(Phoenix Dactylifera L.) Thesis Is Submitted to the Ro

ENVIRONMENTAL REGULATION OF FERTILIZATION AND FRUIT SETTING IN DATE PALM (Phoenix dactylifera L.)

Thesis is submitted to The Robert H. Smith Faculty of Agriculture Food and Environment for the M.Sc. in Plant Sciences

by Filip Slavković

January 2015

This thesis was written under the supervision of Dr. Yuval Cohen and Prof. Rina Kamenetsky of the Agriculture Research Organization, The Volcani Center.

Filip Slavković Dr. Yuval Cohen

Prof. Rina Kamenetsky

ACKNOWLEDGEMENTS

I would like to express my gratitude to Dr. Yuval Cohen and Prof. Rina Kamenetsky for their kind and generous support throughout the research, great help in search for future projects, as well as for making my stay in Israel feel at home.

I would like to thank David Birger for sharing his experiences and advice for development of fertilization protocols.

Special thanks to Mazal Ish-Shalom and Miriam Benita for their generous help regarding the molecular biology protocols and guidance.

I would like to thank Hanita Zemach for her practical guidance on histological protocols, staining and microscopy.

I wish to thank Dr. Sonia Philosoph-Hadas and Dr. Shimon Meir for helpful suggestions regarding the setup and post-harvest application of anti-ethylene compounds.

I would like to thank everyone taking part in this project in Southern Arava Research Center and mainly Avi Sadowsky and Amnon Greenberg for their help in the in vivo experiment.

I would like to express my personal gratitude to the Hebrew University of Jerusalem and the Pears Foundation for supporting my studies.

Finally, I would like to thank my mother Sofija Slavković and my family for continuous support and encouragement.

Dedication

This thesis is dedicated to the loving memory of my father Siniša Slavković (1955-2006) who raised me to be the person I am today.

Table of Contents 1. INTRODUCTION ...... 1

1.1. Botanical background ...... 1

1.2. Reproductive biology of date palm ...... 2

1.3. Horticultural challenges ...... 3

1.4. Fertilization process ...... 4

1.5. The role of hormones in post-pollination processes ...... 6

1.6. Parthenocarpy ...... 7

1.7. Genomic and transcriptomic research in date palm ...... 9

2. RESEARCH OBJECTIVES ...... 10

3. MATERIALS AND METHODS ...... 11

3.1. Plant material ...... 11

3.2. Development of an in vitro assay for spikelet culturing ...... 11

3.2.1. Selection and optimization of growth media and cultivation conditions under different temperature regimes ...... 12

3.2.2. Prevention of fungal contamination ...... 12

3.2.3. Use of ethylene inhibitors to prolong vase-life ...... 12

3.3. Effect of temperature regimes on fertilization and fruit setting in modular phytotrons - in vivo ...... 13

3.4. Histology and microscopy ...... 14

3.5. Pollen tube germination and elongation in vitro and on the stigma 14

3.6. Molecular analysis ...... 15

3.6.1. RNA extraction ...... 16

3.6.2. Gene validation and primer design ...... 16

3.6.3. Gene expression analysis ...... 17

3.7. Statistical analysis ...... 17

4. RESULTS ...... 18

4.1. Morpho-anatomical characterization of fertilization and fruit set in field-grown date cultivars 'Medjoul' and 'Barhee' ...... 18

4.1.1. 'Barhee' ...... 19

4.1.2. 'Medjoul' ...... 21

4.1.3. Comparison between 'Barhee' and 'Medjoul' ...... 23

4.2. Effects of temperature regimes on pollination, fertilization and fruit- set in date palm ...... 24

4.2.1. Development of an in vitro assay for studying date palm fertilization ...... 24

4.2.2. Effect of temperature regimes on pollination and fertilization ...... 31

4.2.3. Effects of temperature regimes on fertilization and fruit set in "modular phytotrons" - in vivo ...... 33

4.3. Expression analysis of genes involved in hormonal regulation during early fruit development of cultivars 'Medjoul' and 'Barhee' ... 41

5. DISCUSSION ...... 46

5.1. Morpho-anatomical traits of reproductive system and fruit set in 'Medjoul' and 'Barhee' ...... 46

5.2. Temperature affects pollen germination, fertilization and fruit-set processes ...... 48

5.3. Molecular analysis of genes involved in hormonal regulation during early fruit development of cultivars 'Medjoul' and 'Barhee' ...... 54

References ...... 58

Appendix ...... 67

List of Figures

Figure 1: Schematic representation of fertilization in angiosperms ...... 5

Figure 2: Experimental layout of pollination under controlled temperature conditions in special chambers in the field ...... 13

Figure 3: Daily average and extreme temperatures at pollination in Yotvata during spring periods of 2005-2012 ...... 14

Figure 4:Morphological characterization of early fruitlet development in pollinated and non-pollinated 'Barhee' and 'Medjoul' during the first four weeks after pollination ...... 18

Figure 5: Pollinated seed-bearing 'Barhee' fruitlets versus non-pollinated single and triple parthenocarpic fruitlets ...... 19

Figure 6: Histological characterization of early fruitlet development in cv. 'Barhee' during the first 5 WAP ...... 20

Figure 7: Deterioration of two ovules in pollinated 'Barhee' as opposed to uniform ovule growth in non-pollinated flower ...... 20

Figure 8: Histological characterization of early fruit development in 'Medjoul' during the first 40 DAP in 2012 ...... 21

Figure 9: Effects of Ethylene inhibitors on spikelets "vase life" 10 days after culturing ...... 26

Figure 10: Effect of 1-MCP and STS on viability, flower abscission and spikelet browning of pollinated and non-pollinated spikelets in vitro ...... 28

Figure 11: Pollinated and non-pollinated inflorescences exposed to four temperature regimes 10 days after setup ...... 29

Figure 12: Effect of four temperature regimes on pollinated and non- pollinated inflorescences in vitro ...... 30

Figure 13: Pollen tube length 9 hours after incubation at 4 constant temperature regimes ...... 31

Figure 14: Pollen tube length (µm) in vitro in the dark under four constant temperature treatments measured after 3, 6 and 9 hours respectively ...... 32

Figure 15: Pollen germination on the stigma in vitro under 4 constant temperatures ...... 33

Figure 16: Temperature comparison in high temperature units, medium temperature units and low temperature units ...... 35

Figure 17: Effects of three temperature regimes (warm – 32/18°C, medium – 25/12°C and cool – 20/8°C) on pollen germination on the stigma in bunches pollinated on the trees in modular phytotrons in vivo ...... 36

Figure 18: Effects of three temperature treatments (warm – 32/18°C, medium – 25/12°C and cool – 20/8°C) on pollen germination on the stigma in vivo ...... 36

Figure 19: Fruitlets 5 weeks following pollination in temperature controlled units (2013) ...... 37

Figure 20: Effect of three temperature treatments in vivo on fruitlet size 9 WAP (2014)...... 38

Figure 21: Percentage of normal, parthenocarpic, aborted and non- developed fruits respectively, in response to pollination and growth under different temperatures in vivo (2013) ...... 38

Figure 22: Percentage of normal, parthenocarpic, aborted and non- developed fruits, in response to pollination and growth under different temperatures in vivo, 10 WAP in 2014 ...... 39

Figure 23: Effects of three temperature regimes (warm – 32/18°C, medium – 25/12°C and cool – 20/8°C) on early development of pollinated flowers / fruitlets in modular phytotrons in vivo (2013) ...... 40

Figure 24: Heat map of EvaGreen Ct values of pollinated and non- pollinated flowers of 'Barhee' and 'Medjoul' during the first four weeks of fruit development ...... 42

Figure 25: Hierarchical cluster analysis of genes expressed in pollinated and non-pollinated flowers of cv. 'Barhee' and 'Medjoul' during four developmental stages after pollination ...... 43

Figure 26: Differential expressions of selected genes in 'Medjoul' and 'Barhee' during four weeks of early fruit development ...... 45

List of Tables

Table 1: Percentage of parthenocarpic singlets, parthenocarpic triplets, normal and shed fruitlets respectively in 'Barhee' at 9 WAP (2014) ...... 19

Table 2: Sizes of carpels and ovules (mm2) in pollinated vs. non- pollinated flowers of 'Barhee' during first 35 DAP (2012) ...... 22

Table 3: Carpel and ovule size in pollinated and non-pollinated 'Medjoul' flowers / fruitlets (mm2) during 0-40 DAP (2012) ...... 22

Table 4: Size of degenerating carpels and ovules (mm2) in 'Medjoul', 13 and 21 DAP in pollinated and non-pollinated flowers / fruitlets (2012) ...... 22

Table 5: Percentage of fruitlet-drop (abscission) in 'Barhee' versus 'Medjoul' 3, 4 and 9 WAP respectively grown in the field (March-April 2014) ...... 23

Table 6: Effect of culture media and temperature on isolated spikelets viability and flower abscission ...... 25

Table 7: Effects of four temperatures on pollen germination in isolated spikelet sections in vitro ...... 33

Table 8: Variation in fruitlet weight 5 WAP (2013) in temperature controlled units ...... 37

Table 9: Effect of different temperature treatments in vivo on fruitlet weight 9 WAP in the season of 2013 and 10 WAP in 2014 respectively ...... 37

Table 10: Effects of three alternating temperatures in vivo ("Modular phytotron") on carpel and ovule size (mm2) of pollinated ‘Medjoul’ at five points after pollination ...... 40

Table 11: Differential expression of selected genes between non- pollinated and pollinated flowers of 'Medjoul', four weeks after pollination ... 44

ABSTRACT Control of pollination and fertilization in date palm is essential for development of high quality fruits. Overly high rate of fruit set may cause excessive fruit load, requiring expensive fruit thinning to prevent reduction in fruit size and marketability. On the other hand, inefficient pollination results in lower yields. None-fertilized flowers may also develop into parthenocarpic singlet or triplet fruits, which have no commercial value. Although female flower comprises three separate carpels, only a single carpel develops into a fruit, while two others degenerate. In addition, pollination efficiency, environmental conditions and genetic background (different cultivars) influence developmental processes of fertilization and fruit development. The aim of our research is comprehensive characterization of fertilization and early fruit development in date palm under different conditions. Specifically, we focused on: 1. Morpho-physiological depiction of fertilization and fruit set processes in two date cultivars 'Barhee' and 'Medjoul'; 2. Study of temperature effects on fertilization and early fruit development; 3. Expression analysis of genes involved in hormonal regulation of fruit development and carpel degeneration. Date is a very large tree. To study environmental effects on its reproductive biology, various techniques were applied. We combined in vitro studies with experiments in planta in the orchard. Only limited success was achieved in calibration of an in vitro culturing protocol for pollination of inflorescence sections, since "vase life" of the detached flowers was very short and senescence occurred within several days to two weeks. Special "modular phytotrons", assembled on pollinated inflorescences of whole date trees in the orchard, were designed for this research, enabling modification of temperature regimes in planta. Pollen tube growth, fertilization, fruitlet formation and carpel degeneration, as well as early development of parthenocarpic fruits were defined and characterized by macro- and microscopic analyses. We have shown that the two studied cultivars varied significantly in their reproductive biology, including development of parthenocarpic fruits, fruitlet shedding and differential

regulation of the physiological processes. Relatively low temperatures, applied during plant fertilization, significantly decreased pollen germination rate, enhanced formation of parthenocarpic fruits and reduced normal fruit development.

Using histological data, we defined the 'developmental checkpoints' and consequent stages of early fruit formation in two cultivars, and confirmed that processes of ovule degeneration and carpel shrinkage occur earlier than we can observe morphologically. Under our experimental conditions, ovule degeneration could first be detected in 'Barhee' 14 days after pollination, lagging about a week in pollinated 'Medjoul'. Moreover, carpels of pollinated flowers were significantly larger in size in comparison to the non-pollinated flowers already at 27 DAP in both 'Medjoul' and 'Barhee'. Carpel degeneration in pollinated 'Medjoul' flowers was significantly faster, as compared to non-pollinated flowers. This demonstrates that in date palm, pollination has substantial effect on triggering a specific developmental pattern. Comparison of fruit shedding between cultivars showed highest fruit- drop in non-pollinated 'Medjoul'. We performed high throughput gene expression analysis of pollinated and non-pollinated flowers of the two date cultivars using Microfluidic Dynamic Array (Fluidigm). Ninety six genes involved in signaling of main plant hormones (auxin, gibberellin, cytokinin, abscissic acid, and ethylene) were selected for the expression analysis, using the recently published date palm transcriptome data. Relative expression of these genes was analyzed at five developmental stages of early fruit development of two cultivars. Preliminary results suggest differential expression patterns among the cultivars, pollination treatments, and different developmental stages.

Abbreviations

ABA: abscisic acid

AUX: auxin

CK: cytokinin

CTAB: cetyl trimethylammonium bromide

DAP: days after pollination

DDW: double distilled water

DH: dehydrogenase

EST: expressed sequence tags

ET: ethylene

FAA: formalin:acetic acid:alcohol

GA: gibberellic acid

GT: glucosyl-transferase

PCD: programmed cell death

Std Dev: standard deviation

WAP: weeks after pollination

1. INTRODUCTION Date palm (Phoenix dactylifera L.) is one of the oldest and economically most important trees in the Middle East and North Africa (Chao and Krueger, 2007), estimated to have nearly 2,000 varieties around the world. Its economic utility is multifold and includes staple food, beverages, ornamentals and architectural materials with a yearly production of 7,5 million tons of fruit (Chao and Krueger, 2007; FAOSTAT, 2012). In Israel, date palms are commercially grown all along the Jordan rift from the Sea of Galilee in the north to the Arava valley on the south. More than 30,000 metric tons of date fruit are annually produced in Israel, out of which about 30% was exported in 2012, mainly to Europe (Cohen and Glasner, 2014). Among cultivars, ’Medjoul‘ has the highest commercial value, surpassing all other varieties with regard to fruit quality and size. ’Medjoul‘ fruit quality, however, is very sensitive to the environmental conditions (Zaid and De Wet, 2002).

1.1. Botanical background Phoenix dactylifera is a diploid (2n = 36), perennial, and monocotyledonous plant, of the Arecaceae (Palmaceae) family, or the palm family. The genus Phoenix is distinguished from other genera of pinnate-leaved palms by the upward and lengthwise folding of the pinnae, as well as by peculiarly furrowed seeds (Nixon and Carpenter, 1978; Dransfield, 2008). The genus contains 14 species, all native to the tropical or subtropical regions of Africa and Southern Asia; ranging from the Atlantic islands through Africa, Crete, the Middle East and India to Hong Kong, Taiwan, Philippines, Sumatra and Malaya (Barrow, 1998; Dransfield, 2008). Most of the 14 Phoenix species are well known as ornamentals, the highly valued is P. canariensis Chabeaud, commonly called the Canary Island Palm (Nixon and Carpenter, 1978; Zaid and De Wet, 2002). The name of the date palm originates from its fruit: "phoenix" from Greek means purple or red (fruit), and "dactylifera" refers to the finger-like appearance of the fruit (Chao and Krueger, 2007). Since ancient time this plant has been recognized as the "tree of life" because of its integration in human settlement, wellbeing, and food security in hot and barren parts of the world, where only a few crops can be produced (Jain et al., 2011). The origin of the date palm is thought to be the ancient Mesopotamia

area (southern Iraq) or western India (Wrigley, 1995). From the center of origin, date cultivation spread throughout the Arabian Peninsula, North Africa and the Middle East. The expansion of date cultivation later accompanied the expansion of Islam and reached southern Spain and Pakistan, and was subsequently, with the Spanish missionaries, introduced to North America and Australia (Nixon, 1951; Zaid and De Wet 2002; Chao and Krueger, 2007). Being a monocotyledon, date palm has highly developed fibrous roots and lignified trunk that lacks cambium, hence it cannot be grafted. It is the tallest of the Phoenix species, however, in spite of its enormous size, date palm tree is grass-like: rather flexible to strong desert winds. The growth form of a palm tree is characteristic; the plant usually consists of an unbranched stem with a crown of large leaves at the apex, reaching the height of over 20 m, and having the crown radius of about 7-8 m. The leaves are 4-5 m long, pinnate, growing upward in a spiral pattern. Each leaf has an auxiliary bud that may be vegetative, floral or intermediate. A fully productive date palm tree can support up to 30 clusters, which can carry more than 300 kg of fruits (Jain et al., 2011).

1.2. Reproductive biology of date palm Date palm is dioecious, meaning that female and male reproductive structures are separated to different individuals; each generating unisexual flowers. Flowers are developing in a big cluster (inflorescence) called spadix or spike, which consists of a central stem called rachis and several dozens of strands or spikelets (Zaid and De Wet, 2002), each carries numerous flowers. The developing inflorescences are enclosed in a hard, fibrous cover (the spathe) that protects the flowers (Chao and Krueger, 2007). As many as 8,000 to 10,000 flowers may be present in a single female inflorescence and even more can be found in a male inflorescence (Zaid and De Wet, 2002). In general, flowers of female and male trees differ in morphology (Nixon and Carpenter, 1978; Vandercook et al., 1980). The staminate (male) and pistillate (female) flowers are connected to spikelet with flattened peduncle, short to elongate, in the pistillate often elongating after fertilization (Dransfield 2008). The female flower is globose and contains three sepals and three petals that are fused together, so that only their tips diverge, and three carpels that are separated; each carpel contains a single anatropous ovule with a single large

stigma. The male flower comprises three connate sepals in a low cupule and three rounded petals; it is sweet-scented and normally possesses six stamens. Pollen is ellipsoidal, bisymmetric or slightly asymmetric with the longest axis 17- 30 µm (Dransfield, 2008). Upon pollination, only one ovule of female flower develops into a fruit, whereas the other two carpels degenerate (Zaid and De Wet, 2002). However, when pollination is not efficient, parthenocarpic fruits can form, in which one or all three non-fertilized carpels develop (Reuveni, 1986). Parthenocarpic fruits may develop from all three carpels, or, similar to the normal fruit, only single carpel will continue its development to the parthenocarpic fruit, while the other two will abort. Various cultivars differ in their ability to produce normal and parthenocarpic fruits. For example, in 'Barhee', non-pollinated flowers tend to produce triple parthenocarpic fruitlets, while single parthenocarpic fruits are characteristic for "Medjoul'. Moreover, most parthenocarpic fruits of non- pollinated 'Medjoul' tend to shed during development, while in 'Barhee' they usually remain attached to the spikelets.

