What's up with House Mice

Total Page:16

File Type:pdf, Size:1020Kb

What's up with House Mice What’s Up with House Mice? – A Review GaryWitmerand SusanJojola USDAAPHISWildlifeServices,NationalWildlifeResearchCenter,FortCollins,Colorado ABSTRACT : Thehousemouseisprobablythemostwidespreadinvasivemammalianspecies,beingubiquitousworldwide.In commensal situations, they are known mainly for property damage, for consumption and contamination of stored foods, as a noise/sanitation/odornuisance,andasavectorofsomediseases.Insomefieldsettings,theyalsocauseconsiderabledamageto fieldcropsandtonaturalresources,suchaswhenintroducedtoislands.Werelyheavilyuponsanitation,rodent-proofing,capture devices, and rodenticides to control populations and reduce damage. However, a number of situations exist whereby these traditionalmethodsarenotadequateorappropriate:cropdamageduring“mouseplagues”inAustralia,livestockfeedconsumption andcontaminationanddiseasehazardsinpoultryandanimalfacilitiesintheU.S.,andnaturalresourcedamageonsmallislands.In thisreview,challengesandsomepotentialsolutionstohousemousemanagementarepresented,includinggeneticresistanceto anticoagulants,theeffectivenessofbaitsgivenabundantfoodresources,there-invasionproblemandneedforperimeterstrategies, efforts with fertility control, and the need for effective multi-capture trap devices. In difficult situations, an IPM strategy that incorporatesacombinationofmethodscloselyintegratedwithlandusesandmanagementpracticesisnecessary. KEY WORDS : commensalrodents,housemouse, Musdomesticus , Musmusculus ,rodentmanagement,rodenticides Proc.22nd Vertebr.PestConf. (R.M.TimmandJ.M.O’Brien,Eds.) PublishedatUniv.ofCalif.,Davis. 2006.Pp.124-130. INTRODUCTION lived (generally less than 1 year) and have high House mice ( Mus musculus and M. domesticus ) are populationturn-overrates;theyaretrulyan“r-selected” the most widespread mammalian species in the world, species. In one study, 20 mice placed in an outdoor nexttohumans.Housemiceoriginatedinthegrasslands enclosurewithabundantfood,water,andcover,becamea ofCentralAsiaandfollowedhumansaroundtheworld. populationof2,000in8months(Corrigan2001). Thereareanumberofspeciesinthegenus Mus ,butmost Miceareknowntosurviveandevenbreedundervery common around the world are Mus musculus and M. extremeconditions,includingdeepincoalmines,athigh domesticus .Here,weusethetermhousemousetorefer mountain elevations, and even in meat cold storage toboth,asthereisdebateintaxonomiccirclesastothe lockers.Althoughtheyevolvedasgrassandseedeaters, distinction between these two very similar species and micecanfeedonvirtuallyanything.Theycanusealmost whether or not they should be lumped under Mus anything for shelter and bedding. Mice are curious by musculus . In general, Musdomesticus isslightlylarger natureandareveryopportunistic,unlikethecommensal andmoreuniformlycolored(abufforgraybrown)than rats, which are much more neophobic. The abilities of M.musculus . The genusisdescribedin moredetailin micetoclimb,jump,swim,dig,gnaw,andaccesssmall Lund(1994)andNowak(1999). placesaretrulyremarkable.Micehavebeendocumented Therehasnotbeenareviewofhousemousebiology, tojumpabout46cmandtogetthroughholesonly6mm behavior, ecology, damage, and management in quite indiameter(Baker etal .1994). sometime.Inthisreview,werevisitthesetopics.We Housemicehavequiteabehavioralrepertoire.Over alsopointoutsomeofthedifferencesbetweenmiceand 50 individual behavior elements have been described, the commensal rats ( Rattus spp.). We examine some includingnon-socialbehaviors(suchasgrooming),social seriousproblemareasaroundtheworldinvolvinghouse investigation and sexual behaviors, and agonistic mice. Finally, we consider some management and behaviors (Mackintosh 1981). In fact, “behavioral researchneedsthatcouldenhanceourmanagementhouse