEQ ID NO : 186 ), Pep 11 Trichoderma atroviride jgilTriat2 (SEQ ID NO : 187 ) , Examples of suitable pep11 genes include, without limi Trichoderma virens jgilTriviGv29_8_2 ( SEQ ID NO : 188 ), tation , Trichoderma reesei pep11 EGR49498 (SEQ ID NO : Glomerella graminicola gi1310800487 ( SEQ ID NO : 189 ), 40 522 ), Trichoderma virens EHK26120 ( SEQ ID NO : 523 ), Metarhizium acridum gil322700577 (SEQ ID NO : 190 ) , Trichoderma atroviride EHK41756 (SEQ ID NO : 524 ) , Thielavia terrestris gil347003264 (SEQ ID NO : 191) , Fusarium pseudograminearum EKJ74550 (SEQ ID NO : Podospora anserine gil171680938 (SEQ ID NO : 192 ), 525 ) , Metarhizium acridum EFY91821 (SEQ ID NO : 526 ) , Chaetomium thermophilum gil340905460 (SEQ ID NO : and Gibberella zeae XP_384151 (SEQ ID NO : 527) , M. 193) , Verticillium dahliae gil346975960 (SEQ ID NO : 194 ) , 45 thermophila XP_003667387.1 (SEQ ID NO : 528 ) , N. crassa Myceliophthora thermophila gil347009870 , gi367026634 XP_960328.1 ( SEQ ID NO : 529 ), and homologs thereof. (SEQ ID NO : 195 ), Neurospora crassa gi185090078 (SEQ Accordingly , in certain embodiments , a protease of the ID NO : 196 ) , Magnaporthe oryzae gi139948622 (SEQ ID present disclosure, typically a pep11 protease , has an amino NO : 197 ) , Chaetomium globosum gil116191517 (SEQ ID acid sequence having 50 % or more identity { e.g. 60 % , 65 % , NO : 198 ) , Magnaporthe oryzae gil39970765 (SEQ ID NO : 50 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , 199) , A. nidulans gi67522232 (SEQ ID NO : 504 ) , A. niger 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid gi350630464 (SEQ ID NO : 505) , A. oryzae gi317138074 sequence selected from SEQ ID NOs: 522-529 . In some ( SEQ ID NO : 506 ), and homologs thereof. embodiments , the protease has 100 % identity to an amino Accordingly , in certain embodiments , a protease of the acid sequence selected from SEQ ID NOs: 522-529 . present disclosure , typically a pep7 protease , has an amino 55 In some embodiments , pep11 is T. reesei pep8. The amino acid sequence having 50 % or more identity ( e.g. 60 % , 65 % , acid sequence encoded by T. reesei pep11 is set forth in SEQ 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , ID NO : 522. In other embodiments , a protease of the present 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid disclosure has an amino acid sequence having 50 % or more sequence selected from SEQ ID NOs: 186-199 , SEQ ID identity {e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , NOs: 504-506 ) . In some embodiments , the protease has 60 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or 100 % identity to an amino acid sequence selected from SEQ more ) to SEQ ID NO : 522. In further embodiments , the ID NOs : 186-199 , SEQ ID NOs: 504-506 . protease has 100 % identity to SEQ ID NO : 522 . In some embodiments , pep7 is T. reesei pep7. The amino Pep12 acid sequence encoded by T. reesei pep7 is set forth in SEQ Examples of suitable pep12 genes include, without limi ID NO : 186. In other embodiments , a protease of the present 65 tation , Trichoderma reesei pep12 EGR52517 (SEQ ID NO : disclosure has an amino acid sequence having 50 % or more 530 ) , Trichoderma virens pep12 EHK18859 (SEQ ID NO : identity ( e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 531) , Trichoderma atroviride pep2 EHK45753 (SEQ ID US 10,731,168 B2 21 22 NO : 532 ), Fusarium pseudograminearum pep12 EKJ73392 (SEQ ID NO : 80 ) , Metarhizium anisopliae (SEQ ID NO : ( SEQ ID NO : 533) , Gibberella zeae pep12 XP_388759 81) , A. nidulans gi67523821 (SEQ ID NO : 538 ) and (SEQ ID NO : 534 ) , and Metarhizium anisopliae pep12 homologs thereof. EFY95489 (SEQ ID NO : 535 ) , N. crassa XP_964574.1 Accordingly , in certain embodiments , a protease of the (SEQ ID NO : 536 ), M. thermophila XP_003659978.1 (SEQ 5 present disclosure, typically tspl protease , has an amino acid ID NO : 537 ) , and homologs thereof . sequence having 50 % or more identity { e.g. 60 % , 65 % , Accordingly, in certain embodiments , a protease of the 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , present disclosure, typically a pep12 protease , has an amino 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid acid sequence having 50 % or more identity { e.g. 60 % , 65 % , sequence selected from SEQ ID NOs: 66-81 , SEQ ID 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , 10 NO :538 . In some embodiments , the protease has 100 % 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid identity to an amino acid sequence selected from SEQ ID sequence selected from SEQ ID NOs : 530-537 . In some NOs : 66-81 , SEQ ID NO :538 . embodiments , the protease has 100 % identity to an amino In some embodiments , tsp1 is T. reesei tspl. The amino acid sequence selected from SEQ ID NOs : 530-537 . acid sequence encoded by T. reesei tspl is set forth in SEQ In some embodiments , pep8 is T. reesei pep12 . The amino 15 ID NO : 66. In other embodiments , a protease of the present acid sequence encoded by T. reesei pep12 is set forth in SEQ disclosure has an amino acid sequence having 50 % or more ID NO : 530. In other embodiments , a protease of the present identity ( e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , disclosure has an amino acid sequence having 50 % or more 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or identity ( e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , more ) to SEQ ID NO : 66. In further embodiments , the 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or 20 protease has 100 % identity to SEQ ID NO : 66 . more) to SEQ ID NO : 530. In further embodiments , the Subtilisin Proteases protease has 100 % identity to SEQ ID NO : 530 . Subtilisin proteases are enzymes with substrate specificity Trypsin -Like Serine Proteases similar to that of subtilisin . Subtilisin proteases use a serine Trypsin -like serine proteases are enzymes with substrate residue for hydrolysis of the peptide bonds in polypeptides specificity similar to that of trypsin . Trypsin -like serine 25 and proteins . Generally , subtilisin proteases are serine pro proteases use a serine residue for hydrolysis of the peptide teases that contain a catalytic triad of the three amino acids bonds in polypeptides and proteins . Typically , trypsin - like aspartate , histidine, and serine . The arrangement of these serine proteases cleave peptide bonds following a positively catalytic residues is shared with the prototypical subtilisin charged amino acid residue . Trypsin -like serine proteases from Bacillus licheniformis. Subtilisin proteases from from eukaryotic organisms such as Trichoderma fungi 30 eukaryotic organisms such as Trichoderma fungi include include trypsin 1 , trypsin 2 , and mesotrypsin . Such trypsin furin , MBTPS 1 , and TPP2 . Eukaryotic trypsin - like serine like serine proteases generally contain a catalytic triad of proteases further include an aspartic acid residue in the three amino acid residues ( such as histidine , aspartate , and oxyanion hole . serine ) that form a charge relay that serves to make the active Subtilisin Protease Slp7 Resembles Also Sedolisin Protease site serine nucleophilic . Eukaryotic trypsin -like serine pro- 35 Tppl . teases further include an “ oxyanion hole ” formed by the Seven subtilisin proteases have been identified in backbone amide hydrogen atoms of glycine and serine , Trichoderma fungal cells : slpl ( tre51365 ); slpl ( trel23244 ) ; which can assist in identification of the polypeptides as slp3 ( tre123234 ) ; slp5 ( tre64719 ), slp6 (trel21495 ), slp7 being trypsin - like serine proteases. ( tre123865 ) , and slp8 ( tre58698 ) . One trypsin - like serine protease has been identified in 40 Slp1 Trichoderma fungal cells : tspl ( tre73897) . As discussed Examples of suitable slp1 proteases include, without below , tsp1 has been demonstrated to have a significant limitation , Trichoderma reesei slp1 (SEQ ID NO : 82 ), impact on expression of recombinant polypeptides, such as Trichoderma atroviride jgilTriat2 (SEQ ID NO : 83 ) , immunoglobulins . Trichoderma atroviride jgilTriat2 (SEQ ID NO : 84 ) , As discussed below in Example 3 , serine proteases were 45 Trichoderma virens jgilTriviGv29_8_2 ( SEQ ID NO : 85 ) , purified from Trichoderma and shown to have multiple Hypocrea lixii gil145583581 (SEQ ID NO : 86 ), Metarhi protease activities that degrade mammalian proteins. Of zium acridum gil322694632 (SEQ ID NO : 87 ), Fusarium these activities, tspl was identified as a trypsin - like serine oxysporum gil342877080 (SEQ ID NO : 88 ) ,Gibberella zeae protease . The tspl protease gene was then deleted from gil46139915 (SEQ ID NO : 89 ) , Epichloe festucae Trichoderma fungal cells and it was demonstrated that 50 gill70674476 (SEQ ID NO : 90 ), Nectria haematococca deleting tspl achieved a significant reduction in total pro gi1302893164 (SEQ ID NO : 91 ) , Sordaria macrospore tease activity resulting in increased stabilization of mam gil336266150 ( SEQ ID NO : 92 ), Glomerella graminicola malian proteins produced by the cells . gil310797947 ( SEQ ID NO : 93 ), Neurospora tetrasperma Examples of suitable tspl proteases include , without gil336469805 (SEQ ID NO : 94 ), Neurospora crassa limitation, Trichoderma reesei tsp1 (SEQ ID NO : 66 ), 55 gil85086707 (SEQ ID NO : 95) , Magnaporthe oryzae Trichoderma atroviride jgilTriat21298187 ( SEQ ID NO : 67 ) , gill45608997 (SEQ ID NO : 96 ), Chaetomium globosum jgilTriviGv29_8_2 (SEQ ID NO : 68 ) , Hypocrea lixii gil116208730 (SEQ ID NO : 97 ), M. thermophila gil145583579 ( SEQ ID NO :69 ) , Hypocrea lixii gil63025000 gi367029081 (SEQ ID NO : 539) , and homologs thereof. (SEQ ID NO : 70 ) , Sclerotinia sclerotiorum gill56052735 Accordingly , in certain embodiments , a protease of the (SEQ ID NO : 71) , Botryotinia fuckeliana gil154314937 60 present disclosure, typically a slp1 protease , has an amino (SEQ ID NO : 72 ), Phaeosphaeria nodorum gill69605891 acid sequence having 50 % or more identity (e.g. 60 % , 65 % , (SEQ ID NO : 73 ), Leptosphaeria maculans gil312219044 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , (SEQ ID NO : 74 ) , Verticillim dahliae gi137992773 (SEQ ID 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid NO : 75) , Cochiobolus carbonum gil1072114 (SEQ ID NO : sequence selected from SEQ ID NOs: 82-97 , SEQ ID 76 ), Metarhizi macridum gil322695345 (SEQ ID NO : 77 ), 65 NO :539 . In some embodiments , the protease has 100 % Metarhizi manisopliae gil4768909 (SEQ ID NO : 78 ) , identity to an amino acid sequence selected from SEQ ID gil464963 (SEQ ID NO : 79 ) , Gibberella zeae gi146139299 NOs : 82-97 , SEQ ID NO :539 . US 10,731,168 B2 23 24 In some embodiments , slp1 is T. reesei slp1. The amino gil85084841 (SEQ ID NO : 179) , Fusarium oxysporum acid sequence encoded by T. reesei slp1 is set forth in SEQ gil56201265 ( SEQ ID NO : 180 ), Gibberella zeae ID NO : 82. In other embodiments , a protease of the present gil46114268 (SEQ ID NO : 181 ), M. thermophila disclosure has an amino acid sequence having 50 % or more gi367026259 (SEQ ID NO : 546 ) , A. nidulans gi67538776 identity (e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 5 (SEQ ID NO : 547 ) , A. oryzae gil69771349 (SEQ ID NO : 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or 222 ) , A. niger gi470729 (SEQ ID NO : 223 ), and homologs more ) to SEQ ID NO : 82. In further embodiments , the thereof. protease has 100 % identity to SEQ ID NO : 82 . Accordingly , in certain embodiments , a protease of the Slp2 present disclosure , typically a slp3 protease, has an amino Examples of suitable slp2 proteases include, without 10 acid sequence having 50 % or more identity (e.g. 60 % , 65 % , limitation , Trichoderma reesei slp2 (SEQ ID NO : 98 ) , T. 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , atroviride jgilTriat2 (SEQ ID NO : 99 ) , T. virens jgilTriv 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid iGv29_8_2 (SEQ ID NO : 100 ) , Hypocrea lixii gill15111226 sequence selected from SEQ ID NOs: 166-181, SEQ ID (SEQ ID NO : 101) , Aspergillus fumigatus gil70997972 NOs :546-547 , SEQ ID NOs: 222-223 . In some embodi (SEQ ID NO : 102 ) , Nectria haematococca gil302915240 15 ments , the protease has 100 % identity to an amino acid (SEQ ID NO : 103) , Gibberella zeae gil46105128 (SEQ ID sequence selected from SEQ ID NOs: 166-181 , SEQ ID NO : 104 ), Isaria farinose gil68165000 (SEQ ID NO : 105 ) , NOs : 546-547 , SEQ ID NOs: 222-223 . Glomerella graminicola gi1310797854 (SEQ ID NO : 106 ) , In some embodiments , slp3 is T. reesei slp3. The amino Epichloe festucae gill70674491 (SEQ ID NO : 107 ) , Metar acid sequence encoded by T. reesei slp3 is set forth in SEQ hizium acridum gil322697754 (SEQ ID NO : 108 ) , Acremo- 20 ID NO : 166. In other embodiments , a protease of the present nium sp . F11177 gil147225254 (SEQ ID NO : 109) , Ophios disclosure has an amino acid sequence having 50 % or more toma piliferum gill5808807 (SEQ ID NO : 110 ), Neurospora identity ( e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , tetrasperma gil336463649 (SEQ ID NO : 111) , Chaetomium 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or thermophilum gil340992600 (SEQ ID NO : 112 ) , Metarhi more ) to SEQ ID NO : 166. In further embodiments , the zium flavoviride gil254351265 (SEQ ID NO : 113 ) , 25 protease has 100 % identity to SEQ ID NO : 166 . Podospora anserine gil171680111 ( SEQ ID NO : 114 ) , Mag Slp5 naporthe oryzae gi139943180 (SEQ ID NO : 115 ) , Sclero Examples of suitable slp5 proteases include, without tinia sclerotiorum gill56058540 (SEQ ID NO : 116 ), Tala limitation , Trichoderma reesei slp5 (SEQ ID NO : 200 ), T. romyces stipitatus gil242790441 (SEQ ID NO : 117 ) , M. atroviride jgilTriat2 (SEQ ID NO : 201 ) , T. virens jgilTriv thermophila gi367021472 (SEQ ID NO : 540 ), A. niger 30 iGv29_8_2 (SEQ ID NO : 202) , Hypocrea lixii gil118161442 gil45237646 (SEQ ID NO : 541) , A. oryzae gil69780712 (SEQ ID NO : 203 ) , Fusarium oxysporum gil342883549 (SEQ ID NO : 542 ) , P. chrysogenum gi255955889 (SEQ ID (SEQ ID NO : 204 ) , Gibberella zeae gi146135733 (SEQ ID NO : 543 ), A. nidulans gi259489544 (SEQ ID NO : 544 ) , N. NO : 205 ) , Glomerella graminicola gil310796396 (SEQ ID crassa gi85084841 (SEQ ID NO : 545 ), and homologs NO : 206 ), Nectria haematococca gil302927954 (SEQ ID thereof. 35 NO : 207) , Cordyceps militaris gil346319783 (SEQ ID NO : Accordingly , in certain embodiments , a protease of the 208 ), Neurospora crassa gil85094084 ( SEQ ID NO : 209) , present disclosure, typically a slp2 protease , has an amino Neurospora tetrasperma gi1336467281 (SEQ ID NO : 210 ), acid sequence having 50 % or more identity ( e.g. 60 % , 65 % , Verticillium dahliae gil346971706 (SEQ ID NO : 211) , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , Thielavia terrestris gil347001418 (SEQ ID NO : 212 ) , Mag 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid 40 naporthe oryzae gil 145605493 (SEQ ID NO : 213 ) , M. sequence selected from SEQ ID NOs: 98-117 , SEQ ID thermophila gi367032200 (SEQ ID NO : 548 ) , P. chrysoge NOs : 540-545 . In some embodiments , the protease has 100 % num gi62816282 (SEQ ID NO : 549 ) , and homologs thereof. identity to an amino acid sequence selected from SEQ ID Accordingly, in certain embodiments , a protease of the NOs: 98-117 , SEQ ID NOs: 540-545 . present disclosure , typically a slp5 protease, has an amino In some embodiments , slp2 is T. reesei slp2 . The amino 45 acid sequence having 50 % or more identity ( e.g. 60 % , 65 % , acid sequence encoded by T. reesei slp2 is set forth in SEQ 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , ID NO : 98. In other embodiments , a protease of the present 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid disclosure has an amino acid sequence having 50 % ormore sequence selected from SEQ ID NOs: 200-213, SEQ ID identity {e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , NOs: 548-549 . In some embodiments , the protease has 100 % 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or 50 identity to an amino acid sequence selected from SEQ ID more ) to SEQ ID NO : 98. In further embodiments , the NOS: 200-213 , SEQ ID NOs: 548-549 . protease has 100 % identity to SEQ ID NO : 98 . In some embodiments , slp5 is T. reesei slp5 . The amino Slp3 acid sequence encoded by T. reesei slp5 is set forth in SEQ Examples of suitable slp3 proteases include, without ID NO : 200. In other embodiments , a protease of the present limitation , Trichoderma reesei slp2 (SEQ ID NO : 166 ), T. 55 disclosure has an amino acid sequence having 50 % or more atroviride jgilTriat2 (SEQ ID NO : 167) , T. virens jgilTriv identity (e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , iGv29_8_2 (SEQ ID NO : 168 ), Hypocrea koningii 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or gill24295071 (SEQ ID NO : 169 ), Purpureocillium lilacinum more ) to SEQ ID NO : 200. In further embodiments, the gil130750164 (SEQ ID NO : 170 ), Metarhizium anisopliae protease has 100 % identity to SEQ ID NO : 200 . gil16215677 (SEQ ID NO : 171 ) , Hirsutella rhossiliensis 60 Slp6 gil90655148 (SEQ ID NO : 172 ), Tolypocladium inflation Examples of suitable slpó proteases include, without gil18542429 (SEQ ID NO : 173) , Metacordyceps chlamy limitation , Trichoderma reesei slp6 (SEQ ID NO : 214 ), T dosporia gil19171215 ( SEQ ID NO : 174 ) , Cordyceps mili atroviride jgilTriat2 (SEQ ID NO : 215 ) , T. virens jgilTriv taris gi1346321368 (SEQ ID NO : 175 ) , Fusarium sp . iGv29_8_2 ( SEQ ID NO : 216 ) , Hypocrea virens gil628051 (SEQ ID NO : 176 ), Neurospora tetrasperma 65 gil29421423 (SEQ ID NO : 217 ), Hypocrea lixii gil gil336471881 (SEQ ID NO : 177 ), Chaetomium globosum 145583127 (SEQ ID NO : 218 ) , Trichoderma hamatum gill 16197403 (SEQ ID NO : 178 ), Neurospora crassa gil30144643 (SEQ ID NO : 219 ) , Aspergillus fumigatus US 10,731,168 B2 25 26 gil2295 ( SEQ ID NO : 220 ), Aspergillus terreus atroviride jgilTriat2H98568 ( SEQ ID NO : 241) , T. virens gil115391147 (SEQ ID NO : 221) , Aspergillus oryzae jgil TriviGv29_8_2133902 ( SEQ ID NO : 242) , and homologs gil169771349 (SEQ ID NO : 222 ), Aspergillus niger thereof. gil470729 (SEQ ID NO : 223 ) , Glomerella graminicola Accordingly , in certain embodiments , a protease of the gi1310794714 (SEQ ID NO : 224 ) , Gibberella zeae 5 present disclosure has an amino acid sequence having 50 % gil46114946 (SEQ ID NO : 225 ) , Fusarium oxysporum or more identity { e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , gi1342873942 (SEQ ID NO : 226 ) , Nectria haematococca 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid sequence selected from gil302884541 (SEQ ID NO : 227 ), Neosartorya fischeri SEQ ID NOs: 240-242 . In some embodiments , the protease gil119500190 (SEQ ID NO : 228 ), Verticillium alboatrum 10 has 100 % identity to an amino acid sequence selected from gil302413161 ( SEQ ID NO : 229 ), Glomerella graminicola SEQ ID NOs : 240-242 . gil310790144 ( SEQ ID NO : 230 ), N. crassa gi85090020 In some embodiments , slp8 is T. reesei slp8. The amino (SEQ ID NO : 550 ) , and homologs thereof. acid sequence encoded by T. reesei slp8 is set forth in SEQ Accordingly , in certain embodiments , a protease of the ID NO : 240. In other embodiments , a protease of the present present disclosure , typically a slp6 protease , has an amino 15 disclosure has an amino acid sequence having 50 % or more acid sequence having 50 % or more identity ( e.g. 60 % , 65 % , identity ( e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid more ) to SEQ ID NO : 240. In further embodiments , the sequence selected from SEQ ID NOs: 214-230 , SEQ ID protease has 100 % identity to SEQ ID NO : 240 . NO :550 . In some embodiments , the protease has 100 % 20 Glutamic Proteases identity to an amino acid sequence selected from SEQ ID Glutamic proteases are enzymes that hydrolyze the pep NOs: 214-230 , SEQ ID NO :550 . tide bonds in polypeptides and proteins. Glutamic proteases In some embodiments , slp6 is T. reesei slp6 . The amino are insensitive to pepstatin A , and so are sometimes referred acid sequence encoded by T. reesei slp6 is set forth in SEQ to as pepstatin insensitive acid proteases. While glutamic ID NO : 214. In other embodiments , a protease of the present 25 proteases were previously grouped with the aspartic pro disclosure has an amino acid sequence having 50 % or more teases and often jointly referred to as acid proteases , it has identity ( e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , been recently found that glutamic proteases have very 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or different active site residues than aspartic proteases . more ) to SEQ ID NO : 214. In further embodiments , the Two glutamic proteases have been identified in protease has 100 % identity to SEQ ID NO : 214 . 30 Trichoderma fungal cells: gap1 (tre69555 ) and gap2 ( trel06661) . Slp7 Gap1 Examples of suitable slp7 proteases include , without Examples of suitable gapl proteases include, without limitation , Trichoderma reesei slp7 (SEQ ID NO : 231) , T. limitation , Trichoderma reesei gap1 (SEQ ID NO : 118 ), T atroviride jgilTriat2 (SEQ ID NO : 232) , T. virens jgilTriv 35 atroviride jgilTriat2140863 (SEQ ID NO : 119 ), T. virens iGv29_8_2 (SEQ ID NO : 233) , Metarhizium anisopliae jgilTriviGv29_8_21 192684 (SEQ ID NO : 120 ), Aspergillus gil322710320 (SEQ ID NO : 234 ), Nectria haematococca flavus gil238499183 (SEQ ID NO : 121) , Aspergillus niger gil302915000 (SEQ ID NO : 235 ) , Myceliophthora thermo gil145251555 (SEQ ID NO : 122 ) , Aspergillus terreus phila gil347009020 , gi367024935 (SEQ ID NO : 236 ) , Gib gill15491521 (SEQ ID NO : 123 ), gil37154543 ( SEQ ID berella zeae gil46137655 (SEQ ID NO : 237) , Thielavia 40 NO : 124 ) , gil48425531 (SEQ ID NO : 125) , gil351873 (SEQ terrestris gil346996549 ( SEQ ID NO : 238 ), Magnaporthe ID NO : 126 ), Thielavia terrestris gil346997245 (SEQ ID oryzae gil145610733 (SEQ ID NO : 239) , A. nidulans NO : 127 ), Penicillium chrysogenum gil255940586 (SEQ ID gi67541991 (SEQ ID NO : 551 ) , P. chrysogenum NO : 128 ) , M. thermophila gi367026504 ( SEQ ID NO : 574 ) , gi255933786 (SEQ ID NO : 552) , A. niger gi317036543 A. oryzae gi317150886 (SEQ ID NO : 575) , N. crassa (SEQ ID NO : 553 ) , A. oryzae gil69782882 (SEQ ID NO : 45 gi85097968 (SEQ ID NO : 576 ), A. niger gil31056 (SEQ ID 554 ), N. crassa gi85109979 (SEQ ID NO : 555 ) , and NO : 577 ) , P. chrysogenum gi255930123 ( SEQ ID NO : 578 ), homologs thereof. A. niger gil45236956 (SEQ ID NO : 579) , A. oryzae Accordingly , in certain embodiments , a protease of the gil69772955 ( SEQ ID NO : 580 ), A. niger gil45249222 (SEQ present disclosure , typically a slp7 protease , has an amino ID NO : 581 ), A. nidulans gi67525839 (SEQ ID NO : 582 ) , acid sequence having 50 % or more identity { e.g. 60 % , 65 % , 50 A. oryzae gil69785367 (SEQ ID NO : 583 ), P. chrysogenum 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , gi255955319 (SEQ ID NO : 584 ) , M. thermophila 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid gi367019352 (SEQ ID NO : 585 ), A. oryzae gi391863974 sequence selected from SEQ ID NOs: 231-239 , SEQ ID (SEQ ID NO : 586 ) , M. thermophila gi367024513 (SEQ ID NOs: 551-555 . In some embodiments , the protease has 100 % NO : 587 ) , and homologs thereof. identity to an amino acid sequence selected from SEQ ID 55 Accordingly , in certain embodiments , a protease of the NOs: 231-239, SEQ ID NOs: 551-555 . present disclosure , typically a gap1 protease , has an amino In some embodiments , slp7 is T. reesei slp7 . The amino acid sequence having 50 % or more identity { e.g. 60 % , 65 % , acid sequence encoded by T. reesei slp7 is set forth in SEQ 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , ID NO : 231. In other embodiments , a protease of the present 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid disclosure has an amino acid sequence having 50 % or more 60 sequence selected from SEQ ID NOs: 118-128 , SEQ ID identity ( e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , NOs: 574-587 . In some embodiments , the protease has 100 % 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or identity to an amino acid sequence selected from SEQ ID more ) to SEQ ID NO : 231. In further embodiments, the NOs: 118-128 , SEQ ID NOs: 574-587 . protease has 100 % identity to SEQ ID NO : 231 . In some embodiments , gapl is T. reesei gap1 . The amino Slp8 65 acid sequence encoded by T. reesei gapl is set forth in SEQ Examples of suitable slp8 proteases include , without ID NO : 118. In other embodiments , a protease of the present limitation , Trichoderma reesei slp8 (SEQ ID NO : 240 ), T. disclosure has an amino acid sequence having 50 % or more US 10,731,168 B2 27 28 identity ( e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , gil320592937 (SEQ ID NO : 163 ), Verticillium alboatrum 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or gil302406186 (SER ID NO : 164 ), Verticillium dahliae more ) to SEQ ID NO : 118. In further embodiments , the gil346971444 (SEQ ID NO : 165 ) , A. fumigatus protease has 100 % identity to SEQ ID NO : 118 . CAE51075.1 ( SEQ ID NO : 556 ), A. oryzae Gap2 5 XP_001820835.1 (SEQ ID NO : 557 ) , P. chrysogenum Examples of suitable gap2 proteases include, without XP_002564029.1 (SEQ ID NO : 558 ) , A. nidulans limitation , Trichoderma reesei gap2 (SEQ ID NO : 129 ), T atroviride jgilTriat21298116 (SEQ ID NO : 130 ), T. virens XP_664805.1 (SEQ ID NO : 559 ), P. chrysogenum jgilTriviGv29_8_2130331 ( SEQ ID NO : 131 ) , XP_002565814.1 (SEQ ID NO : 560 ), M. thermophila jgilTriviGv29_8_21225131 (SEQ ID NO : 132 ), Aspergillus 10 XP_003663689.1 (SEQ ID NO : 561 ), N. crassa flavus gil238499183 (SEQ ID NO : 133) , Aspergillus niger XP_958412.1 (SEQ ID NO : 562 ) , A. niger XP_001394118.1 gil145251555 (SEQ ID NO : 134 ) , Aspergillus nidulans (SEQ ID NO : 563 ), A. fumigatus CAE17674.1 (SEQ ID NO : gil67901056 ( SEQ ID NO : 135 ) , Aspergillus clavatus 564 ) , A. niger XP_001400873.1 (SEQ ID NO : 565 ) , A. gill21711990 (SEQ ID NO : 136 ) , Aspergillus fumigatus fumigatus CAE46473.1 (SEQ ID NO : 566 ), A. oryzae gil70986250 (SEQ ID NO : 137 ) , Penicillium marneffei 15 XP_002373530.1 (SEQ ID NO : 567 ) , A. nidulans gil212534108 (SEQ ID NO : 138 ) , Talaromyces stipitatus XP_660624.1 (SEQ ID NO : 568) , P. chrysogenum gil242789335 (SEQ ID NO : 139 ), Grosmannia clavigera XP_002562943.1 (SEQ ID NO : 569 ) , A. fumigatus gil320591529 (SEQ ID NO : 140 ), Neosartorya fischeri CAE17675.1 ( SEQ ID NO : 570 ), A. fumigatus EAL86850.2 gil119474281 (SEQ ID NO : 141) , Penicillium marneffei (SEQ ID NO : 571 ) , N. crassa XP_961957.1 (SEQ ID NO : gil212527274 ( SEQ ID NO : 142) , Penicillium chrysogenum 20 572) , A. oryzae BAB97387.1 (SEQ ID NO : 573) , and gil255940586 (SEQ ID NO : 143 ) , gil131056 (SEQ ID NO : homologs thereof. 144) , M. thermophila gi367030275 (SEQ ID NO : 588) , and Accordingly, in certain embodiments , a protease of the homologs thereof. present disclosure , typically a tpp1 protease , has an amino Accordingly , in certain embodiments , a protease of the acid sequence having 50 % or more identity { e.g. 60 % , 65 % , present disclosure , typically a gap2 protease , has an amino 25 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , acid sequence having 50 % or more identity { e.g. 60 % , 65 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , 92 % , 93 % , 94 % , 95 % , sequence selected from SEQ ID NOs: 145-165 , SEQ ID 96 % , 97 % , 98 % , 99 % , 99.5 % or more to an amino acid NOs: 556-573 . In some embodiments , the protease has 100 % sequence selected from SEQ ID NOs: 129-144 , SEQ ID identity to an amino acid sequence selected from SEQ ID NO :588 . In some embodiments , the protease has 100 % 30 NOs : 145-165 , SEQ ID NOs: 556-573 . identity to an amino acid sequence selected from SEQ ID In some embodiments , tpp1 is T. reesei tpp1. The amino NOs : 129-144 , SEQ ID NO : 588 . acid sequence encoded by T. reesei tppl is set forth in SEQ In some embodiments , gap2 is T. reesei gap2. The amino ID NO : 145. In other embodiments , a protease of the present acid sequence encoded by T. reesei gap2 is set forth in SEQ disclosure has an amino acid sequence having 50 % or more ID NO : 129. In other embodiments , a protease of the present 35 identity { e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , disclosure has an amino acid sequence having 50 % ormore 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or identity ( e.g. 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 91 % , more ) to SEQ ID NO : 145. In further embodiments , the 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99.5 % or protease has 100 % identity to SEQ ID NO : 145 . more ) to SEQ ID NO : 129. In further embodiments , the Homologous Proteases protease has 100 % identity to SEQ ID NO : 129 . 40 Other embodiments of the present disclosure relate to Sedolisin Proteases reducing the activity of proteases that are homologous to the Sedolisin proteases are enzymes that use a serine residue proteases of the present disclosure . “ Homology ” as used for hydrolysis of the peptide bonds in polypeptides and herein refers to sequence similarity between a reference proteins. Sedolisin proteases generally contain a unique sequence and at least a fragment of a second sequence . catalytic triad of serine , glutamate , and aspartate . Sedolisin 45 Homologs may be identified by any method known in the proteases also contain an aspartate residue in the oxyanion art, preferably , by using the BLAST tool to compare a hole . Sedolisin proteases from eukaryotic organisms such as reference sequence to a single second sequence or fragment Trichoderma fungi include tripeptidyl peptidase . of a sequence or to a database of sequences. As described Examples of suitable tpp1 proteases include, without below , BLAST will compare sequences based upon percent limitation , Trichoderma reesei tppl (SEQ ID NO : 145) , T. 50 identity and similarity . atroviride jgilTriat2H88756 (SEQ ID NO : 146 ) , T. virens The terms “ identical ” or percent “ identity ,” in the context jgilTriviGv29_8_21217176 (SEQ ID NO : 147 ) , Aspergillus of two or more nucleic acid or amino acid sequences, refers fumigatus gil70993168 (SEQ ID NO : 148 ) , Aspergillus to two ormore sequences or subsequences that are the same. oryzae gil169776800 (SEQ ID NO : 149 ), Aspergillus niger Two sequences are “ substantially identical” if two sequences gil145236399 (SEQ ID NO : 150 ), Aspergillus clavatus 55 have a specified percentage of amino acid residues or gil121708799 (SEQ ID NO : 151) , Aspergillus niger nucleotides that are the same ( i.e. , 29 % identity , optionally gil145239871 ( SEQ ID NO : 152 ) , Aspergillus clavatus 30 % , 40 % , 45 % , 50 % , 55 % , 60 % , 65 % , 70 % , 75 % , 80 % , gil121714541 (SEQ ID NO : 153 ), Aspergillus terreus gill 85 % , 90 % , 95 % , 99 % or 100 % identity over a specified 15387645 (SEQ ID NO : 154 ), Aspergillus fumigatus region , or, when not specified , over the entire sequence ), gil70982015 (SEQ ID NO : 155) , Sclerotinia sclerotiorum 60 when compared and aligned for maximum correspondence gill56045898 (SEQ ID NO : 156 ), Botryotinia juckeliana over a comparison window , or designated region as mea gil154321758 (SEQ ID NO : 157 ), Neosartorya fischeri sured using one of the following sequence comparison gil119499774 (SEQ ID NO : 158 ), Talaromyces stipitatus algorithms or by manual alignment and visual inspection . gil242798348 (SEQ ID NO : 159 ), Penicillium marneffei Optionally , the identity exists over a region that is at least gil212541546 (SEQ ID NO : 160 ) , Gibberella zeae 65 about 50 nucleotides (or 10 amino acids) in length , or more gil46114460 (SEQ ID NO : 161) , Fusarium oxysporum preferably over a region that is 100 to 500 or 1000 or more gil342890694 ( SEQ ID NO : 162) , Grosmannia clavigera nucleotides ( or 20 , 50 , 200 , or more amino acids ) in length . US 10,731,168 B2 29 30 For sequence comparison , typically one sequence acts as and speed of the alignment . The BLASTN program ( for a reference sequence, to which test sequences are compared . nucleotide sequences ) uses as defaults a wordlength (W ) of When using a sequence comparison algorithm , test and 11, an expectation ( E ) or 10 , M = 5 , N = -4 , and a comparison reference sequences are entered into a computer, subse of both strands. For amino acid sequences , the BLASTP quence coordinates are designated , if necessary , and 5 program uses as defaults a wordlength of 3 , and expectation sequence algorithm program parameters are designated . ( E ) of 10 , and the BLOSUM62 scoring matrix ( see Henikoff Default program parameters can be used , or alternative and Henikoff, ( 1992 ) Proc Natl Acad Sci USA 89 ( 22 ) : parameters can be designated . The sequence comparison 10915-10919 ] alignments ( B ) of 50 , expectation ( E ) of 10 , algorithm then calculates the percent sequence identities for M = 5 , N = -4 , and a comparison of both strands. the test sequences relative to the reference sequence, based 10 The BLAST algorithm also performs a statistical analysis on the program parameters . When comparing two sequences of the similarity between two sequences (see , e.g. , Karlin for identity , it is not necessary that the sequences be con and Altschul, ( 1993 ) Proc Natl Acad Sci USA 90 ( 12 ) : 5873 tiguous , but any gap would carry with it a penalty that would 5877 ). One measure of similarity provided by the BLAST reduceparameters the overallare Gap percent opening identity penalty . For = 5 andblastn Gap , the extension default 15 algorithm is the smallest sum probability (P (N )) , which penalty = 2 . For blastp , the default parameters are Gap open provides an indication of the probability by which a match ing penalty = 11 and Gap extension penalty = 1. between two nucleotide or amino acid sequences would A “ comparison window ," as used herein , includes refer occur by chance. For example , a nucleic acid is considered ence to a segment of any one of the number of contiguous similar to a reference sequence if the smallest sum prob positions including , but not limited to from 20 to 600 , 20 ability in a comparison of the test nucleic acid to the usually about 50 to about 200 , more usually about 100 to reference nucleic acid is less than about 0.2 ,more preferably about 150 in which a sequence may be compared to a less than about 0.01 , and most preferably less than about reference sequence of the same number of contiguous posi 0.001 . tions after the two sequences are optimally aligned .Methods Other than percentage of sequence identity noted above, of alignment of sequences for comparison are well known in 25 another indication that two nucleic acid sequences or poly the art. Optimal alignment of sequences for comparison can peptides are substantially identical is that the polypeptide be conducted , e.g. , by the local homology algorithm of encoded by the first nucleic acid is immunologically cross Smith and Waterman (1981 ), by the homology alignment reactive with the antibodies raised against the polypeptide algorithm of Needleman and Wunsch (1970 ) J Mol Biol encoded by the second nucleic acid , as described below . 