A Revisit to a Low-Cost Method for the Isolation Of

* 1 , Christina Seok 2 , Geetha Annavi Geetha , 3 . The copyright holder for this preprint (which was (which preprint this for holder copyright The , Wei Lun Ng 1 , Norsyamimi Rosli Norsyamimi , 3,4 CC-BY 4.0 International license International 4.0 CC-BY , Ramitha Arumugam 1 this version posted August 3, 2018. 2018. 3, August posted version this ; , Jeffrine J. Rovie-Ryan J. Jeffrine , 1 available under a under available , Nurul Adilah Ismail 1 , Ahmad Ismail Ahmad , 1 A revisit to a low-cost method for the isolation of microsatellite of microsatellite for the isolation to a low-cost method A revisit https://doi.org/10.1101/384651 markers: the case of the endangered Malayan tapir (Tapirus indicus) of the endangered Malayan markers: the case Institute Institute of Tropical Biodiversity and Sustainable Development, Universiti Malaysia Department of Biology, Faculty of Science, Universiti Putra Malaysia, Serdang, Selangor, University Malaysia Marine Sciences, Xiamen College of China-ASEAN National Wildlife Forensic Laboratory (NWFL), Ex-Situ Conservation Division, * Corresponding Author: Geetha Annavi * Corresponding Author: Geetha (GA) [email protected] Email: Yien Yong Yien Parks (DWNP), Kuala Lumpur,Malaysia. National and Department of Wildlife 4 Malaysia. Terengganu, Kuala Terengganu, Terengganu, 1 Malaysia 2 3 Qi Luan Lim doi: doi: 5 7 8 9 2 4 6 1 3 14 15 16 11 12 13 10 not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made made It is perpetuity. in preprint the display to a license bioRxiv granted has who the author/funder, is review) peer by certified not bioRxiv preprint preprint bioRxiv 1 . Tapirus indicus individuals The copyright holder for this preprint (which was (which preprint this for holder copyright The CC-BY 4.0 International license International 4.0 CC-BY this version posted August 3, 2018. 2018. 3, August posted version this ; Using six random amplified microsatellite (RAM) markers, this markers, (RAM) microsatellite amplified random six Using . available under a under available Tapirus indicus Tapirus https://doi.org/10.1101/384651 Microsatellites, also known as short tandem repeats (STRs) or short sequence repeats (SSRs), repeats sequence short or (STRs) repeats tandem short as known also Microsatellites, are stretches of DNA consisting of tandemly repeated 1-6 nucleotides occurring locus microsatellite at a of length the high with organisms, most of genomes nuclear the in frequency typically in 5-40 repeats [1]. Slippage event during DNA replication is generally considered as the main mechanism for the expansion and contraction of microsatellites [2]. Mutation rates of the slippage events elevate from background rates when the repeat numbers in Introduction There are many approaches to develop microsatellite markers. We revisited an easy and rapid and easy an revisited We markers. microsatellite develop to approaches many are There Polymerase Chain Reaction (PCR)-cloning-sequencing method to design microsatellite for markers study had rapidly generated 45 unique genomic sequences containing microsatellites. After screening 15 terminal and seven intermediate microsatellite loci, we shortlisted five and seven which were amplified either by single- or multiplex PCR using the economical three- primer PCR method. Genotyping attempts were made with ten Abstract using three of the terminal microsatellite loci and all seven intermediate loci. However, none However, loci. intermediate seven all and loci microsatellite terminal the of three using of the terminal microsatellite loci were considered useful for population genotyping studies, while the seven intermediate loci showed good amplification but were monomorphic in the ten samples. Despite successful detection of amplified loci, we would like to highlight that, to loci microsatellite of isolation for method alternative this in interested are who researchers be cautious and be aware of the limitations and downfalls reported herein that could render genotyping. unsuitable for population these loci doi: doi: 35 36 37 38 39 40 41 33 34 19 20 21 22 23 24 25 17 18 26 27 28 29 30 31 32 not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made made It is perpetuity. in preprint the display to a license bioRxiv granted has who the author/funder, is review) peer by certified not bioRxiv preprint preprint bioRxiv 2 . The copyright holder for this preprint (which was (which preprint this for holder copyright The CC-BY 4.0 International license International 4.0 CC-BY this version posted August 3, 2018. 2018. 3, August posted version this ; available under a under available https://doi.org/10.1101/384651 T. indicus, or commonly known as Malayan Tapir or Asian Tapir, is an odd-toed ungulate (Order Perissodactyla) that occurs solely in Southeast Asia and also the only Old World extant member of Tapiridae family [16]. Its current population distribution includes regions of Myanmar, Thailand, Peninsular Malaysia, and Sumatra with not more than 2500 mature for Union International the by ‘Endangered’ as listed been has it and worldwide, individuals Conservation of Nature (IUCN) Red List [17,18]. The population genetic structure of this species in Peninsular Malaysia remains poorly understood, and this may potentially hamper One of the conventional microsatellite isolation methods employs conversion of a random more or one to system, marker multi-locus a is which marker, (RAM) microsatellite amplified single-locus microsatellite marker. RAM was first described by Zietkiewicz et al. [11] and later further improved by Fisher et al. [12] to anchor the RAM primers consistently at the 5’ contain that amplicons produces then amplification PCR microsatellites. adjacent two of ends microsatellites at both ends of sequence. Extra microsatellite may also be present between the two termini of microsatellites. Next, specific primers can be designed for terminal both and the intermediate microsatellites. This technique has been studies [13–15]. in earlier markers of microsatellite generation used in the rapid There are various methods to develop microsatellite markers [7,8]. These methods have been have methods These [7,8]. markers microsatellite develop to methods various are There improved over decades and are well described. An extensive isolation review methods has of been published microsatellite [7]. Some of these methods are still sufficient and [9,10]. projects marker development microsatellite successfully used in recent microsatellites microsatellites are large [3]. Because of the hypermutability, microsatellite markers have studies genetic molecular for used widely are They [4]. polymorphic highly be to shown been including fingerprinting, parental or kinship analysis, population genetic structure [2,5,6]. resources conservation biological and doi: doi: 62 63 64 65 66 67 68 61 52 53 54 55 56 57 58 59 60 51 46 47 48 49 50 42 43 44 45 not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made made It is perpetuity. in preprint the display to a license bioRxiv granted has who the author/funder, is review) peer by certified not bioRxiv preprint preprint bioRxiv 3