flexibility”isconsideredkeytothesuccessofthehouse micepopulationsandthedamagetheycause. mouse as a species. As a result, house mice have complex,yetadjustablesocialsystems. ABILITIESANDVALUESOFHOUSEMICE In general, miceliveinextendedfamilyunitscalled House mice have remarkable abilities that have “demes”(LathamandMason2004).Thesizeofthearea allowedthemtobehighlysuccessfulincolonizingmost used by this group can vary greatly, depending upon of the world. Perhaps chief among these are their resourceavailabilityanddensities,fromafewmetersto reproductive potential and their adaptability. Several over100monaside.Micehaveastrongsenseoftouch notableresearchershave madeacareer ofstudyingthis and kinetic abilities that allow them to move rapidly in remarkable species (e.g., Berry 1970, Bronson 1979). total darkness and return home after extensive forays This small (±20 g) and highly prolific animal is a (Corrigan2001).Pheromonesplayanimportantrolein continuous breeder in many situations; a female can thisabilityandalsoareessentialinsocialinteractionand produce6-8litters,eachwith4-7young,peryear.The breeding activities. Mice are primarily crepuscular or young mature within 3 weeks or so, and they soon nocturnal, although this varies by density, resource become reproductively active. House mice are short- availability, and predatory pressures. Mice are very 124 active, perhaps as much as 50% of the time, although Finally, when introduced to islands, mice can cause much of this is entails grooming (Latham and Mason significant damage to natural resources, including both 2004). flora and fauna. For example, on Gough Island, mice Unlike commensal rats, mice are nibblers, eating feed on nestling albatross chicks (Cuthbert and Hilton smallbutfrequentmeals(Timm1994 a,Corrigan2001). 2004). Theycaneat10-20%oftheirbodyweightperday.Asa result, they pass 50 or more fecal pellets per day. The MANAGEMENTOFHOUSEMICE smalldroppingsininfestedbuildingsarea“trade-mark” POPULATIONSANDDAMAGE of their presence, even though they are rarely seen. Alargenumberofmethodsandmaterialshavebeen Unlikerats,micedonotrequirefreewaterandcanmeet developed to help solve house mouse problems. In their water needs through metabolism of solid foods. general, the use of multiple approaches and materials Theywilldrinkfreewater,however,ifitisavailable. (that is, employing an integrated pest management It is important to distinguish between “traditional” strategy) is more likely to reduce the problem to a commensal populations of house mice, which live in tolerablelevel.Thetoolsavailableandtheirproperuse closeassociationwithhumansandtheirhabitations,and have been reviewed by Prakash (1988), Timm (1994 a), feralpopulationsthattrulyliveofftheland.Feralmice and Corrigan (2001). Many technical guides are also typicallyhavelargerhomerangesandspendlesstimein available from Cooperative Extension Service offices, territorialdefenseandpatrollingtheirterritories(Latham private companies, and agricultural and health andMason2004).Theytendtobeseasonalbreedersand departments;manyoftheseareavailableontheInternet. exhibit large seasonal fluctuations in densities. They It seems that a major conference on rodent biology, prefer areas of dense ground cover and populations are ecology, and management is held somewhere in the drivenbyrainfallandseedfallpatterns.Housemicedo world every 5 years or so and a proceedings made not compete well with the commensal rats nor with available (e.g., Singleton et al . 