48 (3 ): 443-453 , by the search for similarity method of Pear- 30 Thus, a polypeptide is typically substantially identical to a son and Lipman ( 1988 ) Proc Natl Acad Sci USA 85 (8 ): second polypeptide, for example , where the two peptides 2444-2448, by computerized implementations of these algo differ only by conservative substitutions. Another indication rithms (GAP , BESTFIT, FASTA , and TFASTA in the that tw nucleic acid sequences are substantially identical is Wisconsin Genetics Software Package, Genetics Computer that the two molecules or their complements hybridize to Group , 575 Science Dr. , Madison , Wis . ) , or by manual 35 each other under stringent conditions, as described below . alignment and visual inspection ( see , e.g., Brent et al ., Yet another indication that two nucleic acid sequences are ( 2003) Current Protocols in Molecular Biology , John Wiley substantially identical is that the same primers can be used & Sons, Inc. ( Ringbou Ed ) ] . to amplify the sequence . Two examples of algorithms that are suitable for deter As disclosed herein , proteases of the present disclosure mining percent sequence identity and sequence similarity 40 may also include proteases that are conservatively modified are the BLAST and BLAST 2.0 algorithms, which are variants of proteases encoded by the protease genes dis described in Altschul et al . ( 1997 ) Nucleic Acids Res 25 (17 ): closed above . “ Conservatively modified variants ” as used 3389-3402 and Altschul et al. ( 1990 ) J. Mol Biol 215 ( 3 ) herein include individual substitutions, deletions or addi 403-410 , respectively . Software for performing BLAST tions to an encoded amino acid sequence which result in the analyses is publicly available through the National Center 45 substitution of an amino acid with a chemically similar for Biotechnology Information . This algorithm involves first amino acid . Conservative substitution tables providing func identifying high scoring sequence pairs (HSPs ) by identify tionally similar amino acids are well known in the art. Such ing short words of length W in the query sequence , which conservatively modified variants are in addition to and do either match or satisfy some positive -valued threshold score not exclude polymorphic variants , interspecies homologs, T when aligned with a word of the same length in a database 50 and alleles of the disclosure . The following eight groups sequence . T is referred to as the neighborhood word score contain amino acids that are conservative substitutions for threshold (Altschul et al. , supra) . These initial neighborhood one another : 1 ) Alanine ( A ) , Glycine ( G ) ; 2 ) Aspartic acid word hits act as seeds for initiating searches to find longer (D ), Glutamic acid ( E ); 3 ) Asparagine (N ), Glutamine ( Q ); HSPs containing them . The word hits are extended in both 4 ) Arginine (R ), Lysine (K ) ; 5 ) Isoleucine ( I) , Leucine ( L ), directions along each sequence for as far as the cumulative 55 Methionine ( M ) , Valine ( V ) ; 6 ) Phenylalanine ( F ) , Tyrosine alignment score can be increased . Cumulative scores are ( Y ), Tryptophan (W ); 7 ) Serine (S ) , Threonine ( T) ; and 8 ) calculated using , for nucleotide sequences, the parameters M Cysteine ( C ) , Methionine ( M ) (see , e.g., Creighton , Proteins (reward score for a pair of matching residues ; always > 0 ) ( 1984 ) ) . and N (penalty score for mismatching residues ; always <0 ). FIGS. 45-48 depicts phylogenetic trees of aspartic , sub For amino acid sequences, a scoring matrix is used to 60 tilisin , glutamic and sedolisin proteases of selected filamen calculate the cumulative score . Extension of the word hits in tous fungi. each direction are halted when : the cumulative alignment Methods of Reducing the Activity of Proteases of the score falls off by the quantity X from its maximum achieved Invention value ; the cumulative score goes to zero or below , due to the Further aspects of the present disclosure relate to reducing accumulation of one or more negative -scoring residue align- 65 the activity of proteases found in filamentous fungal cells ments ; or the end of either sequence is reached. The BLAST that express a heterologous polypeptide , such a mammalian algorithm parameters W , T , and X determine the sensitivity polypeptide . US 10,731,168 B2 31 32 The activity of proteases found in filamentous fungal cells homologous to the gene that will create a duplication of the can be reduced by any method known to those of skill in the region ofhomology and incorporate construct DNA between art . the duplicated regions . Such a gene disruption can eliminate In some embodiments reduced activity of proteases is gene expression if the inserted construct separates the pro achieved by reducing the expression of the protease , for 5 moter of the gene from the coding region or interrupts the example , by promoter modification or RNAi. coding sequence such that a nonfunctional gene product In other embodiments , reduced activity of proteases is results . A disrupting construct may be simply a selectable achieved by modifying the gene encoding the protease . marker gene accompanied by 5' and 3 ' regions homologous Examples of such modifications include, without limitation , to the gene . The selectable marker enables identification of a knock -out mutation, a truncation mutation , a point muta- 10 transformants containing the disrupted gene . tion , a missense mutation , a substitution mutation , a frame Protease encoding genes of the present disclosure that are shift mutation , an insertion mutation , a duplication mutation , present in filamentous fungal cells that express a recombi an amplification mutation, a translocation mutation , or an nant polypeptide may also be modified by the process of inversion mutation , and that results in a reduction in the gene conversion ( see, for example, Iglesias and Trautner, corresponding protease activity . Methods of generating at 15 1983, Molecular General Genetics 189: 5 73-76 ). For least onemutation in a protease encoding gene of interest are example , in the gene conversion a nucleotide sequence well known in the art and include , without limitation , corresponding to the gene is mutagenized in vitro to produce random mutagenesis and screening , site - directed mutagen a defective nucleotide sequence , which is then transformed esis , PCR mutagenesis , insertional mutagenesis , chemical into a Trichoderma strain to produce a defective gene . By mutagenesis , and irradiation . 20 homologous recombination , the defective nucleotide In certain embodiments , a portion of the protease encod sequence replaces the endogenous gene. It may be desirable ing gene is modified , such as the region encoding the that the defective nucleotide sequence also contains a catalytic domain , the coding region , or a control sequence marker for selection of transformants containing the defec required for expression of the coding region . Such a control tive gene . sequence of the gene may be a promoter sequence or a 25 Protease encoding genes of the present disclosure that are functional part thereof, i.e., a part that is sufficient for present in filamentous fungal cells that express a recombi affecting expression of the gene . For example , a promoter nant polypeptide may also be modified by established anti sequence may be inactivated resulting in no expression or a sense techniques using a nucleotide sequence complemen weaker promoter may be substituted for the native promoter tary to the nucleotide sequence of the gene ( see , for example , sequence to reduce expression ofthe coding sequence . Other 30 Parish and Stoker , 1997, FEMS Microbiology Letters 154 : control sequences for possible modification include , without 151-157 ) . In particular , expression of the gene by filamen limitation , a leader sequence , a propeptide sequence , a signal tous fungal cells may be reduced or inactivated by intro sequence , a transcription ter nator, and a transcriptional ducing a nucleotide sequence complementary to the nucleo activator . tide sequence of the gene , which may be transcribed in the Protease encoding genes of the present disclosure that are 35 strain and is capable of hybridizing to the mRNA produced present in filamentous fungal cells that express a recombi in the cells . Under conditions allowing the complementary nant polypeptide may also be modified by utilizing gene anti- sense nucleotide sequence to hybridize to the mRNA , deletion techniques to eliminate or reduce expression of the the amount of protein translated is thus reduced or elimi gene . Gene deletion techniques enable the partial or com nated . plete removal of the gene thereby eliminating their expres- 40 In addition , protease encoding genes of the present dis sion . In such methods, deletion of the gene may be accom closure that are present in filamentous fungal cells that plished by homologous recombination using a plasmid that express a recombinant polypeptide may also be modified by has been constructed to contiguously contain the 5' and 3' established RNA interference (RNAi ) techniques ( see, for regions flanking the gene . example , WO 2005/056772 and WO 2008/080017 ). The protease encoding genes of the present disclosure that 45 Protease encoding genes of the present disclosure that are are present in filamentous fungal cells that express a recom present in filamentous fungal cells that express a recombi binant polypeptide may also be modified by introducing , nant polypeptide may also be modified by random or spe substituting , and /or removing one ormore nucleotides in the cific mutagenesis using methods well known in the art , gene, or a control sequence thereof required for the tran including without limitation , chemical mutagenesis ( see, for scription or translation of the gene . For example , nucleotides 50 example , Hopwood , The Isolation of Mutants in Methods in may be inserted or removed for the introduction of a stop Microbiology ( J. R. Norris and D. W. Ribbons , eds. ) pp . codon , the removal of the start codon , or a frame- shift of the 363-433 , Academic Press , New York , 25 1970 ) . Modifica open reading frame. Such a modification may be accom tion of the genemay be performed by subjecting filamentous plished by methods known in the art , including without fungal cells to mutagenesis and screening for mutant cells in limitation , site -directed mutagenesis and per generated 55 which expression of the gene has been reduced or inacti mutagenesis (see , for example , Botstein and Shortie , 1985 , vated . The mutagenesis , which may be specific or random , Science 229 : 4719 ; Lo et al. , 1985, Proceedings of the may be performed , for example , by use of a suitable physical National Academy of Sciences USA 81 : 2285 ; Higuchi et or chemical mutagenizing agent, use of a suitable oligo al. , 1988 , Nucleic Acids Research 16 : 7351 ; Shimada, 1996 , nucleotide , subjecting the DNA sequence to peR generated Meth . Mol. Bioi. 57: 157 ; Ho et al ., 1989, Gene 77: 61 ; 60 mutagenesis , or any combination thereof. Examples of Horton et al. , 1989 , Gene 77 : 61 ; and Sarkar and Sommer, physical and chemical mutagenizing agents include, without 1990 , Bio Techniques 8 : 404 ). limitation , ultraviolet (UV ) irradiation , hydroxylamine , Additionally , protease encoding genes of the present N -methyl - N -nitro - N -nitrosoguanidine (MNNG ) , N -methyl disclosure that are present in filamentous fungal cells that N '- nitrosogaunidine (NTG ) O - methyl hydroxylamine , express a recombinant polypeptide may be modified by gene 65 nitrous acid , ethylmethane sulphonate ( EMS) , sodium bisul disruption techniques by inserting into the gene a disruptive phite , formic acid , and nucleotide analogues . When such nucleic acid construct containing a nucleic acid fragment agents are used , the mutagenesis is typically performed by US 10,731,168 B2 33 34 incubating the Trichoderma cells to be mutagenized in the interferons , cytokines , interleukins, immunodilators , neu presence of the mutagenizing agent of choice under suitable rotransmitters , receptors , reporter proteins, structural pro conditions, and then selecting for mutants exhibiting teins, and transcription factors . reduced or no expression of the gene. Specific examples of suitable mammalian polypeptides In certain embodiments , the at least one mutation or 5 include , without limitation , immunoglobulins, immuno modification in a protease encoding gene of the present globulin heavy chains, immunoglobulin light chains ,mono disclosure results in a modified protease that has no detect clonal antibodies, hybrid antibodies, F (ab ') 2 antibody frag able protease activity . In other embodiments , the at least one ments, F ( ab ) antibody fragments , Fv molecules , single -chain modification in a protease encoding gene of the present Fv antibodies, dimeric antibody fragments , trimeric anti disclosure results in a modified protease that has at least 25 % 10 body fragments , functional antibody fragments , immunoad less, at least 50 % less , at least 75 % less, at least 90 % , at least hesins, insulin - like growth factor 1 , growth hormone , insu 95 % , at least 100 % , at least 200 % , at least 300 % , at least lin , interferon alpha 2b , fibroblast growth factor 21 , human 400 % , at least 500 % , at least 600 % , at least 700 % , at least serum albumin , camelid antibodies and / or antibody frag 800 % , at least 900 % , at least 1,000 % , or a higher percentage ments, single domain antibodies , multimeric single domain less protease activity compared to a corresponding non- 15 antibodies , and erythropoietin . modified protease . Other examples of suitable mammalian proteins include , In certain embodiments , for example , in a Trichoderma without limitation , an oxidoreductase , a transferase , a hydro cell, the at least one mutation or modification in a protease lase , a lyase, an isomerase , a ligase , an aminopeptidase , an encoding gene of the present disclosure results in a reduction amylase , a carbohydrase , a carboxypeptidase , a catalase , a of total protease activity to 49 % or less , typically with a 20 glycosyltransferase , a deoxyribonuclease , an esterase, a mutation in at least 2 distinct protease genes, or 31 % or less , galactosidase , a betagalactosidase, a glucosidase , a glu typically with a mutation in at least 3 distinct protease genes , curonidase , a glucuronoyl esterase , a haloperoxidase , an or 13 % or less, typically with a mutation in at least 4 distinct invertase , a lipase , an oxidase , a phospholipase , a proteolytic protease genes, or 10 % or less, typically with a mutation in enzyme, a ribonuclease , a urokinase , an albumin , a collagen , at least 5 distinct protease genes, or 6.3 % or less , typically 25 a tropoelastin , and an elastin . with a mutation in at least 6 distinct protease genes, or 5.5 % Non -Mammalian Polypeptides or less, typically with a mutation in at least 7 distinct Non -mammalian polypeptides of the present disclosure protease genes , of the total protease activity of the corre may be any non - mammalian polypeptide having a biological sponding parental Trichoderma cell. activity of interest. As used herein , a " non -mammalian Heterologous Polypeptides of the Invention 30 polypeptide" is a polypeptide that is natively expressed in a The invention herein further relates to increasing the non -mammalian organism , such as a fungal cell , a polypep production ofheterologous polypeptides in filamentous fun tide that is derived from a polypeptide that is natively gal cells that express such heterologous polypeptides by expressed in a non -mammal organism , or a fragment reducing the activity of proteases found in the cells . thereof. A non -mammalian polypeptide also includes pep As used herein a “ heterologous polypeptide ” refers to a 35 tides and oligopeptides that retain biological activity . Non polypeptide that is not naturally found in ( i.e., endogenous) mammalian polypeptides of the present disclosure may also a filamentous fungal cell of the present disclosure , or that is include two or more polypeptides that are combined to form expressed at an elevated level in a filamentous fungal cell as the encoded product . Non -mammalian polypeptides of the compared to the endogenous version of the polypeptide . In present disclosure may further include fusion polypeptides, certain embodiments , the heterologous polypeptide is a 40 which contain a combination of partial or complete amino mammalian polypeptide. In other embodiments , the heter acid sequences obtained from at least two different poly ologous polypeptide is a non -mammalian polypeptide . peptides . Non -mammalian polypeptides may also include Mammalian Polypeptides naturally occurring allelic and engineered variations of any Mammalian polypeptides of the present disclosure may be of the disclosed non -mammalian polypeptides and hybrid any mammalian polypeptide having a biological activity of 45 non -mammalian polypeptides . interest. As used herein , a “ mammalian polypeptide” is a Examples of suitable non -mammalian polypeptides polypeptide that is natively expressed in a mammal, a include , without limitation , aminopeptidases , amylases , car polypeptide that is derived from a polypeptide that is bohydrases , carboxypeptidases , catalases , cellulases , chiti natively expressed in a mammal, or a fragment thereof. A nases , cutinases, deoxyribonucleases, esterases , alpha - ga mammalian polypeptide also includes peptides and oligo- 50 lactosidases, beta -galactosidases , glucoamylases , alpha peptides that retain biological activity . Mammalian polypep glucosidases, beta -glucosidases , invertases, laccases , tides of the present disclosure may also include two or more lipases, mutanases, oxidases , pectinolytic enzymes, peroxi polypeptides that are combined to form the encoded product . dases , phospholipases, phytases , polyphenoloxidases , pro Mammalian polypeptides of the present disclosure may teolytic enzymes, ribonucleases, transglutaminases and further include fusion polypeptides , which contain a com- 55 xylanases . bination of partial or complete amino acid sequences Heterologous Polypeptide Production obtained from at least two different polypeptides. Mamma A heterologous polypeptide of interest is produced by lian polypeptides may also include naturally occurring filamentous fungal cells of the present disclosure containing allelic and engineered variations of any of the disclosed at least three proteases having reduced activity by cultivat mammalian polypeptides and hybrid mammalian polypep- 60 ing the cells in a nutrient medium for production of the tides . heterologous polypeptide using methods known in the art. The mammalian polypeptide may be a naturally glycosy For example , the cells may be cultivated by shake flask lated polypeptide or a naturally non - glycosylated polypep cultivation , small- scale or large -scale fermentation (includ tide . ing continuous, batch , fed -batch , or solid state fermenta Examples of suitable mammalian polypeptides include, 65 tions) in laboratory or industrial fermentors performed in a without limitation , immunoglobulins, antibodies , antigens , suitable medium and under conditions allowing the poly antimicrobial peptides, enzymes , growth factors , hormones, peptide to be expressed and /or isolated . The cultivation takes US 10,731,168 B2 35 36 place in a suitable nutrient medium comprising carbon and proteins other than those native to the cell, or in a manner not nitrogen sources and inorganic salts , using procedures native to the cell . An “ expression vector” contains a known in the art. Suitable media are available from com sequence of nucleic acids (ordinarily RNA or DNA ) to be mercial suppliers or may be prepared according to published expressed by the host cell . Optionally , the expression vector compositions ( e.g. , in catalogues of the American Type 5 also includes materials to aid in achieving entry of the Culture Collection ). The secreted polypeptide can be recov nucleic acid into the host cell, such as a virus, liposome, ered directly from the medium . If the polypeptide is not protein coating, or the like . The expression vectors contem secreted , it may be obtained from cell lysates. plated for use in the present disclosure include those into A heterologous polypeptide of interest produced by a which a nucleic acid sequence can be inserted , along with filamentous fungal cell of the present disclosure containing 10 any preferred or required operational elements. Further , the at least three proteases having reduced activity may be expression vector must be one that can be transferred into a detected using methods known in the art that are specific for host cell and replicated therein . Preferred expression vectors the heterologous polypeptide. These detection methods may are plasmids, particularly those with restriction sites that include, without limitation , use of specific antibodies , high have been well documented and that contain the operational performance liquid chromatography, capillary chromatogra- 15 elements preferred or required for transcription of the phy, formation of an enzyme product, disappearance of an nucleic acid sequence . Such plasmids, as well as other enzyme substrate , and SDS- PAGE . For example , an enzyme expression vectors, are well known in the art . assay may be used to determine the activity of an enzyme. Incorporation of the individual polynucleotides may be Procedures for determining enzyme activity are known in accomplished through known methods that include , for the art for many enzymes ( see , for example , O. Schomburg 20 example , the use of restriction enzymes ( such as BamHI, and M. Salzmann (eds . ), Enzyme Handbook , Springer EcoRI, Hhal, Xhol, Xmal, and so forth ) to cleave specific Verlag , New York , 1990 ) . sites in the expression vector, e.g. , plasmid . The restriction The resulting heterologous polypeptide may be isolated enzyme produces single stranded ends that may be annealed by methods known in the art . For example , a heterologous to a polynucleotide having , or synthesized to have, a termi polypeptide of interest may be isolated from the cultivation 25 nus with a sequence complementary to the ends of the medium by conventional procedures including, without cleaved expression vector. Annealing is performed using an limitation , centrifugation , filtration , extraction , spray - dry appropriate enzyme, e.g., DNA ligase. As will be appreci ing , evaporation , and precipitation . The isolated heterolo ated by those of ordinary skill in the art , both the expression gous polypeptide may then be further purified by a variety vector and the desired polynucleotide are often cleaved with of procedures known in the art including ,without limitation , 30 the same restriction enzyme , thereby assuring that the ends chromatography (e.g. , ion exchange, affinity , hydrophobic , of the expression vector and the ends of the polynucleotide chromatofocusing, and size exclusion ), electrophoretic pro are complementary to each other . In addition , DNA linkers cedures (e.g. , preparative isoelectric focusing ( IEF ), differ maybe used to facilitate linking of nucleic acids sequences ential solubility ( e.g. , ammonium sulfate precipitation ), or into an expression vector. extraction ( see, for example , Protein Purification , J.-C. Jan- 35 A series of individual polynucleotides can also be com son and Lars Ryden , editors , VCH Publishers , New York , bined by utilizing methods that are known in the art ( e.g. , 1989 ). U.S. Pat . No. 4,683,195 ) . Preparation of Polynucleotides Encoding Heterologous For example , each of the desired polynucleotides can be Polypeptides initially generated in a separate PCR . Thereafter, specific Sequences of the heterologous polynucleotides of the 40 primers are designed such that the ends of the PCR products present disclosure are prepared by any suitable method contain complementary sequences. When the PCR products known in the art, including , without limitation , direct chemi are mixed , denatured , and reannealed , the strands having the cal synthesis or cloning. For direct chemical synthesis , matching sequences at their 3 ' ends overlap and can act as formation of a polymer of nucleic acids typically involves primers for each other. Extension of this overlap by DNA sequential addition of 3 '- blocked and 5 '- blocked nucleotide 45 polymerase produces a molecule in which the original monomers to the terminal 5 -hydroxyl group of a growing sequences are “ spliced ” together. In this way , a series of nucleotide chain , wherein each addition is effected by individual polynucleotides may be “ spliced ” together and nucleophilic attack of the terminal 5 '- hydroxyl group of the subsequently transduced into a host cell simultaneously . growing chain on the 3 '- position of the added monomer , Thus , expression of each of the plurality of polynucleotides which is typically a phosphorus derivative , such as a phos- 50 is affected . photriester , phosphoramidite , or the like. Such methodology Individual polynucleotides, or “ spliced ” polynucleotides , is known to those of ordinary skill in the art and is described are then incorporated into an expression vector . The present in the pertinent texts and literature [e.g. , in Matteucci et al. , disclosure is not limited with respect to the process by which (1980 ) Tetrahedron Lett 21: 719-722; U.S. Pat . Nos. 4,500 , the polynucleotide is incorporated into the expression vec 707 ; 5,436,327 ; and 5,700,637 ] . In addition , the desired 55 tor. Those of ordinary skill in the art are familiar with the sequences may be isolated from natural sources by splitting necessary steps for incorporating a polynucleotide into an DNA using appropriate restriction enzymes , separating the expression vector. A typical expression vector contains the fragments using gel electrophoresis , and thereafter , recov desired polynucleotide preceded by one or more regulatory ering the desired nucleic acid sequence from the gel via regions, along with a ribosome binding site , e.g., a nucleo techniques known to those of ordinary skill in the art, such 60 tide sequence that is 3-9 nucleotides in length and located as utilization of polymerase chain reactions (PCR ; e.g., U.S. 3-11 nucleotides upstream of the initiation codon in E. coli. Pat. No. 4,683,195 ) . See Shine and Dalgarno ( 1975 ) Nature 254 ( 5495 ) : 34-38 and Each heterologous polynucleotide of the present disclo Steitz (1979 ) Biological Regulation and Development (ed . sure can be incorporated into an expression vector. “ Expres Goldberger , R. R ), 1: 349-399 (Plenum , N.Y.) . sion vector” or “ vector” refers to a compound and/ or com- 65 The term " operably linked ” as used herein refers to a position that transduces, transforms, or infects a host cell , configuration in which a control sequence is placed at an thereby causing the cell to express nucleic acids and /or appropriate position relative to the coding sequence of the US 10,731,168 B2 37 38 DNA sequence or polynucleotide such that the control ( glaA ), fungal acetamidase ( amds ) , fungal glyceraldehyde sequence directs the expression of a polypeptide. 