Mitochondrial Copper Homeostasis in Mammalian Cells

Mitochondrial copper homeostasis in mammalian cells

Dissertation

zur Erlangung des akademischen Grades

Doctor rerum naturalium (Dr. rer. nat.)

vorgelegt der

Fakultät Mathematik und Naturwissenschaften der Technischen Universität Dresden

von

Corina Oswald

(Diplom-Biochemikerin)

geboren am 10.04.1981 in Dohna, Deutschland

Gutachter: Prof. Dr. Gerhard Rödel Prof. Dr. Alexander Storch

Eingereicht am 30. April 2010 Verteidigt am 13. August 2010

ACKNOWLEDGEMENTS

I sincerely thank my supervisor Prof. Dr. Gerhard Rödel for giving me the opportunity to do my PhD in his group and to join the Dresden International Graduate School for Biomedicine and Bioengineering (DIGS-BB). He introduced me to the world of mitochondria, supported and provided me with all resources and comprehension necessary to conduct my research.

I thank Dr. Udo Krause-Buchholz for his scientific advice and for helping writing the paper by giving constructive comments on the manuscript.

I honestly thank my TAC members Dr. Frank Buchholz and Prof. Dr. Alexander Storch for their interest in this work, for guiding me scientifically, and for stimulating discussions in the TAC meeting. Especially, Dr. Frank Bucholz for giving insightful suggestions as RNAi specialist, and Prof. Dr. Alexander Storch for acting as reviewer of this thesis.

The dSTORM images would not have been possible without the very friendly collaboration with Prof. Dr. Markus Sauer and Sebastian van de Linde, Institute for Applied Laser Physics and Laser Spectroscopy of the University of Bielefeld. Thank you!

I am furthermore grateful to all former and present lab members for the friendly working atmosphere, for fruitful discussions, for providing advice and assistance in many situations. In particular, I thank the “girls” in the lab – Anja, Kirsten, Susi2, Simone and Uta for struggling together through the ups and downs.

I am grateful to Uta Gey, Dr. Kristof Zarschler and Dr. Kai Ostermann for critical proof reading of the thesis.

Special thanks are dedicated to my friends for all our unforgettable moments together.

I sincerely thank my parents, who helped, supported and encouraged me all the time.

Above all, I want to thank Stefan for always being there, motivating and believing in me.

CONTENTS

List of Figures and Tables iv Abbreviations v Abstract 1

1 Indroduction 2

1.1 Mitochondria and the respriratory chain 2 1.2 The human mitochondrial genome 4 1.3 Homoplasmy and heteroplasmy 6 1.4 Mitochondrial disorders 6 1.4.1 Mutations in mitochondrial DNA 7 1.4.2 Mutations in nuclear DNA 8 1.5 Cytochrome c oxidase 9 1.6 Cytochrome c oxidase assembly 11 1.7 Copper and its trafficking in the cell 13 1.8 Mitochondrial copper metabolism 15 1.9 Cox17 19 1.10 Aims of the thesis 21

2 Materials and Methods 22

2.1 Materials 22 2.1.1 Chemicals and reagents 22 2.1.2 Antibodies 24 2.1.3 Plasmid 24 2.1.4 Kits 25 2.1.5 Marker 25 2.1.6 Enzymes 25 2.1.7 Primers 26 2.1.8 siRNAs 26 2.2 Methods 28 2.2.1 Cell culture 28 2.2.1.1 Cell culture: HeLa cells 28 2.2.1.2 Cell culture: HeLa cells transfected with pTurboRFP-mito 28

CONTENTS

2.2.1.3 Subcultivation 29 2.2.1.4 Determination of cell number 29 2.2.1.5 Cell storage and thawing 29 2.2.2 Transient transfection of HeLa cells 30 2.2.3 Transfection of HeLa cells with pTurboRFP-mito 30 2.2.4 Immunocytochemistry 31 2.2.5 RNA extraction and quantitative real-time PCR 31 2.2.6 Isolation of mitochondria 32 2.2.6.1 Isolation of mitochondria for BN-PAGE Analysis 32 2.2.6.2 Isolation of mitochondria for localization studies 33 2.2.6.3 Isolation of bovine heart mitochondria 33 2.2.7 Proteinase K treatment of mitochondria and mitoplasts 34 2.2.8 Photometric activity assay 34 2.2.8.1 Citrate synthase activity 34 2.2.8.2 Cytochrome c oxidase activity 35 2.2.9 Blue native polyacrylamide gel electrophoresis (BN-PAGE) 36 2.2.9.1 In gel activity assay 37 2.2.9.2 2D-BN/SDS-PAGE 37 2.2.10 SDS-PAGE and Western blot analysis 37 2.2.11 Direct stochastic optical reconstruction microscopy (dSTORM) 38 2.2.12 Flow cytometric phenotyping 39 2.2.12.1 Determination of cell cyle phase 39 2.2.12.2 Identification of apoptotic cells 40 2.2.12.3 Detection of ROS 41 2.2.13 Oxygen measurement 42 2.2.14 Cu–His supplementation 43

3 Results 44

3.1 Subcellular localization of Cox17 44 3.2 Transient knockdown of COX17 in HeLa cells 46 3.2.1 Knockdown of COX17 mRNA 47 3.2.2 Knockdown of Cox17 protein 49 3.2.3 Effect of COX17 knockdown on the steady-state levels of OXPHOS subunits 50 3.2.4 Effect of COX17 knockdown on the steady-state levels of copper- bearing COX subunits 51

CONTENTS

3.2.5 Subdiffraction-resolution fluorescence imaging 51 3.3 Phenotypical characterization 56 3.3.1 Growth analyis 57 3.3.2 Cell cycle analysis 57 3.3.3 Apoptosis assay 59 3.3.4 Detection of ROS 61 3.3.5 Oxygen measurement 63 3.4 Cytochrome c oxidase activity 64 3.5 Characterization of mt OXPHOS complexes 65 3.5.1 BN-PAGE/in gel activity assays 65 3.5.2 Supramolecular organization of COX 67 3.5.3 Molecular organization of Cox17 68 3.5.4 Molecular organisation of copper-bearing COX subunits Cox1 and Cox2 69 3.5.5 Supramolecular organization of RC complexes 70 3.5.6 dSTORM of supercomplexes 72 3.6 Copper supplementation 74

4 Discussion 75

4.1 Dual localization of human Cox17 75 4.2 COX17 knockdown affects steady-state levels of copper-bearing COX subunits Cox1 and Cox2 77 4.3 Supramolecular organization of RC is affected as an early response to COX17 knockdown 79 4.4 Cox17 is primarily engaged in copper delivery to Sco1/Sco2 82 4.5 Copper supplementation alone cannot rescue the COX17 phenotype 84 4.6 Outlook 85

5 Appendix 88

6 PhD publication record 96

7 References 97

iii

LIST OF FIGURES AND TABLES

Figure 1.10. Oxidative phosphorylation. 3

Figure 1.20. Model of mammalian I1III2IV1 supercomplex. 4 Figure 1.30. Molecular organization of COX. 10 Figure 1.40. Illustration of the electron flow through the COX. 11 Figure 1.50. Model of the assembly pathway of human COX. 12 Figure 1.60. Pathways of copper trafficking within a mammalian cell. 14

Figure 1.70. NMR solution structures of apo- and Cu1-Cox172S-S. 20 Figure 2.10. Respective positions of the siRNA sequence on COX17 mRNA. 27 Figure 2.20. Quantification of cell cycle distribution of HeLa cells. 40 Figure 2.30. Sample data using Annexin V-FITC Apoptosis Detection Kit. 41 Figure 2.40. DCF fluorescence in HeLa cells. 42 Figure 3.10. Localization of human Cox17. 45 Figure 3.20. siRNA transfection efficiency in HeLa cells. 47 Figure 3.30. Transient knockdown of COX17 mRNA. 48 Figure 3.40. Effect of transient knockdown of COX17 in HeLa cells. 49 Figure 3.50. The principle of dSTORM image analysis. 52 Figure 3.60. Subdiffraction-resolution imaging of immunolabeled pTurboRFP mito HeLa cells transfected with COX17 siRNAs. 55 Figure 3.70. Growth of COX17 knockdown cells. 57 Figure 3.80. Cell cycle analysis. 58 Figure 3.90. Identification of apoptotic cells by flow cytometry. 60 Figure 3.10. ROS production in HeLa cells. 62 Figure 3.11. Respiration rate in COX17 knockdown cells. 63 Figure 3.12. COX activity of COX17 knockdown cells. 64 Figure 3.13. BN-PAGE/in gel activity of digitonin solubilized mitochondria. 66 Figure 3.14. Supramolecular organization of RC complexes. 68 Figure 3.15. 2D-BN/SDS-PAGE of OXPHOS complexes. 70 Figure 3.16. Molecular organization of RC complexes. 72 Figure 3.17. dSTORM of supercomplexes. 73

Table 2.1. List of gel electrophoresis markers. 25 Table 2.2. List of siRNAs. 26

ABBREVIATIONS

AEBSF 4-(2-Aminoethyl)benzenesulfonyl fluoride adPEO Autosomal dominant progressive external ophthalmoplegia APS Ammonium persulphate BHM Bovine heart mitochondria BN Blue native BSA Bovine serum albumine CHAPS 3-[(3-Cholamidopropyl)dimethylammonio]-1- propanesulfonate COX Cytochrome c oxidase CPEO Chronic progressive external ophthalmoplegia CS Citrate synthase Cu-His Copper-histidine DCFH-DA 2′,7′-Dichlorodihydrofluorescein diacetate Ddp Deafness dystonia protein DTNB 5,5’-dithio-bis(2-nitrobenzoate) ddH2O Double distilled water DMEM Dulbecco’s Modified Eagle Medium DOX Doxycycline dNTP Deoxynucleoside triphosphate dSTORM Direct stochastic optical reconstruction microscopy EDTA Ethylendiamin-tetraacetic acid et al. et alii, and others FBS Fetal bovine serum FMN Flavin mononucleotide FITC Fluorescein isothiocyanate FL Fluorescence FRET Fluorescence resonance energy transfer GAPDH Glyceraldehyde 3-phosphate dehydrogenase HMW High molecular weight Hsp60 Heat shock protein 60 HRP Horse radish peroxidase IEF Isoelectric focusing IgG Immunoglobulin G IMM Inner mitochondrial membrane