1.3. Horticultural challenges From the horticultural standpoint, efficient pollination and fertilization are crucial for successful fruit development and marketable dates. When pollination is inefficient, female flowers are not fertilized, which leads to the development of parthenocarpic fruits with no commercial value (Zaid and De Wet, 2002). On the other hand, too efficient fertilization may cause excessive fruit load, which reduces fruit size and marketability and requires expensive fruit thinning. Therefore, optimization of the pollination process is extremely important for the production of quality fruits. Pollination and fertilization processes are limited by various environmental factors. In general, 12-27˚C are optimal for the growth of date palms, while the trees can withstand high temperatures up to 50˚C and short periods of frost at - 5˚C.They flower when the shade temperature increases to more than 18˚C, and for fruit setting more than 25˚C are required (Zaid and de Wet, 2002a). The ideal temperature for the growth of the date palm, during the period from pollination to fruit ripening, ranges from 21 to 27˚C (Zaid and de Wet, 2002a). However, temperatures in some arid regions vary drastically on a daily basis with

amplitudes reaching more than 20˚C; as a result, the success of pollination, fertilization and consequent fruit set is often bellow optimum.

1.4. Fertilization process In order to fertilize female flowers, pollen from male trees must reach the stigma. Naturally, wind-mediated pollination, anemophily, is common in date palms. In commercial production, male inflorescences are collected from male trees for artificial pollination (Chao and Krueger, 2007). Pollen harvested from a single male tree is sufficient for pollination of 50 female trees. Therefore, an Israeli date plantation has approximately 2 % male trees (Cohen and Glasner, 2014). During pollination, pollen grains of angiosperms reach the female pistil and adhere to the stigma. Upon germination, the pollen grain elongates into a pollen tube, penetrates the stigma and heads toward the ovary by creating a path through the female carpelate tissue. Eventually, the tube, containing two sperm cells, enters the ovule and reaches the female gametophyte where fertilization takes place (Figure 1). Female gametophyte is an eight-nuclei structure, comprising the egg cell, polar nuclei, two sinergids and three antipodial cells. After the pollen tube enters the female gametophyte, the pollen tube nucleus disintegrates and the two sperm cells are released; one of the two sperm cells fertilizes the egg cell, forming a diploid (2n) zygote, which then divides repeatedly by mitosis to give rise to the seed embryo; the other sperm cell will fuse with the two haploid polar nuclei forming triploid (3n) endosperm, which will form the main nutrient source for the growing embryo. In angiosperms, i.e. the flowering plants, this process is termed a double fertilization. Fertilization leads to fruit set - the commitment of the ovary to proceed with fruit development, also defined as the changeover from the static condition of the flower ovary to the rapidly growing condition of the young fruit (Serrani et al., 2007). This process is controlled by positive growth signals generated during fertilization, e.g. auxins, gibberellins (GAs), cytokinins and ethylene (Crane 1964; Nitsch 1970; O'Neill 1997; Srivastava, 2005).

Figure 1 - Schematic representation of fertilization in angiosperms. From: Brower, B. Pollination and Fertilization. Retrieved September, 2014, from Connexions, http://cnx.org/content/m44723/latest/?collection=col11516/latest Note that in date palms each one of the three carpels is separated, having its own stigma, and only one ovule is fertilized. Fertilization leads to fruit set - the commitment of the ovary to proceed with fruit development, also defined as the changeover from the static condition of the flower ovary to the rapidly growing condition of the young fruit (Serrani et al., 2007). This process is controlled by positive growth signals generated during fertilization, e.g. auxins, gibberellins (GAs), cytokinins and ethylene (Crane 1964; Nitsch 1970; O'Neill 1997; Srivastava, 2005). In most flowering plants, early fruit development can be divided into three phases. The earliest phase involves the development of the ovary and the decision to abort or to proceed with further cell division and fruit development, i.e. the fruit set. In the second phase, fruit growth is due primarily to cell division. The third phase begins after cell division ceases, and fruit growth continues mostly by cell expansion, until the fruit reaches its final size (Gillaspy et al., 1993). In monocotyledonous plants, the region of most rapid growth of the fruit is the very base, that is, the region enclosed by the calyx (Haas and Bliss, 1935).

1.5. The role of hormones in post-pollination processes Hormonal regulation plays a prominent role in fruit development of plants (Nitsch 1970, Ozga et al., 2003), including all classes of plant hormones: auxins, GAs, cytokinins, inhibitors (for example, ABA), and ethylene. Gibberellins (GAs) are tetracyclic diterpenoids that control a wide range of developmental processes; they are key factors for fruit-set and development. GA treatment of unpollinated pistils promotes fruit initiation, probably by mimicking GA production upon ovule fertilization (Vivian-Smith and Koltunow, 1999; Dorcey et al., 2009). In fact, upon pollination, GA biosynthesis genes are upregulated, and bioactive GA1 and its precursor GA20 levels increase (Ben- Cheikh et al., 1997). Gibberellins and auxins are considered to be the main stimulus in the induction of fruit set, since their endogenous levels increase suddenly in ovaries after fertilization (Gillaspy et al., 1993; Ben-Cheikh et al., 1997; Goetz et al., 2002). Moreover, auxins and GAs are widely known for their ability to promote fertilization-independent fruit development in several species (Barendse and Peeters, 1995; Nitsch, 1970; Ozga and Reinecke, 2003). For example, stimulation of fruit set by GA has been observed in pear (Pyrus communis). GA- induced fruit set may occur in the absence of pollination, resulting in parthenocarpic fruits. On the other hand, following successful pollination, the presence of fertilized ovules generally triggers the development of the ovary into a fruit. The commitment to proceed with fruit development (fruit set) is therefore dependent on one or more positive growth signals produced by pollen during germination and pollen tube growth and during or after fusion of the nuclei (Gillaspy, 1993). Sastry and Muir (1963) showed that it is not auxin, but GA that is transferred from the germinating pollen to the ovary. Subsequently, the GA may induce an increase of the auxin content in the ovary to levels adequate to trigger fruit growth (Sastry and Muir, 1963; Koshioka et al., 1994). Furthermore, Vriezen et al. (2008) showed that the mRNA levels of several ethylene biosynthesis genes and genes involved in ethylene signaling decreased after pollination in tomato, as well as transcript levels of ABA biosynthesis genes. Accordingly, these findings led to a conclusion that the onset of fruit development depends on the

induction of GAs and auxin responses, while ethylene and ABA responses are attenuated.

1.6. Parthenocarpy Parthenocarpy is generally considered as the formation of a fruit without fertilization of the ovules, and it was introduced by Noll (1902) to designate fruit formation without pollination or other stimulation (Nitsch, 1952). For example, the oriental persimmon (Diospyros kaki), as well as some varieties of figs, pears, and grapes, are often parthenocarpic. Moreover, the cultivated banana is always parthenocarpic (D'Angremond, 1912), while the wild banana is not. Parthenocarpic fruit development can be genetically controlled or artificially induced by exogenous application of hormones, mostly auxin and GAs. GAs have been reported to promote parthenocarpic fruit development in different species such as tomatoes (Serrani et al., 2007), apples (Hayashi et al., 1968), pears (Gil et al., 1972), as well as in various cultivars of date palm (Shaheen et al., 1988). In addition, seedless dates were obtained in unpollinated bunches treated with GA3. Abd-Alaal et al. (1982) found that the use of 2,4D, 2,4,5-T, 2,4,5-TP, IAA and GA3 at the concentrations of 25-100 ppm resulted in formation of seedless dates in the 'Khadrawi' date cultivar (Shaheen et al. 1988). Several authors reported a correlation between increased auxin and gibberellin levels in the ovary before fertilization and parthenocarpic fruit development (Gillaspy et al., 1993). The endogenous levels of auxins and GAs are higher in ovaries of parthenocarpic tomato lines than in seed-producing lines (Gustafson, 1939b; Nitsch et al., 1960; Mapelli et al., 1979; Mapelli and Lombardi, 1982). However, Fuentes et al. (2012) reported that in Arabidopsis, auxin-induced parthenocarpy occurs entirely through GA signaling, and is dependent and independent of functional GA signaling machinery, associated with the DELLA proteins. With respect to genetic manipulation, Pandolfini (2009) suggests that parthenocarpy can be achieved in several ways: by genetic modification of auxin synthesis, auxin sensitivity and auxin content, or by manipulating genes of the auxin (IAA9 or ARF8), or gibberellin signal transduction (DELLA). For example, two components of the auxin signal transduction pathway, AUXIN RESPONSE

FACTOR8 (ARF8) from Arabidopsis (Vivian-Smith et al., 2001; Goetz et al., 2006) and the Aux/IAA protein IAA9 from tomato (Wang et al., 2005), have been shown to repress ovary growth before fertilization. Aux/IAA proteins can bind to ARF proteins to activate or inhibit the transcription of auxin responsive genes (Ulmasov et al., 1999b; Hardtke et al., 2004; Tatematsu et al., 2004). It has been proposed that both Arabidopsis and tomato possess ARF8- and IAA9-like orthologs that interact and, together with potentially other as yet unknown proteins, form a protein complex that prevents fruit set prior to fertilization (Goetz et al., 2006; Swain and Koltunow, 2006). Namely, ARF8 is an ovule- specific transcription factor that negatively regulates fruit set (Goetz et al., 2006); after pollination/fertilization ARF8 gene expression is switched off. Moreover, fruit development can be uncoupled from fertilization also by silencing DELLA proteins, which are repressors of GA signaling (Marti et al., 2007). DELLA proteins are a subfamily of the GRAS protein family of putative transcription factors characterized by the conserved amino acid motif DELLA (Thomas and Sun, 2004). These proteins are negative regulators of GA signaling that act immediately downstream of the GA receptor. Binding of GA to its soluble receptor, GID1, causes binding of GID1-GA to DELLAs and leads to their degradation via the ubiquitin-proteasome pathway. DELLAs are nuclear localized and are hypothesized to function as transcriptional regulators (Eckardt, 2007). Cytokinins (CK) play a central role in the regulation of cell division (Frank and Schmulling, 1999). In tomato fruit, CK levels peak during the phase of high mitotic activity (Bohner and Bangerth, 1988). Moreover, high levels of CK were reported to induce programmed cell death (PCD) in proliferating cells of carrot and Arabidopsis (Carimi et al., 2002). In many plant species, plant hormones were also reported to be associated with female gametophyte development, as well as pollen germination and pollen tube elongation. For example, GAs promote Arabidopsis petal, stamen and anther development by opposing the function of the DELLA proteins RGA, RGL1 and RGL2 (Richards et al., 2001). Before fertilization, DELLA proteins repress growth and elongation of the ovary. On fertilization, auxin (IAA) is produced in the ovules, inducing GA3 production in the valves. GA3 then mediates DELLA degradation and fruit growth (Sundberg and Østergaard, 2009).In orchid

Phalaenopsis, ovary wall epidermal cells begin to elongate and form hair cells two days after pollination; this is the earliest visible morphological change in female gametophyte after pollination and prior to pollen germination, indicating that signals associated with pollination itself trigger these changes (Zhang and Oneill, 1993). The effects of inhibitors of ethylene biosynthesis (aminoethoxyvinylglycine - AVG) on early morphological changes indicated that ethylene, in the presence of auxin (NAA), is required to initiate ovary development and, indirectly, subsequent ovule differentiation. Furthermore, pollen germination and growth were strongly inhibited by AVG, indicating that male gametophyte development is also regulated by ethylene.

1.7. Genomic and transcriptomic research in date palm In the last years, much effort has been made in creating molecular information on date palms. Two drafts of the date palm nuclear genome (cv. 'Khalas') were published in 2009 (Al-Dous et al.; GCA_000181215.2), and 2011 (Al-Dous et al.; GCA_000413155.1), estimating the genome size of 550-650 Mb. First, full- genome assemblies of the two date palm organelles, plastid and mitochondrion have been published (Yang et al.; 2012, NC_013991.2; Al-Mssallem et al., 2013, NC_016740.1). Further, a comparative transcriptome study on mesocarps of oil palm and date palm was performed (Bourgis et al., 2011), as well as identification and characterization of differentially expressed ESTs in date palm leaves affected by brittle leaf disease (Saidi et al., 2010). The genomic approach was used to acquire massive transcriptome data for the date palm fruit at seven different developmental stages (Al-Mssallem et al., 2013), subsequently merged into three stages (Yang et al., 2012). Annotated isotigs of the defined fruiting stages provide the ground information to study biological processes of interest in fruit development. In spite of its undeniable significance, only a few studies were performed on date palm fertilization, fruit setting and development. Unlike other crops whose stress-related reproductive biology is well-known, the effects of environmental conditions i.e. temperatures, on pollen tube growth, fertilization and fruit set in date require further study. Due to vulnerability of the reproductive stage and the fact that temperatures in some arid regions vary drastically on a daily basis, the consequent success of pollination, fertilization and fruit set is often bellow

optimum. One of the important questions is whether temperatures limit these processes. In the present study, by using transcriptome data, we also aim to focus on genes involved in hormonal regulation of pollination, fertilization and early fruit development in two cultivars. Our working hypothesis suggests that in date palm, fertilization, early fruit development and parthenocarpy are significantly affected by environmental conditions and hormonal balance.

2. RESEARCH OBJECTIVES

The main aims of the research are as follows: (1) Morphological and anatomical characterization of pollination, fertilization and fruit setting processes in date palm cultivars 'Medjoul' and 'Barhee'; (2) Characterization of parthenocarpic fruit development in two cultivars 'Medjoul' and 'Barhee' and comparison to normal fruit development; (3) Assessment of the temperature effects on fertilization and fruit setting; (4) Expression analysis of genes involved in hormonal regulation during fruit development in pollinated and non-pollinated flowers.

3. MATERIALS AND METHODS

3.1. Plant material Trees of date palms (Phoenix dactylifera L.) cv. 'Medjoul' and 'Barhee' from Southern Arava Research Center, Kibbutz Samar and Mitzpe Shalem were used in this research. The inflorescences of Canary palm (Phoenix canariensis) trees, grown in the campus of Agricultural Research Organization, the Volcani Center in Bet Dagan were employed for calibration of the in vitro assay and treatments with anti-ethylene compounds.

3.2. Development of an in vitro assay for spikelet culturing For in vitro studies, inflorescences of date palm 'Medjoul' were brought from the experimental orchard of Southern Arava Research Center (February – April of 2013) and from Mitzpe Shalem orchard (March 2014). Inflorescences, enclosed in their spathes, were cut, wrapped in wet paper, placed in paper bags and were immediately delivered to the laboratory in cooled containers. In the lab, the spathes were gently open, and single spikelets carrying flowers were cut to the length of approximately 15cm (2012). Alternatively, the central parts of the bunch, comprising approximately 15-20 spikelets were used (2013). To prevent embolism, spikelet base was cut under water. Flowers were carefully pollinated with normal pollen with a small paintbrush, and inflorescence sections were incubated in growth chambers at constant temperatures: 15°C, 20°C, 25°C and 30°C and a 12-h photoperiod at the Volcani Center (2012) or at different temperature regimes (34/28˚C, 28/22˚C, 22/16˚C and 16/10˚C, day/night) at the Phytotron of the Faculty of Agriculture of the Hebrew University of Jerusalem (2013). For sampling, four replicates were used per each time point (1, 2, 3, 4, 6, and 7 days after pollination), so that a total of 72 samples were collected from in vitro fertilization under constant temperature regimes (4 replicates x 6 time points x 3 temperature treatments). Spikelets with flowers that were not pollinated were used as negative control. Pollinated flowers (or control) were fixed in FAA for macro- and microscopic studies. In the in vitro assay, each sample (spikelet or inflorescence section) was scored twice a week for: (a) solution or media contamination (fungi), (b) spikelet

browning, (c) spikelet drying, (d) flower/fruitlet browning, (f) flower/fruitlet drop, (g) stigma browning, and (h) general senescence. Calibration of the assay for spikelet culturing in vitro comprised the evaluation of various media, preserve compounds, fungicides and ethylene inhibitors:

3.2.1. Selection and optimization of growth media and cultivation conditions under different temperature regimes The spikelets were grown either on solid (agar) or liquid media. Each treatment was performed in 8 repetitions. For agar plates, components used were: 3% sucrose, Murashige Skoog (MS) medium (Getter M0222), casein hydrolydase (Getter YB- C1301), plant agar (0.8%, Getter YM-P1001) and active charcoal (0.25%, Getter YB-C1302). pH was set to 5.7. In half of the plates with agar, 5 ml of water were added over a cotton plug to keep humidity of the chamber. To test the liquid media, the spikelets were placed in the tubes with 10 ml water (control) or water solutions of “TOG6”, TOG6 + 2% sucrose, “Longlife” (GADOT) (liquid). All media were replaced on a weekly schedule. Prior to replacing, the base of each spikelet was cut to remove damaged tissue with clogged water vessels.

3.2.2. Prevention of fungal contamination In order to prevent fungal contamination, 0.2% Marpan fungicide was added (dipped) to the liquid media with spikelets which was then replaced every 7 days.

3.2.3. Use of ethylene inhibitors to prolong vase-life To prevent senescence and rapid deterioration of plant material during in vitro culturing, spikelets (from Canary palm inflrorecences) cultivated in liquid solution were pulse-treated with 0.2% Silver thiosulfate (STS) for 4, 8 and 16 hours respectively, at 20°C. Alternatively, spikelets placed in sealed glass chambers at 20°C, and incubated with a total concentration of 500 ppb 1-methylcyclopropene (1-MCP). The gaseous 1-MCP was prepared in a closed Florence flask with 1% KOH, and was then injected into the chambers. The chambers remained sealed for 4 hours. Incubation with 1-MCP was performed just before pollination, or 1 or 2 days after pollination (DAP).

3.3. Effect of temperature regimes on fertilization and fruit setting in modular phytotrons - in vivo For in vivo studies, we used ten years old intact date palm trees 'Medjoul', grown in an orchard at Southern Arava R&D, Yotvata, Israel. Twelve bunches (three bunches per tree in four adjacent trees) were pollinated with a pollen mixture (50% viable pollen + 50% inertial material made of potato flour and charcoal). Bunches were enclosed in special temperature controlled units designed by Crystal Vision (Kibbutz Samar, Israel) with the aim to create a specific temperature regime. The units were regulated by a computerized system to induce three different temperature regimes: cold 20/8°C, medium 25/12°C and warm temperature 32/18°C (day/night, respectively) (Figure 2). Figure 3 represents daily average and extreme temperature during flowering of date palm in Yotvata. In the temperature units, temperatures were lowest at 05:00, increased gradually to highest level at 15:00, and then gradually decreased. For control, four additional bunches were pollinated, but were exposed to outdoor temperatures instead of being enclosed in chambers. Units were installed on the trees around individual inflorescences and sealed during the period of 14.03-22.04, 2013 and 18.03-01.04, 2014. Then, units were removed and further fruitlet development was followed under local weather conditions.

