DOCSLIB.ORG

Mouse Cox7c Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Cox7c Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Cox7c Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Cox7c conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Cox7c gene (NCBI Reference Sequence: NM_007749 ; Ensembl: ENSMUSG00000017778 ) is located on Mouse chromosome 13. 3 exons are identified, with the ATG start codon in exon 1 and the TAA stop codon in exon 2 (Transcript: ENSMUST00000131011). Exon 1~2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Cox7c gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-429M1 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 1~2 covers 100.0% of the coding region. Start codon is in exon 1, and stop codon is in exon 2. The size of intron 2 for 3'-loxP site insertion: 818 bp. The size of effective cKO region: ~1180 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy gRNA region Wildtype allele A T 5' G gRNA region 3' 1 2 3 Targeting vector A T G Targeted allele A T G Constitutive KO allele (After Cre recombination) Legends Homology arm Exon of mouse Cox7c cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7420bp) | A(32.01% 2375) | C(18.26% 1355) | T(29.87% 2216) | G(19.87% 1474) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. Significant high GC-content regions are found. It may be difficult to construct this targeting vector. Page 3 of 7 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr13 - 86046676 86049675 3000 browser details YourSeq 273 1145 3000 3000 96.0% chr14 + 37970774 38380546 409773 browser details YourSeq 166 1139 1392 3000 94.6% chr15 - 67551137 67551431 295 browser details YourSeq 157 1139 1313 3000 93.7% chr9 + 26983121 26983294 174 browser details YourSeq 153 1139 1308 3000 95.3% chr8 - 55730627 55730981 355 browser details YourSeq 153 1139 1306 3000 97.0% chr3 - 35702715 35702884 170 browser details YourSeq 150 1139 1306 3000 92.7% chr4 - 136526768 136526931 164 browser details YourSeq 150 1139 1306 3000 95.2% chr5 + 129113114 129113294 181 browser details YourSeq 150 1139 1311 3000 92.1% chr4 + 8321258 8321426 169 browser details YourSeq 149 1139 1312 3000 92.9% chr14 - 8985829 8986001 173 browser details YourSeq 148 1144 1306 3000 93.8% chrX - 73057334 73057494 161 browser details YourSeq 148 1139 1311 3000 95.2% chr8 - 27663498 27663682 185 browser details YourSeq 148 1139 1306 3000 91.5% chr6 - 16609225 16609388 164 browser details YourSeq 148 1139 1306 3000 95.8% chr5 - 44418404 44418587 184 browser details YourSeq 147 1139 1305 3000 94.1% chr6 - 73557720 73557886 167 browser details YourSeq 147 1143 1306 3000 92.4% chr3 - 50399375 50399532 158 browser details YourSeq 147 1139 1312 3000 89.9% chr1 - 166655969 166656136 168 browser details YourSeq 147 1139 1295 3000 95.6% chr10 + 10704241 10704396 156 browser details YourSeq 146 1139 1295 3000 95.5% chrX - 95511202 95511356 155 browser details YourSeq 146 1139 1296 3000 96.8% chr2 - 146700707 146701149 443 Note: The 3000 bp section upstream of Exon 1 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr13 - 86042506 86045505 3000 browser details YourSeq 94 595 688 3000 100.0% chr11 - 75599646 75599739 94 browser details YourSeq 94 595 688 3000 100.0% chr17 + 25902077 25902170 94 browser details YourSeq 91 595 688 3000 99.0% chr14 + 38380762 38380856 95 browser details YourSeq 88 595 690 3000 95.9% chr4 + 33201977 33202072 96 browser details YourSeq 86 595 688 3000 94.6% chr10 - 96408731 96408823 93 browser details YourSeq 81 595 683 3000 93.2% chr12 - 51840306 51840393 88 browser details YourSeq 78 595 682 3000 90.2% chr2 - 50521578 50521658 81 browser details YourSeq 78 595 682 3000 92.9% chr12 - 102797359 102797444 86 browser details YourSeq 57 612 682 3000 84.4% chr9 + 15312033 15312096 64 browser details YourSeq 30 207 253 3000 90.7% chr11 - 54190201 54190246 46 browser details YourSeq 25 1047 1081 3000 88.9% chr18 - 81638375 81638408 34 Note: The 3000 bp section downstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. Page 4 of 7 https://www.alphaknockout.com Gene and protein information: Cox7c cytochrome c oxidase subunit 7C [ Mus musculus (house mouse) ] Gene ID: 12867, updated on 12-Aug-2019 Gene summary Official Symbol Cox7c provided by MGI