ABBREVIATIONS

IMS Intermembrane space KSS Kearns-Sayre syndrome LDH Lactate dehydrogenase MELAS Mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes MERRF Myoclonic epilepsy associated with ragged-red fibres MIDD Maternally inherited diabetes with deafness MOPS 3-[N-Morpholino]propanesulfonic acid mRNA Messenger RNA mt Mitochondrial mtDNA Mitochondrial DNA MW Molecular weight NAD+ β-nicotinamide adenine dinucleotide NADH Reduced β-nicotinamide adenine dinucleotide NARP Neurogenic muscle weakness, ataxia, and retinitis pigmentosa NDUFB9 NADH dehydrogenase (ubiquinone) subunit 9 nDNA Nuclear DNA NMR Nuclear magnetic resonance nt Nucleotide NTB Nitro tetrazolium blue OMM Outer mitochondrial membrane OXPHOS Oxidative phosphorylation PAA Polyacrylamide PBS Phosphate buffered saline PDH Pyruvate dehydrogenase PS Phosphatidylserine PMS Phenazine methosulfate PI Propidium iodide PIC Protease inhibitor cocktail PVDF Polyvinylidene fluoride RC Respiratory chain RFP Red fluorescent protein RITOLS RNA incorporation throughout the lagging strand RNAi RNA interference ROS Reactive oxygen species rRNA Ribosomal RNA RT Room temperature

ABBREVIATIONS

RT-PCR Reverse transcription – polymerase chain reaction S. cerevisiae Saccharomyces cerevisiae SCs Supercomplexes SDM Strand-displacement mechanism SDS Sodium dodecyl sulphate SEM Standard error of the mean shRNA Short hairpin RNA siRNA Short interfering RNA SOD1 Cu/Zn-superoxide dismutase SOD2 Mn-superoxide dismuatse STED Stimulated Emission Depletion microscopy TBS Tris buffered saline TCEP Tris (2-carboxyethyl) phosphine hydrochloride TEMED N,N,N',N'-tetramethylethylenediamine Tet Tetracycline TOM Translocase outer membrane Tris Tris (hydroxymethyl) aminomethane Triton X-100 T-octylpenoxpolyethoxethanol tRNA Transfer RNA Tween-20 Polyoxyethylene (20) sorbitan monolaurate ultra ddH2O Ultra pure double distilled water v/v Volume per volume VDAC Voltage-dependent anion channel, porin w/v Weight per volume

vii

ABSTRACT

Assembly of cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, requires a concerted activity of a number of chaperones and factors for the correct insertion of subunits, accessory proteins, cofactors and prosthetic groups. Most of the fundamental biological knowledge concerning mitochondrial copper homeostasis and insertion of copper into COX derives from investigations in the yeast Saccharomyces cerevisiae. In this organism, Cox17 was the first identified factor involved in this pathway. It is a low molecular weight protein containing highly conserved twin Cx9C motifs and is localized in the cytoplasm as well as in the mitochondrial intermembrane space. It was shown that copper-binding is essential for its function. So far, the role of Cox17 in the mammalian mitochondrial copper metabolism has not been well elucidated. Homozygous disruption of the mouse COX17 gene leads to COX deficiency followed by embryonic death, which implies an indispensable role for Cox17 in cell survival. In this thesis, the role of COX17 in the biogenesis of the respiratory chain in HeLa cells was explored by use of siRNA. The knockdown of COX17 results in a reduced steady-state concentration of the copper-bearing subunits of COX and affects growth of HeLa cells accompagnied by an accumulation of ROS and apoptotic cells. Furthermore, in accordance with its predicted function as a copper chaperone and its role in formation of the binuclear copper center of COX, COX17 siRNA knockdown affects COX-activity and -assembly. It is now well accepted that the multienzyme complexes of the respiratory chain are organized in vivo as supramolecular functional structures, so called supercomplexes. While the abundance of COX dimers seems to be unaffected, blue native gel electrophoresis reveals the disappearance of COX-containing supercomplexes as an early response. Accumulation of a novel ~150 kDa complex containing Cox1, but not Cox2 could be observed. This observation may indicate that the absence of Cox17 interferes with copper delivery to Cox2, but not to Cox1. Data presented here suggest that supercomplex formation is not simply due to assembly of completely assembled complexes. Instead an interdependent assembly scenario for the formation of supercomplexes is proposed that requires the coordinated synthesis and association of individual complexes.

INTRODUCTION

1 INDRODUCTION

1.1 MITOCHONDRIA AND THE RESPRIRATORY CHAIN

Mitochondria are complex subcellular organelles which perform a wide range of necessary functions, including ATP production, citric acid cycle, fatty acid oxidation, calcium homeostasis, and the production of heme and iron-sulfur clusters (Rizzuto et al., 1998; Scheffler, 2001; McBride et al., 2006). Finally, they play an important role in the regulation of apoptosis (Green and Reed, 1998). Structurally, mitochondria contain two membranes that separate four distinct compartments: the outer membrane (OMM), intermembrane space (IMS), inner membrane (IMM), and the matrix. The two membranes are themselves very different in structure and in function. The OMM contains numerous integral porin proteins, resulting in a membrane that is permable to water, ions, and small proteins (< 5000 Da) (Mannella, 1992; Vander Heiden et al., 2000). The IMM is impermeable, enabling the maintenance of the transmembrane potential (ΔΨ). It is highly folded into cristae, which house the megadalton complexes of oxidative phosphorylation (OXPHOS) (Gilkerson et al., 2003). As the site of OXPHOS, mitochondria provide a highly efficient route to generate ATP from energy-rich molecules. Respiration consists of the sequential transfer of electrons extracted from nutrient compounds through the chain of oxidoreductase reactions, leading to reduction of molecular oxygen to water. Briefly, electrons are transported in the respiratory chain (RC) from NADH or succinate to complex I (NADH ubiquinone oxidoreductase) or complex II (succinate ubiquinone oxidoreductase), respectively, and further via complex III (ubiquinol cytochrome c oxidoreductase) and complex IV (cytochrome c oxidase, COX) to the terminal acceptor molecular oxygen (Hatefi, 1985). In the process, protons (H+) are pumped from the matrix across the IMM into the IMS through respiratory complexes I, III, and IV (Babcock and Wikstrom, 1992). The resulting electrochemical proton gradient (ΔΨ) finally leads to the production of ATP by phosphorylation of ADP via complex V (F1F0-ATP synthase) (Figure 1.1).

INTRODUCTION

Figure 1.1. Oxidative phosphorylation. ATP is generated by the coordinated activity of five multimeric enzyme complexes. Complex I accepts electrons from NADH, and passes them to coenzyme Q (UQ), which also receives electrons from complex II. UQ transfers electrons to complex III, which passes them to cytochrome c (Cyt c). Cytochrome c delivers electrons to complex IV, which uses the electrons and hydrogen ions to reduce molecular oxygen to water. As electrons are transported from one complex to another, protons (H+) are pumped from the mt matrix into the mt IMS, creating an electrochemical proton gradient across the IMM, called ΔΨ. This electrochemical proton gradient allows ATP synthase to use the flow of H+ through the enzyme back into the matrix to generate ATP from ADP and inorganic phosphate (http://tyrosine.umdnj.edu/w wiki/index.php).

Two different models were proposed to describe the arrangement of RC complexes in the IMM. Spectrophotometric pioneering studies of Chance and Williams (1955) depicting the RC as a solid state assembly, in which the substrates are directly channelled between the complexes. This model was substantially confirmed (Capaldi, 1982; Gupte et al., 1984), leading to the postulation of the random collision model, according to which the complexes diffuse individually in the IMM (Hackenbrock et al., 1986). Much more recently, Schägger and Pfeiffer (2000) produced new evidence in favor of a solid state organization of the entire OXPHOS system. They found specific aggregation of the RC complexes to so called supercomplexes (SCs) and introduced the model of the ‘respirasome’. Recent data by Acin-Pérez and coworkers (2008) convincingly show that in mammalian cells RC complexes assemble into functional SCs (Figure 1.2). In addition to a complex I monomer (I1) and a comple III dimer (III2) SCs contain either no or a variable number of complex IV (IV0-4), whereby I1III2IV1 of approximately 1,7 MDa seems to represent the major physiological module of the mammalian RC (Schägger and Pfeiffer, 2000, 2001; Schäfer et al.,

INTRODUCTION

2006). The data as well suggest that complexes II and V are also engaged in SC formation (Acin-Pérez et al., 2008). Several roles have been proposed for SCs, including substrate channelling, catalytic enhancement (Schägger and Pfeiffer, 2000), and stabilization of protein complexes (Acin-Pérez et al., 2004). The importance of complex IV for the assembly and stability of complexes I and III in their supramolecular organization has been demonstrated (Schägger et al., 2004; Schäfer et al., 2006; Suthammarak et al., 2009). Pulse-chase experiments revealed that SC formation is a specific and ordered process of individual complexes and not caused by preparative or electrophoretic artefacts (Acin-Pérez et al., 2008).

Figure 1.2. Model of mammalian I1III2IV1 supercomplex. 3D map (obtained from electron microscopy) of complex I (yellow), X-ray structure of the complex III dimer (red) and X-ray structure of complex IV (green). The left column shows a surface representation in blue of the supercomplex I1III2IV1 3D map. The middle column displays the 3D map with a semitransparent surface and the fitted structures of the individual complexes. The right column shows only the three individual complexes as they would assemble to form the supercomplex. The location of the membrane is depicted in purple (taken in part from Schäfer et al. (2007)).

1.2 THE HUMAN MITOCHONDRIAL GENOME

The 16,569 base pairs long, double-stranded, circular, self-replicating mitochondrial DNA (mtDNA) molecule (Anderson et al., 1981) encodes 13 of the approximately 90 subunits that form the RC, the remaining ones being encoded by the nuclear genome (nDNA). These latter proteins are synthesized in the cytoplasm and imported into mitochondria where they are assembled, together with the mtDNA encoded subunits, to form the RC complexes of the IMM (Lang et al., 1999). Moreover, mtDNA encodes two ribosomal RNAs (rRNAs) and 22 transfer RNAs (tRNAs) for the internal mt translation machinery, which uses its own genetic code (Barrell et al., 1979).