3 -phosphate dehydrogenase (gpd ), yeast alcohol dehydro Regulatory regions include, for example , those regions genase, yeast lactase , yeast 3 - phosphoglycerate kinase, yeast that contain a promoter and an operator. A promoter is triosephosphate isomerase , bacterial a - amylase, bacterial operably linked to the desired polynucleotide, thereby ini- 5 Spo2 , and SSO . Examples of such suitable expression tiating transcription of the polynucleotide via an RNA polymerase enzyme. An operator is a sequence of nucleic vectors and promoters are also described in PCT/ EP2011/ acids adjacent to the promoter , which contains a protein 070956 , the entire contents of which is hereby incorporated binding domain where a repressor protein can bind . In the by reference herein . absence of a repressor protein , transcription initiates through 10 Pharmaceutical Compositions Containing Heterologous the promoter . When present, the repressor protein specific to Polypeptides Produced by Filamentous Fungal Cells of the the protein - binding domain of the operator binds to the Invention operator , thereby inhibiting transcription. In this way, con In another aspect, the present invention provides a com trol of transcription is accomplished , based upon the par position , e.g. , a pharmaceutical composition , containing one ticular regulatory regions used and the presence or absence 15 or more heterologous polypeptides of interest, such as of the corresponding repressor protein . Examples include mammalian polypeptides , produced by the filamentous fun lactose promoters (Lad repressor protein changes conforma gal cells of the present disclosure having reduced activity of at least three proteases and further containing a recombinant Ladtion whenrepressor contacted protein withfrom lactosebinding , thereby to the preventingoperator ) andthe polynucleotide encoding the heterologous polypeptide, for tryptophan promoters (when complexed with tryptophan , 20 mulated together with a pharmaceutically acceptable carrier . TrpR repressor protein has a conformation that binds the Pharmaceutical compositions of the invention also can be operator ; in the absence of tryptophan , the TrpR repressor administered in combination therapy, i.e., combined with protein has a conformation that does not bind to the opera other agents . For example, the combination therapy an tor ). Another example is the tac promoter (see de Boer et al ., include a mammalian polypeptide of interest combined with ( 1983 ) Proc Natl Acad Sci USA 80 ( 1 ) :21-25 ) . As will be 25 at least one other therapeutic agent. appreciated by those of ordinary skill in the art , these and As used herein , “ pharmaceutically acceptable carrier” other expression vectors may be used in the present disclo includes any and all solvents , dispersion media , coatings , sure, and the present disclosure is not limited in this respect. antibacterial and antifungal agents, isotonic and absorption Although any suitable expression vector may be used to delaying agents , and the like that are physiologically com incorporate the desired sequences, readily available expres- 30 patible . Preferably , the carrier is suitable for intravenous , sion vectors include , without limitation : plasmids, such as intramuscular , subcutaneous, parenteral, spinal or epidermal pSCIOL, PBR322 , pBBRIMCS - 3 , PUR , PEX , PMR100 , administration (e.g. ,by injection or infusion ). Depending on PCR4 , PBAD24 , pUC19, PRS426 ; and bacteriophages , such the route of administration , the active compound , i.e. , the asvectors Ml 3may phage only and be suitableà phage for . Of particular course , host such cells expression. One of 35 mammalian polypeptide of interest, may be coated in a ordinary skill in the art , however, can readily determine material to protect the compound from the action of acids through routine experimentation whether any particular and other natural conditions that may inactivate the com expression vector is suited for any given host cell. For pound . example , the expression vector can be introduced into the The pharmaceutical compositions of the invention may host cell, which is then monitored for viability and expres- 40 include one or more pharmaceutically acceptable salts. A sion of the sequences contained in the vector. In addition , " pharmaceutically acceptable salt” refers to a salt that reference may be made to the relevant texts and literature, retains the desired biological activity of the parent com which describe expression vectors and their suitability to pound and does not impart any undesired toxicological any particular host cell . effects ( see e.g. , Berge, S. M., et al . ( 1977 ) J. Pharm . Sci. 66 : Suitable expression vectors for the purposes of the inven- 451-19 ). Examples of such salts include acid addition salts and tion , including the expression of the desired heterologous base addition salts . Acid addition salts include those derived polypeptide , enzyme, and one or more catalytic domains from nontoxic inorganic acids, such as hydrochloric , nitric , described herein , include expression vectors containing the phosphoric , sulfuric , hydrobromic , hydroiodic , phosphorous polynucleotide encoding the desired heterologous polypep and the like , as well as from nontoxic organic acids such as tide, enzyme , or catalytic domain ( s ) operably linked to a 50 aliphatic mono- and dicarboxylic acids, phenyl- substituted constitutive or an inducible promoter . Examples of particu alkanoic acids, hydroxy alkanoic acids, aromatic acids, larly suitable promoters for operable linkage to such poly aliphatic and aromatic sulfonic acids and the like. Base nucleotides include promoters from the following genes : addition salts include those derived from alkaline earth gpdA , cbhl, Aspergillus oryzae TAKA amylase , Rhizomucor metals , such as sodium , potassium , magnesium , calcium and miehei aspartic proteinase , Aspergillus niger neutral alpha- 55 the like , as well as from nontoxic organic amines , such as amylase , Aspergillus niger acid stable alpha- amylase , N , N - dibenzylethylenediamine , N -methylglucamine , chlo Aspergillus niger glucoamylase (glaA ) , Aspergillus roprocaine , choline, diethanolamine, ethylenediamine, pro awamori glaA , Rhizomucor miehei lipase , Aspergillus caine and the like. oryzae alkaline protease , Aspergillus oryzae triose phos A pharmaceutical composition of the invention also may phate isomerase , Aspergillus nidulans acetamidase, Asper- 60 also include a pharmaceutically acceptable antioxidant. gillus oryzae acetamidase, Fusarium oxysporum trypsin - like Examples of pharmaceutically acceptable antioxidants protease , fungal endo a - L - arabinase ( abnA ) , fungal a - L include : (1 ) water soluble antioxidants , such as ascorbic arabinofuranosidase A (abfA ) , fungal a - L - arabinofuranosi acid , cysteine hydrochloride, sodium bisulfate , sodium dase B (abfB ), fungal xylanase (xInA ) , fungal phytase , metabisulfite, sodium sulfite and the like ; ( 2 ) oil -soluble fungal ATP - synthetase , fungal subunit 9 (oliC ) , fungal triose 65 antioxidants , such as ascorbylpalmitate , butylated hydroxy phosphate isomerase (tpi ) , fungal alcohol dehydrogenase anisole ( BHA ) , butylated hydroxytoluene ( BHT) , lecithin , ( adhA ), fungal a -amylase (amy ) , fungal amyloglucosidase propyl gallate , alpha- tocopherol, and the like; and ( 3 ) metal US 10,731,168 B2 39 40 chelating agents , such as citric acid , ethylenediamine tet The amount of active ingredient which can be combined raacetic acid ( EDTA ) , sorbitol, tartaric acid , phosphoric with a carrier material to produce a single dosage form will acid , and the like . vary depending upon the subject being treated , and the Examples of suitable aqueous and nonaqueous carriers particular mode of administration . The amount of active thatmay be employed in the pharmaceutical compositions of 5 ingredientwhich can be combined with a carrier material to the invention include water, ethanol, polyols ( such as glyc produce a single dosage form will generally be that amount erol, propylene glycol, polyethylene glycol, and the like ), of the composition which produces a therapeutic effect . and suitable mixtures thereof, vegetable oils , such as olive Generally , out of one hundred percent, this amount will oil, and injectable organic esters , such as ethyl oleate . Proper range from about 0.01 percent to about ninety - nine percent fluidity can be maintained , for example , by the use of 10 of active ingredient, preferably from about 0.1 percent to coating materials , such as lecithin , by the maintenance of the about 70 percent, most preferably from about 1 percent to required particle size in the case of dispersions, and by the about 30 percent of active ingredient in combination with a use of surfactants . pharmaceutically acceptable carrier . These compositions may also contain adjuvants such as Dosage regimens are adjusted to provide the optimum preservatives , wetting agents , emulsifying agents and dis 15 desired response ( e.g., a therapeutic response ) . For example , persing agents . Prevention of presence of microorganisms a single bolus may be administered , several divided doses may be ensured both by sterilization procedures, and by the may be administered over time or the dose may be propor inclusion of various antibacterial and antifungal agents , for tionally reduced or increased as indicated by the exigencies example , paraben , chlorobutanol, phenol sorbic acid , and the 20 of the therapeutic situation . It is especially advantageous to like. It may also be desirable to include isotonic agents , such formulate parenteral compositions in dosage unit form for as sugars , sodium chloride , and the like into the composi ease of administration and uniformity of dosage . Dosage tions. In addition , prolonged absorption of the injectable unit form as used herein refers to physically discrete units pharmaceutical form may be brought about by the inclusion suited as unitary dosages for the subjects to be treated ; each of agents which delay absorption such as aluminum monos- 25 unit contains a predetermined quantity of active compound tearate and gelatin . calculated to produce the desired therapeutic effect in asso Pharmaceutically acceptable carriers include sterile aque ciation with the required pharmaceutical carrier. The speci ous solutions or dispersions and sterile powders for the fication for the dosage unit forms of the invention are extemporaneous preparation of sterile injectable solutions or dictated by and directly dependent on (a ) the unique char dispersion . The use of such media and agents for pharma- 30 acteristics of the active compound and the particular thera ceutically active substances is known in the art . Except peutic effect to be achieved , and ( b ) the limitations inherent insofar as any conventional media or agent is incompatible in the art of compounding such an active compound for the with the active compound , use thereof in the pharmaceutical tre ment of sensitivity in individuals . compositions of the invention is contemplated . Supplemen For administration of a mammalian polypeptide of inter tary active compounds can also be incorporated into the 35 est, in particular where the mammalian polypeptide is an compositions. antibody, the dosage ranges from about 0.0001 to 100 Therapeutic compositions typically must be sterile and mg/ kg , and more usually 0.01 to 5 mg/ kg , of the host body stable under the conditions of manufacture and storage . The weight. For example , dosages can be 0.3 mg/ kg body composition can be formulated as a solution , microemul weight, 1 mg/ kg body weight, 3 mg/ kg body weight, 5 sion , liposome, or other ordered structure suitable to high 40 mg/kg body weight or 10 mg/ kg body weight or within the drug concentration . The carrier can be a solvent or disper range of 1-10 mg/ kg . An exemplary treatment regime entails sion medium containing , for example , water , ethanol, polyol administration once per week , once every two weeks, once ( for example , glycerol, propylene glycol, and liquid poly every three weeks, once every four weeks , once a month , ethylene glycol, and the like ) , and suitable mixtures thereof. once every 3 months or once every three to 6 months . The proper fluidity can be maintained , for example , by the 45 Certain dosage regimens for an antibody may include 1 use of a coating such as lecithin , by the maintenance of the mg/ kg body weight or 3 mg/ kg body weight via intravenous required particle size in the case of dispersion and by the use administration , with the antibody being given using one of of surfactants . In many cases, it will be preferable to include the following dosing schedules : ( i) every four weeks for six isotonic agents , for example , sugars , polyalcohols such as dosages, then every three months; (ii ) every three weeks ; mannitol, sorbitol, or sodium chloride in the composition . 50 ( iii ) 3 mg/ kg body weight once followed by 1 mg/ kg body Prolonged absorption of the injectable compositions can be weight every three weeks. brought about by including in the composition an agent that Alternatively a mammalian polypeptide of interest can be delays absorption , for example ,monostearate salts and gela administered as a sustained release formulation , in which tin . case less frequent administration is required . Dosage and Sterile injectable solutions can be prepared by incorpo- 55 frequency vary depending on the half -life of the adminis rating the active compound in the required amount in an tered substance in the patient . In general , human antibodies appropriate solvent with one or a combination of ingredients show the longest half life , followed by humanized antibod enumerated above , as required , followed by sterilization ies, chimeric antibodies, and nonhuman antibodies . The microfiltration .Generally , dispersions are prepared by incor dosage and frequency of administration can vary depending porating the active compound into a sterile vehicle that 60 on whether the treatment is prophylactic or therapeutic . In contains a basic dispersion medium and the required other prophylactic applications, a relatively low dosage is admin ingredients from those enumerated above. In the case of istered at relatively infrequent intervals over a long period of sterile powders for the preparation of sterile injectable time. Some patients continue to receive treatment for the rest solutions, the certain methods of preparation are vacuum of their lives . In therapeutic applications, a relatively high drying and freeze- drying ( lyophilization ) that yield a powder 65 dosage at relatively short intervals is sometimes required of the active ingredient plus any additional desired ingredi until progression of the disease is reduced or terminated , and ent from a previously sterile - filtered solution thereof. preferably until the patient shows partial or complete ame US 10,731,168 B2 41 42 lioration of symptoms of disease. Thereafter, the patient can degradable , biocompatible polymers can be used , such as be administered a prophylactic regime. ethylene vinyl acetate , polyanhydrides , polyglycolic acid , Actual dosage levels of the active ingredients in the collagen , polyorthoesters , and polylactic acid . Many meth pharmaceutical compositions of the present disclosure may ods for the preparation of such formulations are patented or be varied so as to obtain an amount of the active ingredient 5 generally known to those skilled in the art. ( see , e.g., which is effective to achieve the desired therapeutic Sustained and Controlled Release Drug Delivery Systems, J. response for a particular patient, composition , and mode of R. Robinson , ed . , Marcel Dekker, Inc. , New York , 1978 ) . administration , without being toxic to the patient . The Therapeutic compositions can be administered with medi selected dosage level will depend upon a variety of phar cal devices known in the art. For example , in a certain macokinetic factors including the activity of the particular 10 embodiment, a therapeutic composition of the invention can compositions of the present invention employed , or the ester , be administered with a needleless hypodermic injection salt or amide thereof, the route of administration , the time of device , such as the devices disclosed in U.S. Pat. Nos . administration , the rate of excretion of the particular com 5,399,163 ; 5,383,851 ; 5,312,335 ; 5,064,413 ; 4,941,880 ; pounddrugs, beingcompounds employed and ,/ theor materialsduration ofused the treatmentin combination, other 15 4,790,824 ; or 4,596,556 . Examples of well -known implants with the particular compositions employed , the age, sex , and modules useful in the present invention include : U.S. weight, condition , general health and prior medical history Pat. No. 4,487,603, which discloses an implantable micro of the patient being treated , and like factors well known in infusion pump for dispensing medication at a controlled the medical arts . rate ; U.S. Pat. No. 4,486,194 , which discloses a therapeutic A “ therapeutically effective dosage ” of an immunoglobu- 20 device for administering medicants through the skin ; U.S. lin of the present disclosure preferably results in a decrease Pat . No. 4,447,233 , which discloses a medication infusion in severity of disease symptoms, an increase in frequency pump for delivering medication at a precise infusion rate ; and duration of disease symptom - free periods, or a preven U.S. Pat. No. 4,447,224 , which discloses a variable flow tion of impairment or disability due to the disease affliction . implantable infusion apparatus for continuous drug delivery; For example , for the treatment of tumors , a “ therapeutically 25 U.S. Pat. No. 4,439,196 , which discloses an osmotic drug effective dosage ” preferably inhibits cell growth or tumor delivery system having multi -chamber compartments ; and growth by at least about 20 % , more preferably by at least U.S. Pat . No. 4,475,196 , which discloses an osmotic drug about 40 % , even more preferably by at least about 60 % , and delivery system . still more preferably by at least about 80 % relative to In certain embodiments , the use of mammalian polypep untreated subjects . The ability of a compound to inhibit 30 tides according to the present disclosure is for the treatment tumor growth can be evaluated in an animal model system of any disease that may be treated with therapeutic antibod predictive of efficacy in human tumors . Alternatively , this ies . property of a composition can be evaluated by examining Filamentous Fungal Cells of the Invention the ability of the compound to inhibit , such inhibition in The invention herein also relates to increasing the levels vitro by assays known to the skilled practitioner. A thera- 35 of production of heterologous polypeptides , such as mam peutically effective amount of a therapeutic compound can malian polypeptides , in filamentous fungal cells by reducing decrease tumor size , or otherwise ameliorate symptoms in a or eliminating the activity of at least three proteases found subject. One of ordinary skill in the art would be able to in cells that express heterologous polypeptides, and that determine such amounts based on such factors as the sub catalyze the degradation of the heterologous polypeptides . ject's size , the severity of the subject's symptoms, and the 40 Reducing or eliminating the activity of proteases found in particular composition or route of administration selected . the filamentous fungal cells that express heterologous poly A composition of the present disclosure can be adminis peptides increases the stability of the expressed recombinant tered via one or more routes of administration using one or polypeptides , which results in an increased level of produc more of a variety of methods known in the art . As will be tion of the heterologous polypeptides. The activity of the appreciated by the skilled artisan , the route and /or mode of 45 proteases found in the filamentous fungal cells may be administration will vary depending upon the desired results . reduced , for example , by modifying the genes encoding the Certain routes of administration for binding moieties of the proteases . invention include intravenous, intramuscular , intradermal , “ Filamentous fungal cells ” include cells from all filamen intraperitoneal, subcutaneous , spinal or other parenteral tous forms of the subdivision Eumycota and Oomycota (as routes of administration , for example by injection or infu- 50 defined by Hawksworth et al ., In , Ainsworth and Bisby's sion . The phrase “ parenteral administration ” as used herein Dictionary of The Fungi , 8th edition , 1995 , CAB Interna means modes of administration other than enteral and topi tional, University Press , Cambridge, UK ). Filamentous fun cal administration , usually by injection , and includes, with gal cells are generally characterized by a mycelial wall out limitation , intravenous, intramuscular , intraarterial, composed of chitin , cellulose , glucan, chitosan ,mannan , and intrathecal, intracapsular , intraorbital, intracardiac , intrader- 55 other complex polysaccharides. Vegetative growth is by mal, intraperitoneal, transtracheal, subcutaneous, subcuticu hyphal elongation and carbon catabolism is obligately aero lar , intraarticular, subcapsular, subarachnoid , intraspinal, bic . In contrast, vegetative growth by yeasts such as Sac epidural and intrasternal injection and infusion . charomyces cerevisiae is by budding of a unicellular thallus Alternatively , a mammalian polypeptide according to the and carbon catabolism may be fermentative . present disclosure can be administered via a nonparenteral 60 Any filamentous fungal cell may be used in the present route , such as a topical, epidermal or mucosal route of disclosure so long as it remains viable after being trans administration , for example , intranasally, orally , vaginally , formed with a sequence of nucleic acids and /or being rectally , sublingually or topically . modified or mutated to decrease protease activity . Prefer The active compounds can be prepared with carriers that ably , the filamentous fungal cell is not adversely affected by will protect the compound against rapid release , such as a 65 the transduction of the necessary nucleic acid sequences, the controlled release formulation , including implants , transder subsequent expression of the proteins { e.g. , mammalian mal patches , and microencapsulated delivery systems. Bio proteins ), or the resulting intermediates. US 10,731,168 B2 43 44 Examples of suitable filamentous fungal cells include, mammalian polypeptide produced at a level of at least 2- fold without limitation , cells from an Acremonium , Aspergillus, higher than the production level of the polypeptide in a Fusarium , Humicola , Mucor, Myceliophthora, Neurospora , corresponding parental Trichoderma fungal cell. In certain Penicillium , Scytalidium , Thielavia , Tolypocladium , or embodiments , the filamentous fungal cells or Trichoderma Trichoderma strain . In certain embodiments , the filamentous 5 fungal cells have reduced or no activity of at least four , at fungal cell is from a Trichoderma sp . , Acremonium , Asper least five , at least six , at least seven , at least eight, at least gillus Aureobasidium , Cryptococcus, Chrysosporium , nine , at least ten , at least eleven , at least twelve , or more Chrysosporium lucknowense, Filibasidium , Fusarium , Gib proteases. berella , Magnaporthe, Mucor, Myceliophthora , Myroth Reduced Expression of Proteases ecium , Neocallimastix , Neurospora , Paecilomyces, Penicil- 10 The reduced activity of the at least three proteases in lium , Piromyces, Schizophyllum , Talaromyces , filamentous fungal cells or Trichoderma fungal cells of the Thermoascus, Thielavia , or Tolypocladium strain . present disclosure can be the result of reduced or eliminated Aspergillus fungal cells of the present disclosure may expression of the proteases . In some embodiments , the include , without limitation , Aspergillus aculeatus, Aspergil reduced or eliminated expression of the at least three pro lus awamori , Aspergillus clavatus, Aspergillus flavus, Asper- 15 teases is the result of a modification to the catalytic domain , gillus joetidus, Aspergillus jumigatus, Aspergillus japonicus, the coding region , or a control sequence required for expres Aspergillus nidulans, Aspergillus niger , Aspergillus oryzae , sion of the coding region of the genes encoding each of the or Aspergillus terreus. proteases. In other embodiments , the reduced or eliminated Neurospora fungal cells of the present disclosure may expression of the proteases is the result of introducing , include , without limitation , Neurospora crassa . 20 substituting , and / or removing one or more nucleotides in the In certain embodiments , the filamentous fungal cell is not genes , or a control sequence thereof required for the tran an Aspergillus cell . scription or translation of the genes encoding each of the In certain embodiments , the filamentous fungal cell is proteases. selected from the group consisting of Trichoderma ( T. In further embodiments , the reduced or eliminated expres reesei ), Neurospora (N. crassa ) , Penicillium ( P. chrysoge- 25 sion of the proteases is the result of inserting into the genes num ) , Aspergillus ( A. nidulans, A. niger and A. oryzae ) , encoding each of the proteases disruptive nucleic acid Myceliophthora (M. thermophila ) and Chrysosporium (C. constructs each containing a nucleic acid fragment homolo lucknowense ) . gous to each of the genes that will create a duplication of the In certain embodiments , the filamentous fungal cell is a region of homology and incorporate construct DNA between Trichoderma fungal cell. Trichoderma fungal cells of the 30 the duplicated regions. In other embodiments , the reduced or present disclosure may be derived from a wild - type eliminated expression of the proteases is the result of gene Trichoderma strain or a mutant thereof. Examples of suit conversion of the genes encoding each of the proteases. In able Trichoderma fungal cells includ without limit still other embodim ts , the reduced or eliminated expres Trichoderma harzianum , Trichoderma koningii, sion of the proteases is the result of by anti -sense polynucle Trichoderma longibrachiatum , Trichoderma reesei , 35 otides or RNAi constructs that are specific for the each of the Trichoderma atroviride, Trichoderma virens, Trichoderma genes encoding each of the proteases . In one embodiment, viride ; and alternative sexual form thereof ( i.e., Hypocrea ). an RNAiconstruct is specific for a gene encoding an aspartic General methods to disrupt genes of and cultivate fila protease such as a pep -type protease , a trypsin - like serine mentous fungal cells are disclosed , for example , for Peni proteases such as a tspl , a glutamic protease such as a cillium , Kopke et al. ( 2010 ) Application of the Saccha- 40 gap -type , protease , a subtilisin protease such as a slp - type romyces cerevisiae FLP/ FRT recombination system in protease , or a sedolisin protease such as a tppl or a slp7 filamentous fungi for marker recycling and construction of protease . In one embodiment, an RNAi construct is specific knockout strains devoid of heterologous genes . Appl Envi for the gene encoding a slp -type protease . In one embodi ron Microbiol. 76 ( 14 ): 4664-74 . doi: 10.1128 / AEM.00670 ment, an RNAi construct is specific for the gene encoding 10 , for Aspergillus, in Maruyama and Kitamoto ( 2011) , 45 slp2, slp3 , slp5 or slp6 . In one embodiment, an RNAi Targeted Gene Disruption in Koji Mold Aspergillus oryzae , construct is specific for two or more proteases . In one in James A. Williams (ed .) , Strain Engineering : Methods and embodiment, two or more proteases are any one of the Protocols , Methods in Molecular Biology , vol. 765 , DOI pep - type proteases, any one of the trypsin - like serine pro 10.1007 /978-1-61779-197-0_27 ; for Neurospora , in Col teases , any one of the slp -type proteases, any one of the lopy et al. (2010 ) High -throughput construction of gene 50 gap - type proteases and/ or any one of the sedolisin proteases. deletion cassettes for generation of Neurospora crassa In one embodiment, two or more proteases are slp2 , slp3 , knockout strains . Methods Mol Biol. 2010 ; 638 : 33-40 . doi: slp5 and /or slp6 . In one embodiment, RNAi construct com 10.1007 /978-1-60761-611-5_3 ; and for Myceliophthora or prises any one of nucleic acid sequences of Table 22.2 . Chrysosporium PCT/ NL2010 /000045 and PCT/ EP98 / In some embodiments , the genes encoding the proteases 06496 . 55 each contain a mutation that reduces or eliminates the Filamentous Fungal Cell Components corresponding protease activity . In other embodiments , the Certain aspects of the present disclosure relate to fila mutation reduces or eliminates the expression of each of the mentous fungal cells having reduced or no detectable activ proteases. In further embodiments , the mutation is a knock ity of at least three proteases and having a recombinant out mutation , a truncation mutation , a point mutation , a polynucleotide encoding a heterologous polypeptide that is 60 missense mutation , a substitution mutation , a frameshift produced at increased levels , for example at least two- fold mutation , an insertion mutation , a duplication mutation , an increased levels . Other aspects of the present disclosure amplification mutation , a translocation mutation , an inver relate to Trichoderma fungal cells that has reduced or no sion mutation that reduces or eliminates the corresponding detectable protease activity of at least three proteases protease activity. selected from pep1, pep2 , pep3 , pep4 , pep5 , pep8 , pep11 , 65 In some embodiments , the mutation is a deletion of the pep12 , tsp1, slp1, slp2 , slp7 , gap1 , and gap2 , where the cell protease encoding gene. In other embodiments , the mutation further contains a recombinant polynucleotide encoding a is a deletion of the portion of the protease encoding gene US 10,731,168 B2 45 46 encoding the catalytic domain of the protease . In still other reduced or no expression levels of protease encoding genes embodiments , the mutation is point mutation in the portion slp2 , pep1, gap1, pep4 , slpl, slp3, pep3, pep2 , pep5 , tspl, of the protease encoding gene encoding the catalytic domain slp7, and slp8 . In some embodiments , the filamentous fungal of the protease . cell, for example , a Trichoderma cell has reduced or no Combinations of Protease Genes 5 expression levels of protease encoding genes slp2 , pep1 , The filamentous fungal cells or Trichoderma fungal cells gap1 , pep4, sip1, slp3 , pep3, pep2, pep5, tsp1, slp7 , slp8 , and of the present disclosure may contain at least three , at least gap 2 . four, at least five, at least six , at least seven , at least eight, In certain embodiments , the filamentous fungal cell has at at least nine , at least ten , or more aspartic proteases , trypsin least three , at least four, at least five , at least six , at least like serine proteases , subtilisin proteases, and /or glutamic 10 seven , at least eight, at least nine, at least ten , or more proteases. In certain embodiments , the proteases are proteases with reduced protease activity , wherein the corre encoded by pep -type protease genes , gap - type protease sponding proteases with wild type activity each have an genes , or slp - type proteases genes. In some embodiments , amino acid sequence that is at least 70 % , at least 75 % , at the pep -type protease genes are selected from pep1, pep2 , least 80 % , at least 85 % , at least 90 % , at least 95 % , at least pep3 , pep4 , pep5, pep8, pep1, and pep12. In other embodi- 15 96 % , at least 97 % , at least 98 % , at least 99 % , or 100 % ments , the gap - type protease genes are selected from gapl, identical to the amino acid sequences of SEQ ID NOs : 1-16 ; and gap2 . In further embodiments, the slp - type proteases 17-36 ; 37-57 ; 58-65 ; 66-81 ; 82-97 ; 98-117 ; 118-128 ; 129 genes are selected from slpl , slp2 , slp3 , and slp7 ; or are 144 ; 166-181 ; 182-185 ; or SEQ ID NOs: 491-588. In selected from slp1 , slp2 , slp3 , slp5 , slp6 , slp7 , and slp8 . In embodiments where the filamentous fungal cell is a certain preferred embodiments , the slp - type proteases gene 20 Trichoderma fungal cell with reduced protease activity in is slp1. one or more proteases, wherein the corresponding proteases In other embodiments , the proteases are encoded by genes with wild type activity each have an amino acid sequence selected from pepl, pep2 , pep3, pep4 , pep5 , pep7 , pep8 , that is at least 70 % , at least 75 % , at least 80 % , at least 85 % , pepl , pepl 2 , tspl, slpl , slp2 , slp3 , slp5 , slpó , slp7 , sip8 , at least 90 % , at least 95 % , at least 96 % , at least 97 % , at least gap1, gap2, and tppl. In some embodiments , the filamentous 25 98 % , at least 99 % , or 100 % identical to the amino acid fungal cell , for example, a Trichoderma cell has reduced or sequences of SEQ ID NOs: 1 , 17 , 37 , 58 , 66 , 82 , 98 , 118 , no expression levels of at least three or at least four protease 129, 166 , or 182 ; or SEQ ID NO :507 , SEQ ID NO :522 , or encoding genes selected from pep1, pep2 , pep3 , pep4, pep5 , SEQ ID NO :530 . pep8 , pep11, pep12 , tspl , slp1, slp2 , slp3 , slp7 , gapl , and Heterologous Polypeptides gap2 . In certain embodiments , the filamentous fungal cell , 30 The filamentous fungal cells or Trichoderma fungal cells for example a Trichoderma cell , has reduced or no expres of the present disclosure contain a recombinant polynucle sion levels of at least three protease encoding genes selected otide encoding a heterologous polypeptide. In certain from pep1, tspl , and slpl. In other embodiments , the fila embodiments , the heterologous polypeptide is a mammalian mentous fungal cell , or Trichoderma cell, has reduced or no polypeptide . In other embodiments , heterologous polypep expression levels of at least three protease encoding genes 35 tide is a non -mammalian polypeptide. selected from gapl , slp1 and pep1. In some embodiments , In embodiments where the filamentous fungal cell con the filamentous fungal cell , for example , a Trichoderma cell tains a recombinant polynucleotide encoding a mammalian has reduced or no expression levels of protease encoding polypeptide, the mammalian polypeptide can be a non genes slp2 , pepl , and gapl . In some embodiments , the glycosylated mammalian