Official Full Name cytochrome c oxidase subunit 7C provided by MGI Primary source MGI:MGI:103226 See related Ensembl:ENSMUSG00000017778 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as Cox7c1; COXVIIc Expression Ubiquitous expression in heart adult (RPKM 584.6), kidney adult (RPKM 436.4) and 28 other tissues See more Orthologs human all Genomic context Location: 13; 13 C3 See Cox7c in Genome Data Viewer Exon count: 3 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 13 NC_000079.6 (86044798..86046795, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 13 NC_000079.5 (86184403..86186400, complement) Chromosome 13 - NC_000079.6 Page 5 of 7 https://www.alphaknockout.com Transcript information: This gene has 4 transcripts Gene: Cox7c ENSMUSG00000017778 Description cytochrome c oxidase subunit 7C [Source:MGI Symbol;Acc:MGI:103226] Gene Synonyms COXVIIc, Cox7c1 Location Chromosome 13: 86,044,816-86,046,904 reverse strand. GRCm38:CM001006.2 About this gene This gene has 4 transcripts (splice variants), 305 orthologues, is a member of 1 Ensembl protein family and is associated with 19 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Cox7c-203 ENSMUST00000131011.1 540 63aa ENSMUSP00000115419.1 Protein coding CCDS26668 P17665 TSL:1 GENCODE basic APPRIS P1 Cox7c-204 ENSMUST00000132233.1 709 49aa ENSMUSP00000117385.1 Protein coding - B8JJA9 TSL:2 GENCODE basic Cox7c-202 ENSMUST00000078764.8 433 24aa ENSMUSP00000119276.1 Protein coding - B8JJB0 TSL:2 GENCODE basic Cox7c-201 ENSMUST00000017922.8 315 No protein - lncRNA - - TSL:2 22.09 kb Forward strand 86.035Mb 86.040Mb 86.045Mb 86.050Mb 86.055Mb Contigs < CT009759.12 Genes (Comprehensive set... < Cox7c-203protein coding < Cox7c-202protein coding < Cox7c-204protein coding < Cox7c-201lncRNA < Gm22574-201TEC Regulatory Build 86.035Mb 86.040Mb 86.045Mb 86.050Mb 86.055Mb Reverse strand 22.09 kb Regulation Legend CTCF Promoter Promoter Flank Gene Legend Protein Coding Ensembl protein coding merged Ensembl/Havana Non-Protein Coding RNA gene Page 6 of 7 https://www.alphaknockout.com Transcript: ENSMUST00000131011 < Cox7c-203protein coding Reverse strand 2.09 kb ENSMUSP00000115... Transmembrane heli... Superfamily Cytochrome c oxidase subunit VIIc superfamily Pfam Cytochrome c oxidase subunit VIIc PANTHER Cytochrome c oxidase subunit VIIc PTHR13313:SF1 Gene3D Cytochrome c oxidase subunit VIIc superfamily CDD Cytochrome c oxidase subunit VIIc All sequence SNPs/i... Sequence variants (dbSNP and all other sources) S Y Variant Legend missense variant synonymous variant Scale bar 0 6 12 18 24 30 36 42 48 54 63 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 7 of 7.
Load more

Recommended publications
  • Gene Expression Profiling of Corpus Luteum Reveals the Importance Of
    bioRxiv preprint doi: https://doi.org/10.1101/673558; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Gene expression profiling of corpus luteum reveals the 2 importance of immune system during early pregnancy in 3 domestic sheep. 4 Kisun Pokharel1, Jaana Peippo2 Melak Weldenegodguad1, Mervi Honkatukia2, Meng-Hua Li3*, Juha 5 Kantanen1* 6 1 Natural Resources Institute Finland (Luke), Jokioinen, Finland 7 2 Nordgen – The Nordic Genetic Resources Center, Ås, Norway 8 3 College of Animal Science and Technology, China Agriculture University, Beijing, China 9 * Correspondence: MHL, [email protected]; JK, [email protected] 10 Abstract: The majority of pregnancy loss in ruminants occurs during the preimplantation stage, which is thus 11 the most critical period determining reproductive success. While ovulation rate is the major determinant of 12 litter size in sheep, interactions among the conceptus, corpus luteum and endometrium are essential for 13 pregnancy success. Here, we performed a comparative transcriptome study by sequencing total mRNA from 14 corpus luteum (CL) collected during the preimplantation stage of pregnancy in Finnsheep, Texel and F1 15 crosses, and mapping the RNA-Seq reads to the latest Rambouillet reference genome. A total of 21,287 genes 16 were expressed in our dataset. Highly expressed autosomal genes in the CL were associated with biological 17 processes such as progesterone formation (STAR, CYP11A1, and HSD3B1) and embryo implantation (eg.