T. indicus . The copyright holder for this preprint (which was (which preprint this for holder copyright The CC-BY 4.0 International license International 4.0 CC-BY this version posted August 3, 2018. 2018. 3, August posted version this ; available under a under available https://doi.org/10.1101/384651 Whole blood samples were collected for microsatellite isolation from three individuals kept in enclosures at the National Zoo of Malaysia or Zoo Negara (3°12'N, 101°45'E) and the Sungai Dusun Wildlife Reserve (3°40'N, 101°21'E) by the respective veterinary officers at the study sites and transported on ice to the laboratory at Universiti Care Animal Institutional the by approved were procedures sampling the All Malaysia. Putra and Use Committee, Universiti Putra Malaysia (ethical approval ref.: UPM/IACUC/AUP- Sample collection and Sample collection DNA extraction Materials and Materials Methods We followed the same technique as described in genotyped a [20] few tapir individuals using microsatellite markers isolated with from RAM marker. minor modifications and RAM with isolated microsatellites analyse to study first the was work our knowledge, our To markers on capillary electrophoresis system. We reported the potential of combining RAM or specific anchor markers and other techniques namely multiplex PCR and three-primer- method for genotyping. We also discussed the advantages and downfalls when using RAM the in polymorphism any detect not did we though Even microsatellites. isolating in markers limitations and process the of reporting the hope we protocol, this through samples genotyped to method this on interest similar with researchers other help would encountered had we that of the data obtained. and interpretation in the generation be cautious conservation conservation efforts (e.g. breeding management) in the nation. Genetic marker such microsatellite as has been used to aid conservation management in other tapir species [19], but yet. species spectacular or published for this not been developed have microsatellites doi: doi: 88 89 90 91 92 93 85 86 87 83 84 72 73 74 75 76 77 78 79 80 81 82 69 70 71 not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made made It is perpetuity. in preprint the display to a license bioRxiv granted has who the author/funder, is review) peer by certified not bioRxiv preprint preprint bioRxiv 4 Fluorometer Fluorometer using TM Nucleic Acid Staining . TM The copyright holder for this preprint (which was (which preprint this for holder copyright The Two types of PCR reaction reaction PCR of types Two μL. CC-BY 4.0 International license International 4.0 CC-BY DNA Mini Kit (Qiagen, Germany) following the ® this version posted August 3, 2018. 2018. 3, August posted version this ; available under a under available used for each RAM primer are listed in Table 1. PCR amplification

a T RAM primer, in a total volume of 25 of volume total a in primer, RAM μM https://doi.org/10.1101/384651 Six 5’-anchoring RAM primers selected from published literature (Table 1) were used for amplification. These RAM primers were selected based on (minimum the length 7 of 5’-anchors nucleotides). Single-primer concentrations of PCR approximately 10 ng of reaction template DNA, 1× MyTaq mixtures Red Mix (Bioline, contained 1.0 and Germany), final PCR the on Details 2). Table in I condition (PCR touchdown and general used: were profiles reaction profile and products were visualised on 2% agarose gel containing RedSafe Solution. The remaining PCR products were purified using the Wizard® PCR Clean-Up following Germany), (Qiagen, Kit Extraction Gel QIAquick® the or USA) (Promega, System and cloned. were ligated purified DNA amplicons instructions. The manufacturer’s Development of microsatellite markers Development of microsatellite manufacturer’s manufacturer’s spin protocol. The gDNA was quantified by Quantus R033/2016). R033/2016). For genotyping, blood samples on FTA® cards (Whatman, UK) and tissue Wildlife of Department the by provided were individuals unrelated putatively ten of samples and National Park (PERHILITAN), Malaysia. Genomic DNA (gDNA) was extracted from these samples using the QIAamp ONE dsDNA dye (Promega, USA) and ranged from 0.2 to 100 ng/μL. USA) from 0.2 to ONE dsDNA and ranged dye (Promega, doi: doi: 98 94 95 96 97 99 117 118 114 115 116 103 104 105 106 107 108 109 110 111 112 113 101 102 100 not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made made It is perpetuity. in preprint the display to a license bioRxiv granted has who the author/funder, is review) peer by certified not bioRxiv preprint preprint bioRxiv 5 Source [21] [15] [22] a T (°C) 63-52 60 60 55 50 55 . The copyright holder for this preprint (which was (which preprint this for holder copyright The PCR types Touc hdow n Gener al Gener al Gener al Gener al Gener al 5 5 5 7 7 11 Target motif (GT) (GT) (CAG) (CA) (CTC) (GACA) CC-BY 4.0 International license International 4.0 CC-BY this version posted August 3, 2018. 2018. 3, August posted version this ; available under a under available NNNKKVRVRVCTCCTCCT CCTCCTC KKVRVRVGACAGACAGA CAGACAGACA 5'-Primer sequences-3' 5'-Primer CATGCACATTGTGTGTGT GTGTGT NNNMMHVHVHVHTGTGT GTGTGTGTGTGTGTGTG KKKYHYHYCAGCAGCAG CAGCAG GATGCGATCCACACACAC ACACA https://doi.org/10.1101/384651 RAM4 RAM17 RAM22 RAM26 RAM28 RAM13 Primer Table 1. List of six primers tested for microsatellite markers isolation. Names given to isolation. Names markers for microsatellite tested of six primers Table 1. List the primers were used as a reference throughout the text. used throughout as a reference the primers were H=A/T/C, B=G/T/C, D=G/A/T, K=G/T, M=A/C, N=A/G/C/T, V=G/C/A, R=G/A, S=G/C and Y=C/T doi: doi: 121 122 123 119 120 not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made made It is perpetuity. in preprint the display to a license bioRxiv granted has who the author/funder, is review) peer by certified not bioRxiv preprint preprint bioRxiv 6 1 cycle 72°C for 1 min 72°C for 3 min 72°C for 20 min Final Extension 40 × 40 × 30 × 35 × 35 × Cycle 60 30 30 60 30 20 30 20 30 60 30 20 20 30 30 seconds a a a a 72 95 72 95 72 95 72 95 55 72 95 °C T T 63→52 65→57 Three-step PCR Step