polypeptide, a glycosylated mam filamentous fungal cell, for example , a Trichoderma cell has 40 malian polypeptide, or combinations thereof , including , reduced or no expression levels of protease encoding genes without limitation , an immunoglobulin , an antibody, a slp2 , pep1, gapl, and pep4 . In some embodiments , the growth factor, and an interferon . In some embodiments , the filamentous fungal cell, for example , a Trichoderma cell has mammalian polypeptide is an immunoglobulin or antibody. reduced or no expression levels of protease encoding genes In embodiments where the filamentous fungal cell contains slp2, pep1, gap1, pep4 , and slp1 . In some embodiments , the 45 a recombinant polynucleotide encoding an immunoglobulin filamentous fungal cell, for example , a Trichoderma cell has or antibody, the filamentous fungal cell , for example , a reduced or no expression levels of protease encoding genes Trichoderma fungal cell may have reduced or no expression slp2 , pepl , gapl, pep4 , slp1, and slp3 . In some embodi of at least three or at least four protease encoding genes ments , the filamentous fungal cell , for example , a selected from pepl , pep3 , pep4 , pep8 , pep11, pep12 , tsp1, Trichoderma cell has reduced or no expression levels of 50 slp1, slp2, slp7, gap1, and gap2 . In certain preferred embodi protease encoding genes slp2 , pep1, gap1, pep4 , slp1, slp3 , ments , the cell , for example a Trichoderma fungal cell , and pep3 . In some embodiments , the filamentous fungal cell , contains a recombinant polynucleotide encoding an immu for example , a Trichoderma cell has reduced or no expres noglobulin or antibody and has reduced or no expression of sion levels of protease encoding genes slp2, pepl , gapl , the protease encoding genes slp1, slp2 , slp3 , tsp1 , pepl , pep4, slpl, slp3, pep3, and pep2. In some embodiments , the 55 gapl, pep4, pep3 , pep2 , pep5, and gap2. In certain preferred filamentous fungal cell, for example , a Trichoderma cell has embodiments , the cell , for example a Trichoderma fungal reduced or no expression levels of protease encoding genes cell, contains a recombinant polynucleotide encoding an slp2 , pepl , gapl , pep4 , slp1, slp3 , pep3 , pep2 , and pep5 . In immunoglobulin or antibody and has reduced or no expres some embodiments , the filamentous fungal cell, for sion of the protease encoding genes pepl , tspl , slpl , and example , a Trichoderma cell has reduced or no expression 60 gap1 . In other embodiments , the cell contains a recombinant levels of protease encoding genes slp2, pepl, gapl , pep4 , polynucleotide encoding an immunoglobulin or antibody slp1 , slp3 , pep3 , pep2, pep5 , and tspl. In some embodi and has reduced expression of the protease encoding genes ments , the filamentous fungal cell, for example, a pep1 , tsp1, slp1, gapl , and pep4 . In other embodiments , the Trichoderma cell has reduced or no expression levels of cell contains a recombinant polynucleotide encoding an protease encoding genes slp2 , pep1, gap1, pep4 , sip1, slp3 , 65 immunoglobulin or antibody and has reduced expression of pep3 , pep2 , pep5 , tsp1, and slp7 . In some embodiments , the the protease encoding genes slpl , slp2 , and slp3 . In other filamentous fungal cell, for example , a Trichoderma cell has embodiments , the cell contains a recombinant polynucle US 10,731,168 B2 47 48 otide encoding an immunoglobulin or antibody and has slp7, and slp2. In certain embodiments, the cell contains a reduced expression of the protease encoding genes slpl , recombinant polynucleotide encoding a growth factor, inter slp2 , slp3, and tsp1. In other embodiments , the cell contains feron , cytokine , human serum albumin , or interleukin and a recombinant polynucleotide encoding an immunoglobulin has reduced expression of the protease encoding genes pepl , or antibody and has reduced expression of the protease 5 gap1, pep4 , slp7, slp2 , and pep2. In certain embodiments , encoding genes slp1, slp2 , slp3 , tsp1, and pepl . In other the cell contains a recombinant polynucleotide encoding a embodiments , the cell contains a recombinant polynucle growth factor, interferon , cytokine, human serum albumin , otide encoding an immunoglobulin or antibody and has or interleukin and has reduced expression of the protease reduced expression of the protease encoding genes slpl , encoding genes pep1, gapl , pep4 , slp7, slp2, pep2, and pep3 . slp2 , slp3, tsp1, pep1, and gap1. In other embodiments, the 10 In certain embodiments , the cell contains a recombinant cell contains a recombinant polynucleotide encoding an polynucleotide encoding growth factor, interferon , immunoglobulin or antibody and has reduced expression of cytokine , human serum albumin , or interleukin and has the protease encoding genes slp1, slp2 , slp3 , tsp1, pepl , reduced expression of the protease encoding genes pepl, recombinantgapl, and pep4 polynucleotide . In other embodiments encoding ,an the immunoglobulin cell contains a 15 gapl, pep4 , slp7, slp2, pep2, pep3, and pep5. In certain or antibody and has reduced expression of the protease embodiments , the cell contains a recombinant polynucle encoding genes slp1, slp2 , slp3 , tsp1, pep1, gap1, pep4 , and otide encoding a growth factor , interferon , cytokine, human pep3 . In other embodiments , the cell contains a recombinant serum albumin , or interleukin and has reduced expression of polynucleotide encoding an immunoglobulin or antibody the protease encoding genes pep1, gap1, pep4 , slp7 , slp2 , and has reduced expression of the protease encoding genes 20 pep2, pep3, pep5 , and slp1. In certain embodiments , the cell slp1, slp2 , slp3 , tsp1, pep1, gapl , pep4 , pep3 , and pep2. In contains a recombinant polynucleotide encoding a growth other embodiments , the cell contains a recombinant poly factor, interferon , cytokine , human serum albumin , or inter nucleotide encoding an immunoglobulin or antibody and has leukin and has reduced expression of the protease encoding reduced expression of the protease encoding genes slpl , genes pepl , gapl , pep4 , slp7, slp2 , pep2, pep3 , pep5 , slpl, slp2 , slp3 , tsp1, pepl, gapl, pep4 , pep3, pep2, and pep5 . 25 and tspl. In other embodiments , the filamentous fungal cell con In certain embodiments , the mammalian polypeptide is tains a recombinant polynucleotide encoding a growth fac produced at a level that is at least 3 - fold , at least 4 - fold , at tor, interferon , cytokine , or interleukin . In embodiments least 5 - fold , at least 6 -fold , at least 7 - fold , at least 8 - fold , at where the filamentous fungal cell , for example a least Si- fold , at least 10 - fold , at least 15 - fold , at least Trichoderma fungal cell contains a recombinant polynucle- 30 20 - fold , at least 25 - fold , at least 30 - fold , at least 40 - fold , at otide encoding a growth factor, interferon , cytokine, human least 50 - fold , at least 60 - fold , at least 70 - fold , at least serum albumin , or interleukin , the filamentous fungal cell 75 - fold , at least 80 - fold , at least 90 -fold , at least 100 - fold , or may have reduced or no expression of at least three or at a greater fold higher than the production level of the least four protease encoding genes selected from pep1 ,pep2 , polypeptide in a corresponding parental filamentous fungal pep3 , pep4, pep5, pep8 , gap1, gap2 , slp1, slp2 , slp7, and 35 cell without the reduced protease activity . In other embodi tspl. In certain embodiments , the cell contains a recombi ments , the mammalian polypeptide is produced in a full nant polynucleotide encoding a growth factor, interferon , length version at a level higher than the production level of cytokine , human serum albumin , or interleukin and has the full - length version of the polypeptide in a corresponding reduced expression of the protease encoding genes pepl , parental filamentous fungal cell. tsp1, slp1, gap1, and gap2 . In certain embodiments , the cell 40 In embodiments where the filamentous fungal cell con contains a recombinant polynucleotide encoding a growth tains a recombinant polynucleotide encoding a non -mam factor, interferon , cytokine, human serum albumin , or inter malian polypeptide, the non -mammalian polypeptide may leukin and has reduced expression of the protease encoding be an aminopeptidase, amylase , carbohydrase, carboxypep genes slp1, slp2 , pep1, gapl, pep4, slp7 , pep2 , pep3, pep5, tidase, catalase , cellulase, chitinase, cutinase , deoxyribonu tspl, and gap2. In other embodiments , the cell, for example 45 clease , esterase, alpha- galactosidase, beta - galactosidase, a Trichoderma fungal cell , contains a recombinant poly glucoamylase , alpha -glucosidase , beta -glucosidase , inver nucleotide encoding a growth factor , interferon , cytokine , tase , laccase , lipase , mutanase , oxidase , pectinolytic human serum albumin , or interleukin and has reduced enzyme, peroxidase , phospholipase , phytase , polyphe expression of the protease encoding genes pepl, tspl, slp1, noloxidase , proteolytic enzyme, ribonuclease , transglutami gap1, gap2 , and pep4 . In a further embodiment, the cell 50 nase or xylanase . In embodiments where the filamentous contains a recombinant polynucleotide encoding a growth fungal cell contains a recombinant polynucleotide encoding factor , and has reduced expression of a pep - type protease a non -mammalian polypeptide , the filamentous fungal cell genes are selected from pep1 , pep2 , pep3, pep4 , and pep5 . may have reduced or no detectable expression of at least In certain preferred embodiments , the growth factor is IGF - 1 three , at least four, at least five, or at least six protease or the interferon is interferon -a 2b . In certain embodiments , 55 encoding genes selected from pep1, pep2, pep3, pep4 ,pep5 , the cell contains a recombinant polynucleotide encoding a pep8 , pep11, pep12 , tspl , slpl , slp2 , slp3 , gap1, and gap2 . growth factor, interferon , cytokine, human serum albumin , In certain embodiments, the non -mammalian polypeptide is or interleukin and has reduced expression of the protease produced at a level that is at least 3 - fold , at least 4 - fold , at encoding genes pep1, gap1, and pep4 . In certain embodi least 5 - fold , at least 6 -fold , at least 7 -fold , at least 8 - fold , at ments , the cell contains a recombinant polynucleotide 60 least 9- fold , at least 10 - fold , at least 15 - fold , at least 20 - fold , encoding a growth factor, interferon , cytokine , human serum at least 25 - fold , at least 30 -fold , at least 40 - fold , at least albumin , or interleukin and has reduced expression of the 50 - fold , at least 60 - fold , at least 70 - fold , at least 75 - fold , at protease encoding genes pepl , gapl , pep4 , and slp7. In least 80 - fold , at least 90 - fold , at least 100 -fold , or a greater certain embodiments , the cell contains a recombinant poly fold higher than the production level of the polypeptide in a nucleotide encoding a growth factor, interferon , cytokine , 65 corresponding parental filamentous fungal cell . In other human serum albumin , or interleukin and has reduced embodiments , the non -mammalian polypeptide is produced expression of the protease encoding genes pep1, gap1, pep4 , in a full length version at a level higher than the production US 10,731,168 B2 49 50 level of the full- length version of the polypeptide in a HDEL -tagged Trichoderma reesei mannosyl oligosaccha corresponding parental filamentous fungal cell . ride 1,2 - C - D -mannosidase for N - glycan engineering in Reduced Activity of Additional Proteases Pichia pastoris . FEBS Lett 503 : 173-178 . In some embodiments , the filamentous fungal cells or In further embodiments , the filamentous fungal cells or Trichoderma fungal cells of the present disclosure also have 5 Trichoderma fungal cells of the present disclosure also reduced activity of one or more additional proteases . In contain an N -acetylglucosaminyltransferase I catalytic certain embodiments , the expression level of the one or more domain and an N -acetylglucosaminyltransferase II catalytic additional proteases is reduced . In certain preferred embodi domain . Such catalytic domains are useful for expressing ments , genes encoding the one or more additional proteases complex N - glycans in non -mammalian cells . N -acetylglu each comprise a mutation that reduces the corresponding 10 cosaminyltransferase I( GlcNAc - TI; GnTI; EC 2.4.1.101) protease activity . The one or more additional protease catalyzes the reaction UDP -N -acetyl - D -glucosamine + 3 - al encoding genes may be pep7 , tpp1 , gap2, slp3 , slp5 , slp6 , pha - D -mannosyl ) -beta - D -mannosyl - R <=>UDP + 3-( 2-( N slp7 , or slp8 . acetyl- beta - D - glucosaminyl) -alpha - D -mannosyl ) -beta - D cellsIn iscertain an Aspergillusembodiments cell , , when the total the proteasefilamentous activity fungal is 15 mannosyl- R , where R represents the remainder of the reduced to 50 % or less of the total protease activity in the N - linked oligosaccharide in the glycan acceptor. An corresponding parental Aspergillus cell in which the pro N -acetylglucosaminyltransferase I catalytic domain is any teases do not have reduced activity. portion of an N -acetylglucosaminyltransferase I enzyme that In certain embodiments , total protease activity is reduced is capable of catalyzing this reaction . N - acetylglucosami in the cell of the present disclosure , for example a 20 nyltransferase II (GlcNAC - TII ; GnTII ; EC 2.4.1.143 ) cata Trichoderma cell , to 49 % or less , 31 % or less, 13 % or less , lyzes the reaction UDP - N -acetyl - D - glucosamine + 6-( alpha 10 % or less, 6.3 % or less, or 5.5 % or less, of the total D -mannosyl ) -beta - D -mannosyl - R <=>UDP + 6- ( 2-( N - acetyl protease activity in the corresponding parental filamentous beta - D -glucosaminyl ) -alpha - D - mannosyl) -beta - D fungal cell in which the proteases do not have reduced mannosyl - R , where R represents the remainder of the activity. 25 N - linked oligosaccharide in the glycan acceptor. An Additional Recombinant Modifications N - acetylglucosaminyltransferase II catalytic domain is any In certain embodiments , the filamentous fungal cells or portion of an N -acetylglucosaminyltransferase II enzyme Trichoderma fungal cells of the present disclosure also have reduced activity of a dolichyl -P -Man :Man (5 )GleNAc ( 2 ) that is capable of catalyzing this reaction . Examples of PP- dolichyl mannosyltransferase . Dolichyl- P - Man :Man (5 ) 30 domainssuitable andN -an acetylglucosaminyltransferase N -acetylglucosaminyltransferase I II catalytic GlcNAc ( 2 )-PP - dolichyl mannosyltransferase (EC 2.4.1.130 ) transfers an alpha - D -mannosyl residue from domains can be found in International Patent Application dolichyl -phosphate D -mannose into a membrane lipid No. PCT/ EP2011 / 070956 . The N - acetylglucosaminyltrans linked oligosaccharide . Typically , the dolichyl -P -Man :Man ferase I catalytic domain and N -acetylglucosaminyltrans ( 5 )GlNAc ( 2 ) -PP -dolichyl mannosyltransferase enzyme is 35 ferase II catalytic domain can be encoded by a single encoded by an alg3 gene . Thus, in certain embodiments , the polynucleotide . In certain embodiments , the single poly filamentous fungal cell has reduced activity of ALG3, which nucleotide encodes a fusion protein containing the N - acetyl is the activity encoded by the alg3 gene . In some embodi glucosaminyltransferase I catalytic domain and the ments , the alg3 gene contains a mutation that reduces the N -acetylglucosaminyltransferase II catalytic domain . Alter corresponding ALG3 activity . In certain embodiments , the 40 natively , the N -acetylglucosaminyltransferase I catalytic alg3 gene is deleted from the filamentous fungal cell . domain can be encoded by a first polynucleotide and the In other embodiments , the filamentous fungal cells or N - acetylglucosaminyltransferase II catalytic domain can be Trichoderma fungal cells of the present disclosure further encoded by a second polynucleotide . contain a polynucleotide encoding an a - 1,2 -mannosidase . In embodiments where , the filamentous fungal cell or The polynucleotide encoding the a - 1,2 -mannosidase may be 45 Trichoderma fungal cell contains an N - acetylglucosaminyl endogenous in the host cell, or it may be heterologous to the transferase I catalytic domain and an N -acetylglucosaminyl host cell. These polynucleotides are especially useful for a transferase II catalytic domain , the cell can also contain a filamentous fungal cell expressing high -mannose glycans polynucleotide encoding a mannosidase II. Mannosidase II transferred from the Golgi to the ER without effective enzymes are capable of cleaving Man5 structures of Glc exo - a - 2 -mannosidase cleavage. The a - 1,2 -mannosidase 50 NAcMan5 to generate GlcNAcMan3 , and if combined with may be a mannosidase I type enzyme belonging to the action of a catalytic domain ofGnTII , to generate GO ; and glycoside hydrolase family 47 ( cazy.org/GH47_all.html) . In further , with action of a catalytic domain of a galactosyl certain embodiments the a - 1,2 -mannosidase is an enzyme transferase , to generate G1 and G2. In certain embodiments listed at cazy.org/GH47_characterized.html. In particular , mannosidase II - type enzymes belong to glycoside hydrolase the a - 1,2 -mannosidase may be an ER - type enzyme that 55 family 38 ( cazy.org/GH38_all.html) . Examples of such cleaves glycoproteins such as enzymes in the subfamily of enzymes include human enzyme AAC50302 , D. melano ER A -mannosidase I EC 3.2.1.113 enzymes . Examples of gaster enzyme (Van den Elsen J. M. et al (2001 ) EMBO J. such enzymes include human a -2 -mannosidase IB 20 : 3008-3017 ), those with the 3D structure according to ( AAC26169 ) , a combination of mammalian ER mannosi PDB -reference 1HTY , and others referenced with the cata dases , or a filamentous fungal enzyme such as a - 1,2- 60 lytic domain in PDB . For ER /Golgi expression , the catalytic mannosidase (MDS1 ) ( T. reesei AAF34579 ; Maras M et al domain of the mannosidase is typically fused with an J Biotech . 77 , 2000 , 255 ) . For ER /Golgi expression the N - terminal targeting peptide , for example using targeting catalytic domain of the mannosidase is typically fused with peptides listed in the International Patent Application No. a targeting peptide , such as HDEL , KDEL , or part of an ER PCT/ EP2011 /070956 or of SEQ ID NOS 589-594 . After or early Golgi protein , or expressed with an endogenous ER 65 transformation with the catalytic domain of a mannosidase targeting structures of an animal or plant mannosidase I II -type mannosidase , a strain effectively producing enzyme , see , for example , Callewaert et al . 2001 Use of GlcNAc2Man3, GlcNAc Man3 or GO is selected . US 10,731,168 B2 51 52 In certain embodiments that may be combined with the glucosaminyltransferase I catalytic domain and a polynucle preceding embodiments , the filamentous fungal cell further otide encoding an N - acetylglucosaminyltransferase II cata contains a polynucleotide encoding a UDP -GlcNAc trans lytic domain and culturing the filamentous fungal cell to porter. produce the complex N - glycan , for example In certain embodiments that may be combined with the 5 GlcNAc2Man3GlcNAc2 glycan , where the preceding embodiments , the filamentous fungal cell further GlcNAc2Man3GlcNAc2 glycan constitutes at least 5 % , at contains a polynucleotide encoding a B - 1,4 -galactosyltrans least 10 % , at least 20 % , at least 30 % , at least 40 % , at least ferase . Generally, B - 1,4 - galactosyl transferases belong to the 50 % , at least 60 % , at least 70 % , at least 80 % , at least 90 % , CAZY glycosyl transferase family 7 (cazy.org or 100 % (mol % ) of the neutral N -glycans secreted by the GT7_all.html) . Examples of useful 4GalT enzymes include 10 filamentous fungal cell. In certain embodiments , the com 4GalT1, e.g. bovine Bos taurus enzyme AAA30534.1 plex N -glycan , for example GlcNAc2Man3GlcNAc2 gly (Shaper N. L. et al Proc. Natl . Acad . Sci. U.S.A. 83 (6 ), can , represents at least 5 % , at least 10 % , at least 20 % , at 1573-1577 (1986 )) , human enzyme (Guo S. et al. Glycobi least 30 % , at least 40 % , at least 50 % , at least 60 % , at least ology 2001, 11 :813-20 ), and Mus musculus enzyme 70 % , at least 80 % , at least 90 % , or 100 % (mol % ) of the total AAA37297 (Shaper , N. L. et al. 1998 J. Biol. Chem . 263 15 N -glycans of the polypeptide . In certain embodiments , said (21 ), 10420-10428 ) . In certain embodiments of the invention complex N - glycans are GlcNAcMan3 and / or where the filamentous fungal cell contains a polynucleotide GlcNAc2Man3 . encoding a galactosyltransferase , the filamentous fungal cell Another aspect includes methods of producing a Gl or G2 also contains a polynucleotide encoding a UDP -Gal 4 epi N -glycan or mixture thereof, for example merase and / or UDP -Gal transporter. In certain embodiments 20 GalGlcNAc2Man3GlcNAc2 { i.e. G1, i.e. Gai 4GlcNAC of the invention where the filamentous fungal cell contains 2Mana3 (GlcNAc 2Mana6 )Man 4GlcNAc 4GlcNAc} or a polynucleotide encoding a galactosyltransferase , lactose GlcNAc 2Mana3 (Gai 4GlcNAc 2Mana6 )Man 4GlcNAc may be used as the carbon source instead of glucose when 4GlcNAc } and / or Gal2GlcNAc2Man3GlcNAc2 { i.e. G2 , culturing the host cell. The culture medium may be between i.e. Gai 4GlcNAc 2Mana3 (Gai 4 GlcNAc 2Mana6 )Man pH 4.5 and 7.0 or between 5.0 and 6.5 . In certain embodi- 25 4GlcNAc 4GlcNAc } glycan in a filamentous fungal cell ments of the invention where the filamentous fungal cell including the steps of providing a filamentous fungal cell contains a polynucleotide encoding a galactosyltransferase with a recombinant polynucleotide encoding a heterologous and , optionally , a polynucleotide encoding a UDP- Gal 4 polypeptide and a reduced level of activity of an alg3 epimerase and / or UDP -Gal transporter, a divalent cation mannosyltransferase compared to the level of activity in a such as Mn2 + , Ca2 + or Mg2 + may be added to the cell 30 wild -type filamentous fungal cell and comprising further a culture medium . polynucleotide encoding an N -acetylglucosaminyltrans In certain embodiments that may be combined with the ferase I catalytic domain , a polynucleotide encoding an preceding embod ts , the level of activity of alpha -1,6 N - acetylglucosaminyltransferase II catalytic domain , and a mannosyltransferase in the host cell is reduced compared to polynucleotide encoding a GalT catalytic domain and cul the level of activity in a wild - type host cell. In certain 35 turing the filamentous fungal cell to produce the Gl or G2 embodiments , the filamentous fungal has a reduced level of N - glycan or mixture thereof, where Gl glycan constitutes at expression of an ochl gene compared to the level of expres least 5 % , at least 10 % , at least 20 % , at least 30 % , at least sion in a wild - type filamentous fungal cell . 40 % , at least 50 % , at least 60 % , at least 70 % , at least 80 % , Another aspect includes methods of producing a at least 90 % , or 100 % (mol % ) of the neutral N - gl yeans Man3GlcNAc2 N -glycan [ i.e. Mana3 (Manoch )Man 4Glc- 40 secreted by the filamentous fungal cell , or where the G2 NAC 4GlcNAc] in a filamentous fungal cell including the glycan constitutes at least 5 % , at least 10 % , at least 20 % , at steps of providing a filamentous fungal cell with a recom least 30 % , at least 40 % , at least 50 % , at least 60 % , at least binant polynucleotide encoding a heterologous polypeptide 70 % , at least 80 % , at least 90 % , or 100 % (mol % ) of the and a reduced level of activity of an alg3 mannosyltrans neutral N - glycans secreted by the filamentous fungal cell . In ferase compared to the level of activity in a wild -type 45 certain embodiment, G1 glycan constitutes at least 10 % , at filamentous fungal cell and culturing the filamentous fungal least 20 % , at least 30 % , at least 40 % , at least 50 % , at least cell to produce a Man3GlcNAc2 glycan , where the 60 % , at least 70 % , at least 80 % , at least 90 % , or 100 % (mol Man3GlcNAc2 glycan constitute at least 10 % , at least 20 % , % ) of the total N -glycans of the polypeptide . In certain at least 30 % , at least 40 % , at least 50 % , at least 60 % , at least embodiment, G2 glycan constitutes at least 10 % , at least 70 % , at least 80 % , at least 90 % , or 100 % (mol % ) of the 50 20 % , at least 30 % , at least 40 % , at least 50 % , at least 60 % , neutral N -gl yeans secreted by the filamentous fungal cell . In at least 70 % , at least 80 % , at least 90 % , or 100 % (mol % ) certain embodiment, Man3GlcNAc2 N - glycan represents at of the total N - glycans of the polypeptide. least 10 % , at least 20 % , at least 30 % , at least 40 % , at least In certain embodiments , the method of producing a com 50 % , at least 60 % , at least 70 % , at least 80 % , at least 90 % , plex N -glycan will generate a mixture of different glycans . or 100 % (mol % ) of the total N -glycans of the heterologous 55 The complex N - glycan or Man3GlcNAc2 may constitute at polypeptide. least 5 % , at least 10 % , at least 20 % , at least 30 % , at least Another aspect includes methods of producing a complex 40 % , at least 50 % , at least 60 % , at least 70 % , at least 80 % ) , N - glycan (i.e an N - glycan comprising a terminal or at least 90 % or more of such a glycan mixture . In certain GlcNAc2Man3 structure ) , for example embodiments, at least 5 % , at least 10 % , at least 20 % , at least GlcNAc2Man3GlcNAc2 {i.e. GO , i.e. GlcNAc 2Man 3 (G1- 60 30 % , at least 40 % , at least 50 % , at least 60 % , at least 70 % , cNAc 2Man 6 )Man 4GlcNAc 4GlcNAc } glycan in a fila at least 80 % ) , or at least 90 % or more of the N - glycans of mentous fungal cell including the steps of providing a the polypeptide consists of such a glycan mixture . In certain filamentous fungal cell with a recombinant polynucleotide embodiments , the method of producing a complex and G1 encoding a heterologous polypeptide, a reduced level of and / or G2 N - glycan will generate a mixture of different activity of an alg3 mannosyltransferase compared to the 65 glycans. The complex N - glycan , Man3GlcNAc2 ,G1 and/ or level of activity in a wild - type filamentous fungal cell and G2 may constitute at least 5 % , at least 10 % , at least 20 % , at comprising further a polynucleotide encoding an N -acetyl least 30 % , at least 40 % , at least 50 % , at least 60 % , at least US 10,731,168 B2 53 54 70 % , at least 80 % ), or at least 90 % or more of such a glycan Trichoderma Kre2, Kre2 - like, Och1, Anp1, and Vanl. In one mixture . In certain embodiments , at least 5 % , at least 10 % , embodiment, the targeting peptide is selected from the group at least 20 % , at least 30 % , at least 40 % , at least 50 % , at least of SEQ ID NOs: 589-594 . 60 % , at least 70 % , at least 80 % ) , or at least 90 % or more of Uses of the Filamentous Fungal Cells of the Invention the N -glycans of the polypeptide consists of such a glycan 5 The invention herein further relates to methods of using mixture . any of the filamentous fungal cells of the present disclosure , In certain embodiments , methods of producing a hybrid such as Trichoderma fungal cells , that have reduced or no N - glycan are desirable . As used herein , the term “ hybrid ” protease activity of at least three proteases and that contain means a glycan containing both unsubstituted terminalman a recombinant polynucleotide encoding a heterologous poly nose residues ( as are present in high - mannose glycans ) and 10 peptide , such as a mammalian polypeptide, that is produced substituted mannose residues with an N -acetylglucosamine at increased levels , for improving heterologous polypeptide linkage, for example GlcNAcß2Mana3 [Mana3 (Mana6 ) stability and for making a heterologous polypeptide. Meth Mana6 ]Man 4GlcNAc 4GlcNAc. In such embodiments , a ods of measuring protein stability and for making a heter Man5 { i.e Man3 [Mana3 (Mana6 )Mana6 ]Man 4GlcNAC ologous polypeptide are well known, and include, without 4GlcNAc} expressing filamentous fungal cell such as T. 15 limitation , all the methods and techniques described in the reesei strain is transformed with a recombinant polynucle present disclosure . otide encoding a heterologous polypeptide and a polynucle Accordingly , certain embodiments of the present disclo otide encoding an N - acetylglucosaminyltransferase I cata sure relate to methods of improving heterologous polypep lytic domain and the filamentous fungal cell is cultured to tide stability , by : a ) providing a filamentous fungal cell of produce the hybrid N - glycan where the hybrid N - glycan 20 the present disclosure having reduced or no activity of at constitutes at least 5 % , at least 10 % , at least 20 % , at least least three proteases, where the cell further contains a 30 % , at least 40 % , at least 50 % , at least 60 % , at least 70 % , recombinant polynucleotide encoding a heterologous poly at least 80 % , at least 90 % , or 100 % (mol % ) of the neutral peptide ; and b ) culturing the cell such that the heterologous N -glycans secreted by the filamentous fungal cell. In certain polypeptide is expressed , where the heterologous polypep embodiment, at least 10 % , at least 20 % , at least 30 % , at least 25 tide has increased stability compared to a host cell not 40 % , at least 50 % , at least 60 % , at least 70 % , at least 80 % , containing the mutations of the genes encoding the pro at least 90 % , or 100 % (mol % ) of the N - glycans of the teases . Other embodiments of the present disclosure relate to polypeptide consists of a hybrid N - glycan . methods of improving mammalian polypeptide stability , by : The Man3GlcNAc2, complex , hybrid , G1 , and G2 N -gly a ) providing a Trichoderma fungal cell of the present can may be attached to a molecule selected from an amino 30 disclosure having reduced or no activity of at least three acid , a peptide , and a polypeptide. In certain embodiments , proteases, where the cell further contains a recombinant the Man3GlcNAc2 , complex , hybrid ,G1 , and G2 N - glycan polynucleotide encoding a mammalian polypeptide; and b ) is attached to a heterologous polypeptide . In certain embodi culturing the cell such that the mammalian polypeptide is ments , the heterologous polypeptide is a glycosylated pro expressed , where the mammalian polypeptide has increased tein . In certain embodiment, the glycosylated polypeptide is 35 stability compared to a host cell not containing themutations a mammalian polypeptide. In certain embodiments, mam of the genes encoding the proteases. The filamentous fungal malian polypeptide is an antibody or its antigen -binding cell or Trichoderma fungal cellmay be any cell described in fragment. the section entitled “ Filamentous Fungal Cells of the Inven In certain embodiments , glycosyltransferases , or tion " . Methods of measuring polypeptide stability and for example , GnTI, GnTII , or GalT or glycosylhydrolases, for 40 culturing filamentous fungal and Trichoderma fungal cells example , a - 1,2 -mannosidase or mannosidase II , include a are well known in the art, and include, without limitation , all targeting peptide linked to the catalytic domains. The term the methods and techniques described in the present disclo " linked ” as used herein means that two polymers of amino sure . acid residues in the case of a polypeptide or two polymers In certain embodiments , the stability of the heterologous of nucleotides in the case of a polynucleotide are either 45 polypeptide or mammalian polypeptide is increased by at coupled directly adjacent to each other or are within the least 2 - fold , at least 3 - fold , at least 4 - fold , at least 5 - fold , at same polypeptide or polynucleotide but are separated by least 6 - fold , at least 7 - fold , at least 8 - fold , at least 9 - fold , at intervening amino acid residues or nucleotides . A “ targeting least 10 - fold , at least 15 - fold , at least 20 - fold , at least peptide” , as used herein , refers to any number of consecutive 25 - fold , at least 30 - fold , at least 40 - fold , at least 50 - fold , at amino acid residues of the recombinant protein that are 50 least 60 - fold , at least 70 - fold , at least 75 - fold , at least capable of localizing the recombinant protein to the endo 80 - fold , at least 90 - fold , at least 100 - fold , or a greater fold plasmic reticulum ( ER ) or Golgi apparatus (Golgi ) within higher compared to a heterologous polypeptide or mamma the filamentous fungal cell . The targeting peptide may be lian polypeptide expressed in a corresponding parental fila N - terminal or C - terminal to the catalytic domains. In certain mentous fungal or Trichoderma fungal cell . embodiments , the targeting peptide is N - terminal to the 55 Other embodiments of the present disclosure relate to catalytic domains. In certain embodiments , the targeting methods of making a heterologous polypeptide, by: a ) peptide provides direct binding to the ER or Golgi mem providing a filamentous fungal cell of the present disclosure brane . Components of the targeting peptide may come from having reduced or no activity of at least three proteases, any enzyme that normally resides in the ER or Golgi where the cell further contains a recombinant polynucleotide apparatus . Such enzymes include mannosidases ,mannosyl- 60 encoding a heterologous polypeptide; b ) culturing the host transferases , glycosyltransferases , Type 2 Golgi proteins , cell such that the heterologous polypeptide is expressed ; and and MNN2, MNN4 , MNN6 , MNNY, MNN10 , MNS1 , c ) purifying the heterologous polypeptide. Further embodi KRE2, VAN1, and OCH1 enzymes . Suitable targeting pep ments of the present disclosure relate to methods ofmaking tides are described in the International Patent Application a mammalian polypeptide, by : a) providing a Trichoderma No. PCT/ EP2011 /070956 . In one embodiment , the targeting 65 fungal cell of the present disclosure having reduced or no peptide of GnTI or GnTII is human GnTII enzyme. In other activity of at least three proteases , where the cell further embodiments, targeting peptide is derived from contains a recombinant polynucleotide encoding a mamma US 10,731,168 B2 55 56 lian polypeptide; b ) culturing the host cell such that the mass of the produced antibody. Methods of determining the mammalian polypeptide is expressed ; and c ) purifying the mass percentage of polypeptide fragments are well known in mammalian polypeptide. The filamentous fungal cell or the art and include, measuring signal intensity from an SDS -gel . Trichoderma fungal cell may be any cell described in the In further embodiments , the non -mammalian polypeptide section entitled “ Filamentous Fungal Cells of the Inven- 5 is selected from an aminopeptidase, amylase , carbohydrase, tion ” . Methods of culturing filamentous fungal and carboxypeptidase , catalase , cellulase. chitinase, cutinase , Trichoderma fungal cells and purifying polypeptides are deoxyribonuclease, esterase , alpha -galactosidase , beta - ga well known in the art , and include, without limitation , all the lactosidase, glucoamylase , alpha- glucosidase , beta -glucosi methods and techniques described in the present disclosure . dase, invertase , laccase , lipase , mutanase , oxidase , pecti In certain embodiments , the filamentous fungal cell or 10 nolytic enzyme, peroxidase , phospholipase , phytase, Trichoderma fungal cell is cultured at a pH range selected polyphenoloxidase , proteolytic enzyme, ribonuclease , trans from pH 3.5 to 7 ; pH 3.5 to 6.5 ; pH 4 to 6 ; pH 4.3 to 5.7 ; glutaminase , and xylanase . pH 4.4 to 5.6 ; and pH 4.5 to 5.5 . In certain embodiments , to In certain embodiments of any of the disclosed methods, produce an antibody the filamentous fungal cell or the method includes the further step of providing one or Trichoderma fungal cell is cultured at a pH range selected 15 more , two or more , three or more , four or more , or five or from 4.7 to 6.5 ; pH 4.8 to 6.0 ; pH 4.9 to 5.9 ; and pH 5.0 to more protease inhibitors . In certain embodiments , the pro 5.8 . tease inhibitors are peptides that are co -expressed with the In some embodiments , the heterologous polypeptide is a mammalian polypeptide. In other embodiments , the inhibi mammalian polypeptide. In other embodiments , the heter tors inhibit at least two , at least three , or at least four ologous polypeptide is a non -mammalian polypeptide. 