DOCSLIB.ORG

Infection Exposure Promotes ETV6-RUNX1 Precursor B-Cell

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Infection Exposure Promotes ETV6-RUNX1 Precursor B-Cell Published OnlineFirst June 19, 2017; DOI: 10.1158/0008-5472.CAN-17-0701 Cancer Tumor and Stem Cell Biology Research Infection Exposure Promotes ETV6-RUNX1 Precursor B-cell Leukemia via Impaired H3K4 Demethylases Guillermo Rodríguez-Hernandez 1,2, Julia Hauer3, Alberto Martín-Lorenzo1,2, Daniel Schafer€ 3, Christoph Bartenhagen4, Idoia García-Ramírez1,2, Franziska Auer3, Ines Gonzalez-Herrero 1,2, Lucia Ruiz-Roca1,2, Michael Gombert3, Vera Okpanyi3, Ute Fischer3, Cai Chen3, Martin Dugas4, Sanil Bhatia3,Rene Martin Linka3, Marta Garcia-Suquia5, María Victoria Rascon-Trincado 5, Angel Garcia-Sanchez5,6, Oscar Blanco2,7, Maria Begona~ García-Cenador2,8, Francisco Javier García-Criado2,8, Cesar Cobaleda9, Diego Alonso-Lopez 10, Javier De Las Rivas2,10,11, Markus Muschen€ 12, Carolina Vicente-Duenas~ 2, Isidro Sanchez-García 1,2, and Arndt Borkhardt3 Abstract ETV6-RUNX1 is associated with the most common subtype of Rag1/2 expression, known for human ETV6-RUNX1 pB-ALL. childhood leukemia. As few ETV6-RUNX1 carriers develop pre- Murine and human ETV6-RUNX1 pB-ALL revealed recurrent cursor B-cell acute lymphocytic leukemia (pB-ALL), the underly- genomic alterations, with a relevant proportion affecting genes ing genetic basis for development of full-blown leukemia remains of the lysine demethylase (KDM) family. KDM5C loss of function to be identified, but the appearance of leukemia cases in time- resulted in increased levels of H3K4me3, which coprecipitated space clusters keeps infection as a potential causal factor. Here, with RAG2 in a human cell line model, laying the molecular basis we present in vivo genetic evidence mechanistically connecting for recombination activity. We conclude that alterations of KDM preleukemic ETV6-RUNX1 expression in hematopoetic stem family members represent a disease-driving mechanism and an cells/precursor cells (HSC/PC) and postnatal infections for explanation for RAG off-target cleavage observed in humans. human-like pB-ALL. In our model, ETV6-RUNX1 conferred a Our results explain the genetic basis for clonal evolution of an low risk of developing pB-ALL after exposure to common patho- ETV6-RUNX1 preleukemic clone to pB-ALL after infection expo- gens, corroborating the low incidence observed in humans. sure and offer the possibility of novel therapeutic approaches. Murine preleukemic ETV6-RUNX1 pro/preB cells showed high Cancer Res; 77(16); 1–13. Ó2017 AACR. Introduction genotype–phenotype association. Its presence is only associated with pB-ALL and it seems to confer a low risk of developing this Childhood B-cell precursor-acute lymphoblastic leukemia leukemia. Secondary genetic events are required for a pB-ALL (pB-ALL) arises from interactions between genetic (inherited) evolving from an ETV6-RUNX1 preleukemic clone. Studies on susceptibility and exogenous exposures. The ETV6-RUNX1 fusion twins with concordant ALL have revealed that ETV6-RUNX1 gene gene is the most common chromosomal alteration in pediatric fusion represents the first event ("hit") in the process of leuke- cancer and occurs in approximately 25% of childhood pB-ALL mogenesis, creating a preleukemic clone, which requires second- (1, 2). This fusion gene is one of the most extreme examples of ary postnatal genetic aberrations (3–5). This is further supported 1Experimental Therapeutics and Translational Oncology Program, Instituto de Cancer Research Center (CSIC-USAL), Salamanca, Spain. 12Department of Biología Molecular y Celular del Cancer, CSIC/Universidad de Salamanca, Laboratory Medicine, University of California San Francisco, San Francisco, Campus M. de Unamuno s/n, Salamanca, Spain. 