INTRODUCTION

In contrast to the nDNA, mtDNA is not associated with histones but organized in nucleoids, nucleoprotein complexes associated with the IMM (Iborra et al., 2004; Legros et al., 2004). Each human nucleoid is supposed to contain two to eight mtDNA molecules and distributed throughout the entire mt compartment (Legros et al., 2004). The mt genome shows a compact gene organization, with only 1.1 kilobase pairs of non-coding DNA sequence.

The mechanism of mtDNA replication is not fully understood, but for almost 30 years mtDNA replication was assumed to occur through a strand- displacement mechanism (SDM) (Robberson et al., 1972). This model proposes an asynchronous strand replication in which both strands (heavy/leading (H) and light/lagging (L)) of the circular genome are replicated semi-independently. The replication of mtDNA starts in the major non-coding (regulatory) region (D-loop) as it contains the H-strand replication origin, designated as OH, displacing the L-strand from the H-strand. The L-strand is single stranded until synthesis of the nascent H-strand exposes the L-strand replication origin, OL. At this point, replication of the L-strand starts in the opposite direction until both strands have been completely replicated. The alternative RITOLS (RNA incorporation throughout the lagging strand) model proposes both, a bidirectional coupled H-strand and L-strand synthesis mode as well as an unidirectional mode in which the L-strand is initially laid-down as RNA (Holt et al., 2000). Very recently, Pohjoismaki and co-workers (2010) convincingly confirmed the RITOLS model, in which the replication initiates in the non-coding region close to or at OH, displacing the L-strand from the H- strand. The RITOLS model is similar to the asynchronous mode of replication, but RNA intermediates are produced on the L-strand preceding conversion to DNA (Krishnan et al., 2008).

Approximately 1,500 different mt proteins exist (Distler et al., 2008), whereby the mammalian mt proteome exhibits considerable tissue heterogeneity (Chan, 2006; Reifschneider et al., 2006; Johnson et al., 2007). Mitochondria are active structures and their morphology and intracellular dynamics can be tightly controlled by the processes of continuous fission- fusion events, inner membrane/cristae formation and mt remodeling (Chan, 2006). Consequently, in most mammalian cells mitochondria exist as branched chain reticulum networks with a diverse distribution within the cell.

INTRODUCTION

Most frequently, mitochondria localize to sites where ATP demand is highest (Li et al., 2004), and it could be shown that tissues with high demand for aerobic respiration, such as skeletal muscle and heart, have the most prominent reticulum network (Kirkwood et al., 1986; Bach et al., 2003). In addition, movement of mitochondria is mediated by the interaction with the cytoskeleton and their transport is modulated in response to physiological signals (Hollenbeck and Saxton, 2005).

1.3 HOMOPLASMY AND HETEROPLASMY

The mt genome is exclusively maternal inherited and present at high copy number within a typical human cell (~1,000–4,000 copies / cell) (Giles et al., 1980; Lightowlers et al., 1997; Legros et al., 2004). The multiple copies of mtDNA per cells are homoplasmic in normal cells, however, recent studies revealed an apparently low level of heteroplasmy* in the mtDNA (He et al., 2010). The frequency of heteroplasmic variants differs between various tissues of the same individual, indicating that an individual does not have a single mtDNA genotype. These heteroplasmic variants may be maternally inherited or the result of somatic mutations (Polyak et al., 1998; Wai et al., 2008; He et al., 2010). The level of heteroplasmy is an important factor in determining the amount of mt dysfunction, because clinical phenotypes are often assumed to be associated with a threshold level of mutation (Sciacco et al., 1994).

1.4 MITOCHONDRIAL DISORDERS

OXPHOS is under the genetic control of the nDNA and the maternally inherited mtDNA. Mt diseases might occur by defects in both genomes, whereby tissues with high energy demand such as the brain, muscle and heart, are affected most frequently.

*Homoplasmy is the genetic state of mitochondria, in which all of the mtDNA copies are identical within a cell or an individual, whereas heteroplasmy describes the coexistence of two or more genotypes.

INTRODUCTION

1.4.1 MUTATIONS IN MITOCHONDRIAL DNA

Human mtDNA mutations were discovered for the first time in 1988 (Holt et al., 1988 and Wallace 1988), and today hundreds of points mutations, deletions, or rearrangements in mtDNA associated with diseases are known (Chan, 2006). Maternal inherited mutations in mtDNA may cause mt diseases including muscle weakness, diabetes, stroke, or heart failure (Giles et al., 1980; Ankel- Simons and Cummins, 1996; Chan, 2006). In almost all mt diseases caused by mutant mtDNA, the patients cells are heteroplasmic with normal and mutant mtDNA coexisting (Wallace, 1999). A minimum critical number of mutated mtDNA molecules has to be present before clinical symptoms appear and it seems likely that the pathogenic threshold is lower in tissues that are dependent on oxidative metabolism (White et al., 2005). However, the proportion of mutant mtDNA in most cases determines the severity of disease (Macmillan et al., 1993; Elliott et al., 2008). Classical mt diseases, like myoclonic epilepsy associated with ragged-red fibres (MERRF) (Shoffner et al., 1990) or mt encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS) (Enter et al., 1991) are caused by point mutations in tRNAs. The same mutation can thereby trigger different clinical outcome, for example the base substitution A3243G (Goto et al., 1990), the most common mutation of MELAS, can sometimes cause less severe disorders like maternally inherited diabetes with deafness (MIDD) or it may lead to neurogenic muscle weakness, ataxia, and retinitis pigmentosa (NARP)) (Kirches et al., 2001). It is hypothesized that the heterogeneous tissue distribution might cause this variety of distinct diseases. In contrast, different mutations can result in similar phenotypes, which e.g. are associated with progressive neurodegenerative disorder of infancy and early childhood (Leigh syndrome (Leigh, 1951)) (Naess et al., 2009). Large deletions or duplications in the range of several kilobase pairs are observed in the three main clinical phenotypes: Chronic Progressive External Ophthalmoplegia (CPEO), in Pearson's Syndrome and in Kearns-Sayre Syndrome (KSS) (Wallace, 1992). The majority of these large-scale rearrangements of mtDNA are sporadic and therefore supposed to be the result of single mutational event occurring in the early embryonic development (Schon et al., 1989; Chen et al., 1995).

INTRODUCTION

1.4.2 MUTATIONS IN NUCLEAR DNA

Nuclear encoded gene products account for many mt diseases, including disorders due to (i) nuclear gene defects encoding structural components or assembly factors of the OXPHOS system, (ii) gene defects altering the abundance and stability of the mtDNA and (iii) gene defects encoding non- OXPHOS mt proteins (Zeviani and Di Donato, 2004). Disorders due to nuclear gene defects encoding structural components or assembly factors of the OXPHOS system are the main group of diseases associated with nDNA abnormalities. Several disease-associated mutations in nDNA encoded structural subunits of complex I, II and III have been identified (Bourgeron et al., 1995; Loeffen et al., 1998; Budde et al., 2000; Triepels et al., 2001; Haut et al., 2003). In most cases, the affected individuals show clinical characteristics of Leigh syndrome, occasionally complicated by cardiomyopathy, or multisystem involvement (Morris et al., 1996; Parfait et al., 2000). Defects of genes involved in the assembly of respiratory complexes affect, so far, the assembly of complex III, IV and V (Tiranti et al., 1998; de Lonlay et al., 2001; De Meirleir et al., 2004; Leary et al., 2007). Mutations in assembly factors of complex IV, including SURF1, SCO1, SCO2 and COX10, are thereby the most common observation (Papadopoulou et al., 1999; Valnot et al., 2000a; Valnot et al., 2000b; Agostino et al., 2003). Particularly, mutations in SURF1, which encodes a 30 kDa hydrophobic protein located in the IMM, are relatively frequent and account for the majority of the Leigh syndrome cases due to COX deficiency (Tiranti et al., 1999). The second group comprised nDNA mutations in factors altering the abundance and stability of the mtDNA. Mutations in POLG1 and POLG2, encoding mt polymerase gamma 1 and 2, respectively, are of particular interest (Van Goethem et al., 2001; Hudson and Chinnery, 2006). They represent the most common causes of autosomal dominant progressive external ophthalmoplegia (adPEO) (Spinazzola and Zeviani, 2005), a mt disease characterized by accumulation of multiple large deletions of mtDNA in patients tissues (Suomalainen et al., 1997). Several neurodegenerative disorders are associated with an impairment of mt biogenesis and OXPHOS. These are diseases caused by mutations in nuclear genes encoding non-OXPHOS mt proteins, such as frataxin in Friedreich

INTRODUCTION ataxia, a mt protein which is likely to play an important role in iron handling and iron-sulfur protein maintenance (Campuzano et al., 1997; Martelli et al., 2007) and Ddp1 (deafness dystonia protein 1), a component of the import machinery, which is responsible for X-linked deafness-dystonia syndrome (Koehler et al., 1999).

1.5 CYTOCHROME C OXIDASE

The cytochrome c oxidase (COX) is the terminal enzyme of the eukaryotic RC. This membrane embedded complex acts as a dimer (Henderson et al., 1977; Frey and Murray, 1994) and faces both, the mt IMS and the mt matrix, whereas it emerges slightly more to the mt IMS side (Carr and Winge, 2003). According to the structure of the bovine enzyme, mammalian COX is composed of 13 structural subunits, with the three mtDNA encoded subunits Cox1, Cox2 and Cox3 forming the catalytic core of the enzyme (Tsukihara et al., 1996; Yoshikawa et al., 1998). The two heme a moieties (a and a3) and the two copper centers (CuA and CuB) within subunits Cox1 and Cox2 are responsible for the electron transfer and are essential for catalytic competence (Capaldi, 1990). The remaining ten subunits (Cox4, Cox5a, Cox5b, Cox6a, Cox6b, Cox7a, Cox7b, Cox7c and Cox8), which are thought to play a role in stabilizing the enzyme and modulating its activity (Arnold and Kadenbach, 1997; Kadenbach et al., 2000), are encoded in the nDNA and have to be imported and assembled in concert with the mtDNA encoded subunits.

Figure 1.3 (a) presents an illustration of mammalian COX, showing exclusively subunits that contain cofactors or are engaged in early assembly steps of the enzyme. The crystal structure of the dimeric COX from bovine heart is depicted in Figure 1.3 (b).