2003). This is an established native rodent populations. Hence, feral indication of the continual problems rodents cause and mouse populations usually occur where this situation theneedforongoingresearchandadaptivemanagement. doesnotexist,suchasonagriculturallandsinAustralia Among the management techniques for house mice, andonislandswithfewornoterrestrialmammals.These making resources less available to mice is an essential situationsarediscussedinmoredetailbelow. first step. This is accomplished by good sanitation House mice play a number of important ecological practicesandbymakingbuildingsrodentproof(Baker et roles,suchasprovidingapreybaseforalargearrayof al . 1994). Recall, however, that keeping mice out of predacious animals cycling nutrients, and dispersing buildingsisarealchallengebecauseoftheirremarkable seedsandspores.Alsoimportantistheverylargeroleof abilities.Nonetheless,thesuccessofcommensalratsand housemiceinmedicalresearch.Theyhavebeenusedto mice in urban/suburban, industrial, and agricultural this purpose at least since the mid-1660s, and modern settingsislargelyattributabletothe vastharboragethat laboratory strains were developed in the early 1900s weprovideinthoseareas. (Lund1994).Arecentarticlein USATODAY (March6, Traps,especiallykilltraps,havebeenusedforalong 2006,p.13D)estimatedthatasmanyas25millionmice time to control unwanted mice. The history of mouse areusedinmedicalresearcheachyear. trap development was reviewed by Drummond (2003). Snaptrapsareveryeffectivebutnotalwayspracticalto DAMAGECAUSEDBYHOUSEMICE useonalargescale.Appropriatebaitingandplacement House mice cause many types of damage (Timm isveryimportantforhighcapturesuccess(Timm1994 a, 1994 a). A major concern is the consumption and Corrigan 2001). Live traps are mostly used for rodent contaminationofstoredfoods;ithasbeenestimatedthat research purposes but have become more popular with substantialamountsofstoredfoodsarelosteachyearin the public, many of whom are averse to killing pest this manner (LaVoie et al .1991). Where feral popula- animals.Morerecently,multiple-capturelivetrapshave tionsofmiceoccur,theydamagemanytypesofcropsin becomeavailable(Temme1980).Whenmicearetaken the field, especially corn, cereal grains, and legumes. elsewhere and released, however, they generally do not Mice also consume and contaminate large
Recommended publications
  • TAXONOMIC STUDIES from RODENT OUTBREAK AREAS in the CHITTAGONG HILL TRACTS Nikhil
    Bangladesh J. Zool. 46(2): 217-230, 2018 ISSN: 0304-9027 (print) 2408-8455 (online) NEW RECORDS OF RODENT SPECIES IN BANGLADESH: TAXONOMIC STUDIES FROM RODENT OUTBREAK AREAS IN THE CHITTAGONG HILL TRACTS Nikhil Chakma*, Noor Jahan Sarker, Steven Belmain1, Sohrab Uddin Sarker, Ken Aplin2 and Sontosh Kumar Sarker3 Department of Zoology, University of Dhaka, Dhaka-1000, Bangladesh Abstract: Rodents are regarded as crop pests, significant reservoirs and vectors for many zoonotic diseases around the world. Basic taxonomic information of rodents present in a locality can help understand which species are responsible as crop pest in that habitat. The phenomenon of the 50-year cycle of gregarious bamboo flowering and rodent outbreaks in the Chittagong Hill Tracts (CHT) of Bangladesh, rodents trapping were carried out in four habitats from March, 2009 to December, 2011 in Ruma upazila of Bandarban hill district. Variety of traps were used to capture small mammals. The captured species were measured and identified using taxonomical dichotomous keys and DNA bar-coding performed in Australia. A total of 14 different small mammalian species were captured of which nine belonging to the Muridae family, and one species each of Spalacidae, Sciuridae, Tupaiidae and Soricidae families. The dominant small mammal species captured were Rattus rattus (54.06%) followed by Mus musculus (26.39%), Rattus nitidus (10.98%), Suncus murinus (5.45%), Mus terricolor (1.09%), Mus cookii nagarum (0.97%), Cannomys badius (0.16%), Leopoldamys edwardsi (0.12%), Berylmys bowersi (0.12%), Vernaya fulva (0.08%), Rattus andamanensis (0.08%), Tupaia glis (0.04%) and Callosciurus pygerythrus (0.04%).