25/12° 25/12° 25/12° 25/12° C C 20/8° 32/18° 20/8° 32/18° 20/8° 20/8° ° 32/18° 32/18 C C C C

a) b) Figure 2 Left: Experimental layout of pollination under controlled temperature conditions in special chambers in the field (a); right: modular phytotrons assembled on pollinated bunches on a tree (2013) (b). Three alternating temperature regimes were applied in four replicates, using one bunch per replicate.

In a negative control, bunches were not pollinated; instead, they were closed in paper bags to prevent pollination. The developing flowers from each bunch were sampled ten times, within first six weeks from pollination.

Figure 3 - Daily average and extreme temperatures at pollination in Yotvata during spring periods of 2005-2012.

3.4. Histology and microscopy Flowers and young fruitlets were collected from the spikelets and immediately fixed in FAA (10% formaldehyde: 5% acetic acid: 50% ethanol, v/v). Morphological and histological studies were performed using stereoscope (DMLB, Leica) and light microscope (MZFLIII, Leica). For histological studies, FAA fixed samples were gradually dehydrated in alcohol (50%, 70%, 90%, 95% and 100% ethanol), cleared with xylene (Histo-clear) and paraffin embedded by placing in liquid paraffin using Paraplast Plus – Tissue Embedding Medium (8889502004). Samples were sectioned in 15 μm using a Leica RM2245 microtome and stained with Safranin / Fast Green (Ruzin, 1999).

3.5. Pollen tube germination and elongation in vitro and on the stigma Pollen was germinated in vitro at different constant temperatures (15°C, 20°C, 25°C and 30°C) for 3 hours in a solution of 10% sucrose and 500mg\L Boric Acid (Bernestein, 2004). Pollen grains were visualized under a microscope (MZFLIII, LEICA), photographed (Nikon DS-Fi1) and their tube length was measured using the NIS-Elements BR 3.1 Program.

Analysis of pollen tube elongation in stigmas was adapted from Reuveni et al. (1986) and Cohen et al. (2004). Prior to histological evaluation, FAA fixed flowers were washed three times in double distilled water (DDW) and ethanol (100%) 1:1; each washing lasted 10 minutes. Samples were gently stirred during this time. Washing was repeated five more times by using DDW. Using stereoscopic microscope, flowers were dissected, and the three carpels were separated. Stigmas with the surrounding tissue were cut off from each carpel in order to be assessed individually. At this point, in order to prevent from shriveling, carpels were drenched with water droplets and were kept constantly wet. Stigmas were then cleared in scintillation vials containing 1 ml of 10M NaOH for two hours with the aim to slightly bleach the sample and make the tissue softer and easier to manipulate. After being cleared with NaOH, washing with DDW was repeated five more times. Stigmas were placed on the glass slides, stained with aniline blue (0.4% in

0.35% K3PO4 solution), covered with a covering glass, and examined immediately under fluorescence microscope (MZFLIII, LEICA) with a UV excitation filter set (340-380/400/425 nm). Pollen germination on the stigma was estimated on a five-point scale: 0 – no germination; 1 – low or sporadic germination; 2 – moderate germination; 3 – pollen germination covers most of the stigma; and 4 – high germination.

3.6. Molecular analysis For molecular analysis, we used date palm cultivars 'Medjoul' and 'Barhee', grown in the orchard at Kibutz Samar, Israel. Flowers were collected at 5 different time points: before pollination (0), 1, 2, 3 and 4 weeks following pollination. Additional inflorescences were opened and immediately covered with paper bags to prevent pollination. Flowers were collected from these inflorescences at the same time points as non-pollinated controls. Four replicates were used per treatment, per time point. Upon sampling, flowers were manually removed at the orchard from the spikelet, immediately frozen in liquid nitrogen, transferred in dry ice to the laboratory, and kept in -80°C until use.

3.6.1. RNA extraction RNA was extracted from 2 g flower tissue that was ground in liquid nitrogen according to the CTAB-based method (Chang, 1993). 20-ml preheated extraction buffer (65˚C) was quickly added to suspend the RNA and the mix was extracted with an equal volume of chloroform: isoamyl alcohol (24:1) and precipitated overnight at 4˚C LiCl at final concentration of 2.5 M. Nucleic acids were pelleted using centrifugation (13,000 rpm for 20 min), washed with 70% ethanol and dissolved in 500 µl of SSTE buffer (10 mM Tris–HCl, pH 8.0, 1 mM EDTA, 1M NaCl, 0.5 % (w/v) SDS). Following another extraction with equal volume of phenol: chloroform: isoamyl alcohol (25:24:1), RNA was finally precipitated with two volumes of ice cold absolute ethanol overnight at -20˚C. After centrifugation (13,000 rpm for 20 min) and another washing with 70% ethanol, pellet was dried and dissolved in 30 μl of ultra-pure water ("Biological industries"). DNA traces were digested using 1 unit of RQ1 RNase free DNase ("Promega"), in the presence of 40 units Ribolock RNase inhibitor (Thermo Fisher Scientific) for 60 min at 37˚C. Then, RNA was re-extracted using phenol: chloroform: isoamyl alcohol, (25:24:1), extraction and precipitation with isopropanol and glycogen (Thermo Fisher Scientific). Eventually, it was centrifuged, washed with ethanol and dissolved in ultra-pure water. The quality and purity of RNA were examined by a Thermo Scientific NanoDrop™ 1000 Spectrophotometer and by running samples on 1.5% Agarose gel (sampls were denaturing at 70°C for 10 minutes with 2X RNA loading dye (Thermo Fisher Scientific). For cDNA synthesis, Thermo Scientific Verso cDNA Synthesis Kit was used with random hexamer primers, according to the manufacturer instructions. cDNA synthesis was performed at 42°C (1 hour) followed by enzyme inactivation at 95°C for 2 minutes.

3.6.2. Gene validation and primer design The transcriptome of the 'Khalas' cultivar (Al-Mssallem 2013, WGS- ACYX02000001-ACYX02142304) was used as a reference to identify genes involved in hormonal biosynthesis and regulation. Only genes active at early early stages of fruit development (1-30 DAP) were considered. Kyoto Encyclopedia of Genes and Genomes (KEGG) as well as National Center for Biotechnology Information (NCBI) databases were used for data mining and

gene validation in order to select a total of ninety six transcript sequences Genes of the main hormone families: GAs (including DELLA proteins), auxins, cytokinins, ABA, and ethylene were selected. In addition, genes related to programmed cell death, and senescence-associated proteins were also selected. With respect to genes coding for same proteins / enzymes, we included sequences with both high and low relative expression, according to the transcriptome. Multiple alignments were performed using DNAman software and specific primers were designed for the selected genes. As house-keeping genes, actin, elongation factor, F-box and glucose-6-phosphate dehydrogenase (G6PD) were selected (Appendix 1). Primers were designed using Primer3 Software (http://primer3.ut.ee/), IDT Primer Quest tool (http://eu.idtdna.com/Primerquest/Home/Index), and BioEdit Software (Ver. 7.2).

3.6.3. Gene expression analysis cDNA samples from 72 plant samples of 'Barhee' and 'Medjoul' (four biological repeats per treatment) were placed in two plates, as two technical repeats. Calibration curves were made of cDNA mixtures of 'Barhee' and 'Medjoul' samples collected at 0, 2 and 4 WAP and diluted at ratio 1:1, 1:4, 1:16, 1:64, 1:256 and 1:1024. Gene expression analysis was performed using Fluidigm Real-time PCR analysis software version 4.1.2. Upon selecting actin as a reference gene, and a ('time zero') sample before pollination as a reference sample, the heat map of EvaGreen Ct values was obtained. Moreover, data was measured as the ΔΔCT value - the fold change in gene expression normalized to an endogenous reference gene (actin), and relative to the untreated (non- pollinated) control. Finally, in order to acquire relative expression, data was processed using the 2-ΔΔCT method.

3.7. Statistical analysis

Data was processed by using Jump software (JMP Ver.9). Analysis of variance (ANOVA) was used as statistical method for comparison of the means with Tukey-Kramer HSD and Student test. Moreover, for the gene expression analysis, hierarchical cluster analysis was performed.

4. RESULTS

4.1. Morpho-anatomical characterization of fertilization and fruit set in field-grown date cultivars 'Medjoul' and 'Barhee' Morphological (2012, 2014) and anatomical (2012) characterization of date flowers and fruitlets of cv. 'Barhee' and 'Medjoul' was analyzed during the first four weeks after pollination. In both cultivars, flower consists of three carpels, only one of which develops when the flower is pollinated and the other two degenerate. Alternatively, in the absence of pollination, parthenocarpic singlets (PS) formed in 'Medjoul', whereas in 'Barhee', both parthenocarpic singlets and parthenocarpic triplets (PT) developed (Figure 4).

Figure 4 - Morphological characterization of early fruitlet development in pollinated and non-pollinated field-grown 'Barhee' and 'Medjoul' during the first four weeks after pollination (2014). Bars represent 1000 µm.

4.1.1. 'Barhee' In 'Barhee', in non-pollinated inflorescences, both PS and PT fruitlets developed. Representative spikelets of pollinated and non-pollinated inflorescences, and a cross section through normal, PS and PT fruitlets are presented in Figure 5. The share of normal (seed-bearing), PS and PT, as well as shed fruitlets were counted. In pollinated bunches only low levels of PS and PT were detected. (Table 1, 2014). In non-pollinated flowers, high levels of parthenocarpic fruits were detected. No difference was observed in the percentage of PS and PT.

Figure 5 - Left: Pollinated seed-bearing 'Barhee' fruitlets (a) versus non-pollinated single and triple parthenocarpic fruitlets (b); right: cross sections of a parthenocarpic triplet (c), parthenocarpic singlet (d), and a normal seed-bearing fruitlets (e) at 9 WAP (2014).

Table 1 - Percentage of parthenocarpic singlets, parthenocarpic triplets, normal and shed fruitlets respectively in 'Barhee' at 9 WAP (2014).

'Barhee' Parthenocarpic Parthenocarpic Normal Shed fruitlets single triple No pollination 20.23 ± 3.49 C 21.58 ± 3.84 C 7.14 ± 2.49 D 51.03 ± 4.53 AB Pollination 0.87 ± 0.87 D 0.18 ± 0.18 D 57.00 ± 2.70 A 40.79 ± 3.02 B

Histological analysis of pollinated and non-pollinated fruitlets revealed earlier differences in development. In pollinated 'Barhee', we could detect a dominant enlargement of the "chosen" carpel over the other two at 14 DAP. However, in non-pollinated fruitlets, at this stage, all three carpels were developing at similar rates leading to the formation of PTs. Moreover, at this stage, we could observe deterioration of two of the ovules (in pollinated flowers) or delay in the development of all three ovules (in non-pollinated fruitlets) (Figure 6 and 7).

Figure 6 - Histological characterization of early fruitlet development in cv. 'Barhee' during the first 5 WAP. Bar represents 1111 µm.

Figure 7 - Deterioration of two ovules in pollinated 'Barhee' as opposed to uniform ovule growth in non-pollinated flower.

To follow the process of fruitlet degeneration, we compared sizes of the three carpels and their ovules. No significant differences in carpel size were detected between the "leading" carpel size and their ovules in the singlet pollinated and non-pollinated 'Barhee' fruitlets (Table 2). These results are in accordance with those of Torahi and Arzani (2010) who reported no difference in size between single 'Barhee' fruits developed from pollinated and unpollinated flowers during the first 30 days of development. On the other hand, already at 26 DAP the leading carpels of the pollinated singlets were significantly larger in size than the means of the non-pollinated three carpels within the triplets (Table 2.). Furthermore, at 38 DAP, ovule size of pollinated singlets was notably larger as compared to the ovules of non-pollinated triplets.

4.1.2. 'Medjoul' In 'Medjoul', the three-carpel flower develops into a single seeded berry fruit regardless of pollination (Figure 8). In pollinated flowers, as soon as 13 to 16 DAP one of the three carpels grew more rapidly and became dominant in size over the other two, which were consequently aborted. A similar process occurred in non-pollinated flowers but was delayed by several-days. In pollinated flowers at 21 DAP, we observed considerable carpel shrinkage, whereas in non-pollinated flowers at this stage, only beginning of carpel shrinkage could be detected.

Figure 8 - Histological characterization of early fruit development in 'Medjoul' during the first 41 DAP in 2112. Size bars represent 1111 µm.

Table 2 - Sizes of carpels and ovules (cross section area - mm2) in pollinated vs. non-pollinated flowers of 'Barhee' during first 35 DAP (2012). Means not connected by same letter within a row are significantly different (P≤0.05) according to Tukey and Kramer test. 26 DAP 35 DAP Treatment 7 DAP 14 DAP *singlet **triplet *singlet **triplet Pollinated 2.11 ± 0.07 A 3.88 ± 0.82 A 12.25 ± 0.96 A 22.96 ± 1.11 A Carpel size Non-pollinated 2.39 ± 0.11 A 5.28 ± 0.88 A 13.2 ± 1.58 A 6.59 ± 0.71 B 26.46 ± 2.17 A 10.35 ± 0.45 B Pollinated 0.17 ± 0.00 B 0.30 ± 0.03 A 0.47 ± 0.06 A 0.75 ± 0.08 A Ovule size Non-pollinated 0.20 ± 0.00 A 0.35 ± 0.06 A 0.49 ± 0.04 A 0.19 ± 0.02 A 0.97 ± 0.07 A 0.28 ± 0.02 B * The size of the leading carpel (pollinated flower) was compared to the leading carpel size of the non-pollinated flower. ** The size of the leading carpel (pollinated) was compared to the mean of the three carpels in the triplet (non-pollinated) flower.

Table 3 - Carpel and ovule size in pollinated and non-pollinated 'Medjoul' flowers / fruitlets (cross section area - mm2) during 0-40 DAP (2012). Means not connected by same letter within a row are significantly different (P≤0.05) according to Tukey and Kramer test.

13 DAP 21 DAP 'Medjoul' Treatment 8 hours 6 DAP (leading (leading 27 DAP 40 DAP carpel) carpel) Pollination 1.20 ± 0.17 A 1.59 ± 0.06 A 2.82 ± 0.20 A 8.89 ± 0.75 A 24.51 ± 1.33 A 42.50 ± 2.65 A Carpel size No pollination 1.54 ± 0.05 A 1.67 ± 0.08 A 2.39 ± 0.06 A 7.56 ± 0.62 A 15.45 ± 2.40 B 31.67 ± 1.98 B Pollination 0.08 ± 0.00 A 0.12 ± 0.00 A 0.15 ± 0.00 A 0.43 ± 0.02 A 0.71 ± 0.09 A 1.47 ± 0.25 A Ovule size No pollination 0.09 ± 0.00 A 0.1 ± 0.00 A 0.21 ± 0.01 B 0.46 ± 0.02 A 1.28 ± 0.04 B 1.99 ± 0.15 A

Table 4 - Size of degenerating carpels and ovules (cross section area - mm2) in 'Medjoul', 13 and 21 DAP in pollinated and non- pollinated flowers / fruitlets. Means not connected by same letter within a row are significantly different (P≤0.05) according to Tukey and Kramer test.

Size of degenerating Size of ovules in degenerating Size of degenerating Treatment carpels 13 DAP carpels 13 DAP carpels 21 DAP No pollination 2.20 ± 0.04 B 0.12 ± 0.003 A 0.77 ± 0.18 A Pollination 1.80 ± 0.12 A 0.12 ± 0.005 A 0.40 ± 0.07 A

No significant differences in carpel size of 'Medjoul' flowers were observed in the first 3 weeks following pollination. However, at 27 and 40 DAP, the leading carpels of the pollinated flowers were significantly larger in size as compared to those of the non-pollinated ones. Moreover, the ovules of the leading carpels were larger in size in pollinated flowers, as compared to the non-pollinated flowers, being significant at 13 and 27 DAP (Table 3). Comparing sizes of ovules in degenerating carpels, we reported no statistical difference among treatments. Nevertheless, at 13 DAP, the two degenerating carpels were significantly larger in size in non-pollinated fruitlets, as compared to those of the pollinated fruitlets, showing that the process of carpel abortion starts earlier and occurs at a higher rate in pollinated fruitlets (Table 4).

4.1.3. Comparison between 'Barhee' and 'Medjoul' In pollinated 'Barhee' and 'Medjoul', first indications of programmed cell death were reported 14 and 21 DAP respectively, through ovule deterioration and carpel shrinkage. In pollinated 'Medjoul', carpel degeneration was faster as compared to the non-pollinated 'Medjoul'. 'Barhee' and 'Medjoul' differ in their shedding of fruitlets. Fruit-drop was compared at 3, 4, and 9 WAP (Table 5), showing great differences in response to pollination. Highest fruit shedding was reported in non-pollinated 'Medjoul', differing from other treatments at all examination times.

Table 5 - Percentage of fruitlet-drop (abscission) in 'Barhee' versus 'Medjoul' 3, 4 and 9 WAP respectively grown in the field (March-April 2014). Means not connected by same letter within a row are significantly different (P≤0.05) according to Tukey and Kramer test.

Cultivar Treatment 21 DAP 28 DAP 63 DAP 'Barhee' Pollination 6.5 ± 1.68 B 17.57 ± 3.57 B 40.80 ± 3.02 BC No pollination 3.72 ± 1.52 B 14.43 ± 2.87 B 51.03 ± 4.53 B Pollination 15.32 ± 2.85 B 21.19 ± 7.25 B 28.77 ± 3.28 C 'Medjoul' No pollination 40.82 ± 9.62 A 68.5 ± 5.51 A 90.04 ± 2.02 A

4.2. Effects of temperature regimes on pollination, fertilization and fruit-set in date palm

4.2.1. Development of an in vitro assay for studying date palm fertilization The in vitro fertilization assay was developed with the aim to study date fertilization of isolated pollinated spikelets under controlled environmental conditions: We tried to optimize survival conditions of spikelets, flowers and organs incubated in different media and under different temperature regimes. This section was performed in collaboration with David Birger, another master student in the laboratory.

Optimization of growth media and cultivation conditions in vitro In order to improve "vase life" of the flowers and spikelets, we calibrated the in vitro assay. The vase life of spikelets was tested in five growth media: Three different liquid media were tested: T.O.G.6, T.O.G.6 + 2% sucrose, “Longlife” and solid agar media. Spikelets of 'Medjoul' were incubated at three different temperature regimes: 20°C, 25°C and 30°C (Table 6). In order to prevent fungal contamination, 0.2% Marpan fungicide was added (dipped) to the media with spikelets which was then replaced every 7 days. Without the use of Marpan, all the spikelets were contaminated after only two days under all temperature treatments (data not shown). In October 2013, we used Canary palm in order to calibrate in vitro assay and extend spikelet vase-life. Both palms are close relatives and possess similar reproductive mechanisms, but vary in their annual cycle and flowering season. Date palm flowers during relatively short season in March-April, while Canary palm flowers in October. Therefore, we used Canary palm to complement our main research to obtain plant material out of the date flowering season.