2Institute of Biomedical California. Research of Salamanca (IBSAL), Salamanca, Spain. 3Department of Note: Supplementary data for this article are available at Cancer Research Pediatric Oncology, Hematology and Clinical Immunology, Heinrich-Heine Online (http://cancerres.aacrjournals.org/). University Dusseldorf,€ Medical Faculty, Dusseldorf,€ Germany. 4Department of fi Computer Science, Bonn-Rhein-Sieg University of Applied Sciences, G. Rodríguez-Hernandez, J. Hauer, and A. Martín-Lorenzo share rst authorship of this article. Sankt Augustin, Germany. 5Departamento de Ciencias Biomedicas y del Diag- ~ nostico, Area de Obstetricia y Ginecología, HUS-Universidad de Salamanca, C. Vicente-Duenas, I. Sanchez-García, and A. Borkhardt share senior authorship Salamanca, Spain. 6IBSAL, Facultad de Medicina, Universidad de Salamanca, of this article. Salamanca, Spain. 7Departamento de Anatomía Patologica, Universidad Corresponding Author: Arndt Borkhardt, Moorenstr. 5, 40225 Dusseldorf,€ de Salamanca, Salamanca, Spain. 8Departamento de Cirugía, Universidad Germany. Phone: 49-211-81-17680; Fax: 49-211-81-16707. E-mail: de Salamanca, Salamanca, Spain. 9Centro de Biología Molecular Severo [email protected] Ochoa, CSIC/Universidad Autonoma de Madrid, Campus de Cantoblanco, doi: 10.1158/0008-5472.CAN-17-0701 Madrid, Spain. 10Bioinformatics Unit, Cancer Research Center (CSIC-USAL), Salamanca, Spain. 11Bioinformatics and Functional Genomics Research Group, Ó2017 American Association for Cancer Research. www.aacrjournals.org OF1 Downloaded from cancerres.aacrjournals.org on October 1, 2021. © 2017 American Association for Cancer Research. Published OnlineFirst June 19, 2017; DOI: 10.1158/0008-5472.CAN-17-0701 Rodríguez-Hernandez et al. by the fact that the fusion gene may be present for up to 10 years contaminating red blood cells were lysed with RCLB lysis buffer before leukemia diagnosis (3–5). Correspondingly, high-resolu- and the remaining cells were then washed in PBS with 1% FCS. tion genome-wide analysis revealed multiple additional genetic After staining, all cells were washed once in PBS and were lesions in overt ETV6-RUNX1–associated leukemia (6). These resuspended in PBS with 1% FCS containing 2 mg/mL propidium critical secondary events are frequently driven by genomic altera- iodide (PI) to allow dead cells to be excluded from both analyses tions mediated by RAG recombinase activity, and only infrequent- and sorting procedures. The samples and the data were acquired in ly by point mutations (7). This suggests that high RAG expression an AccuriC6 Flow Cytometer and analyzed using FlowJo software. and/or facilitated recruitment of RAG to cryptic recombination Specific fluorescence of FITC, PE, PI, and APC excited at 488 nm signal sequence (RSS) might be a common path in the acquisition (0.4 W) and 633 nm (30 mW), respectively, as well as known of secondary alterations in ETV6-RUNX1 pB-ALL. The pending forward and orthogonal light scattering properties of mouse cells challenge is to identify the relevant exposures and decipher how were used to establish gates. Nonspecific antibody binding was and when these factors contribute to the multistep natural history suppressed by preincubation of cells with CD16/CD32 Fc-block of ETV6-RUNX1 pB-ALL, because it can offer prophylactic inter- solution (BD Biosciences). For each analysis, a total of at least À ventions. The lack of genetically engineered human-like ETV6- 50,000 viable (PI ) cells were assessed. RUNX1 pB-ALL models has hampered our better understanding The following antibodies were used for flow cytometry: anti- of the pathogenesis of this disease (8, 9). Thus far, experimental B220 (RA3-6B2), CD3e (145-2C11), CD4 (RM4-5, 1:500), CD8a models of ETV6-RUNX1–associated leukemia have recapitulated (53-6.7, 1:500), CD11b/Mac1 (M1/70, 1:200), CD19 (1D3), some aspects of disease evolution but not the full disease phe- CD117/c-Kit (2B8, 1:200), CD127/IL-7Ra (A7R34, 1:50), Ly- notype, irrespective of the mode and timing of expression or the 6G/Gr1 (RB6-8C5), IgM (R6-60.2), Sca1/Ly-6A/E (E13-161.7, source of target cells (10–15). 