    [Show full text]
  • Table S1. Nakharuthai and Srisapoome (2020)
    Primer name Nucleotide sequence (5’→3’) Purpose CXC-1F New TGAACCCTGAGCTGAAGGCCGTGA Real-time PCR CXC-1R New TGAAGGTCTGATGAGTTTGTCGTC Real-time PCR CXC-1R CCTTCAGCTCAGGGTTCAAGC Genomic PCR CXC-2F New GCTTGAACCCCGAGCTGAAAAACG Real-time PCR CXC-2R New GTTCAGAGGTCGTATGAGGTGCTT Real-time PCR CXC-2F CAAGCAGGACAACAGTGTCTGTGT 3’RACE CXC-2AR GTTGCATGATTTGGATGCTGGGTAG 5’RACE CXC-1FSB AACATATGTCTCCCAGGCCCAACTCAAAC Southern blot CXC-1RSB CTCGAGTTATTTTGCACTGATGTGCAA Southern blot CXC1Exon1F CAAAGTGTTTCTGCTCCTGG Genomic PCR On-CXC1FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC1ROverEx CTCGAGTTTTGCACTGATGTGCAATTTCAA Overexpression On-CXC2FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC2ROverEx CTCGAGCATGGCAGCTGTGGAGGGTTCCAC Overexpression β-actinrealtimeF ACAGGATGCAGAAGGAGATCACAG Real-time PCR β-actinrealtimeR GTACTCCTGCTTGCTGATCCACAT Real-time PCR M13F AAAACGACGGCCAG Nucleotide sequencing M13R AACAGCTATGACCATG Nucleotide sequencing UPM-long (0.4 µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE PCR UPM-short (2 µM) CTAATAC GACTCACTATA GGGC RACE PCR Table S1. Nakharuthai and Srisapoome (2020) On-CXC1 Nucleotide (%) Amino acid (%) On-CXC2 Nucleotide (%) Amino acid (%) Versus identity identity similarity Versus identity identity Similarity Teleost fish 1. Rock bream, Oplegnathus fasciatus (AB703273) 64.5 49.1 68.1 O. fasciatus 70.7 57.7 75.4 2. Mandarin fish, Siniperca chuatsi (AAY79282) 63.2 48.1 68.9 S. chuatsi 70.5 54.0 78.8 3. Atlantic halibut, Hippoglossus hippoglossus (ACY54778) 52.0 39.3 51.1 H. hippoglossus 64.5 46.3 63.9 4. Common carp IL-8, Cyprinus carpio (ABE47600) 44.9 19.1 34.1 C. carpio 49.4 21.9 42.6 5. Rainbow trout IL-8, Oncorhynchus mykiss (CAC33585) 44.0 21.3 36.3 O. mykiss 47.3 23.7 44.4 6. Japanese flounder IL-8, Paralichthys olivaceus (AAL05442) 48.4 25.4 45.9 P.
    [Show full text]
  • Mouse Models of Human Disease an Evolutionary Perspective Robert L
    170 commentary Evolution, Medicine, and Public Health [2016] pp. 170–176 doi:10.1093/emph/eow014 Mouse models of human disease An evolutionary perspective Robert L. Perlman* Department of Pediatrics, The University of Chicago, 5841 S. Maryland Ave, MC 5058, Chicago, IL 60637, USA *E-mail: [email protected] Received 31 December 2015; revised version accepted 12 April 2016 ABSTRACT The use of mice as model organisms to study human biology is predicated on the genetic and physio- logical similarities between the species. Nonetheless, mice and humans have evolved in and become adapted to different environments and so, despite their phylogenetic relatedness, they have become very different organisms. Mice often respond to experimental interventions in ways that differ strikingly from humans. Mice are invaluable for studying biological processes that have been conserved during the evolution of the rodent and primate lineages and for investigating the developmental mechanisms by which the conserved mammalian genome gives rise to a variety of different species. Mice are less reliable as models of human disease, however, because the networks linking genes to disease are likely to differ between the two species. The use of mice in biomedical research needs to take account of the evolved differences as well as the similarities between mice and humans. KEYWORDS: allometry; cancer; gene networks; life history; model organisms transgenic, knockout, and knockin mice, have If you have cancer and you are a mouse, we can provided added impetus and powerful tools for take good care of you. Judah Folkman [1] mouse research, and have led to a dramatic increase in the use of mice as model organisms.