Denaturation Annealing Extension Denaturation Annealing Extension Denaturation Annealing Extension Denaturation Annealing Extension Denaturation Annealing Extension . The copyright holder for this preprint (which was The copyright holder for 1 cycle 95 °C for 3 min Pre-denaturation b b CC-BY 4.0 International license CC-BY 4.0 International Type of profile General Touchdown Specific General Touchdown this version posted August 3, 2018. this version posted August ; available under a for protocol I and III was dependent on the annealing temperature used for each RAM marker in Table 1 and tested marker in Table 3 respectively. in Table marker 1 and tested RAM marker in Table used for each temperature on the annealing I and III was dependent for protocol https://doi.org/10.1101/384651 III. Screening markers I. RAM amplification II. Colony PCR a PCR condition Touchdown PCR was performed at -1 °C per cycle and remained constant at the last annealing temperature for the rest of reaction cycles. of reaction for the rest temperature annealing last at the remained constant -1 °C per cycle and Touchdown PCR was performed at T a b Table 2. All PCR condition used in the development of microsatellite markers isolated from Random amplified microsatellite (RAM). from Random microsatellite amplified isolated markers of microsatellite used in the development PCR condition Table 2. All doi: 125 126 127 124 not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made bioRxiv a license to display the preprint in perpetuity. is the author/funder, who has granted not certified by peer review) bioRxiv preprint 7 μM μg/mL) of cells per per cells of μL Red Mix, 0.25 Mix, Red T4 DNA Ligase Ligase DNA T4 μL 2× Rapid Ligation Ligation Rapid 2× μL TM . The copyright holder for this preprint (which was (which preprint this for holder copyright The μL volume per tube) for the products of each purified PCR product, 0.5 0.5 product, PCR purified μL μL with PCR condition II (Table 2). The PCR CC-BY 4.0 International license International 4.0 CC-BY ≥90% similarity and were detected by an online tool called this version posted August 3, 2018. 2018. 3, August posted version this ; of ligation reaction was added to transform 20 transform to added was reaction ligation of μL available under a under available of super optimal broth (SOC) medium. The bacteria were cultured were bacteria The medium. (SOC) broth optimal super of μL pGEM®-T Easy Vector, 4.0 Vector, Easy pGEM®-T μL Then, 5 Then, units/μL). https://doi.org/10.1101/384651 Sequences generated from the same locus were referred to as redundant sequences, and they and sequences, redundant as to referred were locus same the from generated Sequences were defined as sequences with ‘Decrease Redundancy’ [23] under default settings. From sequences the generated output, from non-redundant same RAM markers were paired sequence-by-sequence Sequences chimeras. or sequences similar highly detect to [24,25] and LALIGN using compared sequences were discarded. between two different structure showing possible chimeric Colony PCR was performed in reaction mixtures containing 1× MyTaq 1× containing mixtures reaction in performed was PCR Colony of each primer in a final volume of 10 (Promega, USA) before transforming into JM109 (Escherichia coli). Ligation reactions High-Efficiency (in 10 Competent Cells amplicons were visualised on 2% agarose gel, and clones with different insert sizes were chosen for subsequent Sanger sequencing service on an ABI Genetic Analyzer ABI3730XL (Applied Biosystems, USA). The purified PCR amplicons were individually ligated onto the pGEM®-T Easy Vector RAM were prepared with the following modifications to the protocol: 5 protocol: the to modifications following the with prepared were RAM 0.5 Buffer, (3 Weiss Weiss (3 980 by followed tube, colony and screening blue-white before overnight °C 4 at placed and mg/mL), (40 X-gal and PCR screening for insert sizes. Eleven to 35 white colonies on the agar plates per ligation reaction were randomly selected and subjected to colony PCR using the M13 primers (F: 5'- GTAAAACGACGGCCAGT-3'; R: 5'-AACAGCTATGACCATG-3'). in an incubator at 37 °C for 16-18 hours, plated on LB agar containing ampicillin (50 ampicillin containing agar LB on plated hours, 16-18 for °C 37 at incubator an in doi: doi: 153 146 147 148 149 150 151 152 141 140 142 129 130 143 144 145 128 131 132 133 134 136 137 138 139 135 not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made made It is perpetuity. in preprint the display to a license bioRxiv granted has who the author/funder, is review) peer by certified not bioRxiv preprint preprint bioRxiv 8 μL single-plex . The copyright holder for this preprint (which was (which preprint this for holder copyright The ) designed from intermediate sequence in between CC-BY 4.0 International license International 4.0 CC-BY this version posted August 3, 2018. 2018. 3, August posted version this ; μM of primer mix using touchdown profile of PCR condition III internal primer available under a under available https://doi.org/10.1101/384651 Screening of markers To test the designed primer pairs, PCR amplification was performed in 10 microsatellites microsatellites constituted a non-degenerate RAM or specific anchor primer pairing with a specific primer (termed two terminal microsatellites. A specific anchor primer has the sequence criteria General of marker. RAM its to corresponds the that anchor 5’ specific a targeted and motif repeating in S1 Table. designed primers are listed Primer3Plus ([27]). The design using of primer pair PCR reaction mixtures containing 1× MyTaq Red Mix (Bioline, Germany), 2-20ng template DNA, of and 0.4 unspecific minimal with sizes expected of bands produced that loci of pairs Primer 2). (Table products were chosen for further analysis by fragment analysis (Table 3), and their internal primers were redesigned to attach at the 5’ end one of the following sequences: M13 (5’-6- FAM-TCCCAGTCACGACGT-3’), (5’-HEX-CACTGCTTAGAGCGATGC- M13modB AGGTGAGATGACAGGAGATC-3’), Neomycin rev (5’-6-FAM- Unlike usual primer pair design, primer pairs of the isolated loci carrying terminal sequences (intermediate microsatellites) were detected using IMEx [26] using the following criteria: minimum eight repeats for mononucleotide , four repeats for di- and trinucleotide, repeat hexanucleotide and penta- for repeats two least at and tetranucleotide, for repeats three motifs. Compound microsatellites constituting two or more repeat motifs within 10 distance bp apart were also detected. Interrupted microsatellites were detected by manually examining the upstream and downstream segments of individual perfect microsatellites for within 10bp distance. of the same motif any repeats Perfect Perfect microsatellites present at both ends (terminal microsatellites) and within the doi: doi: 170 171 172 169 164 165 166 167 168 173 174 175 176 177 178 179 162 163 155 156 157 158 159 160 161 154 not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made made It is perpetuity. in preprint the display to a license bioRxiv granted has who the author/funder, is review) peer by certified not bioRxiv preprint preprint bioRxiv 9 . The copyright holder for this preprint (which was (which preprint this for holder copyright The CC-BY 4.0 International license International 4.0 CC-BY this version posted August 3, 2018. 