Table 6 - Effect of culture media and temperature on isolated spikelets viability and flower abscission of 'Medjoul'. Spikelet sections were incubated at different temperatures, their viability and flower abscission was estimated at 1, 5 and 9 days after setup (DAS) using a five-point scale, where 5 – is completely viable and 0 being dead / most contaminated. Means ± standard errors are significantly different (P≤0.05) according to the Tukey-Kramer HSD test.

Temp. Culture media Overall vitality Abscission 1 DAS 5 DAS 9 DAS 1 DAS 5 DAS 9 DAS 20˚C TOG 5 ± 0 a 4.9 ± 0.1 a 5 ± 0 d 5 ± 0 a 4.9 ± 0.1 ab 5± 0 c TOG+2% sucrose 5 ± 0 a 5 ± 0 a 5 ± 0 d 5 ± 0 a 0 ± 0 b 5 ± 0 c LongLife 4.8 ± 0.3 a 4.3 ± 0.6 ab 3.5 ± 1.2 bcd 5 ± 0 a 4.9 ± 0.1 ab 3.6 ± 1.2 abc DDW 4.8 ± 0.1 a 3.1 ± 0.6 abc 1 ± 1 ab 5 ± 0 a 4.8 ± 0.3 ab 1.1 ± 1.1 abc MS Agar + 3% Sucrose 5 ± 0 a 4.1 ± 0.6 ab 1.8 ± 1.2 abc 5 ± 0 a 0 ± 0 b 2.3 ± 1.3 abc 25˚C TOG 5 ± 0 a 4.8 ± 0.1 a 1.5 ± 0.9 ab 5 ± 0 a 4.8 ± 0.1 ab 2.8 ± 1.0 abc TOG+ 5 ± 0 a 5 ± 0 a 4.5 ± 0.3 cd 5 ± 0 a 4.5 ± 0 ab 4.6 ± 0.2 bc 2% sucrose LongLife 3.8 ± 0.4 b 2 ± 0.8bc 0 ± 0 a 5 ± 0 a 2.6 ± 1.0 a 0 ± 0 a DDW 4.3 ± 0.1 ab 3.5 ± 0.5 abc 0 ± 0 a 4.9 ± 0.1 a 4.6 ± 0.1 ab 0 ± 0 a MS Agar + 3% Sucrose 4.9 ± 0.1 a 3.5 ± 0.9 abc 0 ± 0 a 5 ± 0 a 3.8 ± 0.7 ab 2.3 ± 1.3 abc 30˚C TOG 5 ± 0 a 3.3 ± 0.5 abc 0 ± 0 a 5 ± 0 a 4.1 ± 1.5 ab 0.8 ± 0.8 ab TOG+ 5 ± 0 a 4.1 ± 0.6 ab 0 ± 0 a 5 ± 0 a 4.1 ± 0.7 ab 2.0 ± 0.9 abc 2% sucrose LongLife 4.8 ± 0.3 a 3.5 ± 0.8 abc 0 ± 0 a 5 ± 0 a 4.1 ± 0.4 ab 0.8 ± 0.8 ab DDW 4.8 ± 0.1 a 2.8 ± 0.3 abc 0 ± 0 a 5 ± 0 a 3.9 ± 0.4 ab 0 ± 0 a MS Agar + 3% Sucrose 5 ± 0 a 1 ± 0 c 0 ± 0 a 5 ± 0 a 4.3 ± 0.3 ab 0 ± 0 a

Cut spikelets of Canary palm were treated with ethylene inhibitors, 1- Methylcyclopropene (1-MCP) or silver thiosulfate (STS) aiming to hinder senescence – the time-related deterioration of the physiological functions, and support in vitro development of the spikelets. Both treatments extended "vase life" of the flowers and spikelets (Figure 9). Effects of 1-MCP and STS on different physiological parameters were tested in vitro and evaluated on a five-point scale (e.g. 0 being most contaminated, 5 – no contamination) (Figure 10). Pollination greatly reduced viability, the most significant parameter of vase- life in STS-treated spikelets as compared to 1-MCP-treated. Pollinated spikelets treated with 1-MCP remained viable 13 DAP, i.e. they reached the average grade of 3; while the STS-treated and control flowers have been already dried at this time, reaching grade 3 already between 4-7 DAP. Grade 3 was used as indicator of spikelet half-life even though at this point it was already late to use flowers for physiological studies due to pronounced senescence. On the other hand, in non-pollinated flowers, viability of the STS and 1-MCP treated flowers was insignificant.

Figure 9 - Effects of Ethylene inhibitors on spikelets "vase life" 10 days after culturing. Left: First four samples represent non-pollinated STS-treated spikelets with control; whereas additional four are pollinated STS-treated spikelets. Right: Non- pollinated-1-MCP treated spikelet and non-pollinated control, and 1-MCP-treated spikelets 1 and 2 DAP respectively, with the control.

Abscission, the natural detachment of plant organs (fruitlets), was more pronounced in pollinated flowers as compared to non-pollination control, and 1-MCP treatment reduced abscission more efficiently than STS (Figure 10c and 10d). On the other hand, with regard to senescence, no difference was observed in pollinated flowers versus the non-pollination control. Both anti-ethylene treatments extended "vase life" of the flowers and spikelets, showing different effects on particular physiological parameters (Figure 10). The flowers were healthier, less flowers had dropped 3-10 DAP and lower fungal contamination was observed (data not shown). However, overall, we can report that flowers treated with 1-MCP had vase-life of 13 days, whereas pollinated and non-pollinaed STS-treated spikelets were deteriorated after 6 or 12 days respectively. Neither of these treatments was sufficient to maintain in vitro system long enough and allow us to focus on fruitlet development.

Figure 10 – Effect of 1-MCP and STS on viability (a,b), flower abscission (c,d) and spikelet browning (e,f) of pollinated (a,c,e) and non- pollinated Canary palm spikelets (b,d,f) in vitro. Spikelets were graded on a five-point scale, 3, 10 and 13 days after cutting the spikelets (5 – highest viability, 0 is lowest i.e. highest contamination). Experiment was performed in four replicates of single spikelet sections. Means ± standard errors are significantly different (P≤1.15) according to the Tukey-Kramer test.

In order to improve "vase life" of 'Medjoul' flowers in vitro, we tried to culture larger sections of inflorescences instead of single spikelet sections. These were pollinated and exposed to four alternating temperature regimes (Figure 11). Pollination had no significant effect on tested physiological parameters. However, the temperature conditions greatly affected vase life of the flowers (Figure 12), as well as their fungal contamination (data not shown). Senescence and overall inflorescence deterioration were first reported only 6 days after setup at highest temperatures (34/28˚C). On the other hand, deterioration was slowest in inflorescences exposed to lowest temperature treatment (16/10˚C) which had longest vase life of approximately 15 days.

Figure 11 - Pollinated and non-pollinated inflorescences of 'Medjoul' exposed to four temperature regimes 10 days after setup, in three biological replicates per treatment.

Figure 12 – Effect of four temperature regimes on pollinated and non-pollinated inflorescences of 'Medjoul' in vitro. Bunches were graded for carpel health, browning and for fruitlet drop using three replicates per treatment, on a five-point scale (e.g. 5 – being most healthy, whereas 0 – the least). Bars represent standard errors.

4.2.2. Effect of temperature regimes on pollination and fertilization Effects of temperature regimes on pollen germination and pollen tube elongation in artificial media in vitro Pollen grains were germinated in vitro at different constant temperatures, and pollen tube length was measured after 3, 6 and 9 hours respectively (Figure 13).

Figure 13 - Pollen tube length of 'Medjoul' 9 hours after incubation at 4 constant temperature regimes. Bars represent 51 µm. Pollen germination in vitro was strongly influenced by temperature. At 15°C pollen growth rate was slower and pollen tube elongation was retarded as compared to those at 20-30°C (Figure 14). Eventually, the highest pollen tube length was recorded at 25°C suggesting that this temperature may be optimal for pollen germination and tube elongation of cultivar 'Medjoul'.

Figure 14 - Pollen tube length (µm) of 'Medjoul' in vitro in the dark under four constant temperature treatments measured after 3, 6 and 9 hours respectively. Already 3 hours after incubation, significant difference in length was observed between the lowest temperature treatment on one hand, and the remaining three on the other. This trend continued later on during the following 3 hours, clearly distinguishing pollen tube growth rate in three groups: low rate (15°C), medium rate (20 and 30°C) and high growth rate (25°C) (Figure 13). No significant difference was observed when germination was performed in the light or in the dark treatment (data not shown). These results are in accordance with those previously obtained by Bernstein in 2004.

Effect of temperature on pollen germination on the stigma in vitro Pollen grain germination and pollen tube elongation in stigmas and the upper part of the carpel were evaluated following pollination and in vitro culturing of spikelet sections (Figure 15). Stigmas were separated, stained by aniline blue and visualized by a fluorescence microscope. At 16 hours AP, pollen germination was observed under all temperature treatments. However, at 3- and 7 DAP germination was low and inconsistent. In the preliminary experiment, pollen tube elongation was observed under all temperature regimes already in the first day after pollination. The highest pollen germination rate was observed at 30˚C, differing significantly to that at 25˚C and 20˚C (Table 7). Even at 15˚C moderate germination on stigmas was observed. However, pollen tube elongation and penetration to the upper part of the carpel was much slower at 15˚C, as compared to higher temperatures. At 30˚C temperature, a slight non-significant decrease was recorded between 1 and 7 days from pollination.

Figure 15 - Pollen germination on 'Medjoul' stigmas in vitro under 4 constant temperatures visualized using fluorescence microscopy. Bar represents 50 µm.

Table 7 - Effects of four temperatures on pollen tube elongation in isolated 'Medjoul' stigma sections in vitro. Pollen germination on the stigma was estimated on a five- point scale, where 0 – no germination; 4 – high germination. Four flowers were used per temperature treatment i.e. twelve stigmas. Statistical analysis included samples from different temperature and DAPs. Means are significantly different (P≤0.05) according to the Tukey-Kramer HSD test. *DAP- days after pollination.

Temperature, 16 hours AP 3 DAP 7 DAP day/night 15˚C 1.95 ± 0.29 bcd 1.45 ± 0.29 c 1.62 ± 0.29 d 20˚C 1.37 ± 0.29 d 1.75 ± 0.29 bcd 1.68 ± 0.36 bcd 25˚C 1.5 ± 0.29 d 1.91 ± 0.29 bcd 1.35 ± 0.38 d 30˚C 3.41 ± 0.29 a 3.08 ± 0.29 ab 3.00 ± 0.29 abc

4.2.3. Effects of temperature regimes on fertilization and fruit set in "modular phytotrons" - in vivo Due to germination inconsistency in the in vitro assay, as well as the inability to support "vase-life" of cut inflorescences long enough to study fruit development, we attempted to induce controlled temperature on the bunches using special units we called "modular phytotrons", and study pollen germination and fertilization on bunch on the trees in the orchard in vivo (Figure 2). 33

Characterization of the modular phytotrons Following pollination, "modular phytotrons" were installed on the trees around individual pollinated inflorescences and sealed during the period of 14.03- 22.04.2013 (40 days) and 18.03-01.04.2014 (14 days). After removing the units, further fruitlet development was followed under external weather conditions. The setup and maintenance of the "modular phytotrons" was done by Avi Sadowsky and the team of the Southern Arava R & D. Temperature variation inside the "modular phytotrons" were recorded during the season of 2013 (Figure 16). In general, the units induced different temperature regimes. However, while the high temperature units operated almost as planned, those of the medium and lower temperatures did not (Figure16 B-C), Variation in the low temperature units was much higher as compared to that in high temperature units (Figure 16 A-C), and during very warm days could not keep the required temperatures. Still, the two units more successful in reducing the temperatures had significantly lower temperatures than the other treatments (Figure 16 D).

Effects of temperature regimes on pollen germination on stigma in vivo Pollen germination on stigmas was reported under all temperature regimes (Figure 17). However, in the cool treatment (20/8°C) pollen germination was not detected at 16 hours after pollination and was also delayed at 3 DAP, as compared with the medium (25/12°C), warm treatment (32/18°C) and the non-controlled bunches (Figure 18). The highest germination and pollen tube elongation was observed in the warm treatment, followed by the medium, control and the cool treatment. At 7 DAP there was no difference in pollen tube growth between the treatments, suggesting that even in cool temperatures pollen grains can germinate on the stigma.

40.0 Average Temperatures and Std Dev in high Temperature Units 40.0 Average Temperatures and Std Dev in MediumTemperature Units A B 35.0 35.0

30.0 30.0

25.0 25.0

20.0 20.0

15.0 15.0

10.0 10.0

5.0 5.0 time 5:00 PM 5:00 PM 6:00 PM 6:00 PM 6:00 PM 7:00 PM 7:00 PM 7:00 PM time 5:00 PM 5:00 PM 6:00 PM 6:00 PM 6:00 PM 7:00 PM 7:00 PM 7:00 PM date 21/3/13 25/3/13 29/3/13 2/4/13 6/4/13 10/4/13 14/4/13 18/4/13 date 21/3/13 25/3/13 29/3/13 2/4/13 6/4/13 10/4/13 14/4/13 18/4/13

40.0 Average Average Temperatures and Std Dev in LowTemperature Units 40 C Average Temperatures and Std Dev in Low Temperature Units D Average Temperatures in Low Temperature Units 35.0 35 4 9

30.0 30

25.0 25

20.0 20

15.0 15

10.0 10

5.0 5 time 5:00 PM 5:00 PM 6:00 PM 6:00 PM 6:00 PM 7:00 PM 7:00 PM 7:00 PM time 5:00 PM 5:00 PM 6:00 PM 6:00 PM 6:00 PM 7:00 PM 7:00 PM 7:00 PM date 21/3/13 25/3/13 29/3/13 2/4/13 6/4/13 10/4/13 14/4/13 18/4/13 date 21/3/13 25/3/13 29/3/13 2/4/13 6/4/13 10/4/13 14/4/13 18/4/13

Figure 16 - Temperature comparison in high temperature units (A), medium temperature units (B) and low temperature units (C). Data (collected approximately every minute) was averaged per hour. The black shading represents the standard deviation between the four units. The temperatures in the two "low temperature" units that were more successful in preserving low temperatures are presented in (D).

Figure 17 - Effects of three temperature regimes (warm – 32/18°C, medium – 25/12°C and cool – 20/8°C) on pollen germination on the stigma in bunches pollinated on the 'Medjoul' trees in modular phytotrons in vivo 16 hours, 3 and 7 DAP (2013), visualized using fluorescence microscopy.

Figure 18 - Effects of three temperature treatments (warm – 32/18°C, medium – 25/12°C and cool – 20/8°C) on pollen germination on 'Medjoul' stigmas in vivo (modular phytotrons) 16 hours, 3 and 7 DAP (2013) examining four flowers per time point.

Effects of temperature regimes in vivo on fruitlet development of 'Medjoul' The temperature treatments affected growth of fruitlets. Representative fruitlets on spikelet section from each unit 5 WAP are presented in Figure 19 (2013). The fruitlets were much bigger under warmer condition (Table 8, Table 9. Figure 20). Even though variation from the required temperature was observed in the units (see above), the fruitlets in all four repeats seems equally affected. The fruitlets were smaller in the four cool treatments and large in the four warm treatments. Moreover, a distinctive difference in colour development was Figure 19 'Medjoul' fruitlets 5 weeks observed. However, temperature did following pollination in temperature not affect the spikelet elongation and controlled units (2013). the distances between the fruitlets on the spikelets did not vary significantly (Table 8).

Table 8 – Variation in fruitlet weight of 'Medjoul' 5 WAP (2013) in temperature controlled units. Means are significantly different (P≤0.05) according to the Tukey-Kramer HSD test. Fruitlet per Single fruitlet Fruitlet weight per Treatment Units cm spikelet weight (g) cm spikelet (g) (means) (means) (means) Control 4 1.5 1.89 B 2.84 B Warm 4 1.6 3.12 A 4.99 A Medium 4 1.9 1.22 BC 2.20 BC Cold 4 1.5 9.1 C 1.38 C *Connecting Letters Report refers both to the single fruitlet weight and fruitlet weight per cm spikelet.

Table 9 - Effect of different temperature treatments in vivo on fruitlet weight of 'Medjoul' 9 WAP in the season of 2013 and 10 WAP in 2014 respectively. Means are significantly different (P≤0.05) according to the Tukey-Kramer HSD test. Single fruitlet weight (g) Single fruitlet weight (g) Treatments Means Means ± Std. Errors (2013) ± Std. Errors (2014) Control 2.98 ± 0.12 A 4.58 ± 0.13 A Warm 3.76 ± 0.14 B 7.28 ± 0.34 B Medium 1.78 ± 0.12 C 4.39 ± 0.10 A Cool 1.48 ± 0.14 C 2.10 ± 0.08 C

Figure 20 - Effect of three temperature treatments in vivo on 'Medjoul' fruitlet size 9 WAP (2014). The percentage of normal, parthenocarpic, aborted and non-developed fruitlets was measured ten weeks following pollination and incubation under different temperatures in vivo (2013). Significant differences were found between treatments in all tested parameters (Figure 21). Development of normal fruits was enhanced in the warm treatment as compared to the medium and cool.

A B A, B A, B

A, B B A A, B

B B A, B A

A, B A B B

Figure 21 - Percentage of normal, parthenocarpic, aborted and non-developed fruits of 'Medjoul', in response to pollination and growth under different temperatures in vivo, 10 WAP in 2013. Fruitlets from middle parts of eight spikelets taken from two temperature units of the same treatment were used for evaluation. Means are significantly different (P≤1.15) according to the Tukey- Kramer HSD test.

The percentage of parthenocarpic fruits was significantly higher under cool

treatment in 2013, as compared to the warm treatment and the control (Figure 21). In the following season (2014), the experiment was repeated, and once again we confirmed that parthenocarpic fruit formation is enhanced by the cool temperature treatment (Figure 22).

Figure 22 - Percentage of normal, parthenocarpic, aborted and non- developed 'Medjoul' fruits, in response to pollination and growth under different temperatures in vivo, 10 WAP in 2014. Fruitlets from middle parts of eight spikelets taken from two temperature units of the same treatment were used for evaluation. Means are significantly different (P≤1.15) according to the Tukey-Kramer HSD test.