    [Show full text]
  • Biology Assessment Plan Spring 2019
    Biological Sciences Department 1 Biology Assessment Plan Spring 2019 Task: Revise the Biology Program Assessment plans with the goal of developing a sustainable continuous improvement plan. In order to revise the program assessment plan, we have been asked by the university assessment committee to revise our Students Learning Outcomes (SLOs) and Program Learning Outcomes (PLOs). Proposed revisions Approach: A large community of biology educators have converged on a set of core biological concepts with five core concepts that all biology majors should master by graduation, namely 1) evolution; 2) structure and function; 3) information flow, exchange, and storage; 4) pathways and transformations of energy and matter; and (5) systems (Vision and Change, AAAS, 2011). Aligning our student learning and program goals with Vision and Change (V&C) provides many advantages. For example, the V&C community has recently published a programmatic assessment to measure student understanding of vision and change core concepts across general biology programs (Couch et al. 2019). They have also carefully outlined student learning conceptual elements (see Appendix A). Using the proposed assessment will allow us to compare our student learning profiles to those of similar institutions across the country. Revised Student Learning Objectives SLO 1. Students will demonstrate an understanding of core concepts spanning scales from molecules to ecosystems, by analyzing biological scenarios and data from scientific studies. Students will correctly identify and explain the core biological concepts involved relative to: biological evolution, structure and function, information flow, exchange, and storage, the pathways and transformations of energy and matter, and biological systems. More detailed statements of the conceptual elements students need to master are presented in appendix A.
    [Show full text]
  • Micromys Minutus)
    Acta Theriol (2013) 58:101–104 DOI 10.1007/s13364-012-0102-0 SHORT COMMUNICATION The origin of Swedish and Norwegian populations of the Eurasian harvest mouse (Micromys minutus) Lars Råberg & Jon Loman & Olof Hellgren & Jeroen van der Kooij & Kjell Isaksen & Roar Solheim Received: 7 May 2012 /Accepted: 17 September 2012 /Published online: 29 September 2012 # Mammal Research Institute, Polish Academy of Sciences, Białowieża, Poland 2012 Abstract The harvest mouse (Micromys minutus) occurs the Mediterranean, from France to Russia and northwards throughout most of continental Europe. There are also two to central Finland (Mitchell-Jones et al. 1999). Recently, isolated and recently discovered populations on the it has also been found to occur in Sweden and Norway. Scandinavian peninsula, in Sweden and Norway. Here, we In 1985, an isolated population was discovered in the investigate the origin of these populations through analyses province of Dalsland in western Sweden (Loman 1986), of mitochondrial DNA. We found that the two populations and during the last decade, this population has been on the Scandinavian peninsula have different mtDNA found to extend into the surrounding provinces as well haplotypes. A comparison of our haplotypes to published as into Norway. The known distribution in Norway is sequences from most of Europe showed that all Swedish and limited to a relatively small area close to the Swedish Norwegian haplotypes are most closely related to the border, in Eidskog, Hedmark (van der Kooij et al. 2001; haplotypes in harvest mice from Denmark. Hence, the two van der Kooij et al., unpublished data). In 2007, another populations seem to represent independent colonisations but population was discovered in the province of Skåne in originate from the same geographical area.