20 proteases from a protease family selected from aspartic In certain embodiments , the mammalian polypeptide is proteases , trypsin - like serine proteases , subtilisin proteases , selected from an immunoglobulin , immunoglobulin heavy and glutamic proteases . chain , an immunoglobulin light chain , a monoclonal anti In certain embodiments of any of the disclosed methods, body , a hybrid antibody , an Fab ' ) 2 antibody fragment, an the filamentous fungal cell or Trichoderma fungal cell also F ( ab ) antibody fragment, an Fv molecule , a single - chain Fv 25 contains a carrier protein . As used herein , a “ carrier protein ” antibody , a dimeric antibody fragment, a trimeric antibody is portion of a protein that is endogenous to and highly fragment, a functional antibody fragment, a single domain secreted by a filamentous fungal cell or Trichoderma fungal antibody , multimeric single domain antibodies , an immuno cell . Suitable carrier proteins include , without limitation , adhesin , insulin -like growth factor 1 , a growth hormone , those of T. reesei mannanase I (Man5A , or MANI) , T. reesei insulin , and erythropoietin . In other embodiments , the mam- 30 heimocellobiohydrolase et al Appl . II Environ(Cel6A ., Microbiolor CBHII . ) 2003(see , Decembere.g., Palo; malian protein is an immunoglobulin or insulin - like growth 69 ( 12 ) : 7073-7082 ) or T. reesei cellobiohydrolase I (CBHI ) . factor 1. In yet other embodiments , the mammalian protein In some embodiments , the carrier protein is CBH1 . In other is an antibody. In further embodiments , the yield of the embodiments , the carrier protein is a truncated T. reesei mammalian polypeptide is at least 0.5 , at least 1 , at least 2 , CBHI protein that includes the CBHI core region and part of at least 3 , at least 4 , or at least 5 grams per liter. In certain 35 the CBHI linker region . In some embodiments , a carrier embodiments , the mammalian polypeptide is an antibody, such as a cellobiohydrolase or its fragment is fused to an optionally , IgG , IgG2, IgG3, or IgG4. In further embodi antibody light chain and /or an antibody heavy chain . In ments , the yield of the antibody is at least 0.5 , at least 1, at some embodiments , a carrier such as a cellobiohydrolase or least 2 , at least 3 , at least 4 , or at least 5 grams per liter. In its fragment is fused to insulin -like growth factor 1 , growth still other embodiments , the mammalian polypeptide is a 40 hormone , insulin , interferon alpha 2b , fibroblast growth growth factor or a cytokine . In further embodiments , the factor 21 , or human serum albumin . In some embodiments , yield of the growth factor or cytokine is at least 0.1 , at least a carrier - antibody fusion polypeptide comprises a Kex2 0.2 , at least 0.3 , at least 0.4 , at least 0.5 , at least 1 , at least cleavage site . In certain embodiments , Kex2, or other carrier 1.5 , at least 2 , at least 3 , at least 4 , or at least 5 grams per cleaving enzyme, is endogenous to a filamentous fungal cell . liter. In further embodiments , the mammalian polypeptide is 45 In certain embodiments , carrier cleaving protease is heter an antibody, and the antibody contains at least 70 % , at least ologous to the filamentous fungal cell, for example , another 80 % , at least 90 % , at least 95 % , or at least 98 % of a natural Kex2 protein derived from yeast or a TEV protease . In antibody C - terminus and N - terminus without additional certain embodiments , carrier cleaving enzyme is overex amino acid residues. In other embodiments , the mammalian pressed . polypeptide is an antibody, and the antibody contains at least 50 It is to be understood that, while the invention has been 70 % , at least 80 % , at least 90 % , at least 95 % , or at least 98 % described in conjunction with the certain specific embodi of a natural antibody C - terminus and N - terminus that do not ments thereof, the foregoing description is intended to lack any C -terminal or N - terminal amino acid residues illustrate and not limit the scope of the invention . Other In certain embodiments where the mammalian polypep aspects , advantages, and modifications within the scope of tide is purified from cell culture , the culture containing the 55 the invention will be apparent to those skilled in the art to mammalian polypeptide contains polypeptide fragments that which the invention pertains . make up a mass percentage that is less than 50 % , less than The invention having been described , the following 40 % , less than 30 % , less than 20 % , or less than 10 % of the examples are offered to illustrate the subject invention by mass of the produced polypeptides . In certain preferred way of illustration , not by way of limitation . embodiments , the mammalian polypeptide is an antibody, 60 and the polypeptide fragments are heavy chain fragments EXAMPLES and / or light chain fragments . In other embodiments , where the mammalian polypeptide is an antibody and the antibody Example 1 -Identification of Aspartic Proteases in purified from cell culture , the culture containing the anti Trichoderma reesei body contains free heavy chains and/ or free light chains that 65 make up a mass percentage that is less than 50 % , less than This example demonstrates the ability of aspartic pro 40 % , less than 30 % , less than 20 % , or less than 10 % of the teases from Trichoderma reesei ( T. reesei ) culture superna US 10,731,168 B2 57 58 tants to degrade antibody heavy chains and light chains. mM PIPPS , pH 5.5 . Three different model antibodies were Aspartic Protease Purification incubated (0.05 ug ul final concentration ) in the shake flask It was found that protease activity in T. reesei supernatants culture supernatants (diluted 2 mg/ ml in sodium citrate could be inhibited with the aspartic protease inhibitor pep buffer pH 5.5 ) of the pepl deletion strain and its parental statin A. Therefore, pepstatin A (Sigma # P2032 ) was 5 strain Ml 24 , and as a comparison in a fermentation culture attached to agarose beads via a diaminodipropylamine supernatant of the parental strain . Supernatant samples ( 30 linker, and was used as an affinity resin for purification. The ul) from day 5 cultures containing antibody were loaded into T. reesei fed batch fermentation supernatant ( 15 ml) was a 4-15 % SDS PAGE gel and transferred to nitrocellulose for used to batch bind proteases to the resin in 35 ml of buffer immunoblotting with an anti- heavy chain AP conjugated containing 50 mM sodium acetate , 0.2 M NaCl, pH 3.0 . The 10 antibody ( Sigma # A3188 ) or anti -light chain antibody AP column was washed with the samebinding buffer and bound conjugate (Sigma # A3813 ) diluted 1 : 30,000 in TBST . When protein was removed with elution buffer (50 mM Tris -HCL , incubated with antibody overnight for 18 hours , the Apep1 1 M NaCl, pH 8.5 ). Fractions of 0.5 ml were collected . In supernatant degraded less of the heavy chain protein as total 42 ug of protease was purified . The peak fraction compared to the M1 24 control strain or fermentation super contained 0.04 ug/ ul protein . 30 ul of each fraction was 15 natant (pH 5.5 ; 28 ° C .; 20 g /L spent grain extract, 60 g /L mixed with 6 ul of Laemmli sample buffer containing lactose ) (FIG . 39 ). The heavy chain was more susceptible to B -mercaptoethanol . The samples were heated at 95 ° C. for 5 degradation as compared to the light chain . The biggest minutes before being loaded into a 4-15 % PAGE gel (Bio stabilization effect was evident for rituximab and MAB01 Rad mini - protean TGX precast gel ) along with a broad range heavy chains . In the heavy chain , two distinct degradation prestained molecular weightmarker (BioRad ) . The gel was 20 products can be seen -48 kD and -38 kD (FIG . 39 ) . There run in SDS PAGE running buffer for 30 minutes at 100 V , was only a slight improvement in the stability of light chain and then stained with GelCode ( Thermo Scientific ) blue protein in the Apepl supernatant as compared to controls stain . (FIG . 39 ) . A 42 kD doublet band was purified in the pepstatin A Generation of Pep 1 Deletion Plasmid affinity column (FIG . 1) , and was excised from the SDS 25 The first deletion construct for pepl (TrelD74156 ), was PAGE gel and subjected to in - gel trypsin digestion with designed to enable removal of the selection marker from the sequencing grade modified trypsin (Promega # V5111 ) . The Trichoderma reesei genome after successful integration and resulting peptides were then extracted from the gel and thereby recycling of the selection marker for subsequent purified by CI 8 Zip Tip (Millipore # ZTC18M096 ) . The protease gene deletions. In this approach , the recycling of purified peptides were analyzed by LC -MS / MS on a QSTAR 30 the marker , i.e. removal of pyr4 gene from the deletion Pulsar , ESI- hybrid quadrupole - TOF (AB Sciex ). construct, resembles so called blaster cassettes developed This analysis resulted in the identification of 4 aspartic for yeasts (Hartl , L. and Seiboth , B., 2005 , Curr Genet proteases that have very similar molecular weights . The 48 :204-211 ; and Alani, E. et al ., 1987, Genetics 116 :541 identified proteases included : pep1 ( Tre74156 ; 42.7 kD , 545 ) . Similar blaster cassettes have also been developed for 42 % sequence coverage) , pep2 ( Tre53961; 42.4 kD , 15 % 35 filamentous fungi including Hypocrea jecorina (anamorph : sequence coverage ), pep3 ( Trel21133 ; 49 kD , 6 % sequence T. reesei ) (Hartl , L. and Seiboth , B., 2005 , Curr Genet coverage) , and pep5 ( Tre81004 ; 45 kD , 9 % sequence cov 48 : 204-211 ) . erage ) . These aspartic proteases ran at a similar molecular The Treld number refers to the identification number of weight in the PAGE gel . Their amino acid sequence simi a particular protease gene from the Joint Genome Institute larity is between 51 % -64 % . 40 Trichoderma reesei v2.0 genome database . Primers for con Protein (0.8 ug ) from the peak fraction ( F3 ) was then struction of deletion plasmids were designed either “ by eye ” incubated with IgG (50 ug ml) in sodium citrate buffer (50 or using Primer3 software (Primer3 website , Rozen and mM , pH 5.5 ) at 37 ° C. for 20 hours (FIG . 2 ). The protein was Skaletsky ( 2000 ) Bioinformatics Methods and Protocols : incubated either in the presence or absence of 10 uM Methods in Molecular Biology . Humana Press , Totowa , pepstatin A. The antibody mixture was combined with 45 N.J., pp 365-386 ). Laemmli sample buffer and heated at 95 ° C. for 5 minutes. The principle of the blaster cassette using pyr4 as the These samples were then loaded into a 4-15 % PAGE gel marker gene is as follows: pyr4 , encoding orotidine - 5 : (BioRad mini- protean TGX precast gel) along with a broad monophosphate (OMP ) decarboxylase of T. reesei ( Smith , J. range prestained molecular weight marker (BioRad ). The L., et al. , 1991 , Current Genetics 19 :27-33 ) is needed for gel was run in SDS PAGE running buffer for 30 minutes at 50 uridine synthesis . Strains deficient for OMP decarboxylase 100 V. The IgG was not reduced before being run on the gel . activity are unable to grow on minimal medium without Full size IgG runs just above the 200 kDa marker . As can be uridine supplementation ( i.e. are uridine auxotrophs) . The seen in the nonreducing gel in FIG . 2 , the aspartic proteases utilisation of 5 - fluoroorotic acid ( 5 -FOA ) in generation of were able to produce mild degradation of the IgG . Moreover, mutant strains lacking OMP decarboxylase activity (pyr4 IgG degradation was inhibited by pepstatin A. The aspartic 55 strains) is based on the conversion of 5 -FOA to a toxic protease activity was more limited at pH 5.5 than at acidic intermediate 5 - fluoro -UMP by OMP decarboxylase . There pHs, where they had maximal activity . fore , cells which have a mutated pyr4 gene are resistant to Analysis of pep1 Deletion 5 - FOA , but in addition are also auxotrophic for uridine. The The aspartic protease pepl protease was then tested to 5 - FOA resistance can in principle result also from a muta purifyingdetermine itsaspartic abundance proteases in T. reesei from. Thissupernatant was performed samples by 60 tionferase in ), andanother therefore gene the (pyr2 spontaneous , orotate mutantsphosphoribosyltrans obtained with derived from the pepl deletion strain M182 . TheM182 pep1 this selection need to be verified for the pyr4 " genotype by deletion strain also produces the rituximab antibody . complementing the mutant with the pyr4 gene . Once The M181 pepl deletion strain made in the base strain mutated , the pyr4 gene can be used as an auxotrophic M124 was grown in large shake flask cultures along with 65 selection marker in T. reesei . In our blaster cassette pyr4 is M124 control flasks. The cultures were grown in 300 ml of followed by a 308 bp direct repeat of pyr4 5 ' untranslated TrMM with 4 g / L lactose, 2 g / L spent grain extract, and 100 region (5'UTR ) and surrounded by 5 ' and 3 ' flanking regions US 10,731,168 B2 59 60 of the gene to be deleted . Integration of the deletion cassette vector and the flanking regions for removal of vector is selected via the pyr4 function . Removal of the pyr4 sequence prior to transformation into T. reesei. Vector back marker is then forced in the presence of 5 - FOA by recom bone pRS426 was digested with restriction enzymes (EcoRI bination between the two homologous regions (direct repeat and Xhol) . The restriction fragments were then separated of 5'UTR ) resulting in looping out of the selection marker 5 with agarose gel electrophoresis , and the correct fragments and enabling the utilisation of the same blaster cassette (pyr4 were isolated from the gel with a gel extraction kit ( Qiagen ) loopout) in successive rounds of gene deletions . After loop using standard laboratory methods. ing out only the 308 bp sequence of 5'UTR remains in the To construct the deletion plasmid , the vector backbone locus. and the appropriate marker and flanking region fragments Thus, the pyr4 selection marker and the 5 ' direct repeat 10 were transformed into Saccharomyces cerevisiae ( strain fragment ( 308 bp of pyr4 5'UTR ) were produced by PCR H3488 /FY834 ). The yeast transformation protocol was using plasmid PARO502 ( containing a genomic copy of T. based on the method for homologous yeast recombination reesei pyr4 ) as a template . PCR amplification was performed described in the Neurospora knockouts workshop material with Phusion polymerase and either HF buffer or GC buffer , of Colot and Collopy, (Dartmouth Neurospora genome or with Dynazyme EXT polymerase . The reaction condi- 15 protocols website ) , and the Gietz laboratory protocol (Uni tions varied based on the fragment being amplified . Both versity of Manitoba , Gietz laboratory website ) . The plasmid fragments contained 40 bp overlapping sequences needed to DNA from the yeast transformants was rescued by transfor clone the plasmid with the loopout cassette using homolo mation into Escherichia coli . A few clones were cultivated , gous recombination in yeast ( see below ). To enable possible plasmid DNA was isolated and digested to screen for correct additional cloning steps , an Ascl digestion site was placed 20 recombination using standard laboratory methods . A few between the pyr4 marker and the 5 ' direct repeat and Noti clones with correct insert sizes were sequenced and stored . sites to surround the complete blaster cassette . The first deletion plasmid for pepl (plasmid p?Tv41 , 1066 bp of 5 ' flanking region and 1037 bp of 3 ' flanking Table 1.1) used another selection marker , bar, a synthetic region were selected as the basis of the pepl deletion construct carrying a phosphinothricin N - acetyltransferase of plasmid . Fragments were produced by PCR . Products were 25 Streptomyces ssp (GenBank ID : AF013602.1 , Sweigard et separated with agarose gel electrophoresis and correct frag al, 1997, Fungal Genet Newsl 44 : 52-53 ) . The flanking ments were isolated from the gel with a gel extraction kit region and marker fragments were produced by PCR and ( Qiagen ) using standard laboratory methods. Template DNA assembled to a plasmid using the yeast recombination used in the amplification of the flanking regions was from method described above. To clone the second pepl deletion the T. reesei wild type strain QM6a (ATCC 13631) . 30 plasmid (p TTv71 , Table 1.1 ) , the bar marker was removed For the yeast homologous recombination system used in from the deletion plasmid p?Tv41 with Notl digestion and cloning , overlapping sequences for the vector and the selec replaced by the pyr4 blaster cassette described above using tion marker were placed to the appropriate PCR -primers . To the yeast homologous recombination system . These deletion enable marker switch in the construct, Noil restriction sites plasmids for pepl (pTTv41 and PTTv71) result in 1874 bp were introduced between the flanking regions and the selec- 35 deletion in the pep1 locus and cover the complete coding tion marker. Pmel restriction sites were placed between the sequence of PEP1. TABLE 1.1 Primers for generating pepl deletion plasmids . Primer Sequence Deletion plasmid pTTV4I for pepl ( TreID74156 ) , vector backbone PRS426 5flankfw GTAACGCCAGGGTTTTCCCAGTCACGACGGTTTAAACGTATTGCGATGAGCAGC AGA ( SEQ ID NO : 243 ) 5flankrev ATCCACTTAACGTTACTGAAATCTGGTCTCCTAACCCACCAAG ( SEQ ID NO : 244 ) 3 flankfw CTCCTTCAATATCATCTTCTGTCTGTGAAATGAGGTCCCTTCC ( SEQ ID NO : 245 ) 3 flankrev GCGGATAACAATTTCACACAGGAAACAGCGTTTAAACCAAACGCAGCAGAAAC CATA ( SEQ ID NO : 246 )
PTfwd GATTTCAGTAACGTTAAGTGGATGCGGCCGCGACAGAAGATGATATTGAAG ( SEQ ID NO : 247 ) PTrev GACAGAAGATGATATTGAAGGAGGCGGCCGCTTAAGTGGATCCCGGTGAC ( SEQ ID NO : 248 ) Deletion plasmid PTTV71 for pepl ( TreID74156 ) , vector backbone p?Tv41 T315_pyr4_for GGTGGGTTAGGAGACCAGATTTCAGTAACGTTAAGTGGATGCGGCCGCCTAGC ATCGACTACTGCTGC ( SEQ ID NO : 249 ) T316_pyr4_rev GCAGCAGTAGTCGATGCTAGGCGCGCCATGCAAAGATACACATCAA ( SEQ ID NO : 250 ) T317_pyr4_loop_for TTGATGTGTATCTTTGCATGGCGCGCCTAGCATCGACTACTGCTGC (SEQ ID NO : 251 ) US 10,731,168 B2 61 62 TABLE 1.1 - continued Primers for generating pepl deletion plasmids . Primer Sequence T318_pyr4_loop_rev AGGGACCTCATTTCACAGACAGAAGATGATATTGAAGGAGGCGGCCGCGGCTG ATGAGGCTGAGAGAG ( SEQ ID NO : 252 )
10 Generation of pep1 Deletion Strains Ml 81 and Ml 95 Ed Central for Windows 95 (Clone Manager 5 for Windows To enable recycling of the selection marker and allow 95 ) or Geneious Pro 5.3.6 software, (Geneious website ) . rapid deletion of subsequent protease genes , pepl was Southern analyses also verified that four of the clones were single integrants (FIGS . 3B and 3C ). Three clones indicated deleted from M127 (pyr4– mutant of the basic strain M124 ) multiple or inaccurate integration of the deletion cassette using the pyr4 blaster cassette described above . To remove 15 and were discarded . Two pure clones were designated with the vector sequence, plasmid p?Tv71 ( Apep1 -pyr4 ) was strain numbers M181 (9-20A - 1 ) and M195 ( 9-35A - 1 ). digested with Pmel and the correct fragment was purified Generation of Rituximab Producing pep1 Deletion Strain from an agarose gel using QIAquick Gel Extraction Kit M182 ( Qiagen ) . Approximately 5 ug of the pepl deletion cassette To remove vector sequence , plasmid p?Tv41 (Apep1 -bar ) was used to transform strain M127. Preparation of proto 20 was digested with Pmel and the correct fragment was plasts and transformation for pyr4 selection were carried out purified from agarose gel using QIAquick Gel Extraction Kit essentially according to methods in Penttila et al . ( 1987 , (Qiagen ). Approximately 5 ug of the pepl deletion cassette Gene 61 : 155-164) and Gruber et al ( 1990 , Curr . Genet . was used to transform strain M169 ( expressing harmonized 18 : 71-76 ) . rituximab antibody ). Preparation of protoplasts and trans 200 clones were picked as selective streaks. 24 transfor- 25 formation were carried out according to methods described mants growing fast as selective streaks were screened by in Penttila et al ( 1987) and Avalos et al. (1989 ) . PCR using the primers listed in Table 1.2 for the correct Approximately 100 clones were picked as selective integration using standard laboratory methods. Seven puta streaks . 24 transformants growing fast as selective streaks tive disruptants were purified to single cell clones . Deletion were screened by PCR (using the primers listed in Table 1.2 ) of pep1 was verified by Southern analyses from these clones 30 for the correct integration using standard laboratory meth (FIG . 3A ) using standard laboratory methods. DNA for ods. Eight putative disruptants were purified to single cell Southern analyses was extracted with Easy -DNA kit for clones . Deletion of pepl was verified by Southern analyses genomic DNA isolation ( Invitrogen ) . Southern analyses from five clones (FIG . 4A ) using standard laboratory meth were essentially performed according to the protocol for ods described above for M181 and M195 . Southern analyses homologous hybridizations in Sambrook et al . (1989 , 35 also verified that four of the clones were single integrants Molecular Cloning : A laboratory manual . 2nd Ed ., Cold (FIGS . 4B and 4C ) . One clone indicated multiple or inac Spring Harbor Laboratory Press) using radioactive labeling curate integration of the deletion cassette and was discarded . ( 32P ) , HexaLabel Plus , or DecaLabel Plus kits ( Fermentas ). One pure clone (11-1A ) was designated with strain number Southern digestion schemes were designed using either Sci M182 . TABLE 1.2 Primers for screening integration of pepi deletion constructs . Primer Sequence For screening integration of prTv41 T075_74156_5int TCGCTGTAACGAACTTCTGT ( SEQ ID NO : 253 ) T032_Bar_loppu_for CATTGTTGACCTCCACTAGC ( SEQ ID NO : 254 ) T076_74156_3int GCTGCTGATCGGACATTTTT ( SEQ ID NO : 255 ) T031_Bar_alku_rev2 GTTTCTGGCAGCTGGACT ( SEQ ID NO : 256 ) For screening integration of prTv71 T075_74156_5int TCGCTGTAACGAACTTCTGT ( SEQ ID NO : 257 ) T027_Pyr4_orf_start_rev TGCGTCGCCGTCTCGCTCCT ( SEQ ID NO : 258 ) For screening deletion of pepl ORF T077_74156_5orf_pcr CGACGATCTACAGCCATCTG ( SEQ ID NO : 259 ) T078_74156_3orf_pcr ACCCAAAGCGTCCTTCATTA ( SEQ ID NO : 260 ) US 10,731,168 B2 63 64 Analysis of Rituximab Producing pep1 Deletion Strain described for the p?Tv41 pepl deletion plasmid above . 920 M182 bp of 5 ' flanking region and 1081 bp of 3 ' flanking region The M182 strain was grown in Trichoderma minimal were selected as the basis of the pep2 deletion plasmid . medium ( TrMM ) supplemented with 20 g /l spent grain Flanking region fragments were produced by PCR using the extract, 60 g /1 lactose , and 8.1 g / l casamino acids at pH 5.5 5 and 28 ° C. Seven microgram of aspartic protease was primers listed in Table 1.3 . The products were separated with recovered from 15 ml of supernatant. When the purified agarose gel electrophoresis and the correct fragments were fractions were run on a 4-15 % SDS PAGE gel (BioRad isolated from the gel with gel extraction kit ( Qiagen ) using mini- protean TGX precast gel ), the 42 kD molecular weight standard laboratory methods. Template DNA used in the band previously seen in the parent strain had disappeared 10 PCR ofthe flanking regions was from the T. reesei wild type (FIG . 5 ) . Only a faintband around 40 kD could be seen . The 40 kD band may correspond to minor aspartic proteases . A strain QM6a . The bar cassette was obtained from p?Tv41 second purification was done from a cultivation supernatant with Notí digestion . The vector backbone was EcoRI/ Xhol where pepl was present. The Ml 69 strain produced ritux digested pRS426 as for p?Tv41 above. The plasmid was imab and did not contain a pep1 protease deletion . The strain 15 constructed using the yeast homologous recombination was grown in Trichoderma minimal medium supplemented method described for p?Tv41 above . This deletion plasmid with 20 g /l spent grain extract , 60 g /l lactose , and 8.1 g /1 for pep2 (pTTv96 ) results in a 1437 bp deletion in the pep2 casamino acids at pH 5.5 and 28 ° C. 17 ug of aspartic locus and covers the complete coding sequence of PEP2 . TABLE 1.3 Primers for generating pep2 deletion plasmid . Primer Sequence 5'flank fw_vector GTAACGCCAGGGTTTTCCCAGTCACGACGGTTTAAACTTCAGTTGTGGCA TCTCAGC ( SEQ ID NO : 261 ) 5'flank rev_marker GCCAAGCCCAAAAAGTGCTCCTTCAATATCATCTTCTGTCGCGGCCGCGG cassette promoter GAAGCAAGTTTCGAAGTG ( SEQ ID NO : 262 ) 3'flank fw_marker CCCGTCACCGAGATCTGATCCGTCACCGGGATCCACTTAAGCGGCCGCA cassette end ATGGATGAGGTGTGGCTTC ( SEQ ID NO : 263 ) 3'flank rev_vector GCGGATAACAATTTCACACAGGAAACAGCGTTTAAACTCCTCACCGAAG AGCAAGTC ( SEQ ID NO : 264 )
35 protease were purified from 15 ml of supernatant, and Generation of Rituximab Producing pep2 Deletion Strain showed 42 kD band on the SDS PAGE gel ( FIG . 5 ) . M455 According to this analysis , approximately 10 ug of pep1 To remove vector sequence , plasmid PTTv96 (Apep2 -bar ) protease is produced per 15 ml of culture supernatant. That was digested with Pmel and the correct fragment was is about 60 % of the total aspartic protease and only about 40 purified from an agarose gel using QIAquick Gel Extraction 0.04 % of total protein content in the supernatant. This data Kit (Qiagen ) . Approximately 6 ug of the pep2 deletion demonstrates that pep1 is the most abundant aspartic pro cassette was used to transform strain M169 ( expressing tease in T. reesei. harmonized rituximab antibody ). Preparation of protoplasts Analysis of Other Aspartic Proteases and transformation were carried out as described for M182 Deletion of pep2 showed only a slight improvement in 45 above using bar selection . antibody heavy chain production and reduced total protease Over 200 clones were picked as selective streaks . 29 activity (FIGS . 6 and 7 ) . transformants grew well as second streaks. The best 10 Therefore , pep3 and pep5 were the next important pro transformants growing fast as selective streaks were teases to be deleted especially in a pep1 /tsp1 / slp1 triple screened for the correct integration by PCR , using the deletion strain , as they still contribute up to half of the 50 primers listed in Table 1.4 , using standard laboratory meth remaining protease activity in a triple deletion strain super ods . The deletion cassette was integrated properly in 9 of the natant. 10 clones analyzed . The open reading frame was deleted in Generation of pep2 Deletion Plasmid 9 of the 10 transformants analyzed by PCR . Five disruptants The p?Tv96 deletion plasmid for the aspartic protease were purified to single cell clones. One pure transformant pep2 ( TreID0053961) was constructed essentially as ( 206A ) was designated with strain number M455 . TABLE 1.4 Primers for screening integration pep2 deletion constructs . Primer Sequence For screening integration of prTv96 5'flank fw_vector GTAACGCCAGGGTTTTCCCAGTCACGACGGTTTAAACTTCAGTTGTGGCA TCTCAGC ( SEQ ID NO : 265 ) TO32_Bar_loppu_for CATTGTTGACCTCCACTAGC ( SEQ ID NO : 266 ) US 10,731,168 B2 65 66 TABLE 1.4 - continued Primers for screening integration pep2 deletion constructs . Primer Sequence TO30_Bar_alku_rev CGTCACCGAGATCTGATCC ( SEQ ID NO : 267 ) 3'flank rev_vector GCGGATAACAATTTCACACAGGAAACAGCGTTTAAACTCCTCACCGAAG AGCAAGTC ( SEQ ID NO : 268 ) For screening deletion of pep2 ORF T601_pep2 fwd GACGTGGTACGACAACATCG ( SEQ ID NO : 269 ) T623_pep2 rev TATCAAGGTACCGGGGACAG ( SEQ ID NO : 270 )