2018. 3, August posted version this ; available under a under available https://doi.org/10.1101/384651 CTAGTTATTGCTCAGCGGT-3’) for subsequent three-primer PCR reactions [28–30]. The [28–30]. reactions PCR three-primer subsequent for CTAGTTATTGCTCAGCGGT-3’) bp. 46 length up to primer had primer internal tailed 3’), Hill (5’-HEX-TGACCGGCAGCAAAATTG-3’) or T7term (5’-ROX- doi: doi: 181 182 180 not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made made It is perpetuity. in preprint the display to a license bioRxiv granted has who the author/funder, is review) peer by certified not bioRxiv preprint preprint bioRxiv 10 b (bp) Observed size 302-314 212-230 208-234 200 306-314 ), observed and expected sizes. The sizes. expected and observed ), a primer 6-FAM/ M13 6-FAM/ M13 HEX/ M13modB Fluorescent label/ Tail Fluorescent label/ a T 62 57 62 57 63 65- 65- 65- 65- (°C) . The copyright holder for this preprint (which was The copyright holder for a CC-BY 4.0 International license CC-BY 4.0 International this version posted August 3, 2018. this version posted August ; 5'-Primer Sequences-3' 5'-Primer TCCCAGTCACGACGTAGCCAAAGGATAGGGAAAGG CATGCACATTGTGTGTGTGT CACAAAAGCTGTGTGTGTGT CACTGCTTAGAGCGATGCGAGATAGGGAGAGGCTGGT TCCCAGTCACGACGTGCCTTGAAATGGAGTTGGTG CATGCACATTGTGTGTGTGTGTGT TCCCAGTCACGACGTGCCTTGAAATGGAGTTGGTG CATGCACATTGTGTGTGTGT TCCCAGTCACGACGTAGCCAAAGGATAGGGAAAGG CATGCACATTGTGTGTGTGTGTGT available under a F: R: F: R: F: R: F: R: F: R: c c Ti4B9* Ti13D Ti4A9 Ti4A9* Ti4B9 Loci https://doi.org/10.1101/384651 3. 2. 1. No. Terminal microsatellite Terminal Table 3. List of 14 primer pairs from 12 loci developed from RAM markers and the annealing temperature (T temperature annealing the and markers RAM from developed loci 12 from pairs primer 14 of List 3. Table electrophoresis. customised for a dye colour. CE – capillary extended with that tails were primers were doi: 183 184 not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made bioRxiv a license to display the preprint in perpetuity. is the author/funder, who has granted not certified by peer review) bioRxiv preprint 11 190 ~190 192 293 174 259 218 Hill Hill HEX/ HEX/ ROX/ T7term 6-FAM/ 6-FAM/ Neomycin Neomycin 6-FAM/ M13 ROX/ T7term 57 55 55 55 55 55 57 65- 65- 65- 65- 65- 65- 65- . The copyright holder for this preprint (which was The copyright holder for CC-BY 4.0 International license CC-BY 4.0 International this version posted August 3, 2018. this version posted August ; CTAGTTATTGCTCAGCGGTAGGTTGCCATGTTCTCAGGT AGGTGAGATGACAGGAGATCACTGGCGAGAACCTGAGAG TGCTTCAAACCAAGAGGAAC TGACCGGCAGCAAAATTGTCTCTGTTTCTGGGAGTTGG CTGAGTGAAGATGGCAAAGG AGGTGAGATGACAGGAGATCTATGTGTCCCGATTCAGTGC GCGTGATTTTCTCCTGGATG TTTACCCCACTTCAGCCTTG TGACCGGCAGCAAAATTGGAGGGGGTAGTAGTCGTGGA GCCTGGATGCTTGAAAAGAG CACTGCTTAGAGCGATGCAAATCAATGAGCGGAAGGAA TGAGGTCAGAGCTCCTCCT TCCCAGTCACGACGTGTGGACTTGATCCAGGCAGT GGAAGGAGACAGACAGACAGA available under a R: F: R: F: R: F: R: F: R: F: F: R: F: R: d Ti22M1 Ti13D2 Ti17L1 Ti17J1 Ti22G1 Ti26I9 Ti28S9 https://doi.org/10.1101/384651 9. 6. 7. 8. 5. 4. 10. Intermediate microsatellite doi: not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made bioRxiv a license to display the preprint in perpetuity. is the author/funder, who has granted not certified by peer review) bioRxiv preprint 12 390-393 206 ROX/ T7term 6-FAM/ Neomycin 55 55 65- 65- . The copyright holder for this preprint (which was The copyright holder for CC-BY 4.0 International license CC-BY 4.0 International this version posted August 3, 2018. this version posted August ; AGGTGAGATGACAGGAGATCGTGTTCCTCCACTGGCTCTC AACGCAGAGTTGCCTGAC CTAGTTATTGCTCAGCGGTTAACGTCTGTGGCGATCAAC TGCCAACAACTTCTCATTGG available under a F: R: F: R: Ti26I2 Ti28D1 https://doi.org/10.1101/384651 12. 11. Reverse primer of Ti22G1 was attached with the tail M13 (6-FAM) in early stage of project (used in multiplex testing) and had later changed to T7term Observed size of peak(s) in CE inclusive of tail extension. For terminal microsatellite (Ti13D, Ti26I9, Ti28S9), only based on individuals with clear peak peak clear with individuals on based only Ti28S9), Ti26I9, (Ti13D, microsatellite terminal For extension. tail of inclusive CE in peak(s) of size Observed Loci Ti4A9 and Ti4B9 each has an alternative reverse primer with two fewer repeats of motif [GT]. The loci with alternative primer pairs are differentiated differentiated are pairs primer alternative with loci The [GT]. motif of repeats fewer two with primer reverse alternative an has each Ti4B9 and Ti4A9 Loci Underlined sequence denotes the sequence of tails. denotes the Underlined sequence carrying intermediate microsatellites (no.6 to no.12) (no.6 to microsatellites intermediate carrying of tail (+5 bp from M13 to T7term). the change with observed sizes were consistent peak pattern and (ROX) for genotyping. The by the asterisk added to the name of loci. All loci used specific anchor primer/RAM primer as one of the primers for PCR amplification, except loci d monomorphic in 10 individuals genotyped. genotyped. in 10 individuals monomorphic c a b was microsatellite intermediate All of peak pattern. to spurious peaks and complexity due completed could not be individuals as genotyping on 10 pattern doi: 191 193 190 192 188 189 185 186 187 not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made bioRxiv a license to display the preprint in perpetuity. is the author/funder, who has granted not certified by peer review) bioRxiv preprint 13 μM) for non- μM: 10 2.5 μM: μL primer mix of the loci in same . The copyright holder for this preprint (which was (which preprint this for holder copyright The and 0.3 μL, μL single-plex PCR reaction mixtures containing μL, 0.2 T. indicus in single-plex PCR with 1.5-3 ng DNA template CC-BY 4.0 International license International 4.0 CC-BY this version posted August 3, 2018. 2018. 