INTRODUCTION

(a) (b)

ΔΨ

Figure 1.3. Molecular organization of COX. (a) Illustration of mammalian COX subunits that contain cofactors or are enganged in early assembly steps (according to Khalimonchuk and Rödel (2005) and Fernandez- Vizarra et al. (2009)). (b) Structure of the bovine COX (taken in part from Carr and Winge (2003)). The three mt encoded subunits Cox1, Cox2 and Cox3 are highlighted in yellow, blue and green, respectively.

COX catalyzes the reduction of molecular oxygen to water and concomitantly the oxidation of reduced cytochrome c. During the catalytic cycle, reduced

cytochrome c binds to Cox2 and transfers electrons to the CuA site, which is

located in the COX domain projecting to the IMS. Reduced CuA then transfers

the electrons through heme a to the heme a3/CuB binuclear reaction center, both associated with Cox1, where they are used to reduce molecular oxygen to water (Figure 1.4).

A single redox cycle of the COX is accompanied by the transport of two protons from the matrix to the mt IMS, thus contributing to the transmembrane proton gradient and providing the free energy needed for ATP synthesis (Wikstrom, 1977).

INTRODUCTION

Figure 1.4. Illustration of the electron flow through the COX. The IMM and the metal centers involved in electron transfer reactions are shown.

Electrons are transported from reduced cytochrome c to the CuA site within the subunit

Cox2. Reduced CuA transfers the electrons through heme a to the heme a3/CuB binuclear center within Cox1, where they are used to reduce molecular oxygen to water (according to Khalimonchuk and Rödel (2005)).

For the proper assembly of a functional holoenzyme complex, additional nuclear encoded accessory factors are necessary. In Saccharomyces cerevisiae (S. cerevisiae), approximately 20 accessory proteins are required for COX biogenesis and are involved in specific stages of the assembly process (Grivell et al., 1999; Fontanesi et al., 2006). More than a half of these proteins have known human homologues (Petruzzella et al., 1998; Barrientos et al., 2002).

1.6 CYTOCHROME C OXIDASE ASSEMBLY

The assembly of the multi-subunit COX complex is a complicated sequential process that involves the coordinated action of two genomes. Expression of mtDNA encoded subunits, expression of nDNA encoded subunits and import into the mitochondria, as well as the addition of prosthetic groups prior to COX assembly are tightly regulated processes (Fontanesi et al., 2006). The knowledge of the COX assembly process is still limited despite the efforts of a large number of laboratories.

Studies in human cells have revealed three distinct COX assembly intermediates, so called subcomplexes S1, S2 and S3, that probably represent rate-limiting steps in the process (Figure 1.5) (Nijtmans et al., 1998). The

INTRODUCTION first (S1) consist exclusively of Cox1 which is the most hydrophobic and biggest (57 kDa) protein of the core subunits (Capaldi, 1990). It spans the IMM with twelve transmembrane helices (Carr and Winge, 2003) and appears to be the key subunit for both, the assembly and function of COX. The subcomplex S2 comprises Cox1, Cox4 and Cox5a. The insertion of heme a into Cox1 is required for the formation of S2 subcomplex, as patients with mutations in COX10 and COX15, two enzymes involved in the terminal steps of the heme a biosynthetic pathway (Barros et al., 2002; Barros and Tzagoloff, 2002), fail to accumulate the S2 assembly intermediate (Antonicka et al., 2003a; Antonicka et al., 2003b; Williams et al., 2004). The insertion of heme a3 and CuB are likely to occur concertedly, prior to incorporation of Cox2 into the S3 complex (Stiburek et al., 2006). Metallation of Cox2, the smallest (26 kDa) and least hydrophobic core subunit possessing two transmembrane domains, is likewise necessary for the progression to the S3 stage of COX assembly. S2 intermediates accumulate in patients with mutations in SCO1 and SCO2 (Leary et al., 2004; Williams et al., 2004; Stiburek et al., 2005), two metallochaperones responsible for the insertion of copper into the COX catalytic center. After insertion of Cox2 a cascade-like, rapid incorporation of most of the remaining COX subunits occurs to produce S3. Finally, after addition of Cox6a, Cox7a, or Cox7b the assembly of the monomeric holoenzyme (S4) is completed (Nijtmans et al., 1998). Further maturation to form a COX dimer and additional assembly into supercomplexes are necessary to maximize its efficiency and to facilitate the aerobic production of ATP (Poyton and McEwen, 1996; Krause et al., 2004).

Figure 1.5. Model of the assembly pathway of human COX. Three assembly intermediates in the biosynthetic pathway leading to the formation of holo-COX (S4). According to Nijtmans et al. (1998), Stiburek et al. (2006) and Fernandez-Vizarra et al. (2009).

INTRODUCTION

The insertion of cofactors, among them copper for the two redox active metal centers CuA and CuB, is responsible for the catalytic activity of the enzyme and essential for COX assembly.

1.7 COPPER AND ITS TRAFFICKING IN THE CELL

Copper is an essential nutrient required for the activity of a number of enzymes with diverse biological roles. It is required as a catalytical cofactor for a number of biological processes including respiration, iron transport, oxidative stress protection, cell growth, and development (Harris, 2000; Puig and Thiele, 2002). Copper has the ability to cycle between two redox states, oxidized Cu2+ and reduced Cu1+ and due to these redox properties, stringent control systems for copper homeostasis are necessary. Metallochaperones facilitate the transport of copper ions to specific sites and prevent the inappropriate interaction of copper ions with other molecules (Cobine et al., 2004). A number of copper binding proteins for the delivery of copper into the various cellular compartments were initial identified mainly from studies in S. cerevisiae (O'Halloran and Culotta, 2000). Nevertheless, the pathways of copper metabolism in the cell are evolutionarily conserved (Bartnikas and Gitlin, 2001). The proposed trafficking routes within mammalian cells are shown in Figure 1.6 (Bartnikas and Gitlin, 2001). Copper is taken up by the two high affinity transporters Ctr1 and Ctr3 after reduction to Cu1+ on Fre1/2 (Martins et al., 1998; Pena et al., 2000; Lee et al., 2002; De Freitas et al., 2003) and then delivered to the different compartments by one of the three copper chaperons Atox1 (secretory pathway), Ccs1 (metallation of cytoplasmic localized superoxide dismutase (SOD1)) and Cox17 (mt pathway).

INTRODUCTION

Figure 1.6. Pathways of copper trafficking within a mammalian cell. Three pathways of metallochaperone mediated copper delivery are shown. Copper is taken up into the cell via Ctr1 and delivered by Cox17, Ccs1 and Atox1 to their respective protein targets COX, SOD1 and Wilson and Menkes copper transporting ATPases (Bartnikas and Gitlin, 2001).

The transport of copper to the different compartments requires a transient interaction between the metallochaperone and the target enzyme. Studies of Atox1 (anti-oxidant 1, previously HaH1 for human Atx homolog 1) (Klomp et al., 1997) indicate copper dependent interaction between this protein and the two human copper transporting ATPases, Atp7A (Menkes protein) and Atp7B (Wilson protein). This interaction facilitates the transfer of copper into the secretory pathway and copper export from the cell. Results of Hamza et al. (2001) emphasize the role of Atox1 as copper chaperone, as homozygous null mice died shortly after birth. Cytosolic copper shuttling is mediated by Ccs1 (copper chaperone for superoxide dismutase), a 70 kDa homodimer, which is important for activation of Cu/Zn-superoxide dismutase (SOD1) (Prohaska et al., 2003). Ccs1 interacts physically with SOD1 by two putative metal binding sites to secure the enzyme during copper insertion (Casareno et al., 1998; Eisses et al., 2000). Deletion of CCS1 in the mice revealed a marked reduction in SOD1 activity and produces a phenotype similar to SOD1 (−/−) mice, which demonstrate the essential role of Ccs1 in mammalian copper homeostasis (Wong et al., 2000). The third compartment that requires copper ions for normal function are the mitochondria, especially for metallation of

INTRODUCTION

COX and mt localized SOD1. The delivery of copper ions to the mitochondria and their further distribution will be discussed in more detail below.

1.8 MITOCHONDRIAL COPPER METABOLISM

The exact pathways of copper trafficking to the mitochondria are not fully understood. However, within mitochondria, copper is required for incorporation into the COX subunits Cox1 and Cox2 during the biogenesis of COX and for maturing the small mt fraction of SOD1 (Cobine et al., 2006a). The metallation of these two enzymes occurs within the mt IMS and depends on evolutionarily conserved enzyme-specific copper chaperones.

Copper delivery to COX The delivery and insertion of copper into COX is still not well understood despite of many available data. A number of mt proteins that are able to bind copper have been identified in yeast and depletion of most of them results in respiratory deficiency (Horn and Barrientos, 2008). These data imply that the successful delivery of metals to the site of COX assembly and their proper insertion are important steps in the complex formation. It has been established that Cox17 participates in this process in both, yeast and mammalian cells. However, the mechanisms of metal transfer by Cox17 as well as distinct protein partners are still not known (Palumaa et al., 2004). Involvement of Cox17 in copper homeostasis was originally proposed due to the respiratory deficient phenotype of yeast COX17 null mutants, which could be rescued by supplementation of high concentrations of exogenous copper (Glerum et al., 1996a). Yeast Cox17, a low molecular weight protein containing a highly conserved Cx9C motif is localized in the cytoplasm and in the mt IMS. Thus, it was proposed that Cox17 could shuttle copper between this two compartments (Glerum et al., 1996a; Beers et al., 1997). It was subsequently shown that copper binding is essential to its proper function (Heaton et al., 2000) and that the function of Cox17 is critical during early mammalian development (Takahashi et al., 2002). There is evidence that Cox17 delivers copper ions to two additional copper chaperones, Sco1 (Glerum et al., 1996b) and Cox11 (Carr et al., 2002). These proteins are anchored in the IMM through a transmembrane α-helix and participate in the copper insertion into the COX CuA (Cox2) and CuB (Cox1) active sites,

INTRODUCTION respectively, via their mt IMS exposed copper binding sites (Horn and Barrientos, 2008).