    [Show full text]
  • Mouse Models of Human Cancer
    INVITATION ORGANIZERS The German-Israeli Cooperation in Cancer Research was Scientific Program Committee founded in 1976 and is the longest lasting scientific coop- Ministry of Science, DKFZ: Prof. Dr. Hellmut Augustin Technology and Space eration between Germany and Israel. To date 159 projects Israel: Prof. Dr. Eli Pikarsky, Prof. Dr. Varda Rotter have been funded. Beyond this, the cooperation has led to friendships between scientists of both countries and other partners (www.dkfz.de/israel). German-Israeli Cooperation in Cancer Research In 2013, the 6th German-Israeli Cancer Research School will DKFZ: Prof. Dr. Peter Angel take place in the Negev Desert in Israel. The focus will be on Israel: Dr. Ahmi Ben-Yehudah, Nurit Topaz mouse models of human cancer. Prominent Israeli and Ger- man scientists will present their latest advances in cancer Administrative Coordinator research. Dr. Barbara Böck Advanced preclinical tumor models have emerged as a criti- Scientific Coordinator of the Helmholtz Alliance cal bottleneck for both, the advancement of basic tumor Preclinical Comprehensive Cancer Center (PCCC) biology and for translational research. Aimed at overcom- ing this bottleneck, the speakers will highlight recent de- velopments in the field of mouse cancer models that better Contact Address MOST mimic the pathogenesis, the course and the response to Nurit Topaz therapy of human tumors. Ministry of Science, Technology and Space The format of the school will include lectures in the morn- P.O.Box 49100 ing and the late afternoon, framed by social activities. Dur- Jerusalem 91490, Israel ing the poster sessions, the participants are expected to phone: +972 2 5411157, fax: +972 2 5825725 give short presentations, highlighting their research proj- e-mail: [email protected] ects.
    [Show full text]
  • A Guide to Mites
    A GUIDE TO MITES concentrated in areas where clothes constrict the body, or MITES in areas like the armpits or under the breasts. These bites Mites are arachnids, belonging to the same group as can be extremely itchy and may cause emotional distress. ticks and spiders. Adult mites have eight legs and are Scratching the affected area may lead to secondary very small—sometimes microscopic—in size. They are bacterial infections. Rat and bird mites are very small, a very diverse group of arthropods that can be found in approximately the size of the period at the end of this just about any habitat. Mites are scavengers, predators, sentence. They are quite active and will enter the living or parasites of plants, insects and animals. Some mites areas of a home when their hosts (rats or birds) have left can transmit diseases, cause agricultural losses, affect or have died. Heavy infestations may cause some mites honeybee colonies, or cause dermatitis and allergies in to search for additional blood meals. Unfed females may humans. Although mites such as mold mites go unnoticed live ten days or more after rats have been eliminated. In and have no direct effect on humans, they can become a this area, tropical rat mites are normally associated with nuisance due to their large numbers. Other mites known the roof rat (Rattus rattus), but are also occasionally found to cause a red itchy rash (known as contact dermatitis) on the Norway rat, (R. norvegicus) and house mouse (Mus include a variety of grain and mold mites. Some species musculus).