3, August posted version this ; available under a under available primer mix, and 2-20 ng of template DNA. PCR was run using PCR condition III condition PCR using run was PCR DNA. template of ng 2-20 and mix, primer μL listed in Table 3. listed in a https://doi.org/10.1101/384651 Red Mix, 0.4-1.0 Mix, Red doi: doi: Fragman R Studio 1.1.442 [31–33] in order were added. The PCR products were sent for fragment analysis on ABI3730XL. products were sent for fragment PCR order were added. The loci Isolation of microsatellite studies Previous primers. RAM with genome mammalian a from loci microsatellite isolate to attempted study This have succeeded with the use of this technique in plants, fungi, and insects amplification, [15,21,34,35]. which obviates the The steps of use genome fragmentation and of enrichment. Instead, the RAM simple workflow Results and Discussion We also included all seven intermediate microsatellites markers and only three terminal microsatellite loci (Ti13D, (Ti13D, loci microsatellite terminal three only and markers microsatellites intermediate seven all included also We Ti26I9, and Ti28S9) for genotyping 10 individuals of using the same PCR condition III and sent for fragment analysis. Genotypes were examined and scored using R package tailed tailed internal primer/ specific anchor primer/ RAM primer: tailed internal primer: and fluorescent-labelled tail respectively, were prepared. PCR amplification was run in 20 multiplexed were 3) (Table Ti4B9 and Ti4A9 PCR, multiplex in primers designed the of compatibility the test To and Ti22G1 Ti13D, loci including PCR multiplex Another III. condition PCR of profile touchdown using together Ti28S9 were run in the same conditions, except that 0.4 Concurrently, another PCR amplification was performed that excluded the fluorescent-labelled tails and contained contained and tails fluorescent-labelled the excluded that performed was amplification PCR another Concurrently, 10 of concentrations equal in primer internal tailed a and primer anchor specific primer/ internal non-tailed a only tail primers. of fluorescent-labelled effect inhibitory μM, to test the possible Primer mix containing three primers in the ratio of 4:1:4 (final concentration of 10 1× MyTaq 1× T 2) at specific (Table not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made made It is perpetuity. in preprint the display to a license bioRxiv granted has who the author/funder, is review) peer by certified not bioRxiv preprint preprint bioRxiv 14 219 220 221 208 217 218 216 215 211 213 214 212 210 209 197 206 207 196 205 204 200 201 202 203 195 194 198 199 MH292918 - MH292962). From . The copyright holder for this preprint (which was (which preprint this for holder copyright The CC-BY 4.0 International license International 4.0 CC-BY this version posted August 3, 2018. 2018. 3, August posted version this ; available under a under available https://doi.org/10.1101/384651 doi: doi: Testing of designed primers More repeat number found in the terminal microsatellite loci than in their respective RAM primers may be an study, our In 1996). al. et (Fisher template complementary its to 5’-anchor the of hybridisation correct for indicator 69.7% of 89 detected terminal microsatellites have repeat number equal to Comparing to three other studies that reported equal their repeat number using similar method, the proportions of respective loci RAM primers. with equal repeat number to RAMs were 35% (60 loci; [13]), 50% (26 loci; [12]), and 60% (10 loci; [35]). The number in parenthesis is the total number of terminal microsatellites that were isolated regardless of how many different 5’ anchored RAM used. We recorded the highest percentage of such loci largely because three of the the For repeats. five with microsatellites tetranucleotide or tri- yielded all RAM28) and RAM26, (RAM17, RAMs other three RAM markers, half of the terminal microsatellites yielded had the same repeat number in the RAM primers. The remaining 45 sequences were deposited in GenBank (accession numbers.: these sequences, a total of 119 non-interrupted, perfect microsatellites were detected by IMEx [26] under our selection criteria (see Methods), and more than half of them (n = 68) were from the termini of each sequence. In addition, 20 compound microsatellites and six interrupted perfect microsatellites were detected. The intermediate microsatellites obtained were typically low in repeat number: six to 11 repeats for mononucleotide motifs, and at most four repeats for dinucleotide motifs, six repeats for trinucleotide motifs, three repeats for tetranucleotide motifs. hexanucleotide for motifs, and two repeats repeats for pentanucleotide motifs, three The recovery of recombinant inserts from 135 screened colonies was 98.5% (1.5% were false positives). Sixty- microsatellites. two least at carried fragments sequenced the all and sequencing, for sent were clones positive five Among these sequences, 18 (27.7%) were regarded as redundant sequences based on 90% max similarity search. short to due discarded was sequence Another structure. chimaeric possible for discarded was sequence unique One design. bp) and hence for primer (187 length allowed rapid generation of microsatellite-containing genomic sequences with an affordable budget, less work, (<2 weeks per isolation). short time and in a not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made made It is perpetuity. in preprint the display to a license bioRxiv granted has who the author/funder, is review) peer by certified not bioRxiv preprint preprint bioRxiv 15 251 250 249 240 241 242 243 244 245 246 247 248 238 239 233 234 235 236 237 232 231 230 226 227 228 229 225 224 222 223 Co-loading at 60 FDF . The copyright holder for this preprint (which was (which preprint this for holder copyright The C, 40 cycles) and Ti4B9* (65-62⁰C, 40 ⁰ CC-BY 4.0 International license International 4.0 CC-BY Ti4A9* and Ti4B9* used shortened RAM4 (20 bases) as the reverse this version posted August 3, 2018. 2018. 