1:50), CD25 (PC61), CD48 (HM48-1) and CD150 (TC15- To address these issues, we have used a novel experimental 12F12.2) antibodies. Unspecific antibody binding was sup- approach to model the ETV6-RUNX1 preleukemic state by expres- pressed by preincubation with CD16/CD32 (2.4G2) Fc-block sing the human ETV6-RUNX1 fusion gene under the control of the solution (PharMingen). FACS definition of B-cell developmental Sca1 promoter in the mouse hematopoietic system. Sca1-ETV6- stages was performed according to Kwon and colleagues (16) with þ þ RUNX1 mice developed exclusively pB-ALL at a low disease minor modifications. Briefly, BM proB cells (CD19 c-Kit ), BM þ þ À penetrance only when they were exposed to common pathogens. pre-B cells (B220 CD25 IgM ), BM immature B cells þ À þ (B220 IgMhiIgD ), BM recirculating B cells (B220 IgDhi), þ Materials and Methods peripheral transitional B cells (B220 IgMhiIgDhi), peripheral þ mature B cells (B220 IgMloIgDhi), marginal zone (MZ) B cells Primary human samples þ (B220 CD21hiCD23lo), and follicular (FO) B cells Primary cases (Supplementary Fig. S1 and Supplementary þ (B220 CD21intCD23hi). All antibodies were purchased from BD Table S1) were obtained with informed consent in compliance Biosciences. All antibodies were used at a 1:100 dilution unless with the institutional review board of the University of otherwise indicated. Dusseldorf,€ Germany. Mouse leukemia model for ETV6-RUNX1 pB-ALL Histology All animal work has been conducted according to relevant Animals were sacrificed by cervical dislocation; tissue samples national and international guidelines, and it has been approved were formalin-fixed and included in paraffin. Pathology assess- by the Bioethics Committee of University of Salamanca and by the ment was performed on hematoxylin–eosin-stained
Load more

Recommended publications
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Independent Centromere Formation in a Capricious, Gene-Free Domain of Chromosome 13Q21 in Old World Monkeys and Pigs
    Open Access Research2006CardoneetVolume al. 7, Issue 10, Article R91 Independent centromere formation in a capricious, gene-free comment domain of chromosome 13q21 in Old World monkeys and pigs Maria Francesca Cardone*, Alicia Alonso†, Michele Pazienza*, Mario Ventura*, Gabriella Montemurro*, Lucia Carbone*, Pieter J de Jong‡, Roscoe Stanyon§, Pietro D'Addabbo*, Nicoletta Archidiacono*, Xinwei She¶, Evan E Eichler¶, Peter E Warburton† and Mariano Rocchi* reviews Addresses: *Department of Genetics and Microbiology, University of Bari, Bari, Italy. †Department of Human Genetics, Mount Sinai School of Medicine, New York, New York 10029, USA. ‡Children's Hospital Oakland Research Institute, Oakland, California 94609, USA. §Department of Animal Biology and Genetics 'Leo Pardi', University of Florence, Florence, Italy. ¶Howard Hughes Medical Institute, Department of Genome Sciences, University of Washington School of Medicine, Seattle, Washington 98195, USA. Correspondence: Mariano Rocchi. Email: [email protected] Published: 13 October 2006 Received: 3 May 2006 reports Revised: 31 July 2006 Genome Biology 2006, 7:R91 (doi:10.1186/gb-2006-7-10-r91) Accepted: 13 October 2006 The electronic version of this article is the complete one and can be found online at http://genomebiology.com/2006/7/10/R91 © 2006 Cardone et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which deposited research permits unrestricted
    [Show full text]
