Cyclin C: the Story of a Non-Cycling Cyclin
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Cyclin-Dependent Kinases and P53 Pathways Are Activated Independently and Mediate Bax Activation in Neurons After DNA Damage
The Journal of Neuroscience, July 15, 2001, 21(14):5017–5026 Cyclin-Dependent Kinases and P53 Pathways Are Activated Independently and Mediate Bax Activation in Neurons after DNA Damage Erick J. Morris,1 Elizabeth Keramaris,2 Hardy J. Rideout,3 Ruth S. Slack,2 Nicholas J. Dyson,1 Leonidas Stefanis,3 and David S. Park2 1Massachusetts General Hospital Cancer Center, Laboratory of Molecular Oncology, Charlestown, Massachusetts 02129, 2Neuroscience Research Institute, University of Ottawa, Ottawa, Ontario K1H 8M5, Canada, and 3Columbia University, New York, New York 10032 DNA damage has been implicated as one important initiator of ization, and DNA binding that result from DNA damage are not cell death in neuropathological conditions such as stroke. Ac- affected by the inhibition of CDK activity. Conversely, no de- cordingly, it is important to understand the signaling processes crease in retinoblastoma protein (pRb) phosphorylation was that control neuronal death induced by this stimulus. Previous observed in p53-deficient neurons that were treated with camp- evidence has shown that the death of embryonic cortical neu- tothecin. However, either p53 deficiency or the inhibition of rons treated with the DNA-damaging agent camptothecin is CDK activity alone inhibited Bax translocation, cytochrome c dependent on the tumor suppressor p53 and cyclin-dependent release, and caspase-3-like activation. Taken together, our re- kinase (CDK) activity and that the inhibition of either pathway sults indicate that p53 and CDK are activated independently alone leads to enhanced and prolonged survival. We presently and then act in concert to control Bax-mediated apoptosis. show that p53 and CDKs are activated independently on par- allel pathways. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Cyclin K Interacts with Β-Catenin to Induce Cyclin D1 Expression And
Theranostics 2020, Vol. 10, Issue 24 11144 Ivyspring International Publisher Theranostics 2020; 10(24): 11144-11158. doi: 10.7150/thno.42578 Research Paper Cyclin K interacts with β-catenin to induce Cyclin D1 expression and facilitates tumorigenesis and radioresistance in lung cancer Guojun Yao*, Jing Tang*, Xijie Yang, Ye Zhao, Rui Zhou, Rui Meng, Sheng Zhang, Xiaorong Dong, Tao Zhang, Kunyu Yang, Gang Wu and Shuangbing Xu Cancer Center, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China. *These authors contributed equally to this work. Corresponding author: Shuangbing Xu or Gang Wu, Cancer Center, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China. E-mail: [email protected] or [email protected]. © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2019.11.29; Accepted: 2020.08.24; Published: 2020.09.11 Abstract Rationale: Radioresistance remains the major cause of local relapse and distant metastasis in lung cancer. However, the underlying molecular mechanisms remain poorly defined. This study aimed to investigate the role and regulatory mechanism of Cyclin K in lung cancer radioresistance. Methods: Expression levels of Cyclin K were measured by immunohistochemistry in human lung cancer tissues and adjacent normal lung tissues. Cell growth and proliferation, neutral comet and foci formation assays, G2/M checkpoint and a xenograft mouse model were used for functional analyses. Gene expression was examined by RNA sequencing and quantitative real-time PCR. -
Are Expressed by a Majority of Primary Human Acute Myeloid Leukemia Cells and Inducibility of the TLR Signaling Pathway Is Associated with a More Favorable Phenotype
Cancers 2019, 11 S1 of S19 Supplementary Material Functional Toll-Like Receptors (TLRs) are Expressed by a Majority of Primary Human Acute Myeloid Leukemia Cells and Inducibility of the TLR Signaling Pathway is Associated with a More Favorable Phenotype Annette K. Brenner and Øystein Bruserud Table S1. Median concentration increase in the secretion of 19 (16 patients with G-CSF, 67 patients with GM-CSF) soluble mediators as a result of targeting with four different TLR agonists. More than 5-fold increase is highlighted. LPS (TLR4) Flagellin (TLR5) R848 (TLR7/8) Pam3CSK4 (TLR1/2) IL-6 301.0 45.9 10.2 5.3 TNFα 188.7 10.6 5.0 1.5 IL-1β 89.7 9.2 1.1 1.5 CCL3 56.4 6.0 2.4 1.5 CCL2 52.6 9.4 4.3 2.8 G-CSF 51.9 2.7 1.0 1.0 CXCL1 38.0 5.8 1.4 1.5 CCL4 17.2 3.3 2.0 1.3 CCL5 14.5 2.1 1.3 1.1 MMP-1 11.1 3.4 1.4 1.1 CXCL5 8.3 4.3 1.3 1.4 CXCL8 6.0 4.3 1.7 1.3 GM-CSF 5.2 1.5 1.4 1.0 MMP-2 4.0 1.5 1.2 1.1 CXCL10 3.9 1.6 2.2 1.1 HGF 2.0 1.1 1.0 1.0 MMP-9 1.9 2.5 1.3 1.7 IL-1RA 1.8 1.3 1.3 1.0 Serpin E1 1.3 1.3 1.1 1.1 Cystatin C 1.1 1.1 1.0 1.0 Cancers 2019, 11 S2 of S19 Table S2. -