3, August posted version this ; and (E). available under a under available Dye artefact. Template DNA was extracted from blood of a single tapir individual except Multiplex PCR products of 3 loci namely Ti22G1, Ti28S9, and Ti13D. Some undesired signal undesired Some Ti13D. and Ti28S9, Ti22G1, namely loci 3 of products PCR Multiplex Ar – https://doi.org/10.1101/384651 (E) and doi: doi: Inhibitory effect of fluorescent-labelled tail Inhibitory effect of fluorescent-labelled Fig 1. Genotype for the tested five loci from Peak Scanner 2.0. five loci from the tested Fig 1. Genotype for (A) Multiplex PCR products of Ti4A9 and Ti4B9 at final dilution factor (FDF) of 100. (B) Generally, Generally, loci amplified by specific anchor primers produced less stutter peaks than using RAM primers based on the observations on TI4A9-Ti4A9* and Ti4B9-Ti4B9* pairs (Fig 1). When the motif repeat in RAM4 primer was reduced by two repeats, it was expected that the stutter bands (due to primer slipping to 3’ end) could be reduced by increasing the proportion of specific anchor (10 in 24 bases to 10 in 20 bases) to improve the priming efficacy of the 5’-anchor. Both loci, Ti4A9* and Ti4B9*, have shown such improvement but in the expense of (Fig 1B, 1C). led to noise that amplification unspecific increased risk of yield and of two single-plex PCR products, the Ti4A9 (63 °C, 40 cycles) and the Ti4B9* (65-62⁰C, 40 cycles). (C) Co- loading at 60 FDF of two single-plex PCR products, the Ti4A9* (65-62 (D) cycles). in the result were: Of the 24 tested primer pairs, Ti4A9, Ti26I9 and all intermediate microsatellite loci each yielded a clear single band of expected size, while the other eight primer pairs yielded expected bands with some degree of unspecific Table). S1 in (descriptions bands unspecific multiple yielded or amplification in failed either rest The amplification. electrophoresis. in capillary in Table 3 were detected 14 primer pairs all product sizes of Expected for Ti4B9* in (C), and 3 loci in (D) primer, while Ti4A9 and Ti4B9 used original RAM4 primer (24 bases) as the reverse primer. Unless otherwise of 65-57 for 40 cycles. °C PCR for all shown result was touchdown profile specified, In this study, 24 primers pairs were designed (S1 Table). To test the terminal microsatellites, we selected 15 loci RAM28. and RAM26 RAM17, from each locus one RAM13, from loci eight RAM4, from loci four of: comprising primer 17 of total a to adding conditions, different under test to redesigned primers their had RAM4 from loci Two comprising loci seven selected we microsatellites, intermediate the test To microsatellites. terminal for tested pairs from RAM13, RAM26 and RAM28. of which one locus each from RAM17, two loci from RAM22, of: two loci not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made made It is perpetuity. in preprint the display to a license bioRxiv granted has who the author/funder, is review) peer by certified not bioRxiv preprint preprint bioRxiv 16 281 280 279 271 270 269 264 265 266 267 268 273 263 272 274 262 275 258 259 260 261 278 257 276 277 252 253 254 255 256 on Ti28S9, while Ti22G1

3 . The copyright holder for this preprint (which was (which preprint this for holder copyright The on Ti13D and (CAGA) 5 CC-BY 4.0 International license International 4.0 CC-BY this version posted August 3, 2018. 2018. 3, August posted version this ; available under a under available https://doi.org/10.1101/384651 doi: doi: Genotypes of ten individuals by all seven intermediate microsatellites markers were overall monomorphic, except except monomorphic, overall were markers microsatellites intermediate seven all by individuals ten of Genotypes for locus Ti26I2 (Table 3). However, due to a spurious peak at 3 bp distance away from the main peak we could of runs different from obtained be could patterns peak consistent though even genotypes the score confidently not microsatellite terminal three the for electropherogram example an shows 2 Fig samples. DNA same the using PCR loci used for genotyping. We were also not able to complete the genotyping of 10 individuals using the three terminal microsatellite loci due to dubious specificity (Ti28S9, with an extra, consistent complicated peak patterns peak accompanied with noise near (Ti13D and Ti26I9), 400bp), rendering them not suitable for further analysis. Multiplex PCR and genotyping attached sequence tail a primer, RAM common a shared that Ti4B9), and (Ti4A9 loci two involving PCR Multiplex during detected and amplified were loci Both feasible. was tail, fluorescent-labelled a and primers internal their to Ti28S9) and (Ti13D loci microsatellite terminal two involving PCR multiplex Another 1A). (Fig analysis fragment the to attributed be may compatibility The successful. also was (Ti22G1) locus microsatellite intermediate one and different repeat motifs carried on the primers i.e. (TG) comprised of a pair of specific internal primers. Multiplexing primers carrying same or complementary repeat of PCR. or inhibition low efficiency to dimer leading formation of primer result in increased motifs may primer but worked when the tail was removed from the PCR reaction, which was repeated in three PCR trials. This This trials. PCR three in repeated was which reaction, PCR the from removed was tail the when worked but primer The method. three-primer the in used primer tail fluorescent-labelled of effect inhibitory an suggested observation primer pair (originally F: 5’-CACTGCTTAGAGCGATGCAAATCAATGAGCGGAAGGAA-3’ and R: 5’- pairs primer 13 other the All 3. Table in listed one the to redesigned then was TGAGGTCAGAGCTCCTCCT-3’) in Table 3 were successful in amplifying their expected products by both the three-primer PCR and normal PCR reverse primers). and of forward equal concentration and using tail primers (excluding During optimisation, one of the loci, Ti26I9 failed to be amplified when M13modB was used as the labelling tail not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made made It is perpetuity. in preprint the display to a license bioRxiv granted has who the author/funder, is review) peer by certified not bioRxiv preprint preprint bioRxiv 17 309 301 302 303 304 305 306 307 308 300 294 295 296 297 299 292 293 298 291 290 285 286 287 288 289 284 283 282

a T (A) Ti28S9, . The copyright holder for this preprint (which was (which preprint this for holder copyright The CC-BY 4.0 International license International 4.0 CC-BY this version posted August 3, 2018. 2018. 3, August posted version this ; may allow mismatches at the 5’-anchor. This was evident by the nucleotide a T available under a under available https://doi.org/10.1101/384651 doi: doi: Even though it was suggested that reproducibility could still be achieved in the presence of mismatches primer-template [36], the amplification specificity may be further compromised by the presence of microsatellite repeats at the more critical 3’ end of primer. In electropherogram with minimal fact, noise peaks and the higher relative fluorescence intermediate units (RFU) compared microsatellites to terminal produced a cleaner microsatellites. Furthermore, there was only very limited number of nucleotide usable for primer design. As derived from RAM primer) has rendered them to be prone to random amplification of unspecific products. The 5’ The products. unspecific of amplification random to prone be to them rendered has primer) RAM from derived anchors of RAMs used in this study to develop microsatellite markers were 7-12 