Histological characterization of effects of temperatures on fruitlet development in vivo Histological cross sections of pollinated 'Medjoul' dates showed that the three temperature treatments in vivo affected the rate of early fruitlet development (Figure 23). The rate of overall fruitlet development was highest in the warm unit, followed by the medium and the cool unit. In addition, carpel abortion was detected in the warm treatment, already 7 DAP, as opposed to the cool unit, where abortion was still ongoing at 38 DAP. Both carpel size and ovule size were greatly affected by the "modular phytotron" temperature treatments (Table 10, 2013).

Figure 23 - Effects of three temperature regimes (warm – 32/18°C, medium – 25/12°C and cool – 20/8°C) on early development of pollinated flowers / fruitlets of 'Medjoul' in modular phytotrons in vivo (2013). Bars represent 1000 µm.

All of the three treatments greatly affected the size of the leading carpels and ovules, at 24 and 38 DAP, and 17 and 24 DAP respectively. One week following removal of the units (46 DAP), carpels differed in size between the warm unit on one hand, and medium and cool unit on the other.

Table 10 - Effects of three alternating temperatures in vivo ("Modular phytotron") on 2 carpel and ovule size (mm ) of pollinated ‘Medjoul’ at five points after pollination. Values represent Means ± Std Errors of the leading carpels in 8 replicates. Treatment 7 DAP 17 DAP 24 DAP 38 DAP 46 DAP

Warm 1.93 ± 0.05 A 9.98 ± 0.66 A 16.53 ± 0.79 A 56.14 ± 2.59 A 68.11 ± 3.13 A

Medium 1.80 ± 0.01 A 3.36 ± 0.30 B 5.66 ± 0.69 B 16.12 ± 0.85 B 27.98 ± 2.35 B size

Carpel Carpel Cool 1.41 ± 0.05 B 2.01 ± 0.30 B 2.66 ± 0.27 C 8.41 ± 1.40 C 26.68 ± 1.05 B

Warm 0.14 ± 0.00 A 0.47 ± 0.01 A 0.62 ± 0.04 A 2.82 ± 0.20 A /

Medium 0.14 ± 0.00 A 0.25 ± 0.02 B 0.31 ± 0.02 B 0.79 ± 0.03 B / size Ovule Ovule Cool 0.10 ± 0.00 B 0.14 ± 0.02 C 0.19 ± 0.00 C 0.46 ± 0.05 B / *At 46 DAP modular phytotrons were already removed from inflorescences.

4.3. Expression analysis of genes involved in hormonal regulation during early fruit development of cultivars 'Medjoul' and 'Barhee' High-throughput gene expression analysis of pollinated and non-pollinated flowers was performed in two date cultivars 'Medjoul' and 'Barhee', at four stages of early fruit development. Using the recently published date palm transcriptome data (Al-Mssallem, 2013), we selected ninety six candidate genes/transcripts, associated with metabolism and signaling of main plant hormones auxin, gibberellin, cytokinin, abscisic acid, and ethylene, as well as with the processes of plant senescence and programmed cell death. Further data mining and literature search were based on the published date transcriptome, KEGG and NCBI databases. Basic local alignment search tool (BLAST) was used to specify the identity and similarity of the sequences, obtained from the date transcriptome and matching them with annotated genes/proteins deposited in the NCBI database. With regard to different paralogs from the same gene family, we included sequences with both high and low relative expression, according to the transcriptome. All the selected sequences were aligned in 5'-3' direction by checking open reading frames. Specific primers were designed for the selected genes (Appendix). Four constitutively expressed genes were used as references. The analysis was performed with Microfluidic Dynamic Array (BioMark, Fluidigm). The initial analysis, filtering and cleaning of the obtained data resulted in elimination of the sequences of ethylene response transcription factor (ERTF), gibberellic acid insensitive dwarf (GID2) and Bax inhibitor (BI), due to very low expression. Moreover, two replicates of 'Medjoul' (stage 0, before pollination, and stage of two WAP) were disregarded as their expression was low in the reaction. Actin was selected as a reference gene, due to its highest consistency throughout the developmental stages. Gene expression was analyzed using the Fluidigm software, and the obtained heat map of EvaGreen Ct values is presented in Figure 24. This map presents a large overview of the selected candidate genes Ct values and relative expression for all the selected transcripts.

Figure 24 - Heat map of EvaGreen Ct values of pollinated and non-pollinated flowers of 'Barhee' (left quadrant) and 'Medjoul' (right quadrant) during the first four weeks of fruit development, obtained using the Fluidigm software. Heat map represents a total of 72 cDNA samples (listed horizontally), and gene names (listed vertically). Bright yellow colour (lower Ct value) indicates high expression, whereas purple and blue (high Ct value) indicate low expression. The acquired data was used to calculate the ΔΔCT value - the fold change in each gene expression, normalized to reference gene actin and to the non- pollinated control ('Medjoul'). Furthermore, in order to acquire relative expression, data was processed using the 2-ΔΔCT method. Analysis of variance was performed, and genes were clustered according to their expression patterns and plant samples (Figure 25). The presented heat map provides an overview of the selected candidate genes during the first four WAP. The data will serve as a basis for further bioinformatics and PCR analysis of the genes of interest. Our preliminary results suggest differential expression patterns among the cultivars and pollination treatments, as well as among different developmental stages.

Figure 25 - Hierarchical cluster analysis of genes expressed in pollinated and non-pollinated flowers of cv. 'Barhee' and 'Medjoul' during four developmental stages after pollination. Map represents ΔΔCT values: low expression is presented in red; high expression in green. List of genes is displayed horizontally; developmental stages (1-4 weeks after pollination) of two cultivars are displayed vertically.

Differential expression with respect to pollination. Four weeks after pollination (4 WAP), abundance of transcripts of most of the selected categories was recorded in non-pollinated flowers of 'Medjoul', as opposed to the pollinated samples. At this time point, with respect to pollination, higher gene expression was reported in 'Medjoul', in comparison to 'Barhee', e.g., transcript for GA-2 oxidase and abscisic acid stress ripening protein homologue (ASR2). The examples of differential gene expression with respect to pollination are presented in Table 11.

Table 11 – Differential expression of selected genes between non-pollinated and pollinated flowers of 'Medjoul', four weeks after pollination.

Gene group Specific transcript Higher expression DELLA proteins GA-2 oxidase In non-pollinated samples Gibberellin insensitive dwarf 1

Gibberellins GA repressed protein auxin repressed protein – ARP

Auxin response factor - ARF (8;11;16;18-like;27) In non-pollinated samples

Auxins auxin transport protein auxin independent growth promoter

CK DH 11

IPT9 CYP84A In non-pollinated samples

CYP71A1 Cytokinins CK glucosyl-transferase 1

ABA 8 hydroxylase In non-pollinated samples

ABA ABA stress ripening protein Differences in the expression of genes involved in AUX, GA and ABA metabolism were recorded between pollinated and non-pollinated flowers of 'Medjoul' already at 1 WAP. Later, at four WAP in 'Medjoul', we observed a trend of over-representation of GA transcripts in pollinated flowers, associated with upregulation of GID1 (Figure 26 A). In 'Barhee', main differences were observed in GA transcript levels, such as in DELLA transcript.

Cultivar-specific gene expression was observed between 'Barhee' and 'Medjoul' already in the first WAP, (Figure 25, e.g. transcripts of IPT, ARF and CK DH4). As an example, studied cultivars significantly varied in the expression levels of gibberellin stimulated transcript like (GAST-like, Figure 26 B), IAA-amido synthetase (Figure 26 C) and cytokinin-related isopenthenyl transferase 9 transcript (Figure 26 D), showing variations both regarding cultivars and pollination.

5 A 4 B D B CD 3 AB 1 CD CD AB CD AB AB AB AB -2 C BC BC 1 AB AB AB A AB -5 A ABC AB A -1 A AB AB

Relative expression Relative -8

Relative expression Relative AB A A A A -3 -11 A A 0 1 2 3 4 0 1 2 3 4 Weeks after pollination Weeks after pollination 9 10 F C EF 8 D 5 CDEF CDE EF G DEF 6 G 1 BC CD FG CDE DEFG EFG FG CD A 4 FG -3 A DEFG 2 BCDEF ABCDE CDEFG A A A AB ABC AB

Relative expression Relative -7 AB expression Relative 0 ABCD A -11 -2 A 0 1 2 3 4 0 1 2 3 4 Weeks after pollination Weeks after pollination

Figure 26 Differential expressions of selected genes in 'Medjoul' and 'Barhee' during four weeks of early fruit development. Pollinated and non-pollinated flowers were analyzed in both cultivars. A) gibberellin insensitive dwarf 1 (GID1), B) gibberellin associated transcript-like (GAST-like), C) IAA-amido synthetase and D) isopenthenyl transferase 9 (IPT9).

Expression dynamics during early fruit development. Our preliminary results suggest that most of the selected genes showed the increasing trend throughout the studied developmental stages, and expression was higher in the fourth (latest) developmental stage as compared to the first three stages in the two cultivars (e.g. ACC-synthase). In general, at four weeks after anthesis, higher expression of most candidate genes was observed in non- pollinated flowers as compared to pollinated ones (Figure 24). However, some genes have high initial expression (CK GT) that declines at two and three WAP, and show upregulation at four WAP in both cultivars, regardless of pollination treatment. 45

5. DISCUSSION 5.1. Morpho-anatomical traits of reproductive system and fruit set in 'Medjoul' and 'Barhee' The three-carpellate flower is the most common developmental pattern in Arecaceae (Uhl and Moore, 1971). Similar to other common cultivars of date palm, such as 'Deglet Noor' (Long, 1943), or 'Lulu' (Awad, 2010), at anthesis, flowers of the two studied cultivars 'Medjoul' and 'Barhee' comprise three equally developed, separated carpels, of which only one develops into a single fruit. However, when pollination is prevented, 'Medjoul' and 'Barhee' differed in number of carpels developing into fruit, as well as in rate of carpel development, carpel size, and in fruit shedding ratio. Similar to the date palm, examples of three-carpelate gynoecia were described in other palm species - Corypha umbraculifera, Sabal palmetto (Rudall, 2011), as well as Elaeis guineensis (Hartley, 1988). On the other hand, in the Coryphoid palm Thrinax excels, gynoecium comprises a large single carpel, while four-carpelate gynoecia exist in Latania palm. Furthermore, some palm species possess larger multicarpelate gynoecia e.g. Orbignya speciosa, usually with 5-6 carpels, or Phytelephas macrocarpa (Tagua) comprising 7-10 carpels (Uhl and Moore, 1971). In general, fertilization patterns in dates resemble those of olive (Olea europea), in which, only one ovule of the two-carpelate gynoecium bears normal single-seeded fruit following carpel degeneration (King, 1938). Similar to 'Medjoul' and 'Barhee', in most palms, the fruit is developing from a single carpel, and the process of degeneration of two of the three additional carpels is common. However, variation occurs, for instance, Phytelephas sp. usually develops infructescences (the ensemble of multiple fruits derived from the ovaries of an inflorescence), each containing numerous fruits (Bernal and Galeano, 1993). Effect of pollination and pollen quality on ovary and fruit development have been reported in numerous plant species. For example, muskmelon ovaries doubled in size within 48 h after pollination, similar processes were observed in Brodiaea and carnation (O'Neill, 1997). In both studied palm cultivars

normal seed-bearing fruits develop upon successful pollination. In 'Barhee', fruitlet formation was slightly faster. Following pollination, the morphological traits of the developing fruits appear to be similar to those of other date cultivars, such as 'Deglet Noor', 'Khadrawy' and 'Derry' (Haas and Bliss, 1935; Long, 1943; Reuveni, 1986;). On the other hand, two developmental patterns were observed in parthenocarpic fruit formation. When pollination is prevented, the non-pollinated flowers of 'Medjoul' form singlet partenocapric fruits with high ratio of fruit shedding. In comparison, 'Barhee' produced mainly triplets, and fruit shedding is relatively low. Zaid and Al-Kaabi (2007) reported that ‘Barhee’ trees originated from tissue culture were more susceptible to pollination failure and they produced more abnormal fruits than ‘Medjool’. These in vitro generated somaclonal variants of 'Barhee', 'Hallas' and other date palm cultivars, tend to form triplet parthenocarpic fruitlets. Sometimes, multicarpelate fruit formation in dates was observed (Al-Wasel, 2001; Awad, 2007, Cohen et al., 2004). The additional carpels were probably developed by homeotic transformation from the staminoid primordia. Triplet and multicarpelate parthenocarpic fruits are also common in somaclonal variants obtained from in vitro propagation of oil palm (Adam et a., 2005; Corley et al., 1986). Using histological data, we defined several 'developmental checkpoints', i.e., critical stages of carpel and fruit development: (1) following pollination, designation of a "leading carpel" forming the fruit, (2) degeneration vs. continuous development of the two additional carpels, and (3) (parthenocarpic) fruitlet shedding. These processes are similar in the development of the normal, pollinated fruitlet, but differ between the cultivars in developing parthenocarpic fruits. For the first time, we provide evidence that, similar to 'Barhee' (Cohen et al., 2004), pollen germination in ‘Medjoul’ occurrs on stigmas of all carpels, suggesting that all three carpels are receptible and ready for fertilization (Figure 17). These results suggest that the “decision making” checkpoint of carpel abortion appears at post-fertilization stage and the first fertilized carpel may inhibit the developments of two other carpels. For both cultivars, we confirmed that processes of ovule degeneration and carpel reduction occur 47

earlier than we can record from the external morphological observations. Under our experimental conditions, first histological evidence for ovule degeneration in pollinaned 'Barhee' was recorded at 14 DAP, following by pollinated 'Medjoul', in which similar developmental changes were observed only after 21 DAP. In another palm species Geonoma interrupta (Arecaceae) one of the three carpels is completely developed and dominant already at anthesis, before pollination, and fruit will be formed only from this carpel (pseudomonomerous gynoecium) (Stauffer et al., 2002). The gynoecium development of G. interrupta was divided into four stages. In stage II, the sterile carpels already develop unequally, and in stage III the fertile carpel overtops the sterile ones and is the most conspicuous organ of the gynoecium (Stauffer et al., 2002). In contrary, in date palm, histological analysis as well as in situ expression of flower development genes did not detect any differences in the three developing carpels (Daher et al., 2010). Pollination of 'Medjoul' flowers significantly accelerates carpel degeneration, as compared to non-pollinated flowers (Table 4). Carpels of pollinated flowers (only the one developing into fruit) were significantly larger in size, as compared to the non-pollinated flowers, already at 27 DAP (Table 2 and 3). We observed that in date palm, pollination provides a major cue for 'normal' fruit development, acting as the switch for carpel degeneration and single seed-bearing fruit development. When impaired, this process results in parthenocarpic fruit development.

5.2. Temperature affects pollen germination, fertilization and fruit-set processes Temperature ranges and optima for pollen germination are known to vary among species (Farlow et al., 1979; Kuo et al., 1981; Pearson, 1932). Pacini et al. (1997) reported that pollen of the Meditteranean dwarf fan palm Chamaerops humilis, remained viable for an exceptionally long time as compared to Festuca arundinacea, Mercurialis annua, Acanthus mollis, Cucurbita pepo and Spartium junceum. It was also suggested that pollen of

this palm, like that of other palms, is resistant to thermal (Al-Helal et al., 1988) and water stresses (Bassani et al., 1994). In our experiments, highest pollen germination on stigmas of 'Medjoul' in vitro was observed at 30°C, whereas highest pollen tube elongation rate in a solution in vitro was observed at 25°C, thus suggesting 25-30°C as optimal temperature range (Figure 14 and 18). These results are in agreement with Reuveni et al. (1986) and Bernstein (2004) that show fastest germination and pollen tube elongation in styles at 25 and 28°C. In other species, optimum temperatures for in vitro pollen germination varied from 28°C in cotton (Burke et al 2004), to 23°C in peach (Weinbaum et al., 1984) and 22°C in Arabidopsis (Boavida et al., 2007). In contrast, in almond, highest germination was reported at 16°C (Weinbaum et al, 1984). Since date is highly adaptive to high temperatures and can stand temperatures up to 50°C, pollination and tube elongation require higher temperatures. Following to pollination and during fruit ripening optimal reported temperature ranges from 21°C to 27°C (Zaid and De Wet, 2002b). While optima of pollen germination lays between 25 and 30°C, general range of suitable temperatures in orchard are much wider. Thus, even at 15˚C moderate germination of ~ 50 % both in vitro and on date stigmas was observed. However, pollen tube elongation and penetration to the upper part of the carpel was much slower at 15˚C, as compared to higher temperatures, making further germination into the carpel and ovule and fertilization uncertain. Similarly, in avocado pollen tubes failed to reach the ovary at low temperatures (17/12°C) (Sedgley, 1977). Under our experimental conditions, in vitro assay of isolated spikelets was interrupted by early flower senescence, and we could not follow fertilization and fruit setting. However, the increase in parthenocarpic fruitlets in lower temperature in planta experiments suggest reduced fertilization rate. Although no morphological damage was observed within the first days after pollen germination, further in vitro growth of pollen tubes on stigmas was restricted and fertilization did not occur under any temperature regime. In vitro cultured 'Medjuol' flowers wilt relatively fast either due to displacing from the whole plant and shipment to the laboratory, or due to short "vase life" and 49

intense senescence and contamination processes. In a similar experiment, performed with isolated spikelets of 'Barhee', pollen tube elongation was detected within the carpel and up to the ovule within 3-7 days after pollination (Cohen et al., 2004). Therefore we propose that the 'Medjoul' flowers under in vitro conditions possess particularly short "vase life". Beale and Johnson (2013) report that cross talk between the male and female gametophyte is essential for early pollen tube growth and guidance in several species, both monocots and dicots. We argue that under our experimental conditions in vitro the interaction between the male and female counterpart can be disturbed, in addition to pollen germination per se. The reason for such “broken” interaction might be the hormonal imbalance in cut female spikelets through overall senescence. Therefore, pollen tube attractants secreted by the female cells, as well as the cross talk may had been negatively affected. Fast flower senescence might be also caused by ethylene emission, hormonal imbalance or other factors. In spite of our efforts to extend in vitro "vase life” of cut spikelets by using fungicide (Marpan) and anti-ethylene compounds (STS, 1-MCP), flower senescence was faster than fruitlet development, and even if pollination had been successful, we would not have been able to follow the process of fertilization and fruitlet development. In our in planta experiments pollen germination occurred under all temperature regimes, but germination kinetics was clearly affected by temperature range. High temperatures increased pollen germination and tube growth rate in the stigma, reducing the time needed to reach the ovule at the base of the carpel. Similar evidence of the effect of increasing temperature on better pollen tube growth was reported in a range of herbaceous and woody species (Hedhly, 2005). Relatively low temperatures (20/8°C) retarded pollen germination, which was not detected at 16 hours after pollination, and delayed at 3 DAP, as compared with higher temperatures. Only after 7 days, pollen germination was observed at cool temperatures at the same percentage as in other temperature treatments. Even though we showed that pollen germination per se was not damaged under cool temperatures, the major limiting factor for successful fertilization 51