  • Multipoint Genome-Wide Linkage Scan for Nonword Repetition in a Multigenerational Family Further Supports Chromosome 13Q As a Locus for Verbal Trait Disorders D
    Marshall University Marshall Digital Scholar Biochemistry and Microbiology Faculty Research 12-2016 Multipoint genome-wide linkage scan for nonword repetition in a multigenerational family further supports chromosome 13q as a locus for verbal trait disorders D. T. Truong L. D. Shriberg S. D. Smith K. L. Chapman A. R. Scheer-Cohen See next page for additional authors Follow this and additional works at: https://mds.marshall.edu/sm_bm Part of the Behavioral Medicine Commons, Genetic Phenomena Commons, Genetic Processes Commons, Genetic Structures Commons, and the Speech Pathology and Audiology Commons Recommended Citation Truong DT, Shriberg LD, Smith SD, Chapman KL, Scheer-Cohen AR, DeMille MMC, et al. Multipoint genome-wide linkage scan for nonword repetition in a multigenerational family further supports chromosome 13q as a locus for verbal trait disorders. Hum Genet. 2016;135(12):1329-41. This Article is brought to you for free and open access by the Faculty Research at Marshall Digital Scholar. It has been accepted for inclusion in Biochemistry and Microbiology by an authorized administrator of Marshall Digital Scholar. For more information, please contact [email protected], [email protected]. Authors D. T. Truong, L. D. Shriberg, S. D. Smith, K. L. Chapman, A. R. Scheer-Cohen, M. M.C. DeMille, A. K. Adams, Alejandro Q. Nato Jr., E. M. Wijsman, J. D. Eicher, and J. R. Gruen This article is available at Marshall Digital Scholar: https://mds.marshall.edu/sm_bm/228 Hum Genet (2016) 135:1329–1341 DOI 10.1007/s00439-016-1717-z ORIGINAL INVESTIGATION Multipoint genome‑wide linkage scan for nonword repetition in a multigenerational family further supports chromosome 13q as a locus for verbal trait disorders D.
    [Show full text]
  • Comprehensive Analysis Reveals Novel Gene Signature in Head and Neck Squamous Cell Carcinoma: Predicting Is Associated with Poor Prognosis in Patients
    5892 Original Article Comprehensive analysis reveals novel gene signature in head and neck squamous cell carcinoma: predicting is associated with poor prognosis in patients Yixin Sun1,2#, Quan Zhang1,2#, Lanlin Yao2#, Shuai Wang3, Zhiming Zhang1,2 1Department of Breast Surgery, The First Affiliated Hospital of Xiamen University, School of Medicine, Xiamen University, Xiamen, China; 2School of Medicine, Xiamen University, Xiamen, China; 3State Key Laboratory of Cellular Stress Biology, School of Life Sciences, Xiamen University, Xiamen, China Contributions: (I) Conception and design: Y Sun, Q Zhang; (II) Administrative support: Z Zhang; (III) Provision of study materials or patients: Y Sun, Q Zhang; (IV) Collection and assembly of data: Y Sun, L Yao; (V) Data analysis and interpretation: Y Sun, S Wang; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors contributed equally to this work. Correspondence to: Zhiming Zhang. Department of Surgery, The First Affiliated Hospital of Xiamen University, Xiamen, China. Email: [email protected]. Background: Head and neck squamous cell carcinoma (HNSC) remains an important public health problem, with classic risk factors being smoking and excessive alcohol consumption and usually has a poor prognosis. Therefore, it is important to explore the underlying mechanisms of tumorigenesis and screen the genes and pathways identified from such studies and their role in pathogenesis. The purpose of this study was to identify genes or signal pathways associated with the development of HNSC. Methods: In this study, we downloaded gene expression profiles of GSE53819 from the Gene Expression Omnibus (GEO) database, including 18 HNSC tissues and 18 normal tissues.