15 Analysis of Rituximab Producing pep2 Deletion Strain TBST) and anti- IgG AP conjugated secondary antibody The M455 strain , 4 other pep2 deletion transformants , and ( 1: 5000 in TBST ). All antibody incubations were done for 1 the parental rituximab production strain M169 were grown hour at room temperature on a shaker. The membranes were in shake flask cultures in Trichoderma minimal medium then washed with 3 changes of TBST for 20 minutes each on ( TrMM ) supplemented with 20 g /l spent grain extract, 40 g / l 20 the shaker . The membranes were developed with the BCIP / lactose , 100 mM PIPPS , and 8.1 casamino acids at pH 5.5 NBT alkaline phosphatase substrate (Promega # S3771) for and 28 ° C. To analyze the effect on rituximab production , 30 up to 5 minutes . As shown in FIG . 8 , the pep3 protease had ul of supernatant from the day 5 culture samples was low MAB01 degrading activity at pH 5.5 after overnight subjected to immunoblotting . The heavy chain was detected 25 incubation at 37 ° C., but the activity was higher at pH 4.5 . with the anti -heavy chain AP conjugated antibody (Sigma The pep7 protease only had minimal antibody degrading # A3188 ) diluted 1 : 10,000 in TBST . The light chain was activity at pH 4.5 . detected with the anti- kappa light chain AP conjugated Isolation of Additional Aspartic Proteases Using SIP Peptide antibody (Sigma # A3813 ) . A slight improvement in heavy Several additional aspartic proteases were isolated from chain production was seen in transformant 206A (FIG . 6 ). 30 the T. reesei M277 triple protease deletion strain (pep1 , tsp1, The heavy chain was fragmented , but the full length and the slp1) . The M277 strain does not express heterologous pro 38 kD fragment were slightly improved over the parental teins. The M277 deletion strain was generated as described stain . Additionally , total protease activity was measured with in Example 4 below . The strain was grown in Trichoderma succinylated casein (QuantiCleave protease assay kit , Pierce minimal medium supplemented with 20 g /l spent grain # 23263) according to the manufacturer's protocol. Trans- 35 extract , 60 g /l lactose , and 9 g /1 casamino acids at pH 5.5 and formant 206A /M455 showed the biggest decrease in pro 28 ° C. The aspartic proteases were isolated by affinity tease activity compared to the parent strain M169 activity purification using the SIP peptide (Ac -Phe -Lys - Phe- ( AH ( FIG . 7 ) . The total protease activity in the supernatant was PPA ) -Leu - Arg - NH2) ( Kataoka Y. et al. 2005 FEBS Letters reduced by 10 % for M455 . 579 , pp 2991-2994 ). The SIP peptide was conjugated to Analysis of Pichia - Expressed Aspartic Proteases 40 NHS activated agarose resin (Pierce # 26196 ) using the The T. reesei aspartic proteases pep3 ( trel21133 ) and pep7 protocol provided by the manufacturer. The SIP affinity resin ( tre58669 ) expressed from Pichia were also tested in vitro , was used to purify proteases. Fermentation supernatant ( 15 by measuring the degradation of the MAB01 antibody and ml) from the T. reeseiM277 strain was then used to batch IGF - 1 . Degradation of MAB01 and IGF- 1 by pep3 and pep7 bind proteases to the resin in 35 ml buffer containing 50 mM was analyzed by immunoblotting . The aspartic proteases 45 sodium acetate , 0.2 M NaCl, pH 3.0 ( from fermentation were produced in Pichia supernatants . Pichia supernatants conditions pH 5.5 ; 28 ° C .; 9 g /l casaminoacids; 20 g /L spent were diluted to 1x concentration , and then mixed with 50 grain extract , 60 g / L lactose ). The column was washed with mM sodium citrate buffer , pH 5.5 . MAB01 was added to the same binding buffer and bound protein removed with each reaction so that the final concentration would be 0.05 elution buffer (50 mM Tris -HCL , 1 M NaCl, pH 8.5 ) . ug ul. IGF - 1 was added to each reaction so that the final 50 Fractions of 0.5 ml were then collected . concentration would be 0.30 ug al. Ten microliters of each 30 ul of each purified fraction was then run on a 4-15 % reaction mixture was then sampled and added to 3 ul of SDS PAGE gel (BioRad mini- protean TGX precast gel) and Laemmli sample buffer with B -mercaptoethanol . The stained overnight with GelCode blue ( Thermo Scientific ). samples were heated at 95 ° C. for 5 minutes before being The SDS PAGE gel showed predominate bands around 42 loaded into a 4-15 % PAGE gel (BioRad mini -protean TGX 55 kDa and a faint band around 25 kD ( FIG . 9 ) . The bands from precast gel ) along with an all blue precision plus prestained the gel were then cut and subjected to in -gel trypsin diges molecular weight marker (BioRad ) . The PAGE gel was run tion with sequencing grade modified trypsin (Promega for 30 minutes at 200V . The proteins in the gel were then # V5111 ) . The resulting peptides were extracted from the gel electrotransferred into a nitrocellulose filter at 100V for 1 and purified by C18 Zip Tip (Millipore # ZTC18M096 ). The hour . The protein containing nitrocellulose filter was then 60 purified peptides were analyzed by LC -MS / MS on a QSTAR blocked with 5 % milk powder in Tris buffered saline with Pulsar , ESI- hybrid quadrupole - TOF (AB Sciex ). This analy 0.1 % tween ( TBST ) for 1 hour shaking at room temperature . sis revealed that PEP2 , PEP3 , PEP4 , and PEP5 were present The blocked membranes were then probed with antibody . in the sample along with GAP1 and SLP2 . It is believed that The MAB01 containing membranes were probed with an the faint band around 25 kD corresponds to the glutamic anti - IgG heavy chain antibody AP conjugate (Sigma 65 protease GAP1 . # A3188 ) diluted 1: 30,000 in TBST. The IGF- 1 samples were The SIP purified proteases were then tested for their analyzed using a primary anti - IGF - 1 antibody ( 1 : 2000 in ability to degrade the MAB01 antibody heavy chain . The US 10,731,168 B2 67 68 purified SIP proteases were incubated overnight with These results support the conclusion that there are 4 MAB01 at a final concentration of 0.05 ug ul in sodium aspartic proteases present in the SIP fraction (PEP2 , PEP3 , citrate buffer at 37 ° C. The samples were incubated at pH 4.0 PEP4 , and PEP5 ) . and pH 5.5 and both in the presence and absence of an SIP inhibitor peptide . The reactions were sampled after. The 5 Example 2 — Identification of Glutamic Proteases collected samples were analyzed by immunoblotting with an This example demonstrates the ability of glutamic pro anti- IgG heavy chain antibody AP conjugate (Sigma A3188 ) teases from Trichoderma reesei ( T. reesei) culture superna diluted 1 :30,000 in TBST . The results of the immunoblot tants to degrade antibody heavy chains and light chains. showed that the proteases had high protease activity against Analysis of gap1 Deletion the MAB01 heavy chain when incubated at pH 4.0 , and 10 It has been previously determined that there are four reduced activity at pH 5.5 (FIG . 10 ) . Additionally , both glutamic protease sequences in the T. reesei genome. The aspartic and glutamic protease activities were inhibited by most abundant glutamic protease is gapl ( tre69555 ) , as determined by transcriptional profiling . Accordingly , the incubation with the SIP peptide ( FIG . 10 ) . gap1 protease was purified from T. reesei supernatant from Analysis of SIP -Purified Aspartic Proteases 15 SIP peptide affinity chromatography, as described Example Protease activity was then tested against casein both in the 1 . presence and absence of protease inhibitors . Protease activ A gap1 deletion was then generated using the T. reesei ity against casein was tested using the EnzChek protease MAB 01 antibody production strain M244 ( Apepl ) . assay kit (Molecular probes # E6638, green fluorescent Generation of gap1 Deletion Plasmid casein substrate ) . The working stock solution was prepared 20 The deletion PTTvl 17plasmid for the glutamic protease by diluting the stock to 10 ug ml in 50 mM sodium citrate , gapl ( TrelD69555 ) was constructed essentially as described pH 5.5 . The purified protease fractions ( 10 ul ) were diluted for pepl deletion plasmid p?Tv41 in Example 1. 1000 bp of with 40 ug /ml of sodium citrate , pH 5.5 . 100 ul of the diluted 5 ' flanking region and 1100 bp of 3 ' flanking region were substrate was combined with the diluted protease fractions selected as the basis of the gapl deletion plasmid . Flanking in a 96 well sample plate . The plate was then covered and 25 region fragments were produced by PCR using the primers kept at 37 ° C. for one to three hours. Fluorescence readings listed in Table 2.1 . The products were separated with agarose were taken at one , two, and three hours with a Varioskan gel electrophoresis and the correct fragments were isolated fluorescent plate reader ( Thermo Scientific ) using 485 nm from the gel with gel extraction kit ( Qiagen ) using standard excitation and 530 nm emission . laboratory methods . Template DNA used in the PCR of the The SIP inhibitor peptide, pepstatin A , LIP peptide , SBTI , 30 flanking regions was from the T. reesei wild type strain and chymostatin were used as inhibitors. The SIP inhibitor QM6a . The pyr4 blaster cassette was obtained from p?Tv71 peptide inhibited both aspartic and glutamic proteases; pep with Notí digestion . The vector backbone was EcoRI/ Xhol statin A inhibited only aspartic proteases ; LIP peptide only digested PRS426 as in Example 1. The plasmid was con inhibited glutamic protease ; SBTI was able to inhibit SLP2 structed using the yeast homologous recombination method and PEP4 , and chymostatin inhibited SLP2 . SIP , LIP, and 35 described in Example 1. This deletion plasmid for gap1 pepstatin A were used at a concentration of60 uM , and SBTI (p TTvl 17 ) resulted in a 1037 bp deletion in the gap1 locus was used at a concentration of 200 ug/ ml . To differentiate and covers the complete coding sequence of Gap1 . TABLE 2.1 Primers for generating gapi deletion plasmid . Deletion plasmid prTvl17 tor gapl ( TreID69555 ) , vector backbone pRS426 Primer Sequence JJ - 045 primer GATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGGTTTAAAC ACCTCATGAGGGACTATGG ( SEQ ID NO : 271 ) JJ - 046 primer GCGCTGGCAACGAGAGCAGAGCAGCAGTAGTCGATGCTAGGCGGCCG CCAAGAAGAGGCAGAGGGTAAT ( SEQ ID NO : 272 ) JJ - 047 primer CAACCAGCCGCAGCCTCAGCCTCTCTCAGCCTCATCAGCCGCGGCCGC CTATACATACTGATGATACA ( SEQ ID NO : 273 ) JJ - 048 primer TGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCGTTTAAA CGCCCCATGTATGGACTCTAC ( SEQ ID NO : 274 )
55 between the aspartic and glutamic proteases, pepstatin Awas Generation of MAB01 Producing Apep1/ Agap1 Double used as inhibitors , as it does not inhibit glutamic proteases . Deletion Strain M296 To generate the MAB01 antibody producing strain for the When casein digestion was studied , a large portion of the 60 second protease deletions, the pepl deletion strain Ml 81 SIP protease activity was inhibited by pepstatin A ( FIG . 11 ) . (Example 1 ) was transformed with MAB01 light and heavy The results from casein degradation studies suggested that a chain constructs (pTTv98 + pTTv67 ) using hygromycin and large part of the activity at pH 5.5 in the purified fractions acetamide in selection . This MAB01 strain with the pep1 comes from aspartic proteases . The LIP peptide, which is the deletion was designated with number M244 . The removal of GAP1 propeptide, inhibited the protease activity slightly 65 the pyr4 blaster cassette from pep1 locus was carried out less compared to SIP inhibitor. The SBTI and chymostatin essentially as described in Example 3 below for M195 ( in were able to inhibit the SLP2 protease in the purified sample . generation of double protease deletion strain M219 ). This US 10,731,168 B2 69 70 pyr4 strain was designated with number M285 and used as the parent for the subsequent protease deletion . To remove vector sequence, plasmid p?Tvl 17 (Agapl pyr4 ) was digested with Pmel and the correct fragment purified from an agarose gel using QIAquick Gel Extraction 5 Kit ( Qiagen ). Approximately 5 ug of the gapl deletion cassette was used to transform strain M285 (pyr4- of MAB01 antibody strain M244 , based on Apepl strain M181) . Preparation of protoplasts and transformation were carried out using pyr4 selection essentially as described for 10 the pepl deletion strains M181 and M195 in Example 1 . Colonies from the transformation plates were picked as selective streaks . Clones growing fast as selective streaks were screened by PCR using the primers listed in Table 2.2 15 for the correct integration using standard laboratory meth ods. Putative disruptants were purified to single cell clones . TABLE 2.2 Primers for screening gapi integration and strain purity . Primer Sequence For screening integration of prTv117 T052_gapl_5screen_F CTCAGAAAGGTTGTAGTTGTGA (SEQ ID NO : 275 ) T026_Pyr4_orf_5rev2 CCATGAGCTTGAACAGGTAA ( SEQ ID NO : 276 ) T053_gapl_3 screen_R GATGTTGTGTTTTCATCTGCA ( SEQ ID NO : 277 ) T028_Pyr4_flank_rev CATCCTCAAGGCCTCAGAC ( SEQ ID NO : 278 ) For screening deletion of gap /ORF T109_gapl_ORF_F ATGTTCATCGCTGGCGTCG ( SEQ ID NO : 279 ) T110_gapl_ORF_R CTAAACGTAAGAGCAGGTCAA ( SEQ ID NO : 280 )
Analysis of MAB01 Producing Apep1Agapl Double Deletion Strain 40 The double deletion strain (Apep1Agapl ) was grown in a 2 litre shake flask culture containing 300 ml of Trichoderma minimal medium supplemented with 40 g / 1 lactose , 20 g / l spent grain extract, and 9 g / 1 casamino acids and buffered to 45 pH 5.5 with 100 mM PIPPS . The Agapl strain was then tested for MAB01 heavy chain and light chain production ( FIG . 12 ). The Agap1 strain was compared to strains having deletions in each of slp1, slp2, and slp3 . The Apep1 strain 50 M244 was used as a control. Samples were from day 7 large shake flask cultures . Samples were analyzed via immunob lotting with anti - IgG heavy chain (Sigma # A3188 ) or anti light chain (Sigma # A3812 ) antibody AP conjugate (FIG . 12 ) . The gap1 deletion resulted in a 2 - fold improvement in 55 heavy chain production and a 1.6 - fold improvement in light chain production as compared to the M244 control strain (FIG . 13 ) . 60 Analysis of gap2 Deletion Based upon transcriptional profiling data generated from the M194 Trichoderma reesei strain , the second most abun dant glutamic protease was identified as gap2 ( tre106661 ) . 65 Thus, the gap2 protease was also deleted from the M244 (Apep1 ) strain using the PTTV145 deletion construct . US 10,731,168 B2 71 72 Generation of gap2 Deletion Plasmid The p?Tv145deletion plasmid for the glutamic protease gap2 ( TreID106661) was constructed essentially , as described for pepl deletion plasmid p?Tv41 in Example 1 . 1021 bp of 5 ' flanking region and 1010 bp of 3 ' flanking region were selected as the basis of the gap2 deletion 5 plasmid . In this plasmid the direct repeat fragment of the pyr4 blaster cassette was changed from pyr4 5'UTR to 320 bp direct repeat from the end of gap2 5 ' flanking region and no Ascl site was added between the pyr4 and the 5 ' direct repeat. This type of blaster cassette should not leave any 10 additional sequence to the locus of the deleted gene after excision . Fragments were produced by PCR using the prim ers listed in Table 2.3 . The products were separated with agarose gel electrophoresis and the correct fragments were isolated from the gel with gel extraction kit ( Qiagen ) using 15 standard laboratory methods . Template DNA used in the PCR of the flanking regions was the T. reeseiwild type strain QM6a . The pyr4 marker gene was obtained from pHH05 with Notl digestion . The vector backbone was EcoRI/ Xhol digested pRS426 as in Example 1. The plasmid was con- 20 structed using the yeast homologous recombination method described in Example 1. This deletion plasmid for gap2 (pTTv145 ) results in a 944 bp deletion in the gap2 locus and covers the complete coding sequence of GAP2 . TABLE 2.3 Primers for generating gap2 deletion plasmid . Deletion plasmid ptTv145 for gap2 ( TreID106661) , vector backbone pRS426 Primer Sequence T101_gap2_5flank_F_PRS426 GATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGGTT TAAACGCTACTACGCGAGCAAGTG ( SEQ ID NO : 281 ) T102_gap2_5flank_R_pyr4 GGAACTGTCGGCGATTGGGAGAATTTCGTGCGATCGCGGCGGC CGCCGGATGAAGATGTGCAGTTG ( SEQ ID NO : 282 ) T103gap2 - loop_F_pyr4 AGGGAACATATCACCCTCGGGCATTTTTCATTTGGTAGGCGGC CGCTAAGATATCTTCAAGCTTATGCG ( SEQ ID NO : 283 ) T104gap2 - loop_R CGGATGAAGATGTGCAGTTG ( SEQ ID NO : 284 ) T105gap2_3flank_F_loop TGTCTCACTTCCACCCATCTCAACTGCACATCTTCATCCGAGCA ACAACATGAGGTTCGAA ( SEQ ID NO : 285 ) T106_gap2_3ilank_R_PRS426 CCTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACAGTTT AAACACAACGCATGTCCAGCTTTTG (SEQ ID NO : 286 )
Generation of MAB01 Producing Apep1/ Agap2 Double Deletion Strains M360 To generate the MAB01 antibody producing strain for the second protease deletions, the pep1 deletion strain Ml 81 50 (Example 1 ) was transformed with MAB01 light and heavy chain constructs (pTTv98 + pTTv67) using hygromycin and acetamide in selection . The removal of the pyr4 blaster cassette from pep1 locus was carried out essentially as described in Example 3 below for M195 ( in generation of 55 double protease deletion strain M219 ). This pyr4 strain was designated with number M285 and used as the parent for the subsequent protease deletion . To remove vector sequence , plasmid p?Tv145 (Agap2 pyr4 ) was digested with Pmel and the correct fragment 60 purified from an agarose gel using QIAquick Gel Extraction Kit ( Qiagen ). Approximately 5 ug of the gap2 deletion cassette was used to transform strain M285 (pyr4- of MAB01 antibody strain M244 , based on Apepl strain M181) . Preparation of protoplasts and transformation were 65 carried out using pyr4 selection essentially as described for the strains M181 and M195 in Example 1 . US 10,731,168 B2 73 74 Colonies from the transformation plates were picked as a p - aminobenzamidine sepharose 4 fast flow resin (GE selective streaks. Clones growing fast as selective streaks healthcare # 17-5123-10 ) . 15 ml of the fermentation culture were screened by PCR using the primers listed in Table 2.4 supernatant was batch bound to the resin in 35 ml of binding for the correct integration using standard laboratory meth buffer (0.05 M Tris - HCL , 0.5 M NaCl, pH 7.4 ) . After ods. Putative disruptants were purified to single cell clones. packing and washing the column with the same binding TABLE 2.4 Primers for screening gap2 integration and strain purity . Primer Sequence For screening integration of prTv145 T048_gap2_5screen_F GCTTGGCATCACGGAAGCT ( SEQ ID NO : 287 ) T026_Pyr4_orf_5rev2 CCATGAGCTTGAACAGGTAA ( SEQ ID NO : 288 ) T049_gap2_3 screen_R TTGACAAGAAAGGTCCGGTTG ( SEQ ID NO : 289 ) T028_Pyr4_ilank_rev CATCCTCAAGGCCTCAGAC ( SEQ ID NO : 290 ) For screening deletion otgap2 ORF T107_gap2_ORF_F ATGGATGCTATCCGAGCCAG ( SEQ ID NO : 291) T108_gap2_ORF_R CTATTCATACTCAACAGTCACA ( SEQ ID NO : 292 )
25 Analysis of MAB01 Producing Apep1Agap2 Double buffer , the column was eluted with 0.05 M glycine, pH 3.0 . Deletion Strain The fractions were then neutralized with 1M Tris HCL , PH Several deletion transformants were produced . The cul 8.8 . ture supernatants from these transformants were run on a In total 1.7 mg of protein was purified from the affinity 4-15 % SDS PAGE gel and then the MAB01 antibody heavy 30 column. When the peak fractions were run on a 4-15 % chain was analyzed by immunoblotting with an anti- heavy SDS -PAGE gel , several major bands ( ~ 110 kD , 53 kD , 39 chain AP conjugated antibody (Sigma # A3188 ), and the kD , 29 kD ) and many more minor bands were seen . The light chain was detected with an anti -light chain AP conju peak fraction protein mixture (F4 ) was then tested for gated antibody (Sigma # A3812 ) . The results of the immu protease activity by incubated a sample of the F4 with noblot show that deleting gap2 resulted in a several fold 35 human IgGl in sodium citrate buffer (50 mM , pH 5.5 ) at 37 ° increase in MAB01 heavy and light chain production (FIG . C. for 20 hours. The samples were incubated both in the 14 ) . presence and absence of the serine protease inhibitor PMSF Analysis of Pichia -Expressed gap2 (5 mM ). The incubated samples were then analyzed by Pichia supernatants containing Trichoderma reesei gap2 40 immunoblottingantibody (Sigma with # A3188 an anti ) and- IgG an heavy anti- IgGchain light AP conjugatechain AP were also studied in vitro . The gap2 containing supernatant conjugate antibody (Sigma # A3812 ) diluted 1: 30,000 in and MAB01 antibody were diluted into sodium citrate TBST. The results of the immunoblot showed that the F4 buffers adjusted to pH 4.0 , 4.5 , 5.0 , and 5.5 , and incubated purified protein fraction thoroughly degraded the IgG ( FIG . for 20 hours at 37 ° C. Samples were taken at 0 minutes and 16 ) . Additionally , treatment with PMSF was able to inhibit after 20 hours . MAB01 heavy chain production was ana 45 most of the degradation , indicating that the protease activity lyzed by immunblotting using an anti- IgG heavy chain in the F4 fraction that was responsible for the IgG degra (Sigma # A3188 ) antibody AP conjugate. The results of the dation was predominantly serine protease activity . immunoblot show that gap2 had maximal proteolytic activ In order to identify which proteins in the purified fractions ity against heavy chain MAB01 at pH 4.0 (FIG . 15 ) . While exhibited protease activity , the peak fractions were run on an the gap2 protease activity was low at pH 5.5 (FIG . 15 ) , over 50 IgG (0.5 mg/ ml MAB02 ) SDS PAGE zymogram gel ( 12 % ) . 4 days it was able to demonstrate significant activity on the The purified fractions and unpurified supernatant samples heavy chain . The gap2 protease produced degradation prod were run on the zymogram gel under denaturing conditions. ucts around 25 kD , indicating that it has proteolytic activity After running the gel, the proteins in the gel were renatured in the heavy chain hinge region . by incubating the gel in 1 % triton X - 100 to remove the SDS . 55 The zymogram gel was then allowed to incubate overnight Example 3 — Identification of Serine Proteases in reaction buffer (50 mM sodium citrate , pH 5.5 ) so that the proteases could degrade IgG in the gel . The gel was then stained with GelCode blue to reveal the extent of IgG This example demonstrates the ability of serine proteases staining . Active proteases produced a clear band with no from Trichoderma reesei ( T. reesei ) to degrade antibody 60 staining (FIG . 17 ) . heavy chains and light chains. There were two clear bands visible on the IgG gel Serine Protease Purification zymogram at around 29 kD and 65 kD . However , the band Serine proteases comprise a major family of proteases that at 29 kD was much more predominant suggesting itmay be have been identified as antibody degrading enzymes . responsible for most of the serine protease activity in the Accordingly , serine proteases were purified from 65 sample . These bands were the only two visible ones in the Trichoderma supernatant. The serine proteases were first unpurified supernatant sample , and were more pronounced affinity purified from fermentation culture supernatants with in the purified fractions (FIG . 17) . When the protease sample US 10,731,168 B2 75 76 was pre - treated with PMSF , a known serine protease inhibi region fragments were produced by PCR using the primers tor, the clear white bands appeared grey or were not visible , listed in Table 3.1. The products were separated with agarose indicating that the bands correspond to serine protease gel electrophoresis and the correct fragments were isolated enzymes ( FIG . 17 ). from the gel with gel extraction kit ( Qiagen ) using standard 5 laboratory methods. Template DNA used in the PCR of the Identification of the 29 KD Serine Protease TSP1 flanking regions was from the T. reesei wild type strain From a matched SDS PAGE gel without MABO2 , the 29 QM6a . The bar marker was obtained from p?Tv41 (Ex kD band was cut from the gel and subjected to in - gel trypsin ample 1 ) with Notí digestion . The vector backbone was digestion with sequencing grade modified trypsin (Promega EcoRVXhol digested pRS426 as in Example 1. The plasmid # V5111) . In the purified fractions, the 29 kD band was seen was constructed using the yeast homologous recombination as a distinct protein band . This distinct band was then 10 method described in Example 1 . isolated . The resulting peptides were extracted from the gel To clone the second tspl deletion plasmid (pTTv72 ) the and purified by CI 8 ZipTip (Millipore # ZTC18M096 ) . The bar marker was removed from the deletion plasmid p?Tv42 purified peptides were analyzed by LC -MS / MS on a QSTAR with Noil digestion . The pyr4 blaster cassette was obtained Pulsar, ESI- hybrid quadrupole- TOF ( AB Sciex ). The result from p?Tv71 ( Example 1 ) with Notí digestion , ligated to ing mass analysis clearly identified the 29 kD band as the 15 Notl cut p?Tv42 and transformed into E. coli using standard trypsin - like serine protease TSP1 ( tre73897, 35 % sequence laboratory methods. A few transformants were cultivated , coverage ) . plasmid DNA isolated and digested to screen for correct Analysis of tsp 1 Deletion ligation and orientation of the pyr4 blaster cassette using The gene encoding TSP1 (tspl ) was then deleted from the standard methods. One clone with correct insert size and rituximab antibody production strain M169 to create M183 20 orientation was sequenced and stored . These deletion plas ( Atsp1) . Shake flask cultures were made with M169 and the mids for tsp1 (pTTv42 and p?Tv72 ) result in a 1252 bp tspl deletion strain transformants to measure the effect on deletion in the tsp1 locus and cover the complete coding rituximab expression . The cultures were grown in 300 ml of sequence of TSP1 . TABLE 3.1 Primers for generating tspl deletion plasmids . Primer Sequence Deletion plasmid p?Tv42 for tspl ( TreID71322 / TreID73897 ) , vector backbone PRS426 T303_71322_5f GTAACGCCAGGGTTTTCCCAGTCACGACGGTTTAAACTGCTGTTGCTG TTTGTTGATG ( SEQ ID NO : 293 ) T304_71322_5r_pt CCCGTCACCGAGATCTGATCCGTCACCGGGATCCACTTAAGCGGCCGC CTGTGGTGAGATCTCCAGACG ( SEQ ID NO : 294 ) T305_71322_3f_pt GCCAAGCCCAAAAAGTGCTCCTTCAATATCATCTTCTGTCGCGGCCGC ACTGTGCCCAACAATAAGCAG (SEQ ID NO : 295 ) T306_71322_3r GCGGATAACAATTTCACACAGGAAACAGCGTTTAAACCCAAGGCGCT GGCTGTTA ( SEQ ID NO : 296 ) Deletion plasmid prTv72 for tspl ( TreID71322 / TreID73897) , vector backbone prTv42 no new primers , PTTV42 digested with Notl and ligated with pyr4 - loopout fragment from PTTV71
TrMM with 4 g /L lactose , 2 g /L spent grain extract , and 100 Generation of pepltsp1 Double Deletion Strain M219 mM PIPPS , pH 5.5 . Supernatant samples ( 30 ul) from day To reuse pyr4 as the selection marker, removal of the pyr4 5 were loaded into a 4-15 % SDS PAGE gel and transferred blaster cassette from the pepl deletion strain M195 was to nitrocellulose for immunoblotting with an anti- heavy 50 carried out. Spores were spread onto minimal medium plates chain AP conjugated antibody (Sigma # A3188 ) diluted containing 20 g /l glucose , 2 g / 1 proteose peptone, 1 ml/ 1 1 : 10,000 in TBST . Two tspl deletion strain transformants Triton X -100 , 5 mM uridine and 1.5 g / 1 5 -FOA , pH 4.8 . showed a clear increase in rituximab heavy chain expression 5 -FOA resistant colonies were picked after 5-7 days to 0.9 % compared to the parent control strain (FIG . 40 ). NaCl, suspended thoroughly by vortexing and filtrated The deletion construct for the first protease gene, pep1 55 through a cotton - filled pipette tip . To purify clones to single ( TrelD74156 ) , was designed as described above in Example cell clones, filtrates were spread again onto plates described 1 . above . Purified clones were sporulated on plates containing Generation of Tsp1 Deletion Plasmids 39 g / l potato dextrose agarose . These clones were tested for The deletion plasmids for the alkaline trypsin - like serine 60 uridine auxotrophy by plating spores onto minimalmedium protease tsp1 ( TreID71322 / TrelD73897, Dienes et al , 2007 , plates (20 g /l glucose , 1 ml/ 1 Triton X - 100 ) where no growth Enz Microb Tech 40 : 1087-1094 ) were constructed essen was observed , indicating that the selected clones were pyr4 . tially as described for the pepl deletion plasmids in Example All clones were further tested by PCR ( using the primers 1. 953 bp of 5 ' flanking region and 926 bp of 3 ' flanking listed in Table 3.2 ) for the removal of the blaster cassette and region were selected as the basis of the tspl deletion 65 were shown to be correct . The clone ( 9-35A - 1A - a ) used to plasmids. As for pep1, the first deletion plasmid for tspl generate the double protease deletion strain (M219 ) was (pTTv42 ) used bar as the selection marker. The flanking designated with strain number M196 ( Apep1, pyr45) . US 10,731,168 B2 77 78 To remove vector sequence , plasmid p?Tv72 (Atsp1 gen ). Approximately 5 ug of the tspl deletion cassette was pyr4 ) was digested with Pmel and the correct fragment was used to transform strain M181 (Apep1 , Example 1 ) . Prepa purified from an agarose gel using a QIAquick Gel Extrac ration of protoplasts and transformation were carried out tion Kit ( Qiagen ). Approximately 5 ug of the tspl deletion using bar selection essentially as described for the pep1 5 deletion strain M182 in Example 1 . cassette was used to transform M196 (Apep1 , pyr45) . Prepa Colonies growing on transformation plates were picked as ration of protoplasts and transformation were carried out selective streaks. Clones growing fast as selective streaks using pyr4 selection essentially as described for the pep1 were screened by PCR using the primers listed in Table 3.2 deletion strains M181 and M195 in Example 1 . for the correct integration using standard laboratory meth Over 100 colonies were picked and 48 were screened by ods. Putative disruptants were purified to single cell clones . PCR using the primers listed in Table 3.2 for the correct 10 Deletion of tspl was verified by Southern analyses from integration of the deletion cassette and also for the deletion these clones (FIG . 19A ) using standard laboratory methods of the tsp1 ORF using standard laboratory methods. Four described in Example 1 for M181 and M195 . All clones putative Atspl clones were purified to single cell clones . were also verified to be single integrants (FIGS . 19B and Deletion of tspl was verified by Southern analyses from 19C ) . One double protease deletion clone ( 13-172D ) was these clones ( FIG . 18A ) using standard laboratory methods designated with number M194 . TABLE 3.2 Primers for screening removal of pyr4 blaster cassette and for screening tspi integration and strain purity . Primer Sequence For screening removal of pyr4 blaster cassette from M195 T083_74156_5a_seq GATCGACAAAGGTTCCAGCG ( SEQ ID NO : 297 ) TO84_74156_3a_seq AATTGTATCATTCCGAGGCT ( SEQ ID NO : 298 ) For screening integration of p?Tv42 T307_71322_5int CTGTTTGGCCCTCGAAACT ( SEQ ID NO : 299 ) T032_Bar_loppu_for CATTGTTGACCTCCACTAGC ( SEQ ID NO : 300 ) T308_71322_3int TTCGCCATCCAAATTTCTTC ( SEQ ID NO : 301 ) T031_Bar_alku_rev2 GTTTCTGGCAGCTGGACT ( SEQ ID NO : 302 ) For screening integration of prTv72 T307_71322_5int CTGTTTGGCCCTCGAAACT ( SEQ ID NO : 303 ) T027_Pyr4_orf_start_rev TGCGTCGCCGTCTCGCTCCT ( SEQ ID NO : 304 ) T308_71322_3int TTCGCCATCCAAATTTCTTC ( SEQ ID NO : 305 ) TO28_Pyr4_flank_rev CATCCTCAAGGCCTCAGAC ( SEQ ID NO : 306 ) For screening deletion of tsp /ORF T309_71322_5orfpcr CCCAAGTCGTCTCAGCTCTC ( SEQ ID NO : 307 ) T310_71322_3orfpcr TCGAAGGCTTCAGTGAGGTAA ( SEQ ID NO : 308 ) described in Example 1 for M181 and M195 . Southern The double protease deletion strain M194 was used to analyses also indicated that only four transformants ( two generate the MAB01 antibody expressing strains M247 and parallel clones from two transformants , clones 16-5AA , 50 M252 below . Construction of strain M247 was carried out 16-5BA , 16-11AA , 16-11BA , FIGS. 18B and 18C ) were by transforming M194 with MAB01 heavy and light chain constructs (pTTv10l + pTTv102 ). Strain M252 was con single integrants . The other clones were determined to carry structed by transforming M194 with MAB01 heavy and additional copies somewhere else in the genome and were light chain constructs (PTTv99 + pTTV67 ) . Both transforma discarded . To exclude that the faint signal seen in FIG . 18 for 55 tions were based on hygromycin and acetamide selection . the tspl ORF in transformants would originate from tsp1 Analysis ofMAB01 Producing Apep1 Atsp1 Double Dele gene , the deletion of tsp1 ORF was confirmed by PCR using tion Strain M252 the primers in Table 3.2 . No signal for tspl ORF was The MAB01 antibody producing double deletion strain obtained . The clone ( 16-5AA ) used in removal of the pyr4 (Apep1 Atspl) was shown to produce 261 mg/ l antibody , blaster cassette ( and to generate the triple deletion strain 60 with 43 % full length antibody , when grown in a fermentor. M277 ) was designated with strain number M219 The protease activity of the strain was then tested by (Apep1 Atspl) . growing the strain in Trichoderma minimal medium supple Generation of MAB01 Producing Apep1 Atspl Double mented with 20 g /l spent grain extract, 60 g /1 lactose , and 9 Deletion Strains M252 g /l casamino acids at pH 5.5 and 22 ° C. The total protease To remove vector sequence , plasmid p?Tv42 (Atspl - bar ) 65 activity against casein in this strain was determined to be was digested with Pmel and the correct fragment purified 2.0 - fold less than the wild type M124 strain ( FIG . 20 ). from agarose gel using QIAquick Gel Extraction Kit ( Qia Identification of the 65 kn Serine Protease SLP1 US 10,731,168 B2 79 80 The protease producing the activity around 65 kD was pep1 deletion plasmid p?Tv41 in Example 1. 1094 bp of 5 ' more difficult to identify due to its low expression level and flanking regions and 1247 bp of 3 ' flanking region were proximity in size to several highly expressed proteins. The selected as the basis of the slp1 deletion plasmid . Fragments highly expressed proteins were previously identified to be were produced by PCR using the primers listed in Table 3.3 . 5 The products were separated with agarose gel electropho CBHI, CBHII , CIP2 , and xylanase 4. Improvements were resis and the correct fragments were isolated from the gel made to better separate the 65 kD protease from the highly with gel extraction kit ( Qiagen ) using standard laboratory expressed proteins. The improvements included using a methods. Template used in the PCR of the flanking regions lower gel percentage ( 7 % ) SDS PAGE gel for zymogram was from the T. reesei wild type strain QM6a. The pyr4 and standard SDS PAGE gels to run the samples a longer 10 blaster cassette was obtained from p?Tv71 (Example 1 ) time so that the 54 kD molecular weight marker was at the with Notl digestion . The vector backbone was EcoRI/ Xhol bottom of the gels . Additionally , fermentation supernatant digested pRS426 as in Example 1. The plasmid was con from a T. reesei rituximab antibody transformant was also structed using the yeast homologous recombination method used to purify the serine proteases. The rituximab antibody 15 described in Example 1. This deletion plasmid for slp1 transformant is strain M169 , which produces rituximab and ( p TTv126 ) results in 2951 bp deletion in the slp1 locus and lacks protease deletions. The strain was grown in covers the complete coding sequence of SLP1. TABLE 3.3 Primers for generating slpi deletion plasmid . Deletion plasmid ptTv126 for slpl ( TreID51365 ) , vector backbone PRS426 Primer Sequence 5flankfw_vect GTAACGCCAGGGTTTTCCCAGTCACGACGGTTTAAACATCTCGGAGT GATGCTTCCT ( SEQ ID NO : 309 ) slpi_5flankrev_pyr4 Prom GCGCTGGCAACGAGAGCAGAGCAGCAGTAGTCGATGCTAGGCGGCC GCATCAGACGAAACCAGACGAG ( SEQ ID NO : 310 ) slp1_3flankfw_pyr4Term CAACCAGCCGCAGCCTCAGCCTCTCTCAGCCTCATCAGCCGCGGCCG CGCGAATCGAGTTGATGATTC ( SEQ ID NO : 311 ) 3 flankrev_vect GCGGATAACAATTTCACACAGGAAACAGCGTTTAAACCTGGTTGGGA TCTGACCACT ( SEQ ID NO : 312 )