    [Show full text]
  • Single-Cell RNA Sequencing Analysis of Human Neural Grafts Revealed Unexpected Cell Type Underlying the Genetic Risk of Parkinson’S Disease
    Single-cell RNA Sequencing Analysis of Human Neural Grafts Revealed Unexpected Cell Type Underlying the Genetic Risk of Parkinson’s Disease Yingshan Wang1, Gang Wu2 1 Episcopal High School, 1200 N Quaker Ln, Alexandria, VA, USA, 22302 2 Fujian Sanbo Funeng Brain Hospital; Sanbo Brain Hospital Capital Medical University Abstract Parkinson’s disease (PD) is the second most common neurodegenerative disorder, affecting more than 6 million patients globally. Though previous studies have proposed several disease-related molecular pathways, how cell-type specific mechanisms contribute to the pathogenesis of PD is still mostly unknown. In this study, we analyzed single-cell RNA sequencing data of human neural grafts transplanted to the midbrains of rat PD models. Specifically, we performed cell-type identification, risk gene screening, and co-expression analysis. Our results revealed the unexpected genetic risk of oligodendrocytes as well as important pathways and transcription factors in PD pathology. The study may provide an overarching framework for understanding the cell non- autonomous effects in PD, inspiring new research hypotheses and therapeutic strategies. Keywords Parkinson’s Disease; Single-cell RNA Sequencing; Oligodendrocytes; Cell Non-autonomous; Co- expression Analysis; Transcription Factors 1 Table of Contents 1. Introduction ................................................................................................................................. 3 2. Methods......................................................................................................................................
    [Show full text]
  • Mitoxplorer, a Visual Data Mining Platform To
    mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dynamics and mutations Annie Yim, Prasanna Koti, Adrien Bonnard, Fabio Marchiano, Milena Dürrbaum, Cecilia Garcia-Perez, José Villaveces, Salma Gamal, Giovanni Cardone, Fabiana Perocchi, et al. To cite this version: Annie Yim, Prasanna Koti, Adrien Bonnard, Fabio Marchiano, Milena Dürrbaum, et al.. mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dy- namics and mutations. Nucleic Acids Research, Oxford University Press, 2020, 10.1093/nar/gkz1128. hal-02394433 HAL Id: hal-02394433 https://hal-amu.archives-ouvertes.fr/hal-02394433 Submitted on 4 Dec 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License Nucleic Acids Research, 2019 1 doi: 10.1093/nar/gkz1128 Downloaded from https://academic.oup.com/nar/advance-article-abstract/doi/10.1093/nar/gkz1128/5651332 by Bibliothèque de l'université la Méditerranée user on 04 December 2019 mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dynamics and mutations Annie Yim1,†, Prasanna Koti1,†, Adrien Bonnard2, Fabio Marchiano3, Milena Durrbaum¨ 1, Cecilia Garcia-Perez4, Jose Villaveces1, Salma Gamal1, Giovanni Cardone1, Fabiana Perocchi4, Zuzana Storchova1,5 and Bianca H.