CuA site metallation

The CuA site in Cox2 is the entry point of the electrons from cytochrome c

(Figure 1.4). It contains two copper atoms, which are coordinated by a Cx3C motif, two histidines, one methionine and the backbone of a glutamine (Speno et al., 1995). Sco1, the metallochaperone for the formation of the CuA center, was originally identified as essential for COX assembly in yeast (Krummeck and Rödel, 1990) and subsequently together with Sco2 as a multisuppressor of COX17 null mutants (Glerum et al., 1996b). Further studies of the yeast proteins demonstrated physical interactions between both Sco proteins and Cox2 (Lode et al., 2000; Lode et al., 2002). This leds to the conclusion that these proteins act downstream of Cox17 in the mt copper metabolism. The human homologues of SCO1 and SCO2 (Petruzzella et al., 1998) are essential for COX assembly, as mutations in either genes result in severe mt disorders (Papadopoulou et al., 1999; Jaksch et al., 2000; Valnot et al., 2000a; Salviati et al., 2002b). In contrast to their yeast homologues, human Sco1 and Sco2 have been shown to perform independent, cooperative functions in the process of COX assembly, which are absolutely dependent on their Cx3C motifs (Leary et al., 2004; Leary et al., 2009a). Additionally, it was shown that Cox17 has a dual function which involves the simultaneous reduction of the metal-binding cysteine residues of Sco1 and the metal transfer to Sco1 (Banci et al., 2008a). The authors postulate that Cox17 is the starting point of an electron cascade which eventually leads to the reduction of the cysteine residues in the CuA site by Sco1. Indeed, very recently Leary et al. (2009a) suggested a model in which human Cox17 delivers copper to Sco2, which in turn transfers it directly to the CuA site in COX subunit Cox2 in a reaction that is facilitated by Sco1.

CuB site metallation

Metallation of the CuB center of Cox1 is more complicated, as this site is buried within the IMM. It is formed by one copper ion coordinated by three histidine ligands in close proximity to the heme a/a3 moieties. Studies in Rhodobacter sphaeroides led to the conclusion that Cox11 is important for the formation of the CuB site, as a COX11 null mutant lacks CuB but not CuA (Hiser

INTRODUCTION et al., 2000). Additionally, yeast COX11 mutants are characterized by impaired COX activity due to the degradation of Cox1 subunits and unstable heme a (Tzagoloff et al., 1990). Similar to Sco1, Cox11 is tethered to the IMM by a single transmembrane helix (Carr et al., 2005) and it was shown that yeast Cox11 binds copper via its mt IMS exposed C-terminal part of the protein (Carr et al., 2002). It was suggested that copper insertion might occur co-translationally into nascent Cox1 by ribosome-associated Cox11 (Khalimonchuk and Rödel, 2005). This interaction of Cox11 with the mt ribosomes is probably mediated through an additional partner, as the matrix domain of Cox11 is non-essential for its function (Carr et al., 2005). As for Sco1, the direct transfer of copper from Cox17 to Cox11 was shown (Horng et al., 2004) and computer models suggest a direct interaction between Cox11 and Cox1 (Khalimonchuk et al., 2007). However, so far, physical interaction between these proteins could not be detected experimentally.

Cox17, Cox19, Cox23, Pet191 and Cmc1

Several additional low molecular weight proteins, containing the twin Cx9C motif present in Cox17, required for COX assembly have been identified in yeast (Horn and Barrientos, 2008; Leary, 2010). These proteins include Cox19, Cox23, Pet191 and Cmc1, all of which have human homologues (Longen et al., 2009). Yeast cells lacking Cox19 are respiratory deficient, but this phenotype is not reversed by the addition of exogenous copper salts (Nobrega et al., 2002). Mutants of COX23 also fail to assemble COX, but this phenotype can be suppressed by exogenous copper when COX17 is overexpressed (Barros et al., 2004). Although Cox23 does not physically interact with Cox17, Barros and coworkers (2004) suggest a common pathway with Cox17 acting downstream of Cox23. At least two other proteins, Pet191 (McEwen et al., 1993) and Cmc1 (Horn et al., 2008) share similarities with Cox17. Pet191 and Cmc1 are inner membrane-bound mt IMS proteins which are required for full assembly of COX. Particularly, Cmc1 performs independent functions in the process of mt copper trafficking and transfer (Horn et al., 2008). Cox17, Cox19 and Cox23 have been shown to possess a dual localization in the cytoplasm and mt IMS (Nobrega et al., 2002; Barros et al., 2004). An important remaining question concerns the import of these proteins into the mt IMS, as the Cx9C motif present in Cox17, Cox19 and Cox23 are critical for

INTRODUCTION this process. Mesecke et al. (2005) proposed a model for the mt import of proteins with conserved cysteine motifs. They reported that mt IMS proteins traverse the TOM (translocase outer membrane) complex of the OMM in a reduced and unfolded conformation. In the mt IMS the proteins are covalently trapped by preoxidized Mia40 via disulfide bridges and finally released after further isomerization. Reduced Mia40 is reoxidized by the sulfhydryl oxidase Erv1, promoting further cycles of protein import into the mt IMS (Bien et al., 2010). Investigations of the redox properties of the disulfides of human Cox17, strongly support the existance of a mechanism of cysteine reduction in the mt IMS after oxidative folding (Palumaa et al., 2004; Voronova et al., 2007b; Banci et al., 2008b). According to the current hypothesis fully reduced Cox17

(Cox170S-S) is present in the cytoplasm and enters the mt IMS through the OMM pores, where it is then oxidized by Mia40 to its biologically active form,

Cox172S-S. Cox172S-S is able to bind a single copper ion and is now prepared to enter the pathway of copper delivery to COX. This mechanism implies that the copper metallation steps may occur within the mt IMS. The result that yeast Cox17 tethered to the IMM does not affect COX assembly (Maxfield et al., 2004) further supports the idea that copper loading occurs after import in the mt IMS. In addition, deletion of yeast COX17 does not significantly perturb mt copper levels (Carr and Winge, 2003; Cobine et al., 2004). In the light of the finding that a copper-pool bound to a yet unknown soluble, low molecular weight ligand (CuL) exists in the mt matrix (Cobine et al., 2004; Pierrel et al., 2007), copper metallation reactions can occur within the mitochondria through copper transport from the matrix to the mt IMS. So far it is not clear how copper ions enter the matrix and can be eventually later recruited to the mt IMS. It seems that Cmc1 or other, yet unidentified metallochaperones contribute to these processes (Horn et al., 2008; Horn and Barrientos, 2008). Copper is then transferred to Cox17 and subsequently to the COX copper site-specific Sco1/Sco2 and Cox11 (Arnesano et al., 2005; Leary, 2010).

SOD1 and the matrix copper pool Cytosolic SOD1 is an ubiquitous small cytosolic metalloenzyme that catalyzes the conversion of superoxide anion to hydrogen peroxide (H2O2), for protection of the cell against oxygen free radicals (Fridovich, 1995). A small

INTRODUCTION fraction of SOD1 and of its specific metallochaperone Ccs1 is located in the mt IMS (Okado-Matsumoto and Fridovich, 2001; Inarrea, 2002; Kira et al., 2002). The exact role of mt IMS SOD1 in mt function is not known, however, it is thought that the enzyme has a functional relationship with the occurrence of superoxide in this compartment (Inarrea et al., 2007). The bioactive copper pool within the mt matrix is supposed to metallate both, COX and mt SOD1 (Cobine et al., 2004; Cobine et al., 2006a). 85 % and ~70 % of the total mt copper is associated with the matrix copper complex in yeast and mouse liver, respectively (Cobine et al., 2006a). At present, it is not clear how copper is transported across the IMM. However, it is suggested that its translocation is achieved by either a single, bi-directional transporter or two, uni-directional transporters (Leary et al., 2009b; Leary, 2010).

1.9 COX17

Yeast Cox17 is ‘as mentioned above’ a key mt copper chaperone responsible for supplying copper ions to COX. The human Cox17 orthologue shares 48 % sequence identity with yeast counterpart (Amaravadi et al., 1997). The human COX17 is ubiquitously expressed, is composed of three exons and two introns and spans approximately 8 kb of genomic DNA (Punter et al., 2000). It is a low molecular weight (~7 kDa) hydrophilic protein (UniProtKB/Swiss- Prot Q14061) which binds copper ions through a highly conserved metal binding motif (KPCCXC) (Amaravadi et al., 1997). Cox17 also contains a twin

Cx9C structural motif. In principle Cox17 can exist in three different oxidation states: (i) in the fully reduced state where no disulfide bonds are present (Cox170S-S), (ii) as a partially oxidized form with two disulfide bonds (Cox172S-S) or (iii) as fully oxidized protein with three disulfide bonds (Cox173S-S), which differ substantially in their structural features and metal binding properties (Voronova et al., 2007a). Fully reduced Cox17 is designed for specific binding of four copper ions (Cu4Cox170S-S), partially oxidized Cox17 can bind a single copper ion (Cu1Cox172S-S) and fully oxidized Cox17 is not able to bind copper.

Metal transfer experiments with human Cu1Cox172S–S and Cu4Cox170S-S and human Sco1 demonstrated that Cu1Cox172S–S and not Cu4Cox170S-S forms a specific metal-bridge with Sco1 (Banci et al., 2007). These data suggest that the Cox172S-S form is the active state in the copper transfer within the

INTRODUCTION

mt IMS. In contrast, the biological role of Cu4Cox170S-S is currently not clear. It predominantly exists in the cytosol (Palumaa et al., 2004; Voronova et al., 2007b), as this is characterized by a more reducing environment than the mt IMS. Additionally, it is most likely that it retains in the cytosol, as OMM pores are not permeable to copper loaded proteins (Chen and Douglas, 1987).

A structural and dynamical characterization of human Cox17 in its various functional metallated and redox states was presented by Banci et al. (2008b).

apoCox172S-S Cu1Cox172S-S

Figure 1.7. NMR solution structures of apo- and Cu1-Cox172S-S. + NMR solution structure of the partially oxidized apo (apoCox172S-S) and Cu bound

form (Cu1Cox172S-S) of human Cox17. Side chain packing involving hydrophobic residues in the metal binding surroundings is shown in blue. The cysteines residues are shown in yellow and the copper ion is highlighted in cyan (modified from Banci et al. (2008b)).

The three-dimensional structure of human Cox172S-S was solved by nuclear magnetic resonance (NMR) spectroscopy (Figure 1.7) (Banci et al., 2008b). The protein exhibits a helix-turn-helix motif (‘coiled coil-helix-coiled coil- helix’) in which the helices are connected by two parallel disulfide bonds preceded by a flexible and unstructured N-terminal tail. In Cox17, the twin

Cx9C structural motif stabilizes the two antiparallel α-helices and depending on the redox state of Cox17, these opposing cysteine residues can be linked by disulfide bridges (Longen et al., 2009). Upon copper binding, structural and dynamical changes are induced, which are only restricted to the metal- binding region.