Trichoderma minimal medium supplemented with 20 g / 1 35 Generation of MAB01 Producing Apep1 Aslpl Deletion spent grain extract and 60 g /l lactose at pH 5.5 and 28 ° C. Strain M298 and M299 The CBHI produced in this culture lacks the cellulose To generate the MAB01 antibody producing strain for the binding domain ; therefore it is around 10 kD smaller . second protease deletions, the pepl deletion strain M181 ( in However, M169 did not show a distinct band corresponding 40 Example 1 ) was transformed with MAB01 light and heavy to the 65 kD protease ( FIG . 21 ). Thus, the general region chain constructs (pTTv98 + pTTv67) using hygromycin and was cut and subjected to in - gel trypsin digestion with acetamide in selection . The removal of the pyr4 blaster sequencing grade modified trypsin (Promega # V5111 ) . The cassette from pep1 locus was carried out essentially as resulting peptides were extracted from the gel and purified described for M195 above ( in generation of double protease by C 18 ZipTip (Millipore # ZTC18M096 ) . The purified 45 peptides were analyzed by LC -MS /MS on a QSTAR Pulsar, deletion strain M219 ). This pyr4 - strain was designated with ESI -hybrid quadrupole - TOF ( AB Sciex ). number M285 and used as the parent for the subsequent The peptide analysis showed that the second highest protease deletion . scoring protein was the protease tre51365. The top scoring 50 protein was xylanaset , which was a contaminant in the To remove vector sequence , plasmid p?Tv126 (Aslp1 sample . The tre51365 subtilisin protease , now called SLP1 , pyr4 ) was digested with Pmel and the correct fragment was found in 3 independent samples from three separate purified from an agarose gel using QIAquick Gel Extraction purifications. In the best scoring sample , 6 peptides were Kit (Qiagen ). Approximately 5 ug of the slpl deletion found and sequenced by LC - MS/ MS . The sequence cover- 55 cassette was used to transform M285 (pyr45 of MAB01 age was 8 % , since the native protease gene codes for 882 antibody strain M244 , based on Apepl strain M181) . Prepa amino acids that compose a 93 kD protease . In gelatin ration of protoplasts and transformation were carried out zymography , a weak band at -90 kD could be seen along using pyr4 selection essentially as described for the pep1 with smearing down to 65 kd suggesting that the SLP1 60 deletion strains M181 and M195 in Example 1 . protease itself undergoes proteolysis but retains much of its activity . Generation of sip 1 Deletion Plasmid Colonies growing on transformation plates were picked as The gene encoding SLP1 ( slpl) was then deleted in the selective streaks . Clones growing fast as selective streaks MAB01 antibody production strain M244 (Apepl ) . 65 were screened by PCR using the primers listed in Table 3.4 The deletion plasmid for the subtilisin - like protease slp1 for the correct integration using standard laboratory meth ( TreID51365) was constructed essentially as described for ods . Putative disruptants were purified to single cell clones . US 10,731,168 B2 81 82 TABLE 3.4 Primers for screening slpi integration and strain purity . Primer Sequence For screening integration of prTv126 T079_slpl_scrn_5forw GCAGACAAACAGAGCAACGA ( SEQ ID NO : 313 ) T026_Pyr4_orf_5rev2 CCATGAGCTTGAACAGGTAA ( SEQ ID NO : 314 ) T080_slpl_scrn_3rev TAGAGGGTGTCGATGGAAGC ( SEQ ID NO : 315 ) T028_Pyr4_flank_rev CATCCTCAAGGCCTCAGAC ( SEQ ID NO : 316 ) For screening deletion of slp / ORF T081_slpl_orf_fw GGTCTCTTCTTTGCCAGCAC ( SEQ ID NO : 317 ) T082_slpl_orf_rev TGTCGCTGAACTGAATTTGC ( SEQ ID NO : 318 )
Analysis ofMAB01 Producing Apep1Aslpl Double Dele 20 was washed in a vivaspin ultrafiltration spin filter (Sartorius tion Strain M298 /M299 stedim ) with 10 kD molecular weight cutoff to remove the Deletion of slp1 in the M244 strain showed an expected benzamidine inhibitor and concentrate the fraction . The improvement in heavy and light chain production (FIGS . 12 concentrated fractions (cf3 and cf4 ) and nonconcentrated and 13 ) . The slp1 deletion strain (Apep1Aslp1 ) was grown in fractions (f1 - f4 ) were loaded on an MAB02 zymogram gel a 2 litre shake flask culture containing 300 ml of 25 (as described above ) and on a regular SDS PAGE gel for Trichoderma minimal medium supplemented with 40 g /l analysis . The results of the zymogram show that there are lactose , 20 g /l spent grain extract, and 9 g/ l casamino acids two visible proteolytic activities (FIG . 22 ). The most pre and buffered to pH 5.5 with 100 mM PIPPS . As described in dominant band was visible around 40 kD and a fainter band Example 2 above, the culture supernatants were run on a 30 was visible around 26 kD (FIG . 22) . In the zymogram gel , 4-15 % PAGE gel and immunoblotted to detect the MAB01 darker staining protein bands flanked the white zymogram heavy and light chain . The heavy chain was produced at activity band . Comparing this to concentrated fractions levels that were 2.8 - fold higher than the production levels of loaded on an SDS PAGE gel, these doublet bands could be the M244 parent strain (FIG . 13 ). The light chain was seen around 38 kD ( FIG . 23 ). The PAGE gel was a 4-15 % produced at levels that were 1.8 -fold higher than the pro- 35 gradient gel and the zymogram gel was 12 % , so the relative duction levels of the M244 parent strain (FIG . 13 ) . sizes can be slightly different. On the PAGE gel , a protein Identification of Additional Serine Proteases band could clearly be seen in the area of 26 KD , which Additional antibody degrading serine proteases were corresponded to the size of the second fainter zymogram identified using other affinity ligands. The soybean trypsin activity . inhibitor (SBTI ) effectively stabilizes the antibody heavy 40 To further analyze the proteolytic activity of the purified and light chain . Therefore , it is able to inhibit proteases that protease of cf3 , the fraction was tested for its ability to are responsible for cleaving the antibody. Thus, in order to degrade the rituximab antibody heavy chain . A 5 ul sample identify these proteases , affinity purification was performed of cf3 was incubated in sodium citrate buffer pH 5.5 with with SBTI coupled to agarose (Sigma # T0637 ) . 0.05 ug ml rituximab . The incubated samples were then The T. reesei strain M44 was used to identify the pro- 45 analyzed by immunoblotting using an anti- human IgG teases. The M44 strain is a wild type strain with no heter heavy chain - specific AP conjugated antibody (Sigma ologous protein expression . The M44 strain was grown in # A3188 ) diluted 1 : 30,000 in TBST. The results of the Trichoderma minimal medium supplemented with 20 g /l immunoblot show that the proteases immediately degraded spent grain extract and 60 g/ l lactose at pH 5.5 and 28 ° C. the rituximab antibody heavy chain . The full length ritux A 20 ml sample ofM44 culture supernatant from a 217 hour 50 imab heavy chain runs at just over 50 kD , while the initial sample was incubated with the SBTI- agarose affinity resin degradation product was around 45 kD (FIG . 24 ) . Addition ( 1 ml) in 30 ml of binding buffer (50 mM Tris , 0.5 M NaCl, ally , incubation overnight generated an additional product of pH 7.5 ) (pH 5.5 ; 28 ° C .; 20 g / L spent grain extract , 60 g / L 38 kD (FIG . 24 ) . lactose ). The supernatant binding buffer mixture was com The proteases responsible for the zymogram activities bined in a 50 ml conical tube and agitated at room tempera- 55 were identified after LC -MS / MS peptide sequencing . Pro ture for 1 hour. The mixture was then added to a glass tein containing gel sections were cut out of the SDS PAGE column and washed with 200 ml of binding buffer . 50 ml of gel shown in FIG . 23 and subjected to in -gel trypsin diges high salt buffer ( 1 M NaCl) was next used to further remove tion with sequencing grade modified trypsin (Promega nonspecific interactions. Finally , the column was washed # V5111) . The resulting peptides were extracted from the gel again with 100 ml of the original binding /wash buffer. The 60 and purified by C18 Zip Tip (Millipore # ZTC18M096 ) . The column was then eluted with 0.8 M benzamidine HC1 in 50 purified peptides were analyzed by LC -MS / MS on a QSTAR mM Tris , pH 5.0 . The fractions were collected in 0.5 ml Pulsar , ESI- hybrid quadrupole - TOF (AB Sciex ) . volumes and subjected to a protein assay using BioRad The top scoring protease hit was the subtilisin like pro Bradford reagent with bovine immunoglobulin as a stan tease , slp2 ( trel 23244 ). Two peptides from slp2 were found dard . 65 and sequenced , covering 6 % of the entire sequence length . From all the fractions collected , 190 ug of protein was The full length slp2 protease is 58 kD , but it is usual that the purified from the SBTI affinity column. The peak fraction active protease can be smaller in size . US 10,731,168 B2 83 84 There were also other proteases found in adjacent regions. slp3, 1000 bp of 5 ' and 1100 bp of 3 ' flanking regions were Analysis of the lower 26 kD region identified the trypsin selected. Fragments were produced by PCR using the prim serine -like protease tsp1 (tre73897 ). This corresponded to ers listed in Table 3.5 . The products were separated with the faint zymogram activity observed . As described above , agarose gel electrophoresis and the correct fragments were this protease was identified via aminobenzamidine affinity 5 isolated from the gel with gel extraction kit ( Qiagen ) using purification . standard laboratory methods . Template used in the PCR of In addition , the whole SBTI affinity purified fraction was the flanking regions was from the T. reesei wild type strain trypsin digested in solution to determine the entire protease QM6a . The pyr4 blaster cassette was obtained from p?Tv71 content of the sample . Other identified proteases included (Example 1 ) with Notl digestion . The vector backbone was the tre123865 protease slp7 (60 kD ) ; the tre77579 protease 10 EcoRI/ Xhol digested pRS426 as in Example 1. The plas pep4 (42 kD ) ; and the tre58698 protease slp8 (41 kD ). mids were constructed using the yeast homologous recom The Trichoderma reesei subtilisin proteases slp5 , slpó , bination method described in Example 1. The deletion and slp7 were overproduced in Pichia supernatants for plasmid for slp2 (pTTvl 15 ) results in a 2114 bp deletion in investigation of their activity against the antibody rituximab the slp2 locus and covers the complete coding sequence of and MAB01 heavy chains (FIG . 25 ) . The rituximan mock 15 SLP2 . The deletion plasmid for slp3 (pTTvl 16 ) results in a supernatant was compared to supernatants containing slp5 1597 bp deletion in the slp3 locus and covers the complete and slp6 (FIG . 25 A ) . The MAB01 mock supernatant was coding sequence of SLP3 . TABLE 3.5 Primers used for plasmids . Primer Sequence Deletion plasmid prTv115 for slp2 ( TreID123244 ) , vector backbone PRS426 JJ - 037 primer GATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGGTTTAAA CGCAGTCTATCCCATCCCTG ( SEQ ID NO : 319 ) JJ - 038 primer GCGCTGGCAACGAGAGCAGAGCAGCAGTAGTCGATGCTAGGCGGCC GCGCGGATGATGAAGGAAGAAG ( SEQ ID NO : 320 ) JJ - 039 primer CAACCAGCCGCAGCCTCAGCCTCTCTCAGCCTCATCAGCCGCGGCCG CAACAGCTGTTCGCACGCGTG ( SEQ ID NO : 321) JJ - 040 primer TGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCGTTTAAA CGGCTGGGCATTGGGGCCG ( SEQ ID NO : 322 ) Deletion plasmid privl16 for slp3 ( TreID123234 ) , vector backbone PRS426 JJ - 041 primer GATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGGTTTAAA CAAACAAGGCACAAAGGCCTG ( SEQ ID NO : 323 ) JJ - 042 primer GCGCTGGCAACGAGAGCAGAGCAGCAGTAGTCGATGCTAGGCGGCC GCATCCAAGGATGAGGAGAAC ( SEQ ID NO : 324 ) JJ - 043 primer CAACCAGCCGCAGCCTCAGCCTCTCTCAGCCTCATCAGCCGCGGCCG CACCTAATGGTTTCTTCGTTTTTC ( SEQ ID NO : 325 ) JJ - 044 primer TGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCGTTTAAA CCGGTCCGAAGGGTGTTTTGG ( SEQ ID NO : 326 )
compared to supernatants containing slp7 ( FIG . 25B ) . Ritux Generation of MAB01 Producing Apep1Aslp2 and imab and MAB01 were added to the protease - containing 50 Apep1Aslp3 Deletion Strains M292 and M295 Pichia supernatants and incubated overnight at 37 ° C. To generate the MAB01 antibody producing strain for the Samples were taken and analyzed by immunoblotting with second protease deletions , the pepl deletion strain M181 ( in an anti- heavy chain AP conjugated antibody . This analysis Example 1 ) was transformed with MAB01 light and heavy revealed that the slp6 protease showed heavy degradation 55 chain constructs (pTTv98 + pTTv67) using hygromycin and activity on the rituximab heavy chain and light degradation acetamide in selection . The removal of the pyr4 blaster of the MAB01 , compared to the mock control supernatants cassette from pepl locus was carried out essentially as ( FIG . 25 ) . described for M195 above ( in generation of double protease Generation of slp2 and SIP 3 Deletion Plasmids deletion strain M219 ) . This pyr4 strain was designated with Based on the above results , the slp2 and slp3 protease 60 number M285 and used as the parent for the subsequent genes were each deleted from the MAB01 antibody produc protease deletions . ing strain M244 . To remove vector sequence , plasmids p?Tvl 15 (Aslp2 The deletion plasmids for the subtilisin - like proteases slp2 pyr4) and p?Tvl 16 (Aslp3 -pyr4 ) were digested with Pmel ( TrelD 123244 ) and slp3 ( TrelD 123234 ) were constructed and the correct fragments purified from an agarose gel using essentially as described for pepl deletion plasmid p?Tv41 in 65 QIAquick Gel Extraction Kit ( Qiagen ). Approximately 5 ug Example 1. 1000 bp of 5 ' and 1100 bp of 3 ' flanking regions of either deletion cassette was used to transform M285 (pyr were selected as the basis of the slp2 deletion plasmid . For ofMAB01 antibody strain M244 , based on Apep1 strain MI US 10,731,168 B2 85 86 81 ) separately . Preparation of protoplasts and transformation When slp2 was deleted from the M306 multiple deletion were carried out using pyr4 selection essentially as strain ( Apep1Atsp1 Aslpl ) , deletion of slp2 resulted in a described for the pep1 deletion strains M181 and M195 in reduction in sporulation and slower growth as compared to Example 1. the parent strain . Colonies growing on transformation plates were picked as 5 Example4Trichoderma Multiple Protease selective streaks . Clones growing fast as selective streaks Deletion Strains were screened by PCR using the primers listed in Table 3.6 for the correct integration using standard laboratory meth This example demonstrates increased antibody produc ods. Putative disruptants were purified to single cell clones. tion and stability from Trichoderma reesei ( T. reesei ) strains No pure clones were obtained even after repeated purifica- 10 containing multiple deletions of the protease genes identified tion steps. above in Examples 1-3 . TABLE 3.6 Primers for screening slp2 (pTTv115 ) and slp3 (prTv116 ) integration and strain purity . Primer Sequence For screening integration of privl15 T054_slp2_5screen_F GATGCACCGCTGCGGCC ( SEQ ID NO : 327 ) T026_Pyr4_orf_5rev2 CCATGAGCTTGAACAGGTAA ( SEQ ID NO : 328 ) TO28_Pyr4_flank_rev CATCCTCAAGGCCTCAGAC (SEQ ID NO : 329 ) T055_slp2_3 screen_R GGCGTTGCTCCCCATGCG ( SEQ ID NO : 330 ) For screening deletion of slp2 ORF T111_slp2_ORF_F ATGCGGTCCGTTGTCGCC ( SEQ ID NO : 331 ) T112_slp2_ORF_R TTACTCGGAGAGCTCAGAGA ( SEQ ID NO : 332 ) For screening integration of privl16 T056_slp3_5 screen_F GTGAATGGGTGGCAACATGA ( SEQ ID NO : 333 ) T026_Pyr4_orf_5rev2 CCATGAGCTTGAACAGGTAA ( SEQ ID NO : 334 ) TO28_Pyr4_flank_rev CATCCTCAAGGCCTCAGAC ( SEQ ID NO : 335 ) T057_slp3_3 screen_R CATCAAGTTGACCACCATTGT ( SEQ ID NO : 336 ) For screening deletion of slp3 ORF T113_slp3_ORF_F ATGCGGTTGTCCGTCCTCC ( SEQ ID NO : 337 ) T114_slp3_ORF_R TTAACCGGAAGGGTTGCCGT ( SEQ ID NO : 338 )
Analysis of MAB01 Producing Apep1 Aslp2 and 45 Generation of Triple Deletion Strain Apep1 Atsp1Aslp1 Apep1AS1p3 Double Deletion Strains M292 and M295 A T. reesei strain having a triple deletion The M292 strain (Apep1 Aslp2 ) and M295 strain Apep1 Atsp1Aslpl was generated and tested for improve (ApeplAslp3 ) were grown along with their sister transfor ment in antibody production . The strain was also used for mants in a 2 liter shake flask culture containing 300 ml of 50 further rounds of protease deletions. Generation of triple Trichoderma minimal medium supplemented with 40 g / l protease deletion strain M277 lactose , 20 g /l spent grain extract , and 9 g/ l casamino acids To generate a marker - free triple protease deletion strain , and buffered to pH 5.5 with 100 mM PIPPS . The culture the looping out of the pyr4 marker was applied to strain supernatants were run on a 4-15 % SDS PAGE gel and M219 essentially as described above for looping out pyr4 immunoblot analysis was performed to detect the MAB01 55 from the single protease deletion strain Apep1 . Three con heavy chain and light chain . The results show that both secutive 5 -FOA selection steps were carried out to ensure deletions improved MAB01 stability ( FIGS. 12 and 13 ) . The that the clones selected were originating from single cells . Aslp2 deletion improved MAB01 heavy chain expression in Final clones were verified for the looping out of pyr4 by shake flask culture by about 2.4 - fold on day 7 , as compared PCR (using the primers listed in Table 3.1 ); no specific to the parent M244 strain ( FIG . 13 ). The Aslp3 improved 60 signals were seen with primers annealing with the looped MAB01 heavy chain expression in large shake flasks by out part of the pyr4 . The looping out was further verified by about 1.5 - fold and MAB01 light chain expression by about plating the clones onto minimal medium plates with or 1.7 - fold as compared to the M244 parent strain (FIG . 13) . without 5 mM uridine . The clone used to generate the triple Moreover , when compared to Aslp3 and Agapl, Aslp2 protease deletion strain was designated with strain number showed the highest fold increased in MAB01 heavy chain 65 M228 ( Apep1 Atsp1, pyr4-) . expression relative to MAB01 heavy chain expression in the The deletion plasmid PTTv126 for the third protease gene , M244 parent strain ( FIG . 13 ) . subtilisin - like protease slp1 ( TreID51365 ) is described US 10,731,168 B2 87 88 above ( Table 3.3 ). This deletion plasmid results in 2951 bp M219 ) . This pyr4 strain was designated with number M284 deletion in the slp1 locus and covers the complete coding and used as the parent for the subsequent protease deletion . sequence of SLP1. The third protease deletion to M284 was obtained by To remove vector sequence, plasmid p?Tv126 (Aslp1 using slp1 deletion construct p?Tv128 . This construct con pyr4 loopout) was digested with Pmel and the correct 5 tains a native KEX2 overexpression cassette targeted to the fragment purified from an agarose gel using QIAquick Gel slp1 locus. Transformation was carried out essentially Extraction Kit ( Qiagen ) . Approximately 5 ug of the slp1 according to the protocol described in Example 1 for the deletion cassette was used to transform M228 ( Apep1 Atspl , strains M181 and M195 using pyr4 selection . The resulting pyr45) above. Preparation of protoplasts and transformation strain is the MAB01 producing triple protease deletion strain were carried out essentially as described in Example 1 for 10 M304 . the strains M181 and M195 using pyr4 selection . Analysis of MAB01 Producing Triple Protease Deletion 200 clones were picked as first streaks. 48 of these streaks Strain M304 were screened by PCR using the primers listed in Table 4.1 The triple protease deletion ( Apep1 Atsp1Aslp1 ) MAB01 for the correct integration using standard laboratory meth antibody producing strain M304 was shown to produce the ods. Five putative triple protease disruptants 15 MAB01 antibody at yields of up to 3.5 g/ L in culture (pH (Apep1 Atsp1Aslpl ) were purified to single cell clones. Dele 5.5 ; 28- > 22 ° C .; 60 g / L spent grain , 30 g / L glucose , 60 g /L tion of slp1 was verified by Southern analyses of the five lactose + lactose feed ), and product quality up to 84 % of full clones ( FIG . 26A ) . Southern analyses were performed as length IgG (see Example 6 below ) . The protease activity of described in Example 1. Southern analyses also verified that the strain was also tested by growing the strain in three of the clones were single integrants (FIGS . 26B and 20 Trichoderma minimal medium supplemented with 60 g / l 26C ). The two other clones were shown to carry additional solid spent grain , 30 g/ l glucose, and 60 g/ l lactose at pH 5.5 . copies somewhere else in the genome and were discarded . The culture was grown up at 30 ° C. and then shifted to 22 ° The clone used in removal of the pyr4 blaster cassette (and C. for the production phase . The fedbatch cultivation was to generate the quadruple protease deletion strain M307 done with a lactose feed . The total protease activity against below ) was designated with strain number M277 25 casein in this strain was determined to be about 3.2 - fold less ( Apep1 Atsp1Aslp1 ) . compared to the wild type strain M124 (FIG . 20 ) . TABLE 4.1 Primers for screening removal of pyr4 blaster cassette and for screening slpi integration and strain purity . Primer Sequence For screening removal of pyr4 blaster cassette from M219 T307_71322_5int CTGTTTGGCCCTCGAAACT ( SEQ ID NO : 339 ) T026_Pyr4_orf_5rev2 CCATGAGCTTGAACAGGTAA ( SEQ ID NO : 340 ) T308_71322_3int TTCGCCATCCAAATTTCTTC ( SEQ ID NO : 341 ) T028_Pyr4_flank_rev CATCCTCAAGGCCTCAGAC ( SEQ ID NO : 342 ) For screening integration of prTv126 T079_slpl_scrn_5forw GCAGACAAACAGAGCAACGA ( SEQ ID NO : 343 ) T026_Pyr4_orf_5rev2 CCATGAGCTTGAACAGGTAA ( SEQ ID NO : 344 ) T080_slpl_scrn_3rev TAGAGGGTGTCGATGGAAGC ( SEQ ID NO : 345 ) T028_Pyr4_flank_rev CATCCTCAAGGCCTCAGAC ( SEQ ID NO : 346 ) For screening deletion of slplORF T081_slpl_orf_fw GGTCTCTTCTTTGCCAGCAC ( SEQ ID NO : 347 ) T082_slpl_orf_rev TGTCGCTGAACTGAATTTGC ( SEQ ID NO : 348 )
Generation of MAB01 Producing Triple Protease Dele 55 Comparison of Single , Double , and Triple Deletion Strains tion Strain M304 The relative protease activity of culture supernatants from To generate the MAB01 antibody producing strain for the the single protease deletion (Apepl ) strain M181 ( see third protease deletion , the pep11tsp1 double protease dele Example 1 ) , the double protease deletion (Apep1Atspl ) tion strain M194 (Example 3) was transformed with MAB01 60 strain M219 ( see Example 3 ), and the triple protease deletion light and heavy chain constructs (pTTv99 + pTTv67) using (Apep1 Atsp1Aslp1) strain M277 were compared . These hygromycin and acetamide in selection . This MAB01 strain deletion strainswere compared to the wild type strain M1 24 . with pep / tspl double , deletion was designated with number The three protease deletion strains were grown in 2 liter M252. Removal ofthe pyr4 blaster cassette from pep1 locus 65 shakeg/ l spent flasks grain with extract300 ml, TrMMand 100 containing mM PIPPS 40 g / lat lactose pH 5.5, 20 . was carried out essentially as described in Example 3 for Samples were taken on days 3 , 5 , 7, and 10. Day 7 culture M195 ( in generation of double protease deletion strain supernatant samples from M124 , M181 , M219 , and M277 US 10,731,168 B2 89 90 were each diluted 1: 2 in sodium citrate buffer (50 mM , pH protease deletions. With 3 protease deletions , the M277 5.5 ) and 30 ul were loaded on a 12 % zymogram SDS PAGE strain produced MAB01 heavy chain that was significantly gel containing MAB02. The SDS PAGE gel was run at 100V stabile . On day 5 , there was 2.5 - fold more heavy chain in the for 45 minutes . The gel was then incubated in 2.5 % Triton M277 supernatant after overnight incubation . With the day X -100 for one hour, before being washed several times with 5 7(FIG supernatant . 41 ) . , there was 4 - fold more heavy chain visible the reaction buffer ( 50 mM sodium citrate, pH 5.5 ) . The Quadruple Deletion Strain M307 zymogram gel was then left overnight shaking in the reac The M307 strain having aa quadruple deletion tion buffer. The next morning the gel was stained with Apep1Atsp1 Aslp1Agapl was generated and used for further GelCode Blue staining reagent . Regions where the MAB02 rounds of protease deletions . antibody has been degraded showed up as white spots on the 10 Generation of Quadruple Protease Deletion Strain M307 blue stained gel. To generate a marker - free quadruple protease deletion Two protease activities were seen in the controlMl 24 and strain , removal of the pyr4 blaster cassette was applied to the Ml 81 Apepl samples (FIG . 27 ). The most predominate strain M277 essentially as described in Example 3 for activity was seen between 65-90 kD , which corresponds to removal of the pyr4 blaster cassette from the single protease slp1. A fainter activity was seen around 28 kD , which 15 deletion strain M195 (Apepl ) . Three consecutive 5 -FOA corresponds to tsp1. As was expected , the M219 Apep1Atsp1 selection steps were carried out to ensure that the clones strain did not produce a zymogram band at 28 kD . Likewise , selected were originating from single cells . Final clones the M277 Apep1Atsp1 Aslp1 strain did not produce either were verified for the removal of the blaster cassette by PCR zymogram activity . The active size of slp1 appears to be using the primers listed in Table 4.2 with standard laboratory variable , since it was still active when it was cleaved down 20 methods. No specific signals were seen with primers anneal to 65 kD even though its mature size is 90 kD . The size ing with the removed part of the pyr4 . Removal was further variation can be seen in FIG . 27 . The total protease activity against succinylated casein verified by plating the clones onto minimal medium plates from supernatant cultures of the M181, M219 , and M277 with or without 5 mM uridine. No growth was observed on deletion strains was also measured from day 3 , day 5, and 25 theto generate plates without the quadruple uridine proteasesupplementation deletion . strainThe clone was useddes day 7 samples . The supernatants were first diluted to 2 ignated with strain number M306 (Apep1 Atsp1 slp1 , mg/ ml total protein in 50 mM sodium citrate , pH 5.5 before pyr45) . being assayed . 50 ul of diluted supernatant was loaded into The deletion plasmid p?Tvl 17 for the fourth protease a 96 well plate and 50 ul of succinylated casein was added gene, glutamic protease gapl ( TrelD69555 ) is described in insteadto begin ofthe casein reaction was . A usedbackground for each controlsample with . After buffer the 30 Example 2 (Table 2.1 ). This deletion plasmid results in a addition of casein the protease reaction was allowed to 1037 bp deletion in the gap1 locus and covers the complete proceed for 1 hour at 37 ° C. To develop the reaction 50 ul coding sequence ofGapl . of TNBSA reagent was added to every well and the plate To remove vector sequence , plasmid p?Tvl 17 (Agap1 incubated for 16 hours at 37 ° C. The absorbance at 450 nm pyr4 ) was digested with Pmel and the correct fragment was measured for the whole plate . The nonspecific back- 35 purified from an agarose gel using QIAquick Gel Extraction ground signal is subtracted from specific protease activity Kit ( Qiagen ). Approximately 5 ug of the gapl deletion measurement. As shown in FIG . 28 , the supernatant samples cassette was used to transform M306 (Apep1Atsp1Aslp1 , from the three protease deletion strains contained less pro pyr4-) above. Preparation of protoplasts and transformation tease activity than the M124 wild type strain . were carried out essentially as described in Example 1 for The supernatant from the M277 and M124 cultures (day 40 the strains M181 and M195 using pyr4 selection . 5 and 7 ) was diluted to 6 mg/ ml in 50 mM sodium citrate 150 clones were picked as first streaks. 48 of these streaks buffer. To these diluted supernatants the MAB01 antibody were screened by PCR using the primers listed in Table 4.2 was spiked in to a final concentration of 0.05 ug ul. These for the correct integration using standard laboratory meth reactions were incubated at 37 ° C. overnight. The reactions ods. Eight putative quadruple protease disruptants wereincubation sampled . The at20 zero ul samplestime, 1 werehour ,loaded and overinto overnighta 4-15 % 45 (Apep1 Atsp1AslpiAgapl) were purified to single cell clones . SDS PAGE gel and run at 200 volts for 40 minutes. The gel Deletion of gapl was verified by Southern analyses of the was transferred at 100 volts for 1 hour to nitrocellulose for eight clones ( FIG . 29 A ). Southern analyses were performed immunoblotting. The membrane was blocked with 5 % milk as described in Example 1. Southern analyses also verified in TBST for one hour . The heavy chain of MAB01 was that three of the clones were single integrants (FIGS . 29B detected with an anti -heavy chain AP conjugated antibody 50 and 29C ). The five other clones were shown to carry ( Sigma # A3188 ) diluted 1: 30,000 in TBST. After washing additional copies somewhere else in the genome and were the membrane with TBST, the blot was developed with AP discarded . The clone used in removal of the pyr4 blaster substrate ( Promega ). Comparing the overnight incubated cassette ( and to generate the quintuple protease deletion samples it was clearly evident that the heavy chain degraded strain M369 below ) was designated with strain number more in the M124 strain supernatant. The M124 contains no M307 (Apep1 Atsp1 Aslp1Agapl ). TABLE 4.2 Primers for screening removal of pyr4 blaster cassette and for screening gapi integration and strain purity .