can be stigma and ovule receptivity. For example, in sweet cherry, Hedhly et al. (2003) reported that an increase in the average temperature of as little as 2.8°C was enough to negatively affect stigma receptivity. In addition, as high temperatures accelerate and low temperatures retard pollen tube growth rate, it would be expected that fertilization and, hence, fruit set would be enhanced by high temperatures and reduced by low temperatures during bloom (Sanzol, 2000). However, this is not always the case. Although high temperatures during flowering accelerate pollen tube growth, they also enhance maturation and early senescences and degeneration of the stigma (Egea et al., 1991; Burgos et al., 1991) and ovule (Stosser and Anvari, 1982; Postweiler et al., 1985; Cerovic and Ruzic, 1992), and, therefore, fertilization will not succeed. In date palm, the length of the receptivity period of the pistillate flowers varies between cultivars, and is usually up to 8 or 10 days (Albert, 1930; Pereau- le Roy, 1958). ‘Medjoul’ flowers, however, have a rather long flower receptability reaching up to 14 days (Bernstein, 2004). Beyond these limits, fertilization fails and the percentage of parthenocarpic fruits increases to 40 % (Zaid and De Wet, 2002). Moreover, in some cultivars, such as 'Deglet Noor', female flowers do not become receptive for possibly 7 days or more after the spathe cracks (Ream and Furr, 1969). Taken together, fruit-set in dates is rather complex and sensitive to the internal and external conditions. Therefore, as in many species, the main question with respect to fruit-set is whether the equilibrium between pollen tube growth rate and ovule receptivity/degeneration is reached at the given temperature (Sanzol, 2000). Since the temperature conditions in the "modular phytotoron" units were not constant but changed in a sinusoidal pattern during the day (Figure 16), we argue that in the lower temperature treatments, active pollen growth had probably occurred mainly at the hours of highest temperature of the day. We suggest that under lower temperatures a considerable fraction of the pollen tubes did not reach the ovule, thus preventing efficient fertilization. The increased occurrence of parthenocarpic fruits under lower temperatures (20/8°C) implies that the reduced elongation rate of pollen tubes eliminated efficient fertilization. It should be noted that in the experiment, large amount 51

of pollen was provided. Therefore, fertilization should lead to development of a normal fruit, as fertilization of even a single of the three ovules is sufficient for generation of a normal fruit. We speculate that if pollen was a limiting factor, much larger variations in normal fruit set versus parthenocarpic fruit would have been detected. In addition, our results regarding parthenocarpy are in accordance with findings in mango, which, under low temperatures (20/10°C), significantly increased the percentage of stenospermocarpic fruits (Sukhvibul et al., 2000). This fact might also explain reduced fruit setting and yields of dates occurring in commercial plantations under cooler conditions during early spring (Y. Cohen, personal observations). In planta experiments revealed differential effect of temperature regimes during pollination and early fruit development on the levels of normal fruit setting: higher temperatures significantly enhanced the formation of normal seed-bearing fruits. At the same time, ratio of parthenocarpic fruits during two consecutive seasons was significantly higher under cool temparatures, whereas under normal conditions (non-induced conditions) or under moderate temperatures, trees had much lower parthenocarpic fruit percentage. This may suggest that even though conditions below 20˚C reduce fertilization efficiency and favour parthenocarpic fruit development, high temperatures during the middle of the day might compensate for the lower extreme and prevent parthenocarpy. Similarly, in pear, parthenocarpic fruit development is enhanced by frost damage (Lewis 1942, Modlibowska 1945). A tendency towards small parthenocarpic fruits in tomato was observed under low (14 °C) temperature regimes (Adams, 2001; Nuez et al., 1986; Preil, 1973; Preil and Reimann-Philipp, 1969). Alternatively, parthenocarpy is enhanced by high temperatures in pommelo (Citrus grandis) (Susanto, 1990), as well as in wheat (at 36/31˚C) (Tashiro et al., 1990) and rice (39/34°C) (Tashiro et al., 1991). In tomato, however, parthenocarpic fruits develop under optimal (28/22°C), as well as high temperature treatments of 32/26°C (Sato, 2001). It seems that partenocarpy is enhanced by suboptimal (too low or too high) temperatures and might also be associated with additional environmental stresses.

Future research on parthenocarpic fruit development in date palm under various temperature, including shifting and combination of several temperature regimes (e.g., low temperature applied for pollen tube growth and fertilization followed by high temperatures during early fruit setting) will facilitate the optimization of temperature regime for each developmental stage. The histological analysis proved that the general developmental pattern of carpel and fruit development was not altered under different temperature treatments. However, overall rate of development and “decision making” checkpoint of carpel degeneration were greatly affected, indicating that cell division and elongation are promoted by higher temperatures. Furthermore, temperature treatments in planta affected colour, size, and weight of the fruitlets as well as overall rate of their development: fruitlets were much bigger under warmer condition both 5 and 10 weeks following pollination, whereas a distinct difference in colour was observed among the treatments 5 WAP. On the other hand, different treatments did not change the spikelet growth, most likely because elongation of the spikelet within the spathe was already terminated, and additional elongation occurs only at the very base of the spikelet and fruit bunch. Although in planta studying of whole trees in controlled temperature units is beneficial, it is rather challenging, since it is not possible to place the entire adult tree to standard rooms with controlled environments. Therefore, alternative techniques are required. For example, in evaluating effects of temperature regimes on pollination and stigma receptivity in peach, Hedhly et al. (2005) covered trees with polyethylene cages with regulated temperature regime. In addition, studying particular biological processes in large fruit trees often relies on the use of isolated plant organs/parts in vitro (Hedhly, 2005; Sukhvibul et al., 2000; Weinbaum et al., 1984). In the presented research, two systems were developed for the evaluation of the fertilization process in palms. In vitro assays on isolated inflorescences and in planta experiments in "modular phytotrones" complemented each other. Each employed system has specific advantages, as well as technical and biological limitations. The in vitro approach facilitates a direct study of the inflorescences at constant 53

temperatures under artificial conditions. However, major limitations in this approach are the short "vase life" of cut inflorescences, contamination, absence of leaves and hence disturbance of hormonal and environmental stimuli, as well as fast flower senescence, probably due to ethylene release in cut inflorescences. Nevertheless, this approach allows focusing on pollen germination, as well as on individual flowers and careful examination the stigmas and carpels in vitro. Our in planta study in controlled temperature units, actually presents a beneficial “modular phytotron” approach. In this case, the inflorescence remains the integral part of the whole tree, and its hormonal and nutritional balance is intact. Moreover, this approach allowed us to study flowers and fruitlets throughout development, much longer period than any in vitro assay could allow for. However, in these experiments, environmental conditions were modified only in the inflorescences, while temperature effects on the other plant organs were not modified. We are aware of the limitations of this approach: by enclosing inflorescences in environmental controlled units, the tree trunk, leaves and root systems are being exposed to outdoor temperatures and are not controlled. Hence, one of the drawbacks is the disregard of hormonal and other environmental signals such as light and humidity that affect the plant and can be transported from organ to organ.

5.3. Molecular analysis of genes involved in hormonal regulation during early fruit development of cultivars 'Medjoul' and 'Barhee' Plant hormones play a prominent role in fruit development of plants, especially in reproductive traits and fruit setting (Nitsch 1970, Ozga et al., 2003, De Jong et al., 2009, Perez-Amador et al., 2009). They are essential for successful completion of each developmental stage and progression of the developing fruit into the next stage. The abundance of certain hormones at specific stages of fruit development indicates a possible role for these hormones during that developmental stage (Srivastava and Handa, 2005). In tomato, as in many other species, levels of AUX- and GA- genes are upregulated in ovules after pollination, resulting in the activation of AUX and 54

GA response genes, which, in turn, will trigger fruit growth and development by regulating cell division and cell expansion (De Jong et al., 2009). GAs are effective in inducing parthenocarpy in apples (Hayashi et al., 1968), pears , stone fruits, including grape (Nagata, 1982), while AUX or CKs induce parthenocarpy in figs, kiwifruit and strawberry (Kato et al., 2000). Moreover, during fruit development of figs, following decline of endogenous levels of CK, GA and AUX, fruit growth predominantly occurs through cell enlargement; in addition, it has been demonstrated that ethylene promotes expansion of cells (Crane, 1969, Srivastava, 2005). Taken together, hormonal balance vary between different stages of fruit development, while the same hormone can play different functions at different stages (Ozga and Reinecke, 2003), In the presented research, a large number of genes of date palm, associated with hormonal regulation of the reproduction process, were analyzed, for the first time, with respect to early stages of fruit development. The preformed pioneer molecular analysis requires further bioinformatic analyses and PCR validation. However, the initial results already provide an insight into some of the regulatory hormonal processes occurring during early fruit development in date palms. As ripening of dates requires about 150 days, we used previously defined seven developmental phases (Al-Mssallem et al., 2013), subsequently merged into three stages (Zhang, 2012). We focused on early fruit development from anthesis to 45 DAP and collected plant samples for histological and molecular data in weekly intervals. It was shown that at early stages up to 30 DAP young fruits are hard and green and are characterized by high rate of cell multiplication. Later than 30 DAP, cell expansion increases, and accumulation of starch begins in the fruit cells (Zhang, 2012). Earliest stage of fruit development (0-15 DAP) is characterized by nine groups of genes that are expressed higher than those of other fruiting stages. These groups are involved in the molecular function of binding, catalytic activity, structural molecule activity, nucleic acid binding, transcription factor activity, transcription regulator activity, transporter activity, enzyme regulator activity, electron carrier activity and antioxidant activity. In biological process 55

category, both cellular processes and metabolic processes such as replication and repair, translation, and cell growth and death, etc. were expressed at the highest level in the earliest stage (Zhang et al., 2012). Similarly, we observed upregulation of genes associated with CK biosynthesis in earliest stages of fruit set and development in both cultivars. This fact may indicate high ratio of cell division, as shown by Zhang et al. (2012) in the F1 stage of date fruit development, as well as by Janssen et al. (2008) in apple. On the other hand, some genes coding for CK showed cultivar-specific gene expression, suggesting that biosynthesis of this hormone as well as the CK-related mitotic activity are regulated by a number of genes. Moreover, timing of CK expression might vary between cultivars, as observed in the histological results. Assuming high cytokinin activity in early fruit development, and expecting differential response to pollination of auxin and GA genes, we acquired and validated data on numerous genes involved in metabolism and signaling of these hormones during early fruit development. Indeed, the differential expression of auxin-, GA- and cytokinin-related genes with respect to pollination was found in both date palm cultivars. In addition, at 4 WAP upregulation of GA transcripts through upregulation of GID1 was found in pollinated flowers of 'Medjoul'. Similarly, the increase of GA levels in response to pollination was reported in citrus (Ben-Cheikh et al. 1997) and Arabidopsis (Gallego-Giraldo et al., 2014). Our preliminary results suggest that main groups of growth regulators might be involved in pollination, fertilization, fruit set and fruit development. Pollination and fertilization may be regulated by the cross-talk between AUX and GA. Similar to pea (Ozga and Reinecke, 2003) and tomato (De Jong et al., 2009), increasing AUX levels promote biosynthesis of GA, The initial fruit growth is associated with high mitotic activity, regulated by CK levels, while the following stages are characterized by an increase in ET, which may be involved in cell elongation and nutrient mobilization. Moreover, differential expression of GA- and AUX- related genes in pollinated and non-pollinated flowers might specify cultivar-specific developmental differences.

Future research can clarify differences in hormonal regulation of the reproductive processes in date palm. Morpho-physiological, combined with the transcriptome analysis, PCR validation of the selected genes involved in hormonal regulation, and biochemical analysis of plant hormones, will increase our understanding of the complex process of fruit development in dates. Taken together, this new information will be used for the optimization of fruit production of this interesting and useful crop. The presented research provides characterization of pollination, fertilization and early fruit development in date palm. In-depth histological analysis complemented with study on effects of temperature regime on reproductive process increased our understanding of fruit developmental physiology and its sensitivity to stress. Cultivar differences with respect to their reaction to different environmental conditions may serve as basis for improving protocols for pollination, fruit set and thinning.

References

Abd Alaal, A. F., Al Salih, K. K., Shabana, H., and Al Salihy, G. J. (1983). Production of seedless dates by application of growth regulators. Proceedings of the first symposium on the date palm in Saudi Arabia, 276-282. Adam, H., Jouannic, S., Escoute, J., Duval, Y., Verdeil, J.-L. and Tregear, J.W. (2005). Reproductive developmental complexity in the African oil palm (Elaeis guineensis, Arecaceae). American Journal of Botany, 92:1836-1852. Adams, S.R., Cockshull, K.E., Cave, C.R.J. (2001). Effect of temperature on the growth and development of tomato fruits. Annals of Botany, 88, 869–877. Al-Dous, E.K. (2011). De novo genome sequencing and comparative genomics of date palm (Phoenix dactlyfera). Nature Biotechnology 29 (6): 521-7. Al-Helal, A.A., Basalah, M.O., and Mohammed, S. (1988). Effect of storage and temperature on pollen germination and rate of pollen tube elongation of date palm (Phoenix dactilifera L.). Phyton 48: 119-122. Al-Kaabi, H.H., Zaid, A. and Ainsworth, C. (2007). Plant-off-types in tissue culture- derived date palm (Phoenix dactylifera L.) plants. Acta Horticulturae 736: 267- 281. Al-Mssallem, I.S. (2013). Genome sequence of date palm Phoenix dactylifera L. Nature Communications 4:2274. Al-Wasel, A.S. (2001). Field performance of somaclonal variants of tissue culture- derived date palm (Phoenix dactylifera L.). Plant Tissue Culture, 11:97-105. Awad, M.A. (2007). Fruit set failure in tissue culture-derived date palm trees (Phoenix dactylifera L.) cv. 'Nabt Saif' as affected by pollinator type and pollination density. Acta Horticulturae 736, 441-448. Awad, M. A. (2010). Pollination of date palm (Phoenix dactylifera L.) with pollen grains water suspension. Acta Horticulturae 882, 337-344. Barrow, S.C. (1998). A monograph of Phoenix L. (Palmae: Coryphoideae). Kew Bull. 53:513-575. Bassani, M., Pacini, E., and Franchi, G.G. (1994). Humidity stress responses in pollen of anemophilous and entomophilous species. Grana 33: 146-150. Beale, K. M. and Johnson M. A. (2013). Speed dating, rejection, and finding the perfect mate: advice from flowering plants. Current Opinion in Plant Biology 16:1- 8. Ben-Cheikh, W., Perez-Botella, J., Tadeo, F. R., Talon, M. and Primo-Millo, E. (1997). Pollination increases gibberellin levels in developing ovaries of seeded varieties of citrus. Plant Physiology 114, 557–564. Bernal, R. G. and Galeano, G. (1993). Tagua. In: Clay J. W. and Clement C. R. (ed.) Selected species and strategies to enhance income generation from Amazonian forests. FO: Misc/93/6 Working paper. Food and Agriculture Organization of the United nations, Rome, May 1993. 58

Bernestein, Z. (2004). The Date Palm. Israeli Fruit Board (In Hebrew), Tel Aviv. Boavida, L. C. and McCormick, S. (2007). Temperature as determinant factor for increased and reproducible in vitro pollen germination in Arabidopsis thaliana. The Plant Journal 52:570-582. Bourgis, F., Kilaru, A., Cao, X., Ngando-Ebongue, G., Drira, N., Ohlrogge, J.B. and Arondel, V., (2011). Comparative transcriptome and metabolite analysis of oil palm and date palm mesocarp that differ dramatically in carbon partitioning. 10.1073/pnas.1106502108. Burgos, L., Egea, J., and Dicenta, F., (1991). Effective pollination period in apricot (Prunus armeniaca L.) cultivars. Annals of Applied Biology, 119, 533-539. Burke, J. J., Velten, J. and Oliver, M. J. (2004). In vitro analysis of cotton pollen germination. Agronomy journal 96 (2): 359-368. Carimi, F., Zottini, M., Formentin, E., Terzi, M. and Lo Schiavo, F. (2003). Cytokinins: new apoptotic inducers in plants, Planta 216:413-421. Cerovic, R., and Ruzic R., (1992). Senescence of ovules at different temperatures and their effect on the behavior of pollen tubes in sour cherry. Scientia Horticulturae, 51, 321-327. Chao, C. T. and Krueger, R. R. (2007). The Date Palm (Phoenix dactylifera L.): Overview of Biology, Uses and Cultivation. Horticultural Science 42 (5), 1077- 1082. Cohen, Y., Korchinsky, R. and Tripler, E. (2004). Flower abnormalities cause abnormal fruit setting in tissue culture-propagated date palm (Phoenix dactylifera L.). Journal of Horticultural Science and Biotechnology 79 (6),1007-1013. Cohen, Y. and Glasner, B., (2014). Date palm status and perspective in Israel. In: J.M. Al-Khayri, Date palm genetic resources, cultivar assessment, cultivation practices and novel products. pp.1-35, Springer Science+Bussines Media. In Press. Corley, R.H.V., Lee, C.H., Law, I.M. and Wong, C.Y. (1986). Abnormal flower development in oil palm clones. Planter, 62 (723): 233-240. Crane, J. C. (1969). The role of hormones in fruit set and development. HortScience 4 (2): 108-111. Daher, A., Adam, H., Chabrillange, N., Collin, M., Mohamed, N., Tregear, J.W. and Aberlenc-Bertossi, F. (2010). Cell cycle arrest characterizes the transition from a bisexual floral bud to a unisexual flower in Phoenix dactylifera. Annals of Botany 106:255. De Jong, M., Mariani, C. and Vriezen, W. H. (2009). The role of auxin and gibberellin in tomato fruit set. Journal of Experimental Botany 60 (5):1523-1532. Dorcey, E., Urbez C., Blazquez, M.A., Carbonell, J. and Perez-Amador, M.A. (2009). Fertilization-dependent auxin response in ovules triggers fruit development through the modulation of gibberellin metabolism in Arabidopsis. The Plant Journal, 58(2):318-332. 59