INTRODUCTION

1.10 AIMS OF THE THESIS

Mitochondria require a large variety of chemical elements to perform biological functions and among these elements, copper is an essential redox metal used as a cofactor by mitochondrial COX. The coordinated assembly and the insertion of copper into the COX CuA and CuB active sites require the involvement of different chaperones. Since free copper is not available in the cells, a chaperone system is necessary to deliver copper to mitochondria and COX. Studies of COX-deficient yeast (S. cerevisiae) mutants suggest that the transfer of copper to mitochondria requires amongst others the evolutionary conserved proteins Cox17, Cox11 and two members of the Sco protein family for insertion of copper into COX (Khalimonchuk and Rödel, 2005). While the yeast proteins have been studied in detail, only few data are available on mammalian mitochondrial copper metabolism.

The aim of this thesis is the characterization of key proteins regulating the mammalian mt copper metabolism, with special emphasis on Cox17. Despite major research on COX17 in different model systems, the exact role in the mammalian mt metabolism and COX assembly remains unknown.

As a first step, the subcellular localization of human Cox17 is investigated in HeLa cells. In order to reveal the role of Cox17, RNA interference (RNAi) directed against COX17 is used. Knockdown efficiency is verified by qRT-PCR and Western blot analysis. The effects of RNAi-mediated COX17 knockdown are analyzed on different levels, including cell proliferation and apoptosis, ROS formation, enzymatic assays and oxygen consumption. Additionally, the effect of Cox17 depletion of the protein distribution of Cox17 and COX is investigated with direct stochastic optical reconstruction microscopy (dSTORM). The organization of respiratory chain complexes is analyzed upon COX17 knockdown using Blue Native (BN)-PAGE and subsequently in gel enzymatic activity assays (first dimension), or after separation in a SDS-gel (second dimension). Finally, copper supplementation experiments are performed to determine the potential to rescue the COX17 RNAi phenotype.

MATERIALS AND METHODS

2 MATERIALS AND METHODS

2.1 MATERIALS

2.1.1 CHEMICALS AND REAGENTS

The following chemicals and reagents were obtained from the indicated sources:

2-Propanol AppliChem, Germany 3,3'-Diaminobenzidine Fluka, Switzerland 6-Aminocaproic acid Sigma-Aldrich, Germany Acetic acid Roth, Germany Acrylamide/ bisacrylamide (30 %) AppliChem, Germany Acrylamide/ bisacrylamide (40 %) Sigma-Aldrich, Germany AEBSF AppliChem, Germany AgaroseLE Biozym, Germany APSPlusOne GE Healthcare, UK Boric acid Roth, Germany BSA AppliChem, Germany CHAPS GE Healthcare, UK Chloroform Roth, Germany Coomassie® Brilliant Blue G250 Merck, Germany cytochrome c (from horse heart) Sigma-Aldrich, Germany DCFH-DA Sigma-Aldrich, Germany Di-potassium hydrogen phosphate Roth, Germany Digitonin AppliChem, Germany DMEM PAA Laboratories, Germany DTNB Sigma-Aldrich, Germany dNTP mix Promega, Germany EDTA Roth, Germany Ethanol AppliChem, Germany Ethidium bromide (1 µg/ml) Roth, Germany FBS Gold Biochrome, Germany Formalin solution (10 %) Sigma-Aldrich, Germany Galactose Sigma-Aldrich, Germany

MATERIALS AND METHODS

GBX developer/ replenisher Sigma-Aldrich, Germany GBX fixer and replenisher Sigma-Aldrich, Germany Glucose Sigma-Aldrich, Germany Glutamine (stabilized) 200 mM Biochrome, Germany Glycerol AppliChem, Germany Glycine AppliChem, Germany HEPES PAA Laboratories, Germany Hydrochloric acid AppliChem, Germany Imidazole AppliChem, Germany Magnesium chloride Invitek, Germany 2-Mercaptoethanol Roth, Germany Mercaptoethylamine Sigma-Aldrich, Germany Methanol Fisher Scientific, UK MOPS Sigma-Aldrich, Germany N-dodecyl β-D-maltoside Sigma-Aldrich, Germany NAD+ Sigma-Aldrich, Germany Neomycin (G418) PAA Laboratories, Germany Nitrotetrazolium blue chloride Sigma-Aldrich, Germany Nonfat dried milk powder AppliChem, Germany Normal Goat Serum Sigma-Aldrich, Germany Nuclease free water Applied Biosystems / Ambion, Germany Oligofectamine Invitrogen, Germany Opti-MEM Invitrogen, Germany Paraquat (Methyl viologen) Sigma-Aldrich, Germany PBS PAA Laboratories, Germany peqGOLD TriFastTM PeqLab, Germany Ponceau S Roth, Germany Propidium iodid Sigma-Aldrich, Germany Protease inhibitor cocktail Roche, Germany Potassium dihydrogen phosphate Roth, Germany Potassium hydroxide Merck, Germany RNase Away Nunc, Germany RNase-free water Qiagen, Germany SDS AppliChem, Germany Serva Blue G250 Serva, Germany siPORTTM XP1 Applied Biosystems / Ambion, Germany

MATERIALS AND METHODS

Sodium chloride AppliChem, Germany Sodium hydroxide AppliChem, Germany Sodium pyruvate PAA Laboratories, Germany Sucrose Sigma-Aldrich, Germany TCEP Sigma-Aldrich, Germany TEMEDPlusOne Amersham Biosciences, Sweden Tricine Sigma-Aldrich, Germany Tris Roth, Germany Triton X-100 Roche, Germany Trypan blue stain Invitrogen, Germany Tween-20 Roth, Germany

Ultra pure ddH2O AppliChem, Germany

2.1.2 ANTIBODIES

Primary antibodies Manufacturer rabbit anti-Cox17 PTG, UK mouse MitoProfile® Total OXPHOS Human WB MitoSciences, USA Antibody Cocktail mouse anti-complex IV subunit I MitoSciences, USA mouse anti-complex IV subunit II MitoSciences, USA mouse anti-complex IV subunit IV MitoSciences, USA mouse anti-complex IV subunit Va MitoSciences, USA mouse anti-GAPDH Santa Cruz, Germany mouse anti-VDAC Santa Cruz, Germany

Secondary antibodies donkey anti-rabbit IgG / HRP GE Healthcare, UK goat anti-rabbit IgG / Alexa Fluor®488 Invitrogen, Germany goat anti-rabbit F(AB’)2 / Alexa Fluor®647 Invitrogen, Germany goat anti-mouse F(AB’)2 / Alexa Fluor®647 Invitrogen, Germany sheep anti-mouse IgG / HRP GE Healthcare, UK

2.1.3 PLASMID

The pTurboRFP-mito plasmid was purchased from Evrogen (Germany).

MATERIALS AND METHODS

2.1.4 KITS

Kit Manufacturer CytoGLOTM Annexin V-FITC Apoptosis Biomol, Germany Detection Kit DC Protein Assay Bio-Rad, Germany ECLplus SystemTM GE Healthcare, UK MaximaTMSYBR Green qPCR Master Fermentas, Germany Mix (2x) MitoProfile® Benchtop Mitochondria MitoSciences, USA Isolation Kit For Cultured Cells MycoTrace PCR detection kit PAA Laboratories, Germany

2.1.5 MARKER

Table 2.1. List of gel electrophoresis markers.

Marker Application Manufacturer 100 bp DNA-ladder DNA Roth, Germany gelelectrophoresis HMW gel filtration calibration kit BN-PAGE GE Healthcare, UK NativeMarkTM unstained protein BN-PAGE Invitrogen, Germany standard PageRulerTM plus prestained protein SDS-PAGE Fermentas, Germany ladder

2.1.6 ENZYMES

Enzyme Manufacturer Catalase Roche, Germany CombiZyme DNA polymerase Invitek, Germany DyNAzymeTMEXT DNA Polymerase Finnzymes, Finland Glucose oxidase Sigma-Aldrich, Germany Proteinase K Roth, Germany RNase-free DNase I Applied Biosystems / Ambion, Germany RNase inhibitor Promega, Germany SuperScript II Invitrogen, Germany Trypsin-EDTA (1x) PAA Laboratories, Germany

MATERIALS AND METHODS

2.1.7 PRIMERS

The listed PCR primers were synthesized by Biomers (Germany). The listed quantitative PCR primers were obtained from Qiagen (Germany).

PCR primers Sequence (5’ → 3’) COX1 for: TTCGAAGCGAAGGCTTCTC rev: GTCCTATCAATAGGAGCTGT COX2 for: CGACTACGGCGGACTAATCT rev: TCGATTGTCAACGTCAAGGA ß-ACTIN for: AGAAAATCTGGCACCACACC rev: AGAGGCGTACAGGGATAGCA COX17 for: GCCGGGTCTGGTTGACTC rev: CTAGGGCTCTCATGCATTCC GAPDH for: TTGATTTTGGAGGGATCTCG rev: GAGTCAACGGATTTGGTCGT oligo (dT)12-18 primer Invitrogen, Germany

qRT-PCR primers (not specified by manufacturer) Hs_COX17_1_SG Quantitect Primer Assay Hs_GAPDH_2_SG Quantitect Primer Assay Hs_Actin_2_SG Quantitect Primer Assay Hs_COX1_1_SG Quantitect Primer Assay Hs_COX2_2_SG Quantitect Primer Assay Hs_COX4I1_1_SG Quantitect Primer Assay

2.1.8 SIRNAS

The listed siRNA sequences targeting human genes were obtained from Applied Biosystems / Ambion, Germany.