Primer Sequence For screening removal of pyr4 blaster cassette from M277 T079_slpl_scrn_5forw GCAGACAAACAGAGCAACGA ( SEQ ID NO : 349 ) T026_Pyr4_orf_5rev2 CCATGAGCTTGAACAGGTAA ( SEQ ID NO : 350 ) US 10,731,168 B2 91 92 TABLE 4.2 - continued Primers for screening removal of pyr4 blaster cassette and for screening gapi integration and strain purity . Primer Sequence
T080_slpl_scm_3rev TAGAGGGTGTCGATGGAAGC ( SEQ ID NO : 351 ) T028_Pyr4_flank_rev CATCCTCAAGGCCTCAGAC ( SEQ ID NO : 352 ) For screening integration of privl17 T052_gap1_5 screen_F CTCAGAAAGGTTGTAGTTGTGA ( SEQ ID NO : 353 ) T026_Pyr4_orf_5rev2 CCATGAGCTTGAACAGGTAA ( SEQ ID NO : 354 ) T053_gap1_3 screen_R GATGTTGTGTTTTCAGTCTGCA ( SEQ ID NO : 355 ) T028_Pyr4_flank_rev CATCCTCAAGGCCTCAGAC ( SEQ ID NO : 356 ) For screening deletion of gap / ORF T109_gap1_ORF_F ATGTTCATCGCTGGCGTCG ( SEQ ID NO : 357 ) T110_gap1_ORF_R CTAAACGTAAGAGCAGGTCAA (SEQ ID NO : 358 )
Generation of MAB01 Producing Quadruple Protease 25 the pep1/ tspl/ slpl/ gapl quadruple deletion reduced the pro Deletion Strain M3 71 tease activity by 7.8 - fold compared to the wild type M124 To generate quadruple protease deletion strain with strain (FIG . 20 ). MAB01 antibody production , removal of the pyr4 blaster The MAB01 antibody producing strain M371 contains a cassette from slp1 locus from strain M304 was carried out 30 quadruple deletion ApeplAtsp1Aslp1Agap1 . The strain was essentially as described in Example 3 for M195 ( in genera grown in the fermentor and compared to the triple deletion tion of double protease deletion strain M219 ). This pyr4 MAB01 producing strain under the same conditions. The strain was designated with number M317 and used as the batch cultivation was performed with the M371 strain that parent for the subsequent protease deletion . produced MAB01 and was with pep1, tspl , slp1, and gap1 The fourth protease deletion to M317 was obtained by 35 protease deletions and kex2 overexpression . The strain was using gapl deletion construct p?Tvl 17 above. Transforma grown in Trichoderma minimalmedium supplemented with tion was carried out essentially according to the protocol 40 g / l solid spent grain , 40 g / l glucose , and 40 g / 1 lactose at described in Example 1 for the strains M181 and M195 pH 5.5 . The culture was grown up at 30 ° C. and then shifted using pyr4 selection . The resulting strain is the MAB01 to 22 ° C. for the production phase . The batch cultivation was producing quadruple protease deletion strain M371. 40 performed with the M304 strain that produced MAB01 and Analysis of Quadruple Protease Deletion Strain was with pep1 , tsp1, and slp1 protease deletions and kex2 The total protease activity of culture supernatant from the overexpression . The strain was grown in minimal medium quadruple deletion strain M307 was then measured and compared with culture supernatants from the triple deletion supplemented with 40 g / l solid spent grain , 40 g / l glucose , strain M277 and the wild type strain M124 . Each strain was 45 andC. and 40 gthen /l lactose shifted at topH 225.5 ° . C.The for culture the production was grown phase up at. 30 ° grown in 2 liter shake flasks with 300 ml TrMM containing 40 g /l lactose , 20 g /l spent grain extract , and 100 mM PIPPS The full length antibody yield calculated was 20 % higher at pH 5.5 . Day 7 supernatant samples were taken for total in the gap1 deletion strain from the day 6 sample . Under the protease assay. The total protein concentrations of the super same conditions, the quadruple deletion strain produced 1.9 natants were measured using the BCA assay with bovine 50 g/ L (897 mg/ L full length antibody ) and the triple deletions immunoglobulin as the standard . The supernatants were strain produced 1.3 g / L (731 mg/ L full length antibody ) . diluted serially 1 : 2 in sodium citrate buffer at pH 5.5 . The From the fermentor supernatants , the total protease activity diluted supernatants were added to fluorescently labeled against casein was measured . The supernatant samples were casein substrate and incubated at 37 ° C. The fluorescence diluted in sodium citrate buffer pH 5.5 so that the total was measured after 1 hour at 485 nm excitation and 530 nm 55 protein concentration was 0.15 mg/ml for all samples . To emission . The results showed that rate of protease activity of this diluted supernatant 10 ug mlBODIPY casein was added the triple deletion strain M277 was 3 times less than the wild to begin the protease assay. Samples from each day of the type strain M124 and the quadruple deletion strain M307 was 8 times less than the wild type strain M124 ( FIG . 30 ) . cultivation were compared between the two different strains. Additionally , FIG . 20 summarises the total protease activ- 60 The results show that there was up to 30 % less total protease ity against casein from the M188 single deletion strain , the activity in the gapl deletion strain on day 5 (FIG . 31 ) . On M219 double deletion strain , the M277 triple deletion strain , day 6 , the protease activity was 20 % lower ,which correlates and the M307 quadruple deletion strain as compared to the to the 20 % improvement in antibody yield on that day. wild type M124 strain . The pepl single deletion reduced the Quintuple Deletion Strain protease activity by 1.7 - fold , the pep1/ tsp1 double deletion 65 The M369 strain having a quintuple deletion reduced the protease activity by 2 - fold , the pep1/ tsp1 / slp1 Apep1 Atsp1Aslp1Agap1 Agap2 was generated and used for triple deletion reduced the protease activity by 3.2 - fold , and further rounds of protease deletions. US 10,731,168 B2 93 94 Generation of Quintuple Protease Deletion Strain M369 negative for the gap2 ORF . The gap2 deletion was verified To generate a marker - free quintuple protease deletion by Southern analyses of the clone (FIG . 32A ). Southern strain , removal of the pyr4 blaster cassette was applied to analyses were performed as described in Example 1. South strain M307 essentially as described in Example 3 for removal of the pyr4 blaster cassette from the single protease 5 ern analyses also indicated the clone carries an additional deletion strain M195 (Apepl ) . Three consecutive 5 -FOA copy of the deletion cassette somewhere else in the genome selection steps were carried out to ensure that the clones or has some internal rearrangements in that locus ( FIGS. selected were originating from single cells . Final clones 32B and 32C ) . Since this was the only quintuple protease were verified for the removal of the blaster cassette by PCR deletion clone obtained it was selected for further use (FIGS . using the primers listed in Table 4.3 with standard laboratory 10 32D and 32E ). Clone 14 was the clone used for removal of methods . No specific signals were seen with primers anneal the pyr4 blaster cassette , and to generate the 6 - fold protease ing with the removed part of the pyr4 blaster cassette . deletion strains M396 and M400 below (FIG . 32E ). This Removal was further verified by plating the clones onto clone was designated with strain number M369 minimal medium plates with or without 5 mM uridine . No ( ApeplAtsp1Aslp1Agap1Agap2 ) . TABLE 4.3 Primers for screening removal of pyri blaster cassette and for screening qap2 integration and strain purity . Primer Sequence For screening removal of pyr4 blaster cassette from M307 T052_gap1_5 screen_F CTCAGAAAGGTTGTAGTTGTGA ( SEQ ID NO : 359 ) T026_Pyr4_orf_5rev2 CCATGAGCTTGAACAGGTAA ( SEQ ID NO : 360 ) T053_gap1_3 screen_R GATGTTGTGTTTTCAGTCTGCA ( SEQ ID NO : 361 ) T028_Pyr4_flank_rev CATCCTCAAGGCCTCAGAC (SEQ ID NO : 362 ) For screening integration of prTv145 T048_gap2_5screen_F GCTTGGCATCACGGAAGCT ( SEQ ID NO : 363 ) T026_Pyr4_orf_5rev2 CCATGAGCTTGAACAGGTAA ( SEQ ID NO : 364 ) T049_gap2_3 screen_R TTGACAAGAAAGGTCCGGTTG ( SEQ ID NO : 365 ) T028_Pyr4_flank_rev CATCCTCAAGGCCTCAGAC ( SEQ ID NO : 366 ) For screening deletion of gap2 ORF T107_gap2_ORF_F ATGGATGCTATCCGAGCCAG ( SEQ ID NO : 367 ) T108_gap2_ORF_R CTATTCATACTCAACAGTCACA ( SEQ ID NO : 368 )
growth was observed on the plates without uridine supple Analysis of Quintuple Protease Deletion Strain mentation . The clone used to generate the quintuple protease 45 Protease activity from the M369 strain was measured deletion strain was designated with strain number M321 against its parent strain M307 . The gap2 protease deletion (Apep1 Atsp1Aslp1 Agap1, pyr4 ). resulted in 23 % less protease activity against casein (FIG . The deletion plasmid p?Tv145 for the fifth protease gene , 33 ) . glutamic protease gap2 ( TrelD106661) is described in 6 -Fold Deletion Strain Example 2 ( Table 2.3 ) . This deletion plasmid results in a 944 50 The 6 -fold protease deletion strain having deletions bp deletion in the gap2 locus and covers the complete coding Apep1Atsp1 Aslp1Agap1 Agap2Apep4 was generated and sequence of GAP2 . used for further rounds of protease deletions. To remove vector sequence, plasmid p?Tv145 ( Agap2 Generation of pep4 Deletion Plasmids pyr4 loopout) was digested with Pmel and the correct The deletion plasmid p TTv181 for the sixth protease gene , fragment purified from an agarose gel using QIAquick Gel 55 aspartic protease pep4 (TrelD77579 ) was constructed essen Extraction Kit ( Qiagen ). Approximately 5 ug of the gap2 tially as described for the Apepl plasmid p?Tv71 in deletion cassette was used to transform M321 Example 1. 959 bp of 5 ' flanking region and 992 bp of 3 ' ( Apep1Atsp1Aslp1Agap1 , pyr4- ) above . Preparation of pro flanking region were selected as the basis of the pep4 toplasts and transformation were carried out essentially as deletion plasmid . As for pep1, the first deletion plasmid for described in Example 1 for the strains M181 and M195 60 pep4 (pTTv43 , Table 4.4 ) carried another selection marker, using pyr4 selection . bar , which was replaced with the pyr4 blaster cassette . The 100 clones were picked as first streaks. All 20 growing blaster cassette was obtained from p?Tv71 with Notl diges streaks were screened by PCR using the primers listed in tion , ligated to Notl cut p?Tv43 , and then transformed into Table 4.3 for the correct integration using standard labora E. coli using standard methods. A few transformants were tory methods. 10 putative quintuple protease disruptants 65 cultivated , plasmid DNA isolated and digested to screen for (Apep1 Atsp1Aslp1 Agap1Agap2 ) were purified to single cell correct ligation and orientation of the pyr4 blaster cassette clones and rescreened by PCR . Only one purified clone was using standard laboratory methods. One clone with correct US 10,731,168 B2 95 96 insert size and orientation was sequenced and stored secutive 5 - FOA selection steps were carried out to ensure (pTTv73 , Table 4.4 ) . The blaster cassette was changed that the clones selected were originating from single cells . slightly once more: the direct repeat fragment used in Final clones were verified by PCR using the primers listed removal of pyr4 was changed from 308 bp of pyr4 5'UTR to in Table 4.5 with standard laboratory methods . Signal cor 300 bp direct repeat from the end of pep4 5 ' flanking region 5 responding to successful removal of the blaster cassette was ( as in p?Tv145 , gap2 - pyr4 ) . This was made by removing the obtained for all clones. Removal was further verified by existing pyr4 blaster cassette from p?Tv73 with NotI diges plating the clones onto minimal medium plates with or tion . The pyr4 gene was amplified by PCR using p?Tv73 as without 5 mM uridine. No growth was observed on the a template using the primers in Table 4.4 . For the yeast plates without uridine supplementation . Southern analyses homologous recombination system used in cloning , over- 10 of six putative pyr4 clones verified the removal of the lapping sequences for the vector were placed to the appro blaster cassette for three clones. In addition , the Southern priate PCR - primers . To enable marker switch in the con analyses revealed that these three clones have lost the extra struct, Noti restriction sites were introduced on both sides of signals seen for the gap2 flanks in parent M369 . Therefore the pyr4 selection marker and for additional cloning steps an these clones should have the expected genomic organisation Asci site was introduced between the pep4 5 ' direct repeat 15 in the gap2 locus. The clone used to generate the 6 -fold and 3' flank . This type of blaster cassette should not leave protease deletion strain was designated with strain number any additional sequence to the locus of the deleted gene after M3 81 (Apep1Atsp1 Aslp1Agap1 Agap2 , pyr4 ) . excision . The 300 bp pep4 5 ' direct repeat was amplified by To remove vector sequence , plasmid p?Tv181 (Apep4 PCR using the T. reesei wild type strain QM6a as a template . pyr4 loopout) was digested with Pmel and the correct Products were separated with agarose gel electrophoresis 20 fragment purified from an agarose gel using QIAquick Gel and the correct fragments were isolated from the gelwith gel Extraction Kit ( Qiagen ). Approximately 5 ug of the pep4 extraction kit ( Qiagen ) using standard laboratory methods. A deletion cassette was used to transform M381 few of the clones obtained from the recombination were (Apep1 Atsp1Aslp1Agap1Agap2 , pyr4- ) . Preparation of pro cultivated , and plasmid DNA was isolated and digested to toplasts and transformation were carried out essentially as screen for correct recombination using standard methods. 25 described in Example 1 for the strains M181 and M195 These deletion plasmids for pep4 (pTTv43 , p?Tv73 and using pyr4 selection . pTTv181 , Table 4.4 ) result in a 1413 bp deletion in the pep4 Over 200 transformants were picked as first streaks . 32 locus and cover the complete coding sequence of PEP4 . growing streaks were screened by PCR (using the primers TABLE 4.4 Primers for generating pep4 deletion plasmids . Primer Seque Deletion plasmid prTv43 for pep4 ( TreID77579 ) , vector backbone PRS426 T298_77579_5f GTAACGCCAGGGTTTTCCCAGTCACGACGGTTTAAACTCAGGTC AACCACCGAGGAC ( SEQ ID NO : 369 ) T299_77579_5r_pt CCCGTCACCGAGATCTGATCCGTCACCGGGATCCACTTAAGCGG CCGCTGAATGGGATGGTTCGATTG ( SEQ ID NO : 370 ) T300_77579_3f_pt GCCAAGCCCAAAAAGTGCTCCTTCAATATCATCTTCTGTCGCGG CCGCAGGTAGACGCTTTGCGAGTG ( SEQ ID NO : 371 ) T301_77579_3r GCGGATAACAATTTCACACAGGAAACAGCGTTTAAACTGAACT GACGCGGA?TGA ( SEQ ID NO : 372 ) Deletion plasmid PTTv73 forpep4 ( TreID77579 ) , vector backbone PTTV43 no new primers , prTv43 digested with Notl and ligated with pyr4 - loopout fragment from PTTV71 Deletion plasmid prTv181 for pep4 ( TreID77579 ) , vector backbone ptTv73 T209_pyr4_f_recpep4_5f AAGTTCCCTTCCTCTGGCAGCAATCGAACCATCCCATTCAGCGG CCGCCTAGCATCGACTACTGCTGC ( SEQ ID NO : 373 ) T210_pyr4_r CATGCAAAGATACACATCAA ( SEQ ID NO : 374 ) T211_pep4_loop_f_recpyr4 TGATTGTACCCCAGCTGCGATTGATGTGTATCTTTGCATGGCGG CCGCTCAATGTTGACTGCCCCAGG ( SEQ ID NO : 375 ) T212_pep4_loop_r_recpep4_3f GCACTTCTTAGATACACACACACTCGCAAAGCGTCTACCTGGCG CGCCTGAATGGGATGGTTCGATTG ( SEQ ID NO : 376 )
Generation of 6 - Fold Protease Deletion Strains M396 and listed in Table 4.5 ) for correct integration . Seven clones gave M400 the expected signals and were purified to single cell clones To generate a marker- free 6 - fold protease deletion strain , and rescreened by PCR using the primers listed in Table 4.5 . removal of the pyr4 marker was applied to strain M369 65 Deletion of pep4 was verified by Southern analyses from essentially as described in Example 3 for removal of pyr4 five clones ( FIGS . 34A and 34B ) using standard laboratory blaster cassette from the strain M195 (Apepl ) . Three con methods described in Example 3 for Ml 81 and M195 . US 10,731,168 B2 97 98 Southern analyses also indicated that all transformants structed essentially as described for Apepl plasmid PTT041 (FIGS . 34C and 34D ) were single integrants . To exclude that in Example 1. 1215 bp of 5 ' flanking region and 1082 bp of the faint signal seen in the PCR screening for the pep4 ORF 3 ' flanking region were selected as the basis of the pep3 in transformants would originate from pep4 gene , three deletion plasmid . As for gap2 (pTTv145 ) and pep4 (pT clones were purified further via single cell steps and reana 5 Tv181 ) deletion plasmids above , in this plasmid the direct lysed by Southern hybridisations and PCR . No signal for repeat fragment is a 300 bp stretch from the end of pep3 5 ' pep4 ORF was obtained from either analysis indicating flanking region . Fragments were produced by PCR using the strain purity . Clone 25-120A used for removal of the pyr4 primers listed in Table 4.6 . As for p?Tv181 ( Apep4 -pyr4 ) blaster cassette (and in generation of the 7 - fold protease above , to enable marker switch in the construct , NotI deletion strain ) was designated with strain number M396 10 restriction sites were introduced on both sides of the pyr4 and the repurified clone 25-120A -a with strain number selection marker and for additional cloning steps an Asch site M400 . was introduced between the pep3 5 ' direct repeat and 3 ' TABLE 4.5 Primers for screening removal of pyr4 blaster cassette from M369 and for screening pep4 integration and strain purity . Primer Sequence For screening removal of pyr4 blaster cassette from M369 T222_gap2_5f_f2 GGCAGGTCGCAGAGCAAGACA ( SEQ ID NO : 377 ) T049_gap2_3 screen_R TTGACAAGAAAGGTCCGGTTG ( SEQ ID NO : 378 ) For screening integration of ptTv181 T302_77579_5int GATTCATCACAGGGGCAGTC ( SEQ ID NO : 379 ) T027_Pyr4_orf_start_rev TGCGTCGCCGTCTCGCTCCT ( SEQ ID NO : 380 ) T415_77579_3 screen ACGCCGTTGCTGAGCCTTG ( SEQ ID NO : 381 ) T061_pyr4_orf_screen_2F TTAGGCGACCTCTTTTTCCA ( SEQ ID NO : 382 )
Analysis of Protease Activity in the 4- , 5-, and 6 -Fold flank . The products were separated with agarose gel elec Protease Deletion Strains 35 trophoresis and the correct fragments were isolated from the The quadruple protease deletion strain M307, the quin gel with gel extraction kit ( Qiagen ) using standard labora tuple protease deletion strain M369 , and the 6 - fold protease tory methods. Template used in the PCR of the flanking deletion strain transformants were cultivated in shake flask regions was the T. reesei wild type strain QM6a. The pyr4 cultures. Supernatant samples taken from large shake flask marker gene was obtained from p?Tv181 with NotI diges cultures grown in TrMM with 20 g / L spent grain and 40 g / L 40 tion . The vector backbone was EcoRI/ Xhol digested lactose buffered with 100 mM PIPPS at pH 4.8 . The pH was PRS426 as in Example 1. The plasmid was constructed using -4.25 on day 5. The 6 protease deletion transformants tested the yeast homologous recombination method described in were not the final strain , so there was some variation due to Example 1 . the purity of the spores . These were some of the best The second deletion plasmid for the aspartic protease transformants , but further spore purification was done sub- 45 pep3 ( TreID121133 ), p?Tv192, was constructed using the sequently . The day 5 supernatants were diluted 1 :3 in 50 mM plasmid p TTv188 above as the backbone . This second plas sodium citrate buffer pH 4.5. To this diluted supernatant mid carries a native KEX2 ( TreID123156 ) overexpression BODIPY casein FL ( 10 ug ml) was added and incubated cassette and uses acetamidase (AmdS ) gene from Aspergil together at 37 ° C. for 4 hours . To protease activity assay was lus nidulans as the selection marker. The pyr4 blaster conducted as described in the manufacture's protocol (enz- 50 cassette was removed from p?Tv188 with Noti- AscI double Check protease assay kit # E6638, Molecular Probes) . The digestion . The fragments for cDNA1 promoter (template : protease activity results can be seen in FIG . 33 . pTHN3 plasmid DNA) , native kex2 ( template : T. reesei There was a small reduction in protease activity when the QM6a genomic DNA ), trpC terminator ( template : pHH02 quintuple protease deletion strain M369 was grown under plasmid DNA ) and AmdS marker (template : PHHO1 plasmid acidic conditions. The deletion of gap2 in the strain provided 55 DNA) were produced by PCR using the primers listed in a 23 % reduction in protease activity against casein . In the Table 4.6 . As for p?Tv188 above , to enable marker switch in 6 -fold protease deletion strains the aspartic protease pep4 the construct, Noti restriction sites were introduced on both was deleted in the 5 transformants studied . The best trans sides of the AmdS selection marker. The products were formant showed a 35 % reduction compared to its parent separated with agarose gel electrophoresis and the correct strain M369 . 60 fragments were isolated from the gel with gel extraction kit Generation of 7 -Fold Deletion Strain ( Qiagen ) using standard laboratory methods . The plasmid The 7 - fold protease deletion strain having deletions was constructed using the yeast homologous recombination Apep1 Atsp1AslplAgap1 Agap2 Apep4 Apep3 was generated method described in Example 1 . and used for further rounds of protease deletions. The third deletion plasmid for the aspartic protease pep3 Generation of pep3 Deletion Plasmids 65 ( TrelD121133 ) , p?Tv205, was constructed using the plas The first deletion plasmid p?Tv188 for the seventh pro mid p?Tv192 above as the backbone. The AmdS marker was tease gene , aspartic protease pep3 ( TrelD121133 ) was con removed from p?Tv192 with Notl digestion . Fragments for US 10,731,168 B2 99 100 a new pyr4 blaster cassette ( located after the KEX2 over agarose gel electrophoresis and the correct fragments were expression cassette ) were produced by PCR using the prim isolated from the gel with gel extraction kit (Qiagen ) using ers listed in Table 4.6 . In this blaster cassette , the direct standard laboratory methods. The plasmid was constructed repeat is a 300 bp stretch from the beginning of the pep3 3 ' using the yeast homologous recombination method flanking region and located before the pyr4 gene. As for 5 described in Example 1 . pTTv192 above , to enable marker switch in the construct , These deletion plasmids for pep3 (pTTv188 , p?Tv192 and NotI restriction sites were introduced on both sides of the PTTV205, Table 4.6 ) result in a 2590 bp deletion in the pep3 pyr4 blaster cassette . The products were separated with locus and cover the complete coding sequence of PEP3 . TABLE 4.6 Primers for generatin pep3 deletion plasmids . Primer Sequence Deletion plasmid prTv188 for pep3 ( TreID121133 ) , vector backbone PRS426 T346_pep3_5f_for GGTAACGCCAGGGTTTTCCCAGTCACGACGTTTAAACGTCGA GCCCCCTGGACACCT ( SEQ ID NO : 385 ) T347_pep3_5f_rev GCGCTGGCAACGAGAGCAGAGCAGCACTTAGTCGATGCTAGGCG GCCGCCATCGCCGTCGCGGACATGA ( SEQ ID NO : 386 ) T348_pep3_loop_for TGATTGTACCCCAGCTGCGATTGATGTGTATCTTTGCATGGCGG CCGCTCGACGTTGTATCTGCACTC ( SEQ ID NO : 387 ) T349_pep3_loop_rev GTACGTTCTGATTGCCAACTACGGACCAGACCAGGGCTCCGGC GCGCCCATCGCCGTCGCGGACATGA ( SEQ ID NO : 388 ) T350_pep3_3f_for GGAGCCCTGGTCTGGTCCGT ( SEQ ID NO : 389 ) T351_pep3_3f_rev AGCGGATAACAATTTCACACAGGAAACAGCGTTTAAACACGCG CTTCAACATGCCCCA ( SEQ ID NO : 390 ) Deletion plasmid prTv192 forpep3 ( TreID121133 ) , vector backbone prTv188 T389_cDNApromoter_pep3flank GCTGGCCGCTGGGAATAGCGTCATGTCCGCGACGGCGATGGAA TTCGGTCTGAAGGACGT ( SEQ ID NO : 391 ) T138_cDNA1 Rev GTTGAGAGAAGTTGTTGGATTG ( SEQ ID NO : 392 ) T139_123561For_cDNA1 AACCAAAGACTTTTTGATCAATCCAACAACTTCTCTCAACATGA AGATTTCCTCGATCCTTG ( SEQ ID NO : 393 ) 123561Rev TCAGCGCCGTAACCTCTGC ( SEQ ID NO : 394 ) trpctermFor_123561 TGATGGTGATGAGGCGGAAAAGCAGAGGTTACGGCGCTGAGGA TCCACTTAACGTTACTGA ( SEQ ID NO : 395 ) T390_trpCtermR_Amds TCTCTCAAAGGAAGAATCCCTTCAGGGTTGCGTTTCCAGTGCGG CCGCTCTCCTTCTAGAAAGAAGGATTA ( SEQ ID NO : 396 ) T391_Amds_endr ACTGGAAACGCAACCCTGAA ( SEQ ID NO : 397 ) T390_trpctermR_Amds TCTGATTGCCAACTACGGACCAGACCAGGGCTCCGGCGCGGCG GCCGCTAGATCTACG ( SEQ ID NO : 398 ) Deletion plasmid prTv205 for pep3 ( TreID121133 ) , vector backbone prTv192 T428_pep3_3ilankDR_F GTACACTTGTTTAGAGGTAATCCTTCTTTCTAGAAGGAGAGCGG trpCterm CCGCGGAGCCCTGGTCTGGTCC ( SEQ ID NO : 399 ) T429_pep3_3ilankDR_R - pyr4 GCGCTGGCAACGAGAGCAGAGCAGCAGTAGTCGATGCTAGAAG CTGACGGGCGTCAACG ( SEQ ID NO : 400 ) T094_pyr4_F TAGCATCGACTACTGCTGC ( SEQ ID NO : 401 ) T430_pyr4_R - pep3_3ilank GTACGTTCTGATTGCCAACTACGGACCAGACCAGGGCTCCGCG GCCGCCATGCAAAGATACACATCAATC ( SEQ ID NO : 402 )
Generation of 7 - Fold Protease Deletion Strains 60 Final clones were verified by PCR using the primers listed To generate a marker - free 7 - fold protease deletion strain , in Table 4.7 with standard laboratory methods. Signal cor removal of the pyr4 marker was applied to the 6 - fold responding to successful removal of the blaster cassette was deletion strain M396 essentially as described in Example 3 obtained . Removal of the blaster cassette was further veri for removal of the pyr4 blaster cassette from the strain M195 fied by plating the clones onto minimal medium plates with (Apepl ). Four consecutive 5 -FOA selection steps were car- 65 or without 5 mM uridine . No growth was observed on the ried out to ensure that the clones selected were originating plates without uridine supplementation . Southern analyses from single cells . of four putative pyr4- clones verified the removal of the