Cytotoxic Effects and Changes in Gene Expression Profile
Toxicology in Vitro 34 (2016) 309–320 Contents lists available at ScienceDirect Toxicology in Vitro journal homepage: www.elsevier.com/locate/toxinvit Fusarium mycotoxin enniatin B: Cytotoxic effects and changes in gene expression profile Martina Jonsson a,⁎,MarikaJestoib, Minna Anthoni a, Annikki Welling a, Iida Loivamaa a, Ville Hallikainen c, Matti Kankainen d, Erik Lysøe e, Pertti Koivisto a, Kimmo Peltonen a,f a Chemistry and Toxicology Research Unit, Finnish Food Safety Authority (Evira), Mustialankatu 3, FI-00790 Helsinki, Finland b Product Safety Unit, Finnish Food Safety Authority (Evira), Mustialankatu 3, FI-00790 Helsinki, c The Finnish Forest Research Institute, Rovaniemi Unit, P.O. Box 16, FI-96301 Rovaniemi, Finland d Institute for Molecular Medicine Finland (FIMM), University of Helsinki, P.O. Box 20, FI-00014, Finland e Plant Health and Biotechnology, Norwegian Institute of Bioeconomy, Høyskoleveien 7, NO -1430 Ås, Norway f Finnish Safety and Chemicals Agency (Tukes), Opastinsilta 12 B, FI-00521 Helsinki, Finland article info abstract Article history: The mycotoxin enniatin B, a cyclic hexadepsipeptide produced by the plant pathogen Fusarium,isprevalentin Received 3 December 2015 grains and grain-based products in different geographical areas. Although enniatins have not been associated Received in revised form 5 April 2016 with toxic outbreaks, they have caused toxicity in vitro in several cell lines. In this study, the cytotoxic effects Accepted 28 April 2016 of enniatin B were assessed in relation to cellular energy metabolism, cell proliferation, and the induction of ap- Available online 6 May 2016 optosis in Balb 3T3 and HepG2 cells. The mechanism of toxicity was examined by means of whole genome ex- fi Keywords: pression pro ling of exposed rat primary hepatocytes. -
Anti-Cdk8 Antibody Produced in Rabbit (C0238)
ANTI-CDK8 Developed in Rabbit, Affinity Isolated Antibody Product Number C 0238 Product Description Reagent Anti-Cyclin-Dependent Kinase 8 (CDK8) is developed in Anti-CDK8, at approximately 1 mg/ml, is supplied as a rabbit using a synthetic peptide corresponding to the solution in phosphate buffered saline, pH 7.4 containing C-terminal region (aa 451-464) of human CDK8. The 0.2% BSA and 15 mM sodium azide. antibody is purified by protein A affinity chromatography. Anti-CDK8 specifically recognizes a 54 kDa protein Precautions and Disclaimer identified as cyclin-dependent kinase 8 (CDK8). Anti- Due to the sodium azide content, a material safety data CDK8 does not crossreact with the other members of sheet (MSDS) for this product has been sent to the CDK family. It detects human, mouse and rat CDK8. It attention of the safety officer of your institution. Consult is used in immunoblotting, immunoprecipitation and the MSDS for information regarding hazardous and safe immunofluorescence applications. handling practices. Cyclin-dependent kinase 8 (CDK8) is a 464-amino acid Storage/Stability protein containing the sequence motifs and 11 Store at –20 °C. For extended storage, upon initial subdomains characteristic of a serine/threonine-specific thawing, freeze the solution in working aliquots. kinase.1 CDKs become activated through binding to Avoid repeated freezing and thawing to prevent cyclins, formation of cyclin-CDK complexes and denaturing the antibody. Storage in “frost-free” reversible phosphorylation reactions. Cyclin-CDK freezers is also not recommended. If slight complexes directly control progression through G1, S, turbidity occurs upon prolonged storage, clarify the G2 and M phases of the cell division cycle. -
The Involvement of Ubiquitination Machinery in Cell Cycle Regulation and Cancer Progression