Table 2.2. List of siRNAs. gene siRNA ID/ gene ID Sequence (5’ → 3’) number COX17 138009 10063 for: GCCCUAGGAUUUAAAAUAUtt siRNA 1 rev: AUAUUUUAAAUCCUAGGGCtc COX17 16589 10063 for: GGAGAAGAACACUGUGGACtt siRNA 2 rev: GUCCACAGUGUUCUUCUCCtt

MATERIALS AND METHODS

COX17 138010 10063 for: CGAACUUUGAUAUGUGGAAtt siRNA 3 rev: UUCCACAUAUCAAAGUUCGtc COX17 16681 10063 for: GGAAUGCAUGAGAGCCCUAtt siRNA 4 rev: UAGGGCUCUCAUGCAUUCCtt COX17 s19572 10063 for: GAAUGAAGAAGAUUAAUUUtt siRNA 5 rev:AAAUUAAUCUUCUUCAUUCtt COX17 s19571 10063 for: GAACUUUGAUAUGUGGAAAtt siRNA 6 rev:UUUCCACAUAUCAAAGUUCgt COX17 s19573 10063 for: GUAUCAUCGAGAAAGGAGAtt siRNA 7 rev:UCUCCUUUCUCGAUGAUACac negative control siRNAs Silencer 1 AM4635 not specified by manufacturer Silencer 2 AM4637 not specified by manufacturer positive control siRNAs Silencer GAPDH AM4631 not specified by manufacturer Silencer KIF11 AM4639 not specified by manufacturer

Figure 2.1. Respective positions of the siRNA sequence on COX17 mRNA.

MATERIALS AND METHODS

2.2 METHODS

2.2.1 CELL CULTURE

2.2.1.1 CELL CULTURE: HELA CELLS

HeLa cells were maintained at 37 °C in a humidified atmosphere with 5 % CO2 in galactose medium* (Reitzer et al., 1979; Rossignol et al., 2004). Cells were regularly checked with the MycoTrace PCR detection kit for the presence of mycoplasma.

Galactose medium for HeLa cells:

1 × DMEM 10 mM Galactose 10 % (v/v) FBS 2 mM Stable glutamine 10 mM HEPES 1 mM Sodium pyruvate

2.2.1.2 CELL CULTURE: HELA CELLS TRANSFECTED WITH PTURBORFP-MITO

HeLa cells were maintained at 37 °C in a humidified atmosphere with 5 % CO2 in selection medium.

Selection medium for pTurboRFP-mito HeLa cells:

1 × DMEM 1 mg/ml Glucose 10 % (v/v) FBS 1 % (v/v) Stable glutamine 0.4 mg/ml or 0.2 mg/ml Neomycin (G418)

* HeLa cells were grown in galactose medium, as it has been shown that mitochondrial respiration is stimulated in galactose medium. In contrast, when Hela cells are grown in glucose medium, ~80 % of glucose is metabolized through glycolysis.

MATERIALS AND METHODS

2.2.1.3 SUBCULTIVATION

HeLa cells were trypsinized and passaged every second or third day in proportion of 1:4 or 1:6, respectively. For passaging, the cells were washed with 10 ml PBS and incubated in 3 ml trypsin-EDTA (0.5 mg/ml) for 5 min at 37 °C. Trypsinized cells were gently resuspended by several times up/down pipetting in 8 ml (to 12 ml – according to the desired passaging ratio) cell culture medium and 2 ml were transferred into a new tissue culture flask containing 13 ml of cell culture medium.

2.2.1.4 DETERMINATION OF CELL NUMBER

10 µl of the cell suspension was mixed with 10 µl 0.4 % trypan blue solution and counted using a Neubauer hemocytometer.

2.2.1.5 CELL STORAGE AND THAWING

HeLa cells were passaged as described above, seeded in 75 cm2 cell culture flasks and grown until high confluence was reached. The cells were detached, resuspended in cell culture medium and centrifuged at 500 x g for 5 min in a cell centrifuge with a swing-out rotor. The supernatant was removed and the cell pellet was carefully resuspended at a concentration of 1 x 106 cells/1.5 ml of ice cold freezing medium and transferred to a cryotube. The cryotube was immediately stored in an isopropanol alcohol insulated container at -80 °C over night. After 24 h the cell aliquots are transferred and stored in the liquid nitrogen tank at -196 °C.

In order to return the cryoconserved cell suspension from storage it was thawed quickly in a 37 °C water bath with constant moving. The thawed cell suspension was transferred to 15 ml cell culture medium and the cells were centrifuged for 5 min at 200 x g. The supernatant was discarded, the pellet was resuspended in cell culture medium and transferred to a 75 cm2 bottle, which was set up with 12 ml of cell culture medium before. Incubation was carried out at 37 °C and 5 % CO2.

MATERIALS AND METHODS

Freezing medium:

70 % (v/v) DMEM 20 % (v/v) FBS 10 % (v/v) DMSO

2.2.2 TRANSIENT TRANSFECTION OF HELA CELLS

Adherent HeLa cells were transiently transfected by liposomal transfection (lipofection) with Oligofectamin. The method is based on the uptake of complexes formed by interaction of cationic lipids with negatively charged DNA molecules by the cells. One day before transfection 30,000 (100,000; 1 Mio) HeLa cells were plated on 24 well (6 well; 15 cm) plates. On the day of transfection Oligofectamin was diluted 10 times into serum-free medium (Opti-MEM), incubated for 5 min at room temperature (RT) and combined with 25 nM siRNA, diluted in Opti-MEM. Samples were incubated for 20 min at RT and finally pipetted into each well. Gene silencing effects were monitored after 24, 48, 72, 96, 120, 144 h post transfection.

2.2.3 TRANSFECTION OF HELA CELLS WITH PTURBORFP-MITO

The pTurboRFP-mito vector is coding for the red fluorescent protein TurboRFP fused to the mt targeting sequence (MTS) derived from the subunit VIII of human COX (www.evrogen.com). In addition, pTurboRFP-mito mediates neomycin resistance for selection of successfully transfected cells. One day before transfection 100,000 cells were plated on a 6 well plate and grown until ~60 % confluence. On the day of transfection the transfection agent siPORTTM XP-1 was equilibrated to RT, diluted with 97 µl Opti-MEM and kept for 20 min at RT. 1 µg pTurboRFP-mito (0.5 µg/µl) was added in a 3:1 proportion of transfection reagent to DNA. Sample was incubated for 20 min at RT and finally added to the cells. After 24 h the cells were washed with PBS and exposed to selection medium (0.4 mg/ml neomycin) for two weeks. Transfected cells that obtained neomycin resistance in the course of transfection appeared as individual colonies of surviving cells. For picking the clones, ten days post transfection, the plate was rinsed with 10 ml PBS.

MATERIALS AND METHODS

Sterile 3 mm cloning disks (Sigma-Aldrich) were soaked in trypsin-EDTA and carefully placed on each colony, using sterile forceps. After 3 min the disks were transferred into the wells of a 48 well plate already containing 300 µl selection medium. Clones that showed a satisfactory growth after approximately 3 days were detached from the wells by incubation with 50 µl typsin-EDTA and transferred to 6 well plates containing 2 ml selection medium. Cells that reached 90 % confluence were splitted into 75 cm² cell culture flask and were cultivated in selection medium with a reduced amount of neomycin (0.2 mg/ml).

2.2.4 IMMUNOCYTOCHEMISTRY

1x105 HeLa cells transfected with pTurboRFP-mito were grown on 70 mm2 glass chamber slides (BD Falcon, CA), fixed with formalin-PBS (10 %) for 10 min at 4 °C, and transferred into pre-chilled acetone (-20 °C) for 5 min. Subsequently, the cells were incubated with 10 % (w/v) bovine serum albumin in PBS for 1 h at 37 °C to block non-specific binding. Immunocytochemical detection was then performed with a polyclonal Cox17 antibody (1 µg/ml) and with a secondary rabbit IgG Alexa Fluor® 488 antibody (1:500). Images were acquired using a confocal inverse Leica SP 5 (DM 6000B) microscope equipped with a multi-photon laser and a HCX PL APO 63 x objective (1,4 - 0,6 Oil, Lbd.Bl.). The 488 nm and 561 nm laser lines and appropriate 515 (±15) and 590 (±15) nm band pass filter sets were used for excitation and fluorescence detection, respectively. Individual channel images were acquired separately.

2.2.5 RNA EXTRACTION AND QUANTITATIVE REAL-TIME PCR

Cells were rinsed with PBS and total RNA was isolated from HeLa cells using peqGOLD TriFast according to the manufacturers instructions. Finally RNA was eluted in 20 µl RNase-free water. To remove residual DNA, 2 µl 10 x DNase buffer (0.4 M Tris, 0.1 M NaCl, 50 mM MgCl2 in RNAse-free water, pH 7.4) and 2 µl RNase-free DNase I (2 U/µl) were added to the RNA solution and incubated at 37 °C for 30 min, then at 65 °C for 20 min, cooled on ice and collected by brief centrifugation. Purity of RNA was assessed by the ratio of

MATERIALS AND METHODS

the absorbance A260/A280 in a Nanodrop spectrophotometer (PeqLab).

For reverse transcription, 1 µg total RNA, 2 µl RT buffer, 4 µl 25 mM MgCl2,

1 µl dNTP mix, 1 µl oligo (dT)12-18 primers, and 1 µl RNAse inhibitor were added to water to a total volume of 10 µl. Before adding the reverse transcriptase, 1 µl was removed from each sample and mixed with 9 µl water, to be used as a non-template control during RT-PCR. 1 µl SuperScript™II reverse transcriptase was added to each sample tube and reverse transcription was carried out at 42 °C for 50 min. The reaction was terminated at 70 °C for 15 min.

Semi-quantitative RT-PCR was performed with 1 µl of the cDNA template in a total volume of 25 µl of amplification buffer, 10 pmol of specific primers and 0.4 units of CombiZyme DNA polymerase using the following parameters: initial denaturation at 94 °C (5 min) followed by 30 cycles of 30 sec at 94 °C and 30 sec at 48 °C and 30 sec at 72 °C elongation. Primers are listed in chapter 2.1.7. Amplified RT-PCR products were separated on a 1.5 % agarose gel and visualized by staining with ethidium bromide. The house-keeping genes β-actin or GAPDH were used for normalization. For quantitative real-time PCR, 10 µl cDNA were mixed with 2.5 µl 10 x primer mix and 12.5 µl 2x SYBR Green qPCR MasterMix. qRT-PCR was carried out on a Mastercycler®ep realplex instrument (Eppendorf) using an initial denaturation at 95 °C (10 min) followed by 40 cycles of 30 sec at 95 °C and 15 sec at 60 °C and 15 sec at 72 °C elongation. The house-keeping genes β-actin or GAPDH were used for normalization.

2.2.6 ISOLATION OF MITOCHONDRIA

Isolation of mitochondria and solubilization of OXPHOS complexes was basically performed according to Schägger (1996). In brief, 1-2 x 106 HeLa cells were collected with a cell lifter, pelleted by centrifugation at 1,000 x g and stored at -80 °C before continuing cell lysis.