bases including 5-9 blocking were design primer for used anchors of sequences the However, [12]. end 3’ to primer of slipping prevent to bases not always in perfect match to their template, depending on the stringency of RAM amplification. Too high a The nature of primer design for terminal microsatellites (that must include a length of repeat motifs and a 5’ flank 5’ a and motifs repeat of length a include must (that microsatellites terminal for design primer of nature The Limitations Although specific anchor primers of terminal capillary microsatellite by samples the markers genotype studies these of had none [13–15], gels on shown genotyping for applicable successful and loci targeted amplification of electrophoresis. From the result, we have shown that even varied pattern peak though of quality the electrophoresis, capillary microsatellite fluorescent the in detected markers be could described protocols isolated using the across samples. On the contrary, amplification of intermediate microsatellite loci using specific internal primers such issue. did not encounter Fig 2. An example of electropherogram of three terminal microsatellites fragments amplified. (B) Ti13D and (C) Ti26I9. Final dilution factor (FDF) in the range of 5-12. All was amplified in single-plex PCR cycles) (65-57 °C, 40 profile by touchdown may produce low yield, while low loci same the from amplified supposedly were that sequences of pairs between 5’-anchors the in seen mismatches during RAM amplification. The mismatch ranged from 0-9 nucleotides with an average of 4 nucleotides (or an in nucleotides 1-2 only cases extreme In sequences). of pairs the of 5’-anchors between similarity 57% of average the anchors were shared. not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made made It is perpetuity. in preprint the display to a license bioRxiv granted has who the author/funder, is review) peer by certified not bioRxiv preprint preprint bioRxiv 18 335 336 337 338 339 334 326 327 328 325 324 322 323 321 316 317 318 319 320 314 315 313 310 312 331 332 333 311 329 330 T. indicus, although they were . The copyright holder for this preprint (which was (which preprint this for holder copyright The CC-BY 4.0 International license International 4.0 CC-BY this version posted August 3, 2018. 2018. 3, August posted version this ; ). 5 available under a under available to [GT] 7 https://doi.org/10.1101/384651 doi: doi: A computational and experimental definition based upon repeat mutational behavior at A/T and GT/AC behavior upon repeat mutational based definition and experimental A computational 620–635. doi:10.1093/gbe/evq046 Biol Evol. 2010;2: repeats. Genome microsatellite markers. Ecol Lett. 2006;9: 615–629. 2006;9: markers. Ecol Lett. microsatellite 152–172. Agriculturists. 2015;13: marker. The powerful genetic 3. KA, is a microsatellite: F, Eckert Makova KD. What N, Hile SE, Chiaromonte Kelkar YD, Strubczewski 1. guide to using and evaluating A practical for ecologists: Toonen RJ. Microsatellites Selkoe KA, 2. A microsatellites: M, Khatun R, Yaakob Z, Khan MS, Mintoo AA. Development of Moniruzzaman References We would like to thank Dr. Donny Yawah (PERHILITAN), Dr. Mat Naim Bin Haji Ramli (National Zoo of Malaysia) and Dr. Kavitha Jayaseelan (National Zoo of Malaysia) for their assistance in collecting blood samples at the Sungai Dusun Wildlife Reserve and the National Zoo of Malaysia respectively. We also thank Mdm Noor Wildlife National the from samples tapir of collection the in aiding for (PERHILITAN) Kulaimi Mohd binti Azleen PERHILITAN. Forensic Laboratory, monomorphic monomorphic in ten individuals, which may be due to low genetic diversity in this species. Genotyping a larger sample size in the future may reveal useful and polymorphic markers. In general, we do not recommend using above. discussed a few limitations isolation due to RAM markers for microsatellite Acknowledgements In this study, we managed to develop six amplifiable microsatellite markers for Other than null allele [13], mis-scoring of fragment size may arise from hybridisation between RAM primer and template carrying less repeats than the one present in RAM. For instance, the smallest peak of Ti4A9* (302bp) was four bases less than the one detected in Ti4A9 (306bp), which corresponded to four-base reduction in the RAM4 ([GT] modified primer observed in some of the flanks (found in <10% of genomic sequences), truncation of one or more nucleotides from from nucleotides more or one of truncation sequences), genomic of <10% in (found flanks the of some in observed even less flexible. design made primer of anchors, had the 5’-ends not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made made It is perpetuity. in preprint the display to a license bioRxiv granted has who the author/funder, is review) peer by certified not bioRxiv preprint preprint bioRxiv 19 367 368 369 365 363 364 366 362 360 361 356 357 358 359 355 354 350 351 353 349 352 348 344 345 346 347 343 342 340 341 . The copyright holder for this preprint (which was (which preprint this for holder copyright The CC-BY 4.0 International license International 4.0 CC-BY this version posted August 3, 2018. 2018. 3, August posted version this ; available under a under available https://doi.org/10.1101/384651 doi: doi: Panicum maximum. J Environ Biol. 2010;31: 965–968. 2010;31: 965–968. J Environ Biol. Panicum maximum. situ lowland tapir (Tapirus terrestris) conservation. J Hered. 2010;101: 581–590. situ lowland tapir 73–77. J Agric Sci. 2005;28: Pertanika Trop Mystus nemurus: A refined technique. 715–722. (RAMS). Mol Biol Rep. 2012;39: microsatellites amplified isolates using random IUCN Red List of Threatened Species 2016: e.T21472A45173636. 2016 [cited 18 Jul 2016]. Available: 2016 [cited 18 Jul 2016]. Available: e.T21472A45173636. Species 2016: IUCN Red List of Threatened http://www.iucnredlist.org/details/21472/0 Mol Ecol Notes. 2002;2: 96–98. 2002;2: 96–98. Mol Ecol Notes. e92–e96. RAMs-PCR 2012;91: using 5’ anchored method. J Genet. (Linnaeus) in Oryctes rhinoceros Johns Hopkins University Press; 2005. 3rd ed. Baltimore: 346–355. doi:10.1111/j.1749-4877.2012.00317.x Integr Zool. 2012;7: the genus Tapirus. (Moraceae). Appl Plant Sci. 2016;4: apps.1500099. doi:10.3732/apps.1500099 Appl Plant Sci. (Moraceae). 1994;20: 176–183. Genomics. amplification. chain reaction polymerase 4369–4371. doi:10.1093/nar/24.21.4369 Acids Res. 1996;24: Nucleic 160– Mol Ecol. 1999;8: PCR the common ash Fraxinus excelsior. loci using 5’ anchored in microsatellite 163. (Cupressaceae). Appl Plant Sci. 2016;4: doi:10.3732/apps.1500136 Sci. 2016;4: apps.1500136. Appl Plant Chamaecyparis obtusa (Cupressaceae). genetic studies. Ecol Evol. 2014;4: 4399–4428. 