Dransfield, J., Uhl, N.W., Asmussen, C.B., Baker, W.J., Harley, M.M. and Lewis, C.E. (2008). Genera palmarum: the evolution and classification of palms. Kew Publishing, Kew, UK. Eckardt, N.A. (2007). GA perception and signal transduction: molecular interactions of the GA receptor GID1 with GA and the DELLA protein SLR1 in rice. Plant Cell, 19:2095-2097. Egea, J., and Burgos, L. (1992). Effective pollination period as related to stigma receptivity in apricot. Scientia Horticulturae 52, 77-83. Fang, Y., Wu, H., Zhang, T., Yang, M., Yin, Y., Pan, L., Yu, X., Zhang, X., Hu, S., Al- Mssallem, I.S. and Yu, J. (2012). A complete sequence and transcriptomic analyses of Date Palm (Phoenix dactylifera L.) mitochondrial genome. PloS ONE 7(5): e37164. Farlow, P. J., Dyth, D.E. and Kruger, N. S. (1979). Effect of temperature on seed set and in vitro pollen germination in French beans (Phaseolus vulgaris), Australian Journal of Experimental Agriculture and Animan Husbandry. 19: 725-731. Frank, M. and Schmulling, T. (1999). Cytokinin cycles cells. Trends in Plant Science, 4:243-244. Fuentes, S., Ljung, K., Sorefan, K., Alvey, E., Harberd, N. P. and Østergaard, L. (2012). Fruit Growth in Arabidopsis Occurs via DELLA-Dependent and DELLA- Independent Gibberellin Responses. The Plant Cell, 24 (10): 3982-3996. Gallego-Giraldo, C., Hu, J., Urbez, C., Dolores Gomez, M., Sun, T. and Perez- Amador, M. A. (2014). Role of the gibberellin receptors GID during fruit-set in Arabidopsis. The Plant J79 (6): 1020-1032. Gil, G. F., Martin, G. C. and Griggs, W. H. (1972). Fruit set and development in pear: Extractable endogenous hormones in parthenocarpic and seeded fruit. Journal of the American Society for Horticultural Science 97, 731-735. Gillaspy, G., Ben-David, H. and Gruissem, W. (1993). Fruits: A developmental perspective. Plant Cell 5 (10): 1439–1451. Goetz, M., Hooper, L. C., Johnson, S. D., Carlyle, J., Rodrigues, M., Vivian-Smith, A., and Koltunow, A. M. (2007). Expression of Aberrant forms of AUXIN RESPONSE FACTOR8 stimulates parthenocarpy in Arabidopsis and tomato, Plant Physiology 145: 351-366. Gustafson, F. (1939b). The cause of natural parthenocarpy. American Journal of Botany 26, 135-138. Hardtke, C.S., Ckurshumova, W., Vidaurre, D.P., Singh, S.A., Stamatiou, G., Tiwari, S.B., Hagen, G., Guilfoyle, T.J., and Berleth, T. (2004). Overlapping and non- redundant functions of the Arabidopsis auxin response factors MONOPTEROS and NONPHOTOTROPIC HYPOCOTYL 4. Development 131, 1089–1100. Hartley, C. W. S. (1988). The oil palm. London: Longman.

Hass, A.R.C. and Bliss, D.E. (1935). Growth and composition of Deglet Noor dates in relation to water injury. Journal of Agricultural Science published by the California Agricultural Experiment station, Hilgardia 9 (6): 295-344. Hayashi, F., Naito, R., Bukovac, M. J. and Sell, H. M. (1968). Occurrence of

Gibberellin GA3 in Parthenocarpic Apple Fruit. Plant Physiology 43:448-450. Hedhly, A., Hormaza, J.I., and Herrero, M., (2003). The effect of temperature on stigmatic receptivity in sweet cherry (Prunus avium L.). Plant Cell and Environment, 26, 1673–1680. Hedhly, A., Hormaza, J. I. and Herrero, M. (2005). The effect of temperature on pollen germination, pollen tube growth and stigmatic receptivity in peach (Prunus persica L. Batsch.). Plant Biology 7, 476-483. Hedhly A., (2011). Sensitivity of flowering plant gametophytes to temperature fluctuations. Environemntal and Experimental Botany, 74, 9-16. http://faostat.fao.org/site/567/DesktopDefault.aspx?PageID=567#ancor. Accessed on January 8th, 2015. Jain, S. M., Al-Khayri, J. M. and Johnson, D. V. (eds), (2011). Date palm biotechnology. Springer Science+Business Media B.V. London, UK, pp. 320-327. Janssen, B. J., Thodey, K., Schaffer, R. J., Alba, R., Balakrishnan, L., Bishop, R., Bowen, J. H., Crowhurst, R. N., Gleave, A. P., Ledger, S., McArtney, S., Pichler, F.B., Snowden, K.C. and Ward, S. (2008). Global gene expression analysis of apple fruit development from the floral bud to ripe fruit. BMC Plant Biology 8:16. Jong, M., Mariani, C. and Vriezen, W. (2009). The role of auxin and gibberellin in tomato fruit set, Journal of Experimental Botany, doi:10.1093/jxb/erp094. Kato, K., Ohara, H., Takahashi, E. and Matsui H. (2000). Endogenous gibberellin- induced parthenocarpy in grape berries. Acta Horticulturae 514: 69-74. King, J.R., (1938). Morphological development of the fruit of the olive, in Hilgardia, Journal of Agricultural Science 11 (8) 437-458. Koshioka, M., Nishijima, T., Yamazaki, H., Nonaka, M. and Mander, L.N. (1994). Analysis of gibberellins in growing fruits of Lycopersicon esculentum after pollination or treatment with 4-chlorophenoxyacetic acid. Journal of Horticultural Science 69:171–179. Kuo, C. G., Peng J. S. and Tsay J. S. (1981). Effect of high temperature on pollen grain germination, pollen tube growth and seed yield of Chinese cabbage. HortScience 16: 67-68. Lewis, D. (1942). The physiology of incompatibility in plants. I. The effect of temperature. Proceedings of the Royal Society of London, Series B 131, 13-26. Long, E. M. (1943). Developmental anatomy of the fruit of the 'Deglet Noor' Date. Botanical Gazette, 104 (3): 426-436.

Luza, J. G., Polito, V. S. and Weinbaum, S. A. (1987). Pollen germination and tube growth in two walnut (Juglans) species, American Journal of Botany 74 (12): 1989-1903. Mapelli, S., Torti, G. and Soressi M.B.G. (1979). Effects of GA3 on flowering and fruit-set in a mutant of tomato. Horticultural Science 14, 736-737. Mapelii, S. and Lombardi, L. (1982). A comparative auxin and cytokinin study in normal and to-2 mutant tomato plants. Plant and Cell Physiology 23, 751-757. Marti, C., Orzaez, D., Ellul, P., Moreno, V., Carbonell, J. and Granell, A. (2007). Silencing of DELLA induces facultative parthenocarpy in tomato fruits, The Plant Journal 52, 865-876. Modlibowska, I. (1945). Pollen tube growth and embryo sac development in apples and pears. Journal of Pomology, 21, 57-89. Molesini, B., Pandolfini, T, Rotino, G.L., Dani, V., and Spena, A. (2008), Aucsia Gene Silencing Causes Parthenocarpic Fruit Development in Tomato. Plant Physiology 149 (1):534-548. Nagata, K., Kurihara, A. (1982). The varietal difference in the response of grape cultivars to gibberellin application. Bulletin of fruit tree research station E, 4: 7-19. Nitsch, J. P. (1952). Plant hormones in the development of fruits. The quarterly Review of Biology 27 (1): 33-57. Nixon, R. W., and Carpenter, J. B. (1978). Growing dates in the United States. USDA Inform. Bull. 207. Washington, D.C., USA. pp. 3-5. Nuez, F., Cuartero, J., Ferrando, C., Catala, M.S., and Costa, J. (1988). Genetic model for the inheritance of the parthenocarpy in the tomato line '75/59'. Anales de la Estacion Experimental de Aula Dei, 19 (1-2): 7-11. O'Neill, S.D. (1997). Pollination regulation of flower development Annual Review of Plant Physiology and Plant Molecular Biology 48:547-74. Ozga, J. A. and Reinecke, D. M. (2003). Hormonal interaction in fruit development, Journal of Plant Growth Regulation 22:73-81. Pacini, E., Franchi, G. G., Lisci, M and Nepi, M. (1997). Pollen viability related to type of pollination in six angiosperm species. Annals of Botany 80 (1): 83-97. Pandolfini, T., Molesini, B., Rotino, G.L., Dani, V. and Spena A. (2009). Aucsia gene silencing causes parthencarpic fruit development in tomato. Plant Physiology 149 (1): 534-548. Pearson, O. H. (1932). Breeding plants of the cabbage group. California Agricutlural Experiment Station Bulletin 532. Postweiler, K., Stoesser, R., and Anvari S. F., (1985). The effect of different temperatures on the viability of ovules in cherries. Scientia Horticulturae 25, 235- 239. Preil, W., and Reimann-Philipp, R. (1969). Untersuchungen über die Einflüsse verschiedener Umweltfaktoren auf die Funktionsfähigkeit der Pollen von Tomaten 62

(Lycopersicon esculentum Mill.) insbesondere solcher mit erblicher neigung zur Parthenocarpie. Angewandte Botanik, 43: 175-193. Preil, W. (1973). Zur Parthenocarpie bei Tomaten in Abhängigkeit vom Temperaturverlauf. Angewandte Botanik 47, 135-140. Reuveni, O. (1986). Date, CRC Handbook of Fruit Set and Development. Boca Raton, FL: CRC Press,119-122. Reuveni, O., Abu, S. and Golobovitz, S. (1986). Date palm pollen germination and tube elongation on pistillate flowers cultured at different temperatures. Acta Horticulturae 175:91-95. Rezazadeh, R., Hassanzadeh, H., Hosseini, Y., Karami, Y. and Williams, R. (2013). Influence of pollen source on fruit production of date palm (Phoenix dactylifera L.) cv. 'Barhee' in humid coastal regions of southern Iran, Scientia Horticulturae 160:182-188. Richards, D. E., King, K. E., Ait-ali, T. and Harberd, N. P. (2001). How gibberellin regulates plant growth and development: a molecular genetic analysis of gibberellin signaling. Annual Review of Plant Physioliogy and Plant Molecular Bioliogy 52, 67-88. Rudall, P. J., Ryder, R. A. and Baker, W. J. (2011). Comparative gynoecium structure and multiple origins of apocarpy in coryphoid palms (Arecaceae). International Journal of Plant Science 172 (5):674-690. Ruzin, S. E., (1999). Plant microtechniques and microscopy. Oxford University Press. pp. 57-116. Saidi, M. N., Ladouce, N., Hadhri, R., Grima-Pettenati, J., Drira, N. and Gargouri- Bouzid, R. (2010). Identification and characterization of differentially expressed ESTs in date palm leaves affected by brittle leaf disease, Plant Science 179:325- 332. Sanzol, J. and Herrero, M. (2001). The "effective pollination period" in fruit trees. Scientia Horticultuae 90, 1-17. Sato, S., Peet, M. M. and Gardner, R. G. (2000). Formation of parthenocarpic fruit, undeveloped flowers and aborted flowers in tomato under moderately elevated temperatures. Scientia Horticultuae 90: 243-254. Sedgley, M. (1977). The effect of temperature on floral behavior pollen tube growth and fruit set in the avocado. Journal of Horticultural Science 52: 135-141. Sedgley, M. and Shuraki, Y. D. (1996). Fruit development of Pistacia vera (Anacardiaceae) in relation to embryo abortion and abnormalities at maturity. Australian Journal of Botany 44: 35-45. Serrani, J.C., Fos, M., Atares, A. and Garcia-Martınez, J. L. (2007). Effect of gibberellin and auxin on parthenocarpic fruit growth induction in the cv. Micro-tom of tomato. Journal of Plant Growth Regulation 26:211–221.

Shaheen, M. A., Nasr, T. A. and Bacha, M. A. (1988). Effect of some plant growth regulators on induction of seedless fruits in some date palm cultivars. Journal of the College of Agriculture, King Saud University 10 (1): 129-138. Spurgeon, S. L., Jones, C. J. and Ramakrishnan, R. (2008). High throughput gene expression measurement with real time PCR in a microfluidic dynamic array. PlosOne 3 (2) e1662. Srivastava, A. and Handa, A. K. (2005). Hormonal regulation of tomato fruit development: A molecular perspective. Journal of Plant Growth Regulation 24: 67-82. Stauffer, F. W., Rutishauser R. and Endress, P. K (2002). Morphology and development of the female flowers in Geonoma interrupta (Arecaceae). American Journal of Botany 89 (2): 220-229. Stoesser, R., and Anvari, S. F., (1982). On the senescence of ovules in cherries. Scientia Horticulturae, 16, 29-38. Sukhvibul, N., Hetherington, S. E., Whiley, A. W., Smith, M. K. and Vithanage, V. (2000). Effect of temperature on pollen germination, pollen tube growth and seed development in mango (Mangifera indica L.), Acta Horticulturae 509: 609-616. Sundberg, E., and Østergaard L. (2009). Distinct and dynamic auxin activities during reproductive development. Cold Spring Harbor Perspectives in Biology Susanto, S. and Nakajima, Y. (1990). Effect of winter heating on flowering time, fruiting and fruit development in pummelo grown in a plastic house. Journal of Japanese Society for Horticultural Science, 59 (2): 245-253. Swain S. M., and Koltunow A.M. (2006). Auxin and fruit initiation. In L. Taiz, E. Zeiger, (eds), Plant Physiology, 4. Sinauer Associates, Inc., Sunderland, MA. Tashiro, T. and Wardlaw I.F. (1990) The response to high temperature shock and humidity changes prior to and during the early stages of grain development in wheat. Australian Journal of Plant Physiology, 17(5): 551 – 561. Tatematsu, K., Kumagai, S., Muto, H., Sato, A., Watahiki, M.K., Harper, R.M., Liscum, E., and Yamamoto, K.T. (2004). MASSUGU2 encodes Aux/IAA19, an auxin-regulated protein that functions together with the transcriptional activator NPH4/ARF7 to regulate differential growth responses of hypocotyl and formation of lateral roots in Arabidopsis thaliana. Plant Cell 16, 379–393. Torahi, A. and Arzani, K. (2010). Date palm (Phoenix dactylifera L.) fruit growth pattern. Acta Horticultuae 864: 201-206. Tyler, L., Thomas, S. G., Hu, J., Dill, A., Alonso, J. M., Ecker, J. R., and Sun, T. (2004). DELLA proteins and gibberellin-regulated seed germination and floral development in Arabidopsis, Plant Physiology 135:1008-1019. Uhl, N. W. and Moore, H. E. (1971). The palm gynoecium. American Journal of Botany, 58 (10): 945-992.

Ulmasov, T., Hagen, G., and Guilfoyle, T.J. (1999b). Activation and repression of transcription by auxin response factors. Proceedings of the National Academy of Sciences, USA 96, 5844–5849. Van Huizen, R., Ozga, J.A. and Reinecke, D.M. (1997). Seed and hormonal regulation of gibberellin 20-oxidase expression in pea pericarp. Plant Physiology, 115, 123–128. Vivian-Smith, A., Luo, M., Chaudhury, A. and Koltunow, A. (2001). Fruit development is actively restricted in the absence of fertilization in Arabidopsis. Development, 128 (12): 2321-31. Wang, H., Jones, B., Li, Z., Frasse, P., Delalande, C., Regad, F., Chaabouni, S., Latche, A., Pech, J.-C., and Bouzayen, M. (2005). The tomato Aux/IAA transcription factor IAA9 is involved in fruit development and leaf morphogenesis. Plant Cell 17, 2676–2692 Weinbaum, S. A., Parfitt, D. E. and Polito, V. S. (1984). Differential cold sensitivity of pollen grain germination in two Prunus species, Euphytica 33: 419-426. White, P. J. (2002). Recent advances in fruit development and ripening: an overview. Journal of Experimental Botany, 53 (377):1995-2000. Wrigley, G. (1995). Date palm, Phoenix dactylifera. In: Smart J. and Simmonds N. W. (eds.), Evolution of crop plants, 2nd ed. Longman, London: pp. 399-403. Yang, M., Zhang, X., Liu, G., Yin, Y., Chen, K., Yun, Q., Zhao, D., Al-Mssallem, I. S. and Yu, J. (2012). The complete chloroplast genome sequence of date palm (Phoenix dactylifera L.). PloS One 15:5 (9):e12762. Yin, Y., Zhang X., Fang, Y., Pan, L., Sun, G., Xin, C., Ba Abdullah M.M., Yu, X., Hu, S., Al-Mssallem, I.S., Yu, J. (2012). High-throughput sequencing-based gene profiling on multi-staged fruit development of date palm (Phoenix dactylifera L.) Plant Molecular Biology, 78:617-626. Zaid, A. and De Wet, P. F. (2002). Date Palm Cultivation, Food and Agriculture Organization, Plant Production and protection Paper no. 156, http://www.fao.org/docrep/006/y4360e/y4360e00.htm (accessed October 5th, 2013). Zaid, A. and De Wet, P. F. (2002a). Botanical and systematic description of the date palm. In: A. Zaid (ed.), Date Palm Cultivation, Vol. 156. FAO, Rome. p. 29-44. Zaid, A. and De Wet, P. F. (2002b). Climatic requirements of date palm. In: A. Zaid (ed.), Date Palm Cultivation. FAO, Rome. p. 58-73. Zaid, A. and Al-Kaabi, H. (2003). Plant-off types in tissue culture-derived date palm (Phoenix dactylifera L.). Emirates Journal of Agricultural Science 15:17-35. Zaid, A., and Al-Kaabi, H. (2007). Morphological abnormalities in tissue culture- derived date palm (Phoenix dactylifera L.). Acta Horticultureae 736, 329-335. Zhang, G., Pan, L., Yin, Y., Liu, W., Huang, D., Zhang, T., Wang, L., Xin, C., Lin, Q., Sun, G., Ba Abdullah, M., Zhang, X., Hu, S., Al-Msallem, I.S. and Yu, J. (2012).

Large-scale collection and annotation of gene models for date palm (Phoenix dactylifera L.). Plant Molecular Biology, 79(6):521-536. Zhang, X.S., O’Neill, S.D. (1993). Ovary and gametophyte development are coordinately regulated by auxin and ethylene following pollination. Plant Cell 5:403–418.