    [Show full text]
  • Blood Parasites of Mound-Building Mouse, Mus Spicilegus Petényi, 1882 (Mammalia, Rodentia)
    Wiadomoœci Parazytologiczne 2010, 56(1), 63–65 Copyright© 2010 Polskie Towarzystwo Parazytologiczne Blood parasites of mound-building mouse, Mus spicilegus Petényi, 1882 (Mammalia, Rodentia) Grzegorz Karbowiak 1, Jana Fričova 2, Michal Stanko 2,3 , Joanna Hapunik 1, Denisa Varfalvyova 2 1W. Stefański Institute of Parasitology, Polish Academy of Sciences, Twarda Street, 51/55, 00-818 Warsaw, Poland 2Institute of Zoology of Slovak Academy of Sciences, Löfflerova Street, 10, 040 01, Košice, Slovakia 3Matej Bel University, Faculty of Natural Sciences, Tajovského 40, 97401 Banská Bystrica, Slovakia Corresponding author: Grzegorz Karbowiak; E-mail: [email protected] ABSTRACT. Mound-building mice, Mus spicilegus , were studied for the blood parasites in Eastern Slovakia, vicinity Kechnec village near Košice town (Košická kotlina basin, 21°14’ E, 48°33’ N) during years 2002–2005. Overall, 251 specimens were examined. The parasites were detected using microhematokrit centrifugation technique and on the Giemsa’s method stained blood smears and light microscopy. The parasites were found in 3.57% of specimens; 1.20% of mice were infected with Bartonella sp., 2.39% were infected with Babesia piroplasms. No Hepatozoon hemogregarines and trypanosomes were observed. The intensity of infection with Bartonella was low, less than 0.01% of erythrocytes were invaded, the percent of the erythrocytes with Babesia sp. was less than 0.01%. The morphological description and measurements of parasites were made using the „Analysis” software combined with a video camera and a microscope. The mean size of Bartonella sp. bacteria’s were 0.8×0.3 mm, range 0.4–1.5×0.1–0.9 mm, Babesia sp.
    [Show full text]
  • Rodents Prevention and Control
    RODENTS PREVENTION AND CONTROL Santa Cruz County Mosquito & Vector Control 640 Capitola Road • Santa Cruz, CA 95062 (831) 454-2590 www.agdept.com/mvc.html [email protected] Protecting Public Health Since 1994 RODENT SERVICES Residents, property managers, and businesses in Santa Cruz County can request a site visit to assist them with rodent issues to protect public health. Our services include an exterior inspection of your home in which a certified technician looks for rodent entry points and gives advice on preventing rodents from getting into your home. Employees do not bait or trap, but provide guidance and recommendations such as blocking openings and reducing food sources and hiding places. GENERAL INFORMATION Control strategies may vary depending on pest species. ROOF RAT Rattus rattus (also known as black rat, fruit rat or ship rat) Tail Longer than head and body combined Body Slender, belly can be white, light gray, or light tan Ear Large Eye Large Nose Pointed Habits Climb Feces Smaller, pointy ends (actual size) Roof Rat (Rattus rattus)** NORWAY RAT Rattus novegicus (also known as wharf rat,brown rat, sewer rat, common rat) Tail Shorter than head and body combined (If you fold tail back, it cannot reach its head) Body Heavy, thick Ear Small Eye Small Nose Blunt Habits Burrow, can enter through a hole the size of a quarter, likes water Feces Rounder, blunt ends (actual size) Norway Rat (Rattus novegicus)** 2 HOUSE MOUSE Mus musculus Feet Small Head Small Habits Common in homes and buildings, can enter through a hole as small
    [Show full text]
  • A Phylogeographic Survey of the Pygmy Mouse Mus Minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome B Sequences of Museum Specimens
    A Phylogeographic Survey of the Pygmy Mouse Mus minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome b Sequences of Museum Specimens Pascale Chevret1*, Terence J. Robinson2, Julie Perez3, Fre´de´ric Veyrunes3, Janice Britton-Davidian3 1 Laboratoire de Biome´trie et Biologie Evolutive, UMR CNRS 5558, Universite´ Lyon 1, Villeurbanne, France, 2 Evolutionary Genomics Group, Department of Botany and Zoology, University of Stellenbosch, Stellenbosch, South Africa, 3 Institut des Sciences de l’Evolution de Montpellier, UMR CNRS 5554, Universite´ Montpellier 2, Montpellier, France Abstract The African pygmy mice (Mus, subgenus Nannomys) are a group of small-sized rodents that occur widely throughout sub- Saharan Africa. Chromosomal diversity within this group is extensive and numerous studies have shown the karyotype to be a useful taxonomic marker. This is pertinent to Mus minutoides populations in South Africa where two different cytotypes (2n = 34, 2n = 18) and a modification of the sex determination system (due to the presence of a Y chromosome in some females) have been recorded. This chromosomal diversity is mirrored by mitochondrial DNA sequences that unambiguously discriminate among the various pygmy mouse species and, importantly, the different M. minutoides cytotypes. However, the geographic delimitation and taxonomy of pygmy mice populations in South Africa is poorly understood. To address this, tissue samples of M. minutoides were taken and analysed from specimens housed in six South African museum collections. Partial cytochrome b sequences (400 pb) were successfully amplified from 44% of the 154 samples processed. Two species were identified: M. indutus and M. minutoides. The sequences of the M. indutus samples provided two unexpected features: i) nuclear copies of the cytochrome b gene were detected in many specimens, and ii) the range of this species was found to extend considerably further south than is presently understood.