    [Show full text]
  • A Community-Based Transcriptomics Classification and Nomenclature Of
    COMMENT | FOCUS comment | FOCUS A community-based transcriptomics classifcation and nomenclature of neocortical cell types To understand the function of cortical circuits, it is necessary to catalog their cellular diversity. Past attempts to do so using anatomical, physiological or molecular features of cortical cells have not resulted in a unifed taxonomy of neuronal or glial cell types, partly due to limited data. Single-cell transcriptomics is enabling, for the frst time, systematic high-throughput measurements of cortical cells and generation of datasets that hold the promise of being complete, accurate and permanent. Statistical analyses of these data reveal clusters that often correspond to cell types previously defned by morphological or physiological criteria and that appear conserved across cortical areas and species. To capitalize on these new methods, we propose the adoption of a transcriptome-based taxonomy of cell types for mammalian neocortex. This classifcation should be hierarchical and use a standardized nomenclature. It should be based on a probabilistic defnition of a cell type and incorporate data from diferent approaches, developmental stages and species. A community-based classifcation and data aggregation model, such as a knowledge graph, could provide a common foundation for the study of cortical circuits. This community-based classifcation, nomenclature and data aggregation could serve as an example for cell type atlases in other parts of the body. Rafael Yuste, Michael Hawrylycz, Nadia Aalling, Argel Aguilar-Valles, Detlev Arendt, Ruben Armananzas Arnedillo, Giorgio A. Ascoli, Concha Bielza, Vahid Bokharaie, Tobias Borgtoft Bergmann, Irina Bystron, Marco Capogna, Yoonjeung Chang, Ann Clemens, Christiaan P. J. de Kock, Javier DeFelipe, Sandra Esmeralda Dos Santos, Keagan Dunville, Dirk Feldmeyer, Richárd Fiáth, Gordon James Fishell, Angelica Foggetti, Xuefan Gao, Parviz Ghaderi, Natalia A.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name protocadherin 20 Gene Symbol PCDH20 Organism Human Gene Summary This gene belongs to the protocadherin gene family a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. Although its specific function is undetermined the cadherin-related neuronal receptor is thought to play a role in the establishment and function of specific cell-cell connections in the brain. Gene Aliases FLJ22218, PCDH13 RefSeq Accession No. NC_000013.10, NT_024524.14 UniGene ID Hs.391781 Ensembl Gene ID ENSG00000197991 Entrez Gene ID 64881 Assay Information Unique Assay ID qHsaCED0001471 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000409204, ENST00000409186, ENST00000358674 Amplicon Context Sequence AGATCTGGGAAACAGGGAACTGCGGGGCGTTGTCATTGATGTCTCTGATGGCGA TCTTCACCTTCACAAACCTGAAGTATTCCTGAGGCAGGACAAGCACATCCAGCA GCAAAAGACAAGAGTCAGAAGGAGAGGAGGA Amplicon Length (bp) 109 Chromosome Location 13:61987589-61987727 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 97 R2 0.9994 cDNA Cq 30.72 cDNA Tm (Celsius) 82 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 22.91 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report PCDH20, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • Systematic Detection of Brain Protein-Coding Genes Under Positive Selection During Primate Evolution and Their Roles in Cognition