    [Show full text]
  • In This Table Protein Name, Uniprot Code, Gene Name P-Value
    Supplementary Table S1: In this table protein name, uniprot code, gene name p-value and Fold change (FC) for each comparison are shown, for 299 of the 301 significantly regulated proteins found in both comparisons (p-value<0.01, fold change (FC) >+/-0.37) ALS versus control and FTLD-U versus control. Two uncharacterized proteins have been excluded from this list Protein name Uniprot Gene name p value FC FTLD-U p value FC ALS FTLD-U ALS Cytochrome b-c1 complex P14927 UQCRB 1.534E-03 -1.591E+00 6.005E-04 -1.639E+00 subunit 7 NADH dehydrogenase O95182 NDUFA7 4.127E-04 -9.471E-01 3.467E-05 -1.643E+00 [ubiquinone] 1 alpha subcomplex subunit 7 NADH dehydrogenase O43678 NDUFA2 3.230E-04 -9.145E-01 2.113E-04 -1.450E+00 [ubiquinone] 1 alpha subcomplex subunit 2 NADH dehydrogenase O43920 NDUFS5 1.769E-04 -8.829E-01 3.235E-05 -1.007E+00 [ubiquinone] iron-sulfur protein 5 ARF GTPase-activating A0A0C4DGN6 GIT1 1.306E-03 -8.810E-01 1.115E-03 -7.228E-01 protein GIT1 Methylglutaconyl-CoA Q13825 AUH 6.097E-04 -7.666E-01 5.619E-06 -1.178E+00 hydratase, mitochondrial ADP/ATP translocase 1 P12235 SLC25A4 6.068E-03 -6.095E-01 3.595E-04 -1.011E+00 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 Protein kinase C and casein Q9BY11 PACSIN1 3.837E-03 -5.863E-01 3.680E-06 -1.824E+00 kinase substrate in neurons protein 1 Tubulin polymerization- O94811 TPPP 6.466E-03 -5.755E-01 6.943E-06 -1.169E+00 promoting protein MIC C9JRZ6 CHCHD3 2.912E-02 -6.187E-01 2.195E-03 -9.781E-01 Mitochondrial 2-
    [Show full text]
  • A Cytoplasmic COMPASS Is Necessary for Cell Survival and Triple-Negative Breast Cancer Pathogenesis by Regulating Metabolism
    Downloaded from genesdev.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press A cytoplasmic COMPASS is necessary for cell survival and triple-negative breast cancer pathogenesis by regulating metabolism Lu Wang,1 Clayton K. Collings,1 Zibo Zhao,1 Kira Alia Cozzolino,1,2 Quanhong Ma,3 Kaiwei Liang,1 Stacy A. Marshall,1 Christie C. Sze,1 Rintaro Hashizume,2 Jeffrey Nicholas Savas,2 and Ali Shilatifard1,4 1Department of Biochemistry and Molecular Genetics, Northwestern University Feinberg School of Medicine, Chicago, Illinois 60611, USA; 2Department of Neurology, Northwestern University Feinberg School of Medicine, Chicago, Illinois 60611, USA; 3Department of Neurosurgery, Northwestern University Feinberg School of Medicine, Chicago, Illinois 60611, USA; 4Robert H. Lurie National Cancer Institute Comprehensive Cancer Center, Northwestern University Feinberg School of Medicine, Chicago, Illinois 60611, USA Mutations and translocations within the COMPASS (complex of proteins associated with Set1) family of histone lysine methyltransferases are associated with a large number of human diseases, including cancer. Here we report that SET1B/COMPASS, which is essential for cell survival, surprisingly has a cytoplasmic variant. SET1B, but not its SET domain, is critical for maintaining cell viability, indicating a novel catalytic-independent role of SET1B/ COMPASS. Loss of SET1B or its unique cytoplasmic-interacting protein, BOD1, leads to up-regulation of expression of numerous genes modulating fatty acid metabolism, including ADIPOR1 (adiponectin receptor 1), COX7C, SDC4, and COQ7. Our detailed molecular studies identify ADIPOR1 signaling, which is inactivated in both obesity and human cancers, as a key target of SET1B/COMPASS. Collectively, our study reveals a cytoplasmic function for a member of the COMPASS family, which could be harnessed for therapeutic regulation of signaling in human dis- eases, including cancer.