    [Show full text]
  • Rats and Mice Have Always Posed a Threat to Human Health
    Rats and mice have always posed a threat to human health. Not only do they spread disease but they also cause serious damage to human food and animal feed as well as to buildings, insulation material and electricity cabling. Rats and mice - unwanted house guests! RATS AND MICE ARE AGILE MAMMALS. A mouse can get through a small, 6-7 mm hole (about the diameter of a normal-sized pen) and a rat can get through a 20 mm hole. They can also jump several decimetres at a time. They have no problem climbing up the inside of a vertical sewage pipe and can fall several metres without injuring themselves. Rats are also good swimmers and can be underwater for 5 minutes. IN SWEDEN THERE ARE BASICALLY four different types of rodent that affect us as humans and our housing: the brown rat, the house mouse and the small and large field mouse. THE BROWN RAT (RATTUS NORVEGICUS) THRIVES in all human environments, and especially in damp environments like cellars and sewers. The brown rat is between 20-30 cm in length not counting its tail, which is about 15-23 cm long. These rats normally have brown backs and grey underbellies, but there are also darker ones. They are primarily nocturnal, often keep together in large family groups and dig and gnaw out extensive tunnel systems. Inside these systems, they build large chambers where they store food and build their nests. A pair of rats can produce between 800 and 1000 offspring a year. Since their young are sexually mature and can have offspring of their own at just 2-4 months old, rats reproduce extraordinarily quickly.
    [Show full text]
  • DOMESTIC RATS and MICE Rodents Expose Humans to Dangerous
    DOMESTIC RATS AND MICE Rodents expose humans to dangerous pathogens that have public health significance. Rodents can infect humans directly with diseases such as hantavirus, ratbite fever, lymphocytic choriomeningitis and leptospirosis. They may also serve as reservoirs for diseases transmitted by ectoparasites, such as plague, murine typhus and Lyme disease. This chapter deals primarily with domestic, or commensal, rats and mice. Domestic rats and mice are three members of the rodent family Muridae, the Old World rats and mice, which were introduced into North America in the 18th century. They are the Norway rat (Rattus norvegicus), the roof rat (Rattus rattus) and the house mouse (Mus musculus). Norway rats occur sporadically in some of the larger cities in New Mexico, as well as some agricultural areas. Mountain ranges as well as sparsely populated semi­desert serve as barriers to continuous infestation. The roof rat is generally found only in the southern Rio Grande Valley, although one specimen was collected in Santa Fe. The house mouse is widespread in New Mexico, occurring in houses, barns and outbuildings in both urban and rural areas. I. IMPORTANCE Commensal rodents are hosts to a variety of pathogens that can infect humans, the most important of which is plague. Worldwide, most human plague cases result from bites of the rat flea, Xenopsylla cheopis, during epizootics among Rattus spp. In New Mexico, the commensal rodent species have never been found infected with plague; here, the disease is prevalent among wild rodents (especially ground squirrels) and their fleas. Commensal rodents consume and contaminate foodstuffs and animal feed.
    [Show full text]