    Downloaded from genome.cshlp.org on October 7, 2021 - Published by Cold Spring Harbor Laboratory Press Title: Systematic detection of brain protein-coding genes under positive selection during primate evolution and their roles in cognition Short title: Evolution of brain protein-coding genes in humans Guillaume Dumasa,b, Simon Malesysa, and Thomas Bourgerona a Human Genetics and Cognitive Functions, Institut Pasteur, UMR3571 CNRS, Université de Paris, Paris, (75015) France b Department of Psychiatry, Université de Montreal, CHU Ste Justine Hospital, Montreal, QC, Canada. Corresponding author: Guillaume Dumas Human Genetics and Cognitive Functions Institut Pasteur 75015 Paris, France Phone: +33 6 28 25 56 65 [email protected] Dumas, Malesys, and Bourgeron 1 of 40 Downloaded from genome.cshlp.org on October 7, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract The human brain differs from that of other primates, but the genetic basis of these differences remains unclear. We investigated the evolutionary pressures acting on almost all human protein-coding genes (N=11,667; 1:1 orthologs in primates) based on their divergence from those of early hominins, such as Neanderthals, and non-human primates. We confirm that genes encoding brain-related proteins are among the most strongly conserved protein-coding genes in the human genome. Combining our evolutionary pressure metrics for the protein- coding genome with recent datasets, we found that this conservation applied to genes functionally associated with the synapse and expressed in brain structures such as the prefrontal cortex and the cerebellum. Conversely, several genes presenting signatures commonly associated with positive selection appear as causing brain diseases or conditions, such as micro/macrocephaly, Joubert syndrome, dyslexia, and autism.
    [Show full text]
  • Downloaded from the Mouse Lysosome Gene Database, Mlgdb
    1 Supplemental Figure Legends 2 3 Supplemental Figure S1: Epidermal-specific mTORC1 gain-of-function models show 4 increased mTORC1 activation and down-regulate EGFR and HER2 protein expression in a 5 mTORC1-sensitive manner. (A) Immunoblotting of Rheb1 S16H flox/flox keratinocyte cultures 6 infected with empty or adenoviral cre recombinase for markers of mTORC1 (p-S6, p-4E-BP1) 7 activity. (B) Tsc1 cKO epidermal lysates also show decreased expression of TSC2 by 8 immunoblotting of the same experiment as in Figure 2A. (C) Immunoblotting of Tsc2 flox/flox 9 keratinocyte cultures infected with empty or adenoviral cre recombinase showing decreased EGFR 10 and HER2 protein expression. (D) Expression of EGFR and HER2 was decreased in Tsc1 cre 11 keratinocytes compared to empty controls, and up-regulated in response to Torin1 (1µM, 24 hrs), 12 by immunoblot analyses. Immunoblots are contemporaneous and parallel from the same biological 13 replicate and represent the same experiment as depicted in Figure 7B. (E) Densitometry 14 quantification of representative immunoblot experiments shown in Figures 2E and S1D (r≥3; error 15 bars represent STDEV; p-values by Student’s T-test). 16 17 18 19 20 21 22 23 Supplemental Figure S2: EGFR and HER2 transcription are unchanged with epidermal/ 24 keratinocyte Tsc1 or Rptor loss. Egfr and Her2 mRNA levels in (A) Tsc1 cKO epidermal lysates, 25 (B) Tsc1 cKO keratinocyte lysates and(C) Tsc1 cre keratinocyte lysates are minimally altered 26 compared to their respective controls. (r≥3; error bars represent STDEV; p-values by Student’s T- 27 test).