    [Show full text]
  • Cytogenetic and Molecular Characterization of the Macro- And
    University of Ulm Department of Human Genetics Prof. Dr. med. Walther Vogel Cytogenetic and Molecular Characterization of the Macro- and Micro-inversions, which Distinguish the Human and the Chimpanzee Karyotypes - from Speciation to Polymorphism Thesis Applying for the Degree of Doctor of Human Biology (Dr. hum. biol.) Faculty of Medicine University of Ulm Presented by Justyna Monika Szamalek from Wrze śnia in Poland 2006 Amtierender Dekan: Prof. Dr. Klaus-Michael Debatin 1. Berichterstatter: Prof. Dr. med. Horst Hameister 2. Berichterstatter: Prof. Dr. med. Konstanze Döhner Tag der Promotion: 28.07.2006 Content Content 1. Introduction ...................................................................................................................7 1.1. Primate phylogeny........................................................................................................7 1.2. Africa as the place of human origin and the living area of the present-day chimpanzee populations .................................................................9 1.3. Cytogenetic and molecular differences between human and chimpanzee genomes.............................................................................................10 1.4. Cytogenetic and molecular differences between common chimpanzee and bonobo genomes................................................................................17 1.5. Theory of speciation .....................................................................................................18 1.6. Theory of selection
    [Show full text]
  • Mitochondrial Copper Homeostasis in Mammalian Cells
    Mitochondrial copper homeostasis in mammalian cells Dissertation zur Erlangung des akademischen Grades Doctor rerum naturalium (Dr. rer. nat.) vorgelegt der Fakultät Mathematik und Naturwissenschaften der Technischen Universität Dresden von Corina Oswald (Diplom-Biochemikerin) geboren am 10.04.1981 in Dohna, Deutschland Gutachter: Prof. Dr. Gerhard Rödel Prof. Dr. Alexander Storch Eingereicht am 30. April 2010 Verteidigt am 13. August 2010 ACKNOWLEDGEMENTS I sincerely thank my supervisor Prof. Dr. Gerhard Rödel for giving me the opportunity to do my PhD in his group and to join the Dresden International Graduate School for Biomedicine and Bioengineering (DIGS-BB). He introduced me to the world of mitochondria, supported and provided me with all resources and comprehension necessary to conduct my research. I thank Dr. Udo Krause-Buchholz for his scientific advice and for helping writing the paper by giving constructive comments on the manuscript. I honestly thank my TAC members Dr. Frank Buchholz and Prof. Dr. Alexander Storch for their interest in this work, for guiding me scientifically, and for stimulating discussions in the TAC meeting. Especially, Dr. Frank Bucholz for giving insightful suggestions as RNAi specialist, and Prof. Dr. Alexander Storch for acting as reviewer of this thesis. The dSTORM images would not have been possible without the very friendly collaboration with Prof. Dr. Markus Sauer and Sebastian van de Linde, Institute for Applied Laser Physics and Laser Spectroscopy of the University of Bielefeld. Thank you! I am furthermore grateful to all former and present lab members for the friendly working atmosphere, for fruitful discussions, for providing advice and assistance in many situations.
    [Show full text]
  • Comparative Gene Expression Analysis of Blood and Brain Provides Concurrent Validation of SELENBP1 Up-Regulation in Schizophrenia
    Comparative gene expression analysis of blood and brain provides concurrent validation of SELENBP1 up-regulation in schizophrenia Stephen J. Glatta,b,c,d, Ian P. Everallb,c,e, William S. Kremena,c, Jacques Corbeilf,g, Roman Saˇ ´ sˇikh, Negar Khanlouc,e, Mark Hani, Choong-Chin Liewi, and Ming T. Tsuanga,c,j,k,l aCenter for Behavioral Genomics, Departments of cPsychiatry and gMedicine, hUniversity of California San Diego Cancer Center, and eHIV Neurobehavioral Research Center, University of California at San Diego, La Jolla, CA 92093; dVeterans Medical Research Foundation, San Diego, CA 92161; fDepartment of Anatomy and Physiology, Laval University, Quebec, PQ, Canada G1V 4G2; iChondroGene, Inc., Toronto, ON, Canada M3J 3K4; jDepartments of Epidemiology and Psychiatry, Harvard Institute of Psychiatric Epidemiology and Genetics, Boston, MA 02115; and kVeterans Affairs Healthcare System, San Diego, CA 92161 Communicated by Eric R. Kandel, Columbia University, New York, NY, September 1, 2005 (received for review July 28, 2005) Microarray techniques hold great promise for identifying risk come under study. Because gene expression can reflect both genetic factors for schizophrenia (SZ) but have not yet generated widely and environmental influences, it may be particularly useful for reproducible results due to methodological differences between identifying risk factors for a complex disorder such as SZ, which is studies and the high risk of type I inferential errors. Here we thought to have a multifactorial polygenic etiology in which many established a protocol for conservative analysis and interpretation genes and environmental factors interact. However, the simulta- of gene expression data from the dorsolateral prefrontal cortex of neous consideration of thousands of dependent variables also SZ patients using statistical and bioinformatic methods that limit increases the likelihood of false-positive results (7).