Appendix

List of forward and reverse primers used in the gene expression analysis. Transcript sequences were obtained from Al-Mssallem et al., 2013. Gene Annotation Contig Forward primer Reverse primer DELLA protein DPcdna50389 CCTGTGTTGGCGGATCTATT AAGTGGGCGAACTTGAGGTA DELLA protein DWARF8 DPcdna59908 GATGTAACCCTAGCCCAGCA CTGAGGAACCAGGAGGTGAG

DELLA protein DPcdna36383 ACGGTAACGCTGCTGCTAAT GAAAaGACACAGGCGACCAT DELLA DELLA protein RGL1 Dpcdna59332 GGGTTGATAGGCATGAGAAG GCATCTCCCTTTCTCCAATG Stress ripening protein homolog DPcdna08823 AAAGCACCGCCTCAGTTT ATTTGGGTCTGACAGCCTGA Stress ripening protein homolog DPcdna54003 AAAACATGGAGCATCTCGGC CCTCCTCTATCCTGTGCCTG

ABA insensitive DPcdna59821 TCGTCCATCTACTCGCTGAC TCCTCGACGTTCCAGATGTT

Neoxanthin synthase DPcdna00128 AGCTTCGGGGATTACGACTT GCATTAGGTGCCAGAACCAT Aldehyde oxidase and xanthine DPcdna44849 GCTAGAGCAGAGGAAGGTTATC GCAAATGGTCGGGTGAAATC dehydrogenase

Abscisic acid Abscisic Aldehyde oxidase and xanthine DPcdna53178 CTCCGCTATACTCTGTTGAAGG CTGGCTACAGATTCCTGGATAG dehydrogenase ABA-inducible protein kinase DPcdna49946 TGGTGGGTCTTGTCTCTCT CATCTCGTACCGCTCCATTT ABA 8-hydroxylase DPcdna47733/55779 AGGTGATGCCTTTGTTCAGG CTCATTGCCAGGACAGGAGT GA-3 oxydase DPcdna59573 TGTACCAGAGCAGCACGAG GACGACACTCTTAAACCGCC

GA-2 oxydase DPCdna50607 ACCGATCCACAGGTCATCTC CTCCTGGTCTGAAGGGACTG F-box protein GID2 DPcdna56279 CTCCACTCCGTCTACCTTCT GAAAGTTGGACCTCGTCCTT GID1-4 DPcdna38308 GAGAGAGATGTGCTGGGATTT GAAGAGGAGGAATAAAGAGGAGAAG GID1-5 DPcdna46417 CGAGGTTGGTCTTGGAAACG AGAAGTCGAAACCCCACCAT

Gibberellic acid Gibberellic GA-regulated protein 1 DPcdna11742 GTTAGGCTACCGTTCAGGATTT CGCTTCTCCTTCGTGTTCTT GA-2 oxidase, putative DPCdna39111 TGCTTCAGGCTATGACGAATG ATCTCTGGGAGAGGGGAGAT 67

Gene Annotation Contig Forward primer Reverse primer Chitin inducible GA-responsive protein DPcdna45603 CCCAGTACAGGCTCTTGGAT CTGCTTACATCGTCGTCAGC Putative chitin-inducible GA-responsive DPcdna46561 AGAGTTGCCCGTTCAGATGA GGCTTTTATGAGGAGCTGGC protein

GA 20 oxidase DPcdna49465 GCTTCAACCACTACCCTCCA ACCAACATCTTGAGCCAGGA GID1L2 DPcdna51868 ATGCGTTCCACTCCAAGAA CCAGCATCCACAATTCCAAAG GA 2 oxidase DPcdna50446 ACTGTTGCCTGACTGGATTT ACTCCCATCCCTCAGAGATATT GA 2 oxidase DPcdna50721 ACCTTCAGCAAGCTCCTTAC CTTAGCCCTTCAGCCATCAA

Gibberellic acid Gibberellic GA insensitive protein DPcdna45606 CAGGAATCCGTACACACATACA CAGAGCCCTATTGGTGGAAG Ent-copalyl diphosphate synthase 1 DPcdna40087 AGCAAGCCAAGGATTTCTCA GTACagCCTCGCCTCTATGC GASA-like protein DPcdna42426/25 GCTTCACTCACGGCAGAA CATGGGTCTTCCAATCGGTATAG GAST-like protein DPcdna17382 CTCTTAGTCCCAACCTGTGTATC GAACCGTGCTGAGCTTCTAA IAA-amido synthetase DPcdna37624/25 CAAGCAGGACAACAGCAATTT GTGGTGAGGGCAATCTCATAC IAA-amido synthetase DPcdna39883 CTGGAGCAACCTGATACCTAATC CCAGCATAGTGCCTTAACTTCT IAA-induced protein ARG7 DPcdna52909 CTGAGCCTGCCATTGTTTAAG TCTCGCAAGGGATTGTGATAG ARP IAA 27 DPcdna25365 TGTGCCTGCCATGTTATTCC ACACAGGAAACAGGGACCAA

IAA hydrolase DPcdna39301 CAGTGCTACTGTGGACTTTCTT CATTTCCTCCGCAACCTTCT

IAA type protein DPcdna40883 CAAAGTGAATGGGAGCTGGA CATGACACAGGACTTGAGGAAA

IAA-amino acid hydrolase ILR1 DPcdna48023 CCTCATGGGCGTCAAGTATAG GAGTGCTACAAAGGGTGGAA Auxins Auxin-responsive protein IAA13 DPcdna50014 GAAGAGCAACAGCAACGACA ACGGATGAGCATTGAGATCC Auxin-repressed protein DPcdna01527 AGCAACCTAGCCACCAAGAA CCTCGGCACACaAAAAGTCT Putative AUX1-like permease DPcdna12535/36 GCCCATGAGAAGCTGTACTATC CACCAAGCCTAGTAGCTCAAA SAUR family protein DPcdna42587 TAGGTGGAGcCCTAGCtTTG AAATCGCCCTCCTCCTTCTA IAA-amido synthetase DPcdna33546 cACAGCTaCaGCTCCTcataC TTCTCGGCATCTTTCTCGTT

Gene Annotation Contig Forward primer Reverse primer Auxin efflux facilitator SlPIN4 DPcdna32615/13 CGTGTTCGCCAAGGAGTATAA CCATCGTAATCGGAAGAGCTATC Auxin-independent growth promoter DPcdna39865 TGAGGTATATGGCGGAGAGG CATGCGTGATGAAAATCCTG Auxin-regulated protein DPcdna46289 GTCTGGGAAGAGCTTTGTGC CAGATCAGGATTGGGGCTTA Auxin efflux carrier protein-like DPcdna47006 CTCTTGTGGATGGTGGAGTAAG CAAGTCCTCGTGTCGGTTT Putative ARF 1 DPcdna24437/38 CCACCAGAAGGAAGCGATAAG CGTGGATCAGTGGGTCATTT ARP putative DPcdna56259 GTCGTTTtAggggtggtgaa agcagtatcccagcttccaa

AUX-induced protein DPcdna50778 GTCACAGATTCACCGTGTGG GAAACCCAACCTGGATACCTC Auxin-induced lipid transfer protein DPcdna63518 GCAATCCTGTTCTCGTCTCC ATGTAGCCGCTCAAGTTTGG

Auxins Putative auxin response factor 6 DPcdna34533 ACCGTGGATACAgCCAAGAC AGCTTTGAGGTTGCTGGAAA Putative auxin response factor 8 DPcdna59284 CTCTCTATTGCGGTGCCTAAT CAGAAGACCCATCCAGGTAAC Auxin response factor 11 DPcdna44725 GCGACCAAGATTAGAAACAACAC GCAGCATCCAGTCCTCATTAT Auxin response factor 27 DPcdna46801 ACGGTCTCTACGAGTCATTCT CAGGCGAGAGTTCTTGGTTATAC ARF16 DPCdna45922 ATGGGAGGCTTGCTGATATG GAACGGTTCATCTCCAGTTTG Auxin response factor Dpcdna61034 CAGCCAAGGTAGCATCCATT AgCATCAGGGGACTGGTCTA ETTIN-like ARF (3) DPcdna52785 TGTCAGTATAAGGTCAGACGAAATG GGTAGTTTGGCAGCTACTCTTATC ACTIN CACTGCGGAACGGGAAAT GGATGGCTGGAAGAGGAC F-BOX TGGCTGCTGTAGTTGTAGGATG CACCACCACCTGTTGATTTG ELONGATION FACTOR CCAAGTGTGAAAGCAAGCAA TACTTCGCAGGCTGATTGTG G6PDH ACAATCCGAGTCCACCCAC TTGCCTCCATCTGTTTACCC

Cytokinin-O-glucosyltransferase 1 DPcdna59650 CCCTcCGAcTcCCATAAAAT GGTCCAGTGGAAGTGGATGT

Cytokinin dehydrogenase 4 DPcdna51045 GTGTTCGTAGCGGATGTTCT GCCTCTCTTCTCCTTCTCATTT CYP84A33 DPcdna47466 CTGTGTCTCAAAGGAAGAGCA CCGCAGAGAAAGTACGAAGAG

Cytokinins CYP71AP4 DPcdna47669 CATTCGGCATGGCTAGTgTC CAACAGCAACCAGTTCAGCT

Gene Annotation Contig Forward primer Reverse primer CYP84A33 DPcdna48108 ATGAGGAACACGAAGGAGCT CGCACTTGAAGTAGGACAGC Cytokinin dehydrogenase 11 DPcdna57205 AGAGCTGGAAGtCGTAACCG GAGTGATGACGCCGAACTG Isopentenyl transferase IPT1 DPcdna59262 CAGCAGCATCCGACAACTAG GCAGAGAAGCTACAAAGACCG

IPT DPcdna57488 TTGtAATGCCGCTGGACATG AGTTGTTTATTGGCGATCTGGA Histidine kinase 2 DPcdna54121 CATGTGTGTTGGCAAGTAAGG AGAACGAACAGCTCGGTATG

Histidine kinase 3 DPcdna45597 GCAGAGCATGTCACAGGAAG AATTCCATAGACCCCGCCAT Cytokinins Histidine kinase DPcdna44870/896 ACTGATGGGTGGGCAAATAAA GGTAGGTAGAGCCTCAGAAAGA CYP71A1-like DPcdna36524 CAAGGGGCAGCATTTTCAGT ACGGCAGTCACACCTAATGA CYP71A1-like DPcdna59217 aCCCATGACCTCAaGaCTGC CAGAAGGATGGAAAcCCCTA Defender against apoptotic cell death DPcdna03489/95 AACCgAATGATCTGGTTTGC TCACATGACGCCACTTTGTT Defender against apoptotic cell death DPcdna03489/95A TGGAGTTATCTCCTGTGTAGGT CATAAGCTCGTTCTGGTGGTAG Cell death associated protein DPcdna63797 CCCGTCACAACCTCTCTTA CTTTATGGACCGCCACTGAT

Programmed cell death DPcdna67493 GGAGCTACGAACGACGAATAG GCTTGTCGCTCTGGATCAT

Defender against apoptotic cell death DPcdna03489/91 taGGACACTTAGTCTTGGATGGGC TTTGGTaTCaGGaaGAAaCATAAGC PCD BAX inhibitor motif-containing protein DPcdna23351 TTGCCGTCGGATTGACTTG CCTTGCTGCCCAGAATGTATAG Transmembrane BAX inhibitor motif- DPcdna33937/38 CATCCATCGGTTAGGGTGATATT TCTCGGTTTCTTCGCTTCTG containing protein 4 Bax inhibitor1-like Protein DPcdna50404 CCTCCCGCTCTTCTTAATGTTC CTCAGGCTTAGGCACAAAGT ET-responsive factor-like protein DPcdna25723 GTGTGGCTGGGAACTTTCAG GAGGGATCTTCGTTGGGGAA

Ethylene response factor 11 DPcdna00527 AGCCGACATGATGGGAATCT TTACTGTGAGCTGCGGGAAT ACC syntase DPcdna33755 CAGCTTCACACTCGTCTCATC CCTCTTCCTAAGACTCTCCCTATT

Ethylene S-adenosylmethionine synthase DPcdna49970/64558 GTTTCGCTCGCAGGTCTAAG CAAGCACGGCATCAGAGATC S-adenosylmethionine synthase DPcdna35197 GATGGCGGATCTATGTCAGAAG CCACTGTACGATGCTGCTTTA

Gene Annotation Contig Forward primer Reverse primer Ethylene-responsive transcription factor DPcdna43214 ACCTTAGCCTGGACCTCAAC CGAACCCTCCCAGCATCAAT

S-adenosylmethionine synthase DPcdna31510 GAGGTGCGGAAGAATGGAAC CTGGGTGGAGATGAGGACAG

Ethylene-responsive transcription factor DPcdna51712 AAGCAATCAAATCGGCGTgT GGTTCCCTCCCTCTCCTTTG 3 Ethylene Ethylene signal transcription factor DPcdna46898 ACTTTGGATGGGAACGTGAG CCTTCAGTGATGGTGGGAATAG ET receptor DPcdna46300 CCAAGCACCATCTACCcACT GCATTGAGTCCCAGAGGAAA

Senescence-associated protein DPcdna54097 CGATACTGGCAGGAGGGATA CATGAGCGAGATCACCATGA Putative senescence-associated protein DPcdna39108 GTTGAGCGTATGACTAGGAGATG TGGCGATTGAGTGATGAAGA Senescence-associated protein DPcdna52345 GGGATAAACCTCCTGGCTTC GATTGGCAGTCATAGCAGAG

Senescence Senescence-associated protein 6 DPcdna40920 GGACTGTAGTGATCTCTTCTCTTG GTCTCCCTGATTGACTCCTTTG

מצביעות על כך שבתמר להאבקה יש חשיבות בהפעלת דפוס התפתחות הפרי. בהשוואת נשירת הפירות בין הזנים נמצאה נשירת פרי רבה בתפרחות 'מג'הול' שלא הואבקו ונשירה מעטה יחסית בזן 'ברהי'. ביצענו אנליזת ביטוי רחבת היקף בפרחים שהואבקו ובכאלה שלא הואבקו משני הזנים במערכת (Microfluidic Dynamic Array (Fluidigm. תשעים ושישה גנים המעורבים בבקרה הורמונאלית (לאוקסין, גיברלין, ציטוקינינין, ABA ואתילן) נבחרו על סמך מידע מטרנסקריפטום פרי התמר שפורסם לאחרונה. רמות הביטוי היחסיות של גנים אלו נבחנו בחמישה שלבי התפתחות מוקדמים של הפרי בשני הזנים. תוצאות ראשוניות מצביעות על דפוסי ביטוי שונים בין זנים, טיפולי האבקה ושלבים התפתחותיים.

תקציר במטע התמרים המודרני האבקה ודילול הפירות הינם תהליכים מחושבים. הפריה של מרבית הפרחים תביא להתפתחות פירות קטנים, אשר תחייב דילול פרי ידני בהיקף רחב ובעלות גבוהה. האבקה לא יעילה תביא ליבול נמוך. בתנאים אלה עלולים פרחים לא מופרים להתפתח לפירות פרתנוקרפיים, בודדים או משולשים, להם אין כל ערך מסחרי. למרות שהפרח הנקבי מכיל שלוש שלחות, רק אחת מהן מתפתחת לפרי ושתי האחרות מתנוונות. בנוסף, ליעילות ההאבקה, תנאי הסביבה והרקע הגנטי (זנים שונים) השפעה על התהליכים ההתפתחותיים של ההפריה, החנטה והתפתחות הפרי. מטרת העבודה היא אפיון מקיף של ההפריה, החנטה והתפתחות הפרי המוקדמת בתנאי סביבה שונים. הנושאים הספציפיים בהם התמקדנו בעבודה הם: 1. איפיון מורפולוגי-פיזיולוגי של תהליכי ההפריה והחנטה בשני זני תמר, 'ברהי' ו'מג'הול'. 2. לימוד השפעות הטמפרטורה על ההפריה והתפתחות הפרי המוקדמת. 3. בחינה של דפוסי הביטוי של גנים המעורבים בבקרה ההורמונלית של התפתחות הפרי ושל התנוונות שתיים מהשחלות. התמר הינו עץ גדול מאוד אותו קשה להכניס לחדרי גידול ולבחון בתנאים מבוקרים. לבחינת השפעות הסביבה על ביולוגיית הרבייה של התמר השתמשנו במספר גישות ניסיוניות. שילבנו בן ניסיונות in vitro לבין ניסיונות in planta במטע. הצלחנו רק באופן חלקי לכייל פרוטוקול להאבקה של מקטעי תפרחות תמר במצע נוזלי in vitro, משום ש"חיי המדף" של הפרחים המנותקים היו קצרים מאוד ותהליכי הזדקנות של הפרח והתפרחת חלו תוך מספר ימים עד שבועיים. "פיטוטרונים מודולריים", תאים ייחודיים, שמקיפים את התפרחות המואבקות בעצים שלמים במטע ומאפשרים השראה של משטרי סביבה מבוקרים בסביבת האשכול in planta על העץ במטע פותחו בפרויקט. תהליכי צמיחת הנחשון, ההפריה, החטנה, התנוונות שתיים מהשחלות, וכן התפתחות פירות פרתנוקרפיים אופיינו באנליזות מקרוסקופיות ומיקרוסקופיות. הצגנו הבדלים משמעותיים בביולוגית הרבייה של שני הזנים, בהתפתחות פירות פרתנוקרפיים, בנשירת חנטים ובבקרה שונה של התהליכים ההתפתחותיים. טמפרטורות נמוכות יחסית שהושרו במהלך ההפריה הורידו את קצב צמיחת הנחשונים, העלו את רמת הפירות הפרתנוקרפים שנוצריים והאטו את קצב התפתחות הפרי הנורמאלי. באמצעות אנליזה היסטולוגית הגדרנו "צמתים התפתחותיים" ושלבים התפתחות הפרי המוקדמת בשני הזנים, ואישרנו שתהליכי ההתנוונות של ביציות ושחלות מתרחשים מוקדם יותר משניתן לזהות מורפולוגית. בתנאי הניסוי, התנוונות ביציות זוהתה לראשונה ב'ברהי' לאחר כ14- יום, והחלה כשבוע מאוחר יותר ב'מג'הול'. השחלות בפרחים מואבקים היו גדולות יותר לעומת פרחים שלא הואבקו כבר אחרי 27 יום בשני הזנים. תוצאות אלה

עבודה זו נעשתה בהדרכתם של דר' יובל כהן, מינהל המחקר החקלאי, מכון וולקני פרופ' רינה קמנצקי, מינהל המחקר החקלאי, מכון וולקני

השפעות תנאי הסביבה על תהליכי ההפריה והחנטה בתמרים (.Phoenix dactylifera L)

עבודת גמר מוגשת לפקולטה למדעי החקלאות, המזון והסביבה ע"ש רוברט ה. סמית, האוניברסיטה העברית בירושלים

לשם קבלת תואר "מוסמך למדעי החקלאות"

מאת פיליפ סלבקוביץ'

טבת תשע"ה ינואר 5102