2014;4: studies. Ecol Evol. genetic Biol. 2014;6: 1–13. overview. Not Sci doi:10.1590/1678-4685-GMB-2016-0027 Mol Biol. 2016;39: 312–328. are so useful. Genet kinship in beavers (Castor canadensis). J Mammal. 2008;89: 575–581. 2008;89: 575–581. J Mammal. (Castor canadensis). beavers kinship in genotyping. Mol Ecol Resour. 2011;11: 591–611. doi:10.1111/j.1755-0998.2011.03014.x Resour. 2011;11: Mol Ecol genotyping. 22. in markers of microsatellite rapid generation KK, A. primers in Chandra Use of degenerate Tiwari 19. refine ex A, Lalonde DR, Quse V, Shoemaker A, Russello MA. Genetic approaches Silva Gonçalves da 20. in of microsatellites method detection SS, Tan SG, Yusoff K. Rapid and non-radioactive Chan SC, Siraj 21. Trichoderma SG, of Malaysian S, Tan Yusuf UK, Fatihah NHN, Hasan MM. Siddiquee Characterization 18. Tapirus. The S, ZZ, et al. indicus C, Novarino W, bin Saaban Shwe NM, Lynam AJ, Zainuddin Traeholt 14. in mungbean, Vigna radiata. markers of microsatellite Kumar SV, Tan SG, Quah SC, Yusoff K. Isolation 15. markers of single locus DNA microsatellite Tan SG. Development R, Faridah QZ, Manjeri G, Muhamad 16. reference. and geographic of the World. A taxonomic DM, editors. Mammal species Reeder Wilson DE, 17. of and adaptability RS. Distribution, habitat EP, Naranjo EJ, Novarino W, Leonardo Medici García MJ, 10. for Ficus tikoua loci microsatellite of 14 polymorphic L, Hu D-M, Y. Zhang L-S, Tan Chen Development 11. (SSR)-anchored Repeat Sequence by Simple A, Labuda D. Genome fingerprinting Rafalski E, Zietkiewicz 12. PCR. using 5′ anchored isolated locus microsatellites Fisher PJ, Gardner RC, Richardson TE. Single 13. of N. Rapid identification B, Frascaria-Lacoste S, MF, M, Jung-Muller Brachet Jubier Richard 9. primers for of microsatellite Kim YM, Shin YS, Jeong JH. and characterization Development 6. for population data of microsatellite and interpretation in analysis Putman AI, Carbone I. Challenges 7. An markers: of microsatellite Methods for development D, Sasikumar B, Sheeja TE. Senan S, Kizhakayil 8. why they they mean and What markers: L, Diniz A., Munhoz C de F. Microsatellite Vieira MLC, Santini 5. and of mating analysis CK. Microsatellite CK, Bloomquist Nielsen Crawford JC, Liu ZW, Nelson TA, 4. microsatellite trends in O, et al. Current P, Lepais P, Léger S, Chaumeil L, Wagner E, Lagache Guichoux not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made made It is perpetuity. in preprint the display to a license bioRxiv granted has who the author/funder, is review) peer by certified not bioRxiv preprint preprint bioRxiv 20 408 409 406 403 404 405 407 402 399 400 401 397 392 393 394 395 396 398 391 386 388 383 384 385 387 389 390 382 380 381 378 375 376 377 379 374 372 373 370 371 . The copyright holder for this preprint (which was (which preprint this for holder copyright The CC-BY 4.0 International license International 4.0 CC-BY this version posted August 3, 2018. 2018. 3, August posted version this ; available under a under available https://doi.org/10.1101/384651 doi: doi: Microbiol Immunol. 2013;17: 129–132. Microbiol Immunol. Statistical Computing; 2018. Available: http://www.R-project.org/ 2018. Available: Computing; Statistical 1996;26: 159–166. Eur J For within fungi. Pathol. variation genetic for characterizing 2007;29: 823–827. doi:10.1007/s10529-006-9293-2 Lett. http://www.rstudio.com/ for primer development and application that integrates fluorescent labelling and multiplex PCR. Appl and multiplex labelling fluorescent that integrates and application for primer development doi:10.3732/apps.1300027 1300027. Plant Sci. 2013;1: Hereditas. 2014;151: 43–54. validation. microsatellite and economical primer PCR for rapid doi:10.1111/hrd2.00044 2015;17: 1–8. analysis. BMC Genet. fragment microsatellites and microsatellite-linked repetitive elements (eMLREs) by efficient cloning and (eMLREs) by efficient elements repetitive microsatellite-linked and microsatellites 33–45. DNAgenotyping methods. Res. 2001;8: 337–357. doi:10.1016/0196-8858(91)90017-D 1187. doi:10.1093/bioinformatics/btm097 doi:10.1093/nar/gkm306 Res. 2007;35: W71–W74. Acids to Primer3. Nucleic interface it.ch/software/LALIGN_form.html http://web.expasy.org/decrease_redundancy/ Supporting Information The loci. 7 intermediate microsatellite pairs of 15 terminal and S1 Table. List of all designed primer size and description (RAM) markers. Expected microsatellite using six random amplified primers were isolated electrophoresis. is provided. CE – capillary on gel (SAP) pattern anchor primer and band on the specific 36. J Exp of PCR replicates. to irreproducibility does not contribute mismatch J. Primer-template Goodwin 33. Austria: R Foundation for Vienna, computing. environment for statistical R: A language and R Core Team. 34. (RAMs) novel method – a microsatellites RC. Random amplified M, Hamelin Hantula J, Dusabenyagasani 35. Biotechnol from tartary buckwheat. markers of microsatellite Z-W. Development T-L, Zhang Li Y-Q, Shi 32. Available: for R. Boston, MA: RStudio, Inc.; 2015. Development RStudio: Integrated RStudio Team. 29. technique JR, NA, Klooster MR, et al. An efficient Brzyski Hardiman Stamper TI, Stokes RL, Culley TM, 30. with three- P,et al. Multiplexing RD, Gauthier DT, McGinnity PC, Cross Vartia S, Collins TF, Fitzgerald 31. An R package for J. Fragman: W, Zalapa B, Salazar Schlautman G, Diaz-Garcia L, Covarrubias-Pazaran 28. equine of M. Characterization N, Choi-Miura N-H, Tomita T, Mashima S, Hirota K, Miura Tozaki 25. Math. 1991;12: Adv Appl algorithm. local similarity linear-space A Huang X, Miller W. time-efficient, 26. 2007;23: 1181– Bioinformatics. extractor. microsatellite HA. IMEx: Imperfect Mudunuri SB, Nagarajaram 27. web Leunissen JAM. Primer3Plus, an enhanced T, Geurts R, X, Bisseling Untergasser A, Nijveen H, Rao 24. http://embnet.vital- 2016]. Available: n.d. [cited 3 May Pearson B. LALIGN. 23. 2016]. Available: n.d. [cited 1 May C. Decrease Redundancy. Notredame not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made made It is perpetuity. in preprint the display to a license bioRxiv granted has who the author/funder, is review) peer by certified not bioRxiv preprint preprint bioRxiv 21 448 447 443 444 442 445 446 441 439 440 437 434 435 436 438 433 431 432 429 424 425 426 427 428 430 423 420 421 422 418 415 416 417 419 414 412 413 410 411 bioRxiv preprint doi: https://doi.org/10.1101/384651; this version posted August 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. bioRxiv preprint doi: https://doi.org/10.1101/384651; this version posted August 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.