    [Show full text]
  • Cell Type Marker Enrichment Across Brain Regions and Experimental Conditions
    Cell type marker enrichment across brain regions and experimental conditions by Powell Patrick Cheng Tan B. Sc. (Honours), Simon Fraser University, 2010 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science in THE FACULTY OF GRADUATE STUDIES (Bioinformatics) The University Of British Columbia (Vancouver) November 2012 c Powell Patrick Cheng Tan, 2012 Abstract The first chapter of this thesis explored the dominant gene expression pattern in the adult human brain. We discovered that the largest source of variation can be explained by cell type marker expression. Across brain regions, expression of neuron cell type markers are anti-correlated with the expression of oligodendrocyte cell type markers. Next, we explored gene function convergence and divergence in the adult mouse brain. Our contributions are as follows. First, we provide candidate cell type markers for investigating specific cell type populations. Second, we highlight orthologous genes that show functional divergence between human and mouse brains. In the second chapter, we present our preliminary work on the effects of tissue types and experimen- tal conditions on human microarray studies. First, we measured the expression and differential expression levels of tissue-enriched genes. Next, we identified modules with similar expression levels and differen- tial expression p-values. Our results show that expression levels reflect tissue type variation. In contrast, differential expression levels are more complex, owing to the large diversity of experimental conditions in the data. In summary, our work provides a different perspective on the functional roles of genes in human microarray studies. ii Table of Contents Abstract .
    [Show full text]
  • Can We Treat Congenital Blood Disorders by Transplantation Of
    Can we Treat Congenital Blood Disorders by Transplantation of Stem Cells, Gene Therapy to the Fetus? Panicos Shangaris University College London 2019 A thesis submitted for the degree of Doctor of Philosophy 1 Declaration I, Panicos Shangaris confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. 2 Abstract Congenital diseases such as blood disorders are responsible for over a third of all pediatric hospital admissions. In utero transplantation (IUT) could cure affected fetuses but so far in humans, successful IUT has been limited to fetuses with severe immunologic defects, due to the maternal immune system and a functionally developed fetal immune system. I hypothesised that using autologous fetal cells could overcome the barriers to engraftment. Previous studies show that autologous haematopoietic progenitors can be easily derived from amniotic fluid (AF), and they can engraft long term into fetal sheep. In normal mice, I demonstrated that IUT of mouse AFSC results in successful haematopoietic engraftment in immune-competent mice. Congenic AFSCs appear to have a significant advantage over allogenic AFSCs. This was seen both by their end haematopoietic potential and the immune response of the host. Expansion of haematopoietic stem cells (HSC) has been a complicated and demanding process. To achieve adequate numbers for autologous stem cells for IUT, HSCs need to be expanded efficiently. I expanded and compared AFSCs, fetal liver stem cells and bone marrow stem cells. Culturing and expanding fetal and adult stem cells in embryonic stem cell conditions maintained their haematopoietic potential.
    [Show full text]
  • Whole Exome Sequencing in Adult-Onset Hearing Loss Reveals A
    Lewis et al. BMC Medical Genomics (2018) 11:77 https://doi.org/10.1186/s12920-018-0395-1 RESEARCHARTICLE Open Access Whole exome sequencing in adult-onset hearing loss reveals a high load of predicted pathogenic variants in known deafness-associated genes and identifies new candidate genes Morag A. Lewis1,2, Lisa S. Nolan3, Barbara A. Cadge3, Lois J. Matthews4, Bradley A. Schulte4, Judy R. Dubno4, Karen P. Steel1,2† and Sally J. Dawson3*† Abstract Background: Deafness is a highly heterogenous disorder with over 100 genes known to underlie human non- syndromic hearing impairment. However, many more remain undiscovered, particularly those involved in the most common form of deafness: adult-onset progressive hearing loss. Despite several genome-wide association studies of adult hearing status, it remains unclear whether the genetic architecture of this common sensory loss consists of multiple rare variants each with large effect size or many common susceptibility variants each with small to medium effects. As next generation sequencing is now being utilised in clinical diagnosis, our aim was to explore the viability of diagnosing the genetic cause of hearing loss using whole exome sequencing in individual subjects as in a clinical setting. Methods: We performed exome sequencing of thirty patients selected for distinct phenotypic sub-types from well- characterised cohorts of 1479 people with adult-onset hearing loss. Results: Every individual carried predicted pathogenic variants in at least ten deafness-associated genes; similar findings were obtained from an analysis of the 1000 Genomes Project data unselected for hearing status. We have identified putative causal variants in known deafness genes and several novel candidate genes, including NEDD4 and NEFH that were mutated in multiple individuals.
    [Show full text]