    [Show full text]
  • Functions of Cytochrome C Oxidase Assembly Factors
    International Journal of Molecular Sciences Review Functions of Cytochrome c Oxidase Assembly Factors Shane A. Watson and Gavin P. McStay * Department of Biological Sciences, Faculty of School of Life Sciences and Education, Staffordshire University, Science Centre, Leek Road, Stoke-on-Trent ST4 2DF, UK; [email protected]ffs.ac.uk * Correspondence: gavin.mcstay@staffs.ac.uk; Tel.: +44-01782-295741 Received: 17 September 2020; Accepted: 23 September 2020; Published: 30 September 2020 Abstract: Cytochrome c oxidase is the terminal complex of eukaryotic oxidative phosphorylation in mitochondria. This process couples the reduction of electron carriers during metabolism to the reduction of molecular oxygen to water and translocation of protons from the internal mitochondrial matrix to the inter-membrane space. The electrochemical gradient formed is used to generate chemical energy in the form of adenosine triphosphate to power vital cellular processes. Cytochrome c oxidase and most oxidative phosphorylation complexes are the product of the nuclear and mitochondrial genomes. This poses a series of topological and temporal steps that must be completed to ensure efficient assembly of the functional enzyme. Many assembly factors have evolved to perform these steps for insertion of protein into the inner mitochondrial membrane, maturation of the polypeptide, incorporation of co-factors and prosthetic groups and to regulate this process. Much of the information about each of these assembly factors has been gleaned from use of the single cell eukaryote Saccharomyces cerevisiae and also mutations responsible for human disease. This review will focus on the assembly factors of cytochrome c oxidase to highlight some of the outstanding questions in the assembly of this vital enzyme complex.
    [Show full text]
  • Gene Expression Profiling of Corpus Luteum Reveals Important
    G C A T T A C G G C A T genes Article Gene Expression Profiling of Corpus luteum Reveals Important Insights about Early Pregnancy in Domestic Sheep Kisun Pokharel 1 , Jaana Peippo 2, Melak Weldenegodguad 1 , Mervi Honkatukia 3, Meng-Hua Li 4,* and Juha Kantanen 2,* 1 Natural Resources, Natural Resources Institute Finland (Luke), 31600 Jokioinen, Finland; kisun.pokharel@luke.fi (K.P.); melak.weldenegodguad@luke.fi (M.W.) 2 Production Systems, Natural Resources Institute Finland (Luke), 31600 Jokioinen, Finland; jaana.peippo@luke.fi 3 NordGen—The Nordic Genetic Resources Center, 1432 Ås, Norway; [email protected] 4 College of Animal Science and Technology, China Agricultural University, Beijing 100193, China * Correspondence: [email protected] (M.-H.L.); juha.kantanen@luke.fi (J.K.); Tel.: +358-295-326-210 (J.K.) Received: 2 March 2020; Accepted: 8 April 2020; Published: 10 April 2020 Abstract: The majority of pregnancy loss in ruminants occurs during the preimplantation stage, which is thus the most critical period determining reproductive success. Here, we performed a comparative transcriptome study by sequencing total mRNA from corpus luteum (CL) collected during the preimplantation stage of pregnancy in Finnsheep, Texel and F1 crosses. A total of 21,287 genes were expressed in our data. Highly expressed autosomal genes in the CL were associated with biological processes such as progesterone formation (STAR, CYP11A1, and HSD3B1) and embryo implantation (e.g., TIMP1, TIMP2 and TCTP). Among the list of differentially expressed genes, sialic acid-binding immunoglobulin (Ig)-like lectins (SIGLEC3, SIGLEC14, SIGLEC8), ribosomal proteins (RPL17, RPL34, RPS3A, MRPS33) and chemokines (CCL5, CCL24, CXCL13, CXCL9) were upregulated in Finnsheep, while four multidrug resistance-associated proteins (MRPs) were upregulated in Texel ewes.