International Journal of Molecular Sciences Review The Involvement of Ubiquitination Machinery in Cell Cycle Regulation and Cancer Progression Tingting Zou and Zhenghong Lin * School of Life Sciences, Chongqing University, Chongqing 401331, China; [email protected] * Correspondence: [email protected] Abstract: The cell cycle is a collection of events by which cellular components such as genetic materials and cytoplasmic components are accurately divided into two daughter cells. The cell cycle transition is primarily driven by the activation of cyclin-dependent kinases (CDKs), which activities are regulated by the ubiquitin-mediated proteolysis of key regulators such as cyclins, CDK inhibitors (CKIs), other kinases and phosphatases. Thus, the ubiquitin-proteasome system (UPS) plays a pivotal role in the regulation of the cell cycle progression via recognition, interaction, and ubiquitination or deubiquitination of key proteins. The illegitimate degradation of tumor suppressor or abnormally high accumulation of oncoproteins often results in deregulation of cell proliferation, genomic instability, and cancer occurrence. In this review, we demonstrate the diversity and complexity of the regulation of UPS machinery of the cell cycle. A profound understanding of the ubiquitination machinery will provide new insights into the regulation of the cell cycle transition, cancer treatment, and the development of anti-cancer drugs. Keywords: cell cycle regulation; CDKs; cyclins; CKIs; UPS; E3 ubiquitin ligases; Deubiquitinases (DUBs) Citation: Zou, T.; Lin, Z. The Involvement of Ubiquitination Machinery in Cell Cycle Regulation and Cancer Progression. 1. Introduction Int. J. Mol. Sci. 2021, 22, 5754. https://doi.org/10.3390/ijms22115754 The cell cycle is a ubiquitous, complex, and highly regulated process that is involved in the sequential events during which a cell duplicates its genetic materials, grows, and di- Academic Editors: Kwang-Hyun Bae vides into two daughter cells. -
Multi-Targeted Mechanisms Underlying the Endothelial Protective Effects of the Diabetic-Safe Sweetener Erythritol
Multi-Targeted Mechanisms Underlying the Endothelial Protective Effects of the Diabetic-Safe Sweetener Erythritol Danie¨lle M. P. H. J. Boesten1*., Alvin Berger2.¤, Peter de Cock3, Hua Dong4, Bruce D. Hammock4, Gertjan J. M. den Hartog1, Aalt Bast1 1 Department of Toxicology, Maastricht University, Maastricht, The Netherlands, 2 Global Food Research, Cargill, Wayzata, Minnesota, United States of America, 3 Cargill RandD Center Europe, Vilvoorde, Belgium, 4 Department of Entomology and UCD Comprehensive Cancer Center, University of California Davis, Davis, California, United States of America Abstract Diabetes is characterized by hyperglycemia and development of vascular pathology. Endothelial cell dysfunction is a starting point for pathogenesis of vascular complications in diabetes. We previously showed the polyol erythritol to be a hydroxyl radical scavenger preventing endothelial cell dysfunction onset in diabetic rats. To unravel mechanisms, other than scavenging of radicals, by which erythritol mediates this protective effect, we evaluated effects of erythritol in endothelial cells exposed to normal (7 mM) and high glucose (30 mM) or diabetic stressors (e.g. SIN-1) using targeted and transcriptomic approaches. This study demonstrates that erythritol (i.e. under non-diabetic conditions) has minimal effects on endothelial cells. However, under hyperglycemic conditions erythritol protected endothelial cells against cell death induced by diabetic stressors (i.e. high glucose and peroxynitrite). Also a number of harmful effects caused by high glucose, e.g. increased nitric oxide release, are reversed. Additionally, total transcriptome analysis indicated that biological processes which are differentially regulated due to high glucose are corrected by erythritol. We conclude that erythritol protects endothelial cells during high glucose conditions via effects on multiple targets. -
Ccnf (NM 007634) Mouse Tagged ORF Clone – MR210593 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR210593 Ccnf (NM_007634) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Ccnf (NM_007634) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Ccnf Synonyms: CycF; Fbxo1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Ccnf (NM_007634) Mouse Tagged ORF Clone – MR210593 ORF Nucleotide >MR210593 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAGCGGCGGTGTGATCCATTGTAGGTGTGCCAAGTGTTTCTGTTATCCTACTAAACGAAGAATCA AAAGAAGACCCAGAAACTTAACCATCTTGAGTCTCCCAGAAGATGTACTCTTTCATATCCTGAAATGGCT TTCTGTTGGGGACATCCTTGCTGTCCGAGCTGTCCACTCCCACCTCAAGTACCTGGTGGACAACCATGCC AGTGTGTGGGCATCCGCCAGCTTCCAGGAGCTGTGGCCTTCTCCACAGAACCTGAAGCTCTTTGAAAGGG CTGCTGAAAAGGGAAATTTTGAAGCTGCTGTGAAGTTGGGGATTGCCTACCTCTACAATGAAGGCCTGTC TGTGTCAGATGAGGCCTGCGCAGAAGTGAACGGCTTGAAGGCCTCTCGCTTCTTCAGCATGGCTGAGAGA CTGAATACGGGTTCTGAGCCCTTCATTTGGCTCTTCATCCGCCCACCGTGGTCAGTGTCCGGAAGCTGCT GCAAGGCTGTGGTTCATGACAGCCTCCGAGCGGAGTGTCAGTTACAGAGAAGTCATAAAGCTTCCATACT ACACTGCTTGGGAAGGGTGCTAAATCTTTTTGAGGACGAAGAGAAAAGGAAGCAGGCGCGTAGCCTTTTG -
Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells
Cancer Therapeutics, Targets, and Chemical Biology Research Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells Mary Zhang1, Aarti Mathur1, Yuwei Zhang1, Sichuan Xi1, Scott Atay1, Julie A. Hong1, Nicole Datrice1, Trevor Upham1, Clinton D. Kemp1, R. Taylor Ripley1, Gordon Wiegand2, Itzak Avital2, Patricia Fetsch3, Haresh Mani6, Daniel Zlott4, Robert Robey5, Susan E. Bates5, Xinmin Li7, Mahadev Rao1, and David S. Schrump1 Abstract Cigarette smoking at diagnosis or during therapy correlates with poor outcome in patients with lung and esophageal cancers, yet the underlying mechanisms remain unknown. In this study, we observed that exposure of esophageal cancer cells to cigarette smoke condensate (CSC) led to upregulation of the xenobiotic pump ABCG2, which is expressed in cancer stem cells and confers treatment resistance in lung and esophageal carcinomas. Furthermore, CSC increased the side population of lung cancer cells containing cancer stem cells. Upregulation of ABCG2 coincided with increased occupancy of aryl hydrocarbon receptor, Sp1, and Nrf2 within the ABCG2 promoter, and deletion of xenobiotic response elements and/or Sp1 sites markedly attenuated ABCG2 induction. Under conditions potentially achievable in clinical settings, mithramycin diminished basal as well as CSC- mediated increases in AhR, Sp1, and Nrf2 levels within the ABCG2 promoter, markedly downregulated ABCG2, and inhibited proliferation and tumorigenicity of lung and esophageal cancer cells. Microarray analyses revealed that mithramycin targeted multiple stem cell–related pathways in vitro and in vivo. Collectively, our findings provide a potential mechanistic link between smoking status and outcome of patients with lung and esophageal cancers, and support clinical use of mithramycin for repressing ABCG2 and inhibiting stem cell signaling in thoracic malignancies. -
A Haploid Genetic Screen Identifies the G1/S Regulatory Machinery As a Determinant of Wee1 Inhibitor Sensitivity
A haploid genetic screen identifies the G1/S regulatory machinery as a determinant of Wee1 inhibitor sensitivity Anne Margriet Heijinka, Vincent A. Blomenb, Xavier Bisteauc, Fabian Degenera, Felipe Yu Matsushitaa, Philipp Kaldisc,d, Floris Foijere, and Marcel A. T. M. van Vugta,1 aDepartment of Medical Oncology, University Medical Center Groningen, University of Groningen, 9723 GZ Groningen, The Netherlands; bDivision of Biochemistry, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands; cInstitute of Molecular and Cell Biology, Agency for Science, Technology and Research, Proteos#3-09, Singapore 138673, Republic of Singapore; dDepartment of Biochemistry, National University of Singapore, Singapore 117597, Republic of Singapore; and eEuropean Research Institute for the Biology of Ageing, University of Groningen, University Medical Center Groningen, 9713 AV Groningen, The Netherlands Edited by Stephen J. Elledge, Harvard Medical School, Boston, MA, and approved October 21, 2015 (received for review March 17, 2015) The Wee1 cell cycle checkpoint kinase prevents premature mitotic Wee1 kinase at tyrosine (Tyr)-15 to prevent unscheduled Cdk1 entry by inhibiting cyclin-dependent kinases. Chemical inhibitors activity (5, 6). Conversely, timely activation of Cdk1 depends on of Wee1 are currently being tested clinically as targeted anticancer Tyr-15 dephosphorylation by one of the Cdc25 phosphatases drugs. Wee1 inhibition is thought to be preferentially cytotoxic in (7–10). When DNA is damaged, the downstream DNA damage p53-defective cancer cells. However, TP53 mutant cancers do not response (DDR) kinases Chk1 and Chk2 inhibit Cdc25 phos- respond consistently to Wee1 inhibitor treatment, indicating the phatases through direct phosphorylation, which blocks Cdk1 existence of genetic determinants of Wee1 inhibitor sensitivity other activation (11–13). -
Supplemental Information
Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.