    [Show full text]
  • COX7C (NM 001867) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC118992 COX7C (NM_001867) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: COX7C (NM_001867) Human Untagged Clone Tag: Tag Free Symbol: COX7C Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene ORF within SC118992 sequence for NM_001867 edited (data generated by NextGen Sequencing) ATGTTGGGCCAGAGCATCCGGAGGTTCACAACCTCTGTGGTCCGTAGGAGCCACTATGAG GAGGGCCCTGGGAAGAATTTGCCATTTTCAGTGGAAAACAAGTGGTCGTTACTAGCTAAG ATGTGTTTGTACTTTGGATCTGCATTTGCTACACCCTTCCTTGTAGTAAGACACCAACTG CTTAAAACATAA Clone variation with respect to NM_001867.2 5' Read Nucleotide >OriGene 5' read for NM_001867 unedited Sequence: TGTAGATTTTGTAATACGACTCACTATTAGGGCGGCCGCGAATTCGCACGAGGCCGGGGA ACAAGGTCGTGAAAAAAAGGTCTTGGTGAGGTGCCGCCATTTCATCTGTCCTCATTCTCT GCGCCTTTCGCAGAGCTTCCAGCAGCGGTATGTTGGGCCAGAGCATCCGGAGGTTCACAA CCTCTGTGGTCCGTAGGAGCCACTATGAGGAGGGCCCTGGGAAGAATTTGCCATTTTCAG TGGAAAACAAGTGGTCGTTACTAGCTAAGATGTGTTTGTACTTTGGATCTGCATTTGCTA CACCCTTCCTTGTAGTAAGACACCAACTGCTTAAAACATAAGGATGTTTCAGTTCCTCCA TTTAACAGATATGAAGAGCATTTTAAGAGGTGCAGCCTCTGGAAGTGGATCAAACTAGAA CTCATATGCCATACTAGATATGTTTGTCAATAAACTTATGACGTGAAAAAAAAAAAAAAA AAACTCGACTCTAGATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGC ATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCA CCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATA
    [Show full text]
  • Comparative Transcriptome Profile Between Iberian Pig Varieties
    animals Article Comparative Transcriptome Profile between Iberian Pig Varieties Provides New Insights into Their Distinct Fat Deposition and Fatty Acids Content Ana Villaplana-Velasco 1,2, Jose Luis Noguera 3, Ramona Natacha Pena 4 , Maria Ballester 5, Lourdes Muñoz 6, Elena González 7 , Juan Florencio Tejeda 7 and Noelia Ibáñez-Escriche 8,* 1 Genetics and Genomics, The Roslin Institute, Royal (Dick) School of Veterinary Studies, The University of Edinburgh, Easter Bush Campus, Midlothian, Edinburgh EH25 9RG, UK; [email protected] 2 Centre for Medical Informatics, Usher Institute, The University of Edinburgh, 9 Little France Road, Edinburgh EH16 4UX, UK 3 Animal Breeding and Genetics Program, IRTA, 25198 Lleida, Spain; [email protected] 4 Departament de Ciència Animal, Universitat de Lleida-Agrotecnio Center, 25198 Lleida, Spain; [email protected] 5 Animal Breeding and Genetics Program, IRTA, Torre Marimon, 08140 Caldes de Montbui, Spain; [email protected] 6 INGA FOOD S.A, 06200 Almendralejo, Spain; [email protected] 7 Department of Animal Production and Food Science, Research University Institute of Agricultural Resources (INURA), Escuela de Ingenierías Agrarias, Universidad de Extremadura, 06007 Badajoz, Spain; [email protected] (E.G.); [email protected] (J.F.T.) 8 Department for Animal Science and Tecnology, Universistat Politécnica de València, 46022 Valencia, Spain * Correspondence: [email protected]; Tel.: +34-963-877-438 Citation: Villaplana-Velasco, A.; Noguera, J.L.; Pena, R.N.; Ballester, Simple Summary: Iberian pigs are meat quality models due to their high fat content, high intra- M.; Muñoz, L.; González, E.; Tejeda, J.F.; Ibáñez-Escriche, N.
    [Show full text]