2.2.6.1 ISOLATION OF MITOCHONDRIA FOR BN-PAGE ANALYSIS

According to the manufacturers protocol (MitoProfile Benchtop Mitochondria Isolation Kit for Cultured Cells, MitoSciences) cells were thawed on ice,

MATERIALS AND METHODS resuspended in 5 mg/ml reagent A and incubated for 10 min on ice. The cells were transferred in a pre-cooled 2 ml Dounce Homogenizer (MitoSciences) and homogenized with 50 strokes using pestle B. After centrifugation at 1,000 x g for 10 min at 4 °C the supernatant was saved and procedure was repeated using reagent B. Mitochondria were then pelleted from the supernatants (12,000 x g, 15 min, 4 °C) and resuspended in 12 µl lysis buffer (50 mM NaCl, 5 mM 6-aminocaproic acid, 50 mM imidazole, 1 mM AEBSF, 1x protease inhibitor cocktail (PIC) and 8 µl 10 % digitonin (in lysis buffer). After 15 min incubation on ice, the samples were centrifuged (18,000 x g, 15 min) and 5 µl coomassie-free loading buffer (10 % glycerol, 0.01 % Ponceau S) were added to the supernatant. Samples were subsequently loaded onto a 3-13 % polyacrylamide (PAA) gradient gel including a 3 % spacer gel.

2.2.6.2 ISOLATION OF MITOCHONDRIA FOR LOCALIZATION STUDIES

According to Schägger (1996) cells were thawed on ice, resuspended in 500 µl hypotone buffer (83 mM sucrose, 10 mM MOPS, pH 7.2) and homogenized in a glass/glass pestle with 50 strokes before 500 µl CL 1 buffer (250 mM sucrose, 30 mM MOPS, pH 7.2) were added. Cell debris was collected by centrifugation (600 x g, 15 min) and the procedures were repeated. Mitochondria were then pelleted from the supernatants (15,000 x g, 15 min, 4 °C) and resuspended in CL 1 buffer. Protein concentration was measured using the DC Protein Assay. Samples were dissolved in SDS-PAGE sample buffer containing 50 mM TCEP by incubation for 7 min at 45 °C and separated on 15 % PAA gels.

2.2.6.3 ISOLATION OF BOVINE HEART MITOCHONDRIA

20 mg bovine heart was homogenized with 250 µl buffer M (440 mM sucrose, 20 mM MOPS, 1 mM EDTA, pH 7.2) in a glass/glass pestle. Mitochondria were pelleted (20,000 x g, 20 min, 4 °C) and resuspended in 40 µl lysis buffer (50 mM NaCl, 5 mM 6-aminocaproic acid, 50 mM imidazole, 1mM AEBSF, 1 x PIC) and 15 µl 10 % digitonin (in lysis buffer). After 15 min incubation on ice, the samples were centrifuged (18,000 x g, 15 min) and 5 µl Coomassie-free loading buffer (10 % glycerol, 0.01 % Ponceau S) were added to the

MATERIALS AND METHODS supernatant. Samples were subsequently loaded onto a 3-13 % PAA gradient gel including a 3 % spacer gel.

2.2.7 PROTEINASE K TREATMENT OF MITOCHONDRIA AND

MITOPLASTS

For mitoplast formation 20 µg of mitochondria were incubated in ice-cold hypotonic buffer (10 mM Tris/HCl, pH 7.4, 1 mM EDTA, 10 mM MOPS, 50 mM sucrose), and incubated for 30 min on ice. Mitoplasts were stabilized by the addition of one volume buffer containing 250 mM sucrose. Proteinase K was added to a final concentration of 10 µg/ml to either mitochondria or mitoplasts in the presence or absence of 1 % Triton X-100. Samples were incubated for 15 min on ice, and the reaction was stopped by the addition of PIC (1:50) and AEBSF to a final concentration of 1 mM. The pellet obtained by centrifugation (18,000 x g for 10 min at 4 °C) was subjected to SDS-PAGE.

2.2.8 PHOTOMETRIC ACTIVITY ASSAY

2.2.8.1 CITRATE SYNTHASE ACTIVITY

Citrate synthase (CS) was determined spectrophotometrically at 25 °C by measuring the concentration of the CoA-SH at 412 nm. Sample mixture was prepared by adding of 10 µl oxaloacetate (10 mM in TE, pH 8), 30 µl acetyl- CoA (5 mM in TE, pH 8), 10 µl DTNB (10 mM in 1 M Tris/HCL, pH 8) to a total volume of 200 µl TE buffer (50 mM Tris/HCl, 2 mM EDTA, pH 8). 10 µg of isolated mitochondria were used to start the reaction. Readings were taken at 20 s intervals for 2–2.5 min to measure acetyl-CoA deacylase activity.

The reaction is described as follows: acetyl-CoA + oxaloacetate + H2O ↔ citrate + CoA-SH + H+ (side reaction: CoA-SH + DTNB → mercaptide ion) and the activity is calculated according to:

MATERIALS AND METHODS

-1 E * min activity =

ε (DTNB) * Cmito *d

-1 E * min = increase in absorbance per min -1 ε (DTNB) = absorption coefficient at 412 nm [13.6 * (mM * cm) ] -1 Cmito = mitochondria concentration [mg*ml ] d = optical path of the cuvette [cm]

2.2.8.2 CYTOCHROME C OXIDASE ACTIVITY

COX activity of isolated mitochondria, normalized to the activity of CS was photometrically measured as described by Tzagoloff et al. (1975). To this end, cytochrome c was prepared by reduction with DTT, purified by de-salting on a PP-10 column (GE Healthcare) and reoxidized by active COX. The extent of reduction of cytochrome c was determined by measuring the differences in absorbance at 550 nm. Mitochondria were solubilized in assay buffer (50 mM potassium phosphate buffer, pH 7.2, 0.5 % (v/v) Tween) and COX reaction was started by addition of ferrous cytochrome c (final concentration 120 µM). The initial fast reaction rate was measured at RT by monitoring the decrease in absorbance at 550 nm during the first 60 s of the reaction. Specificity of the measurement was obtained by adding of ferrocyanide, a specific inhibitor of COX.

The absorption A550/min was calculated using the maximum linear rate for both the sample and the blank. The activity of the samples was calculated according to a first-order reaction with respect to the COX concentration:

MATERIALS AND METHODS

ΔA/min * dilution * 0.2 Unit/ml =

Vol (sample) * Δε (cytochrome c)

ΔA/min = A/min (sample) – A/min (blank)

Vol (sample) = volume of sample in ml 0.2 = total assay volume is 1 ml dilution = dilution factor of the sample (= 0.2 ml / Vol (sample) ) Δε (cytochrome c) = extinction coefficient between ferroctyochrome c and ferricytochrome c at 550 nm [21.84 mM]

Unit definition: one unit oxidizes one µmole of ferrocytochrome c per minute at 25 °C, pH 7.0.

2.2.9 BLUE NATIVE POLYACRYLAMIDE GEL ELECTROPHORESIS (BN-PAGE)

BN-PAGE originally established by Schägger and von Jagow (1991) was performed for separation of OXPHOS complexes. 200 µg isolated mitochondria were pelleted (15,000 x g, 15 min, 4 °C) and resuspended in 12 µl 50 mM NaCl, 5 mM 6-aminocaproic acid, 50 mM imidazol, pH 7.0 supplemented with PIC and digitonin (detergent:protein ration of 4:1 g/g) for 15 min on ice. The samples were centrifuged (18,000 x g, 10 min), and 5 µl of Coomassie-free loading buffer (5 % glycerol, 0.01 % Ponceau S) were added to the supernatant. Subsequently, the samples were loaded onto 3-13 % PAA gradient gel including a 2.5 % spacer gel. The NativeMark™ unstained protein standard and the high molecular weight gel filtration calibration kit (thyroglobulin mono-/dimer: 669/1,300 kDa, ferritin: 440 kDa, aldolase: 158 kDa) were used as molecular weight markers. Gels were run in a vertical electrophoresis apparatus Hoefer SE 600 Ruby (GE Healthcare) with a gel size of 18 x 16 cm. Gel electrophoresis was started in the presence of anode buffer (25 mM Imidazol, pH 7.0) and cathode buffer A (50 mM Tricine, 7.5 mM Imidazol, 0.02 % (w/v) Serva Blue G 250, pH 7.0) with a change to cathode buffer B (50 mM Tricine, 7.5 mM Imidazol, 0.002 % (w/v) Serva Blue G 250,

MATERIALS AND METHODS

pH 7.0) after approximately ½ of the gel run.

2.2.9.1 IN GEL ACTIVITY ASSAY

Complex I specific activity was determined after 30 min equilibration in buffer I (2 mM Tris/HCL, pH 7.4) and subsequent incubation at 30 °C in the presence of buffer I containing 2.5 mg/ml nitro tetrazolium blue (NTB) and 0.1 mg/ml NADH (Tzagoloff et al., 1975; Suthammarak et al., 2009). For complex IV activity, gels were equilibrated for 1 h at 30 °C in buffer IV (50 mM potassium phosphate, pH 7.4, 75 mg/ml sucrose), followed by incubation at 30 °C in the presence of buffer IV containing 5 mM cytochrome c (Wittig and Schägger, 2007). Lactate dehydrogenase (LDH) specific activity was examined after 1 h equilibration in LDH assay buffer (10 mM Tris/HCL, 10 mM lactic acid, pH 8) and subsequent incubation at 30 °C in the presence of LDH assay buffer containing 3 mM NAD+, 0.75 mM NTB and 0.05 mM phenazine methosulfate (PMS).

2.2.9.2 2D-BN/SDS-PAGE

For separation of individual complex subunits in a second dimension, strips from the first dimension BN-PAGE were sliced, and proteins were denatured by incubation for 30 min at RT in 1 % SDS containing 5 mM TCEP. The second dimension gel electrophoresis was carried out in the MiniVE-system (GE Healthcare) using 12 % SDS-gels. Proteins were transferred onto a polyvinylidene difluoride (PVDF) membrane using a semi-dry blot system and probed with primary antibodies directed against Cox17, VDAC, Cox1, and complex I subunit NDUFB8, complex II 30 kDa-subunit, complex III subunit Core 2, complex IV subunit II, and ATP synthase subunit alpha, which are components of the total OXPHOS human antibody cocktail. Proteins were detected with horseradish peroxidase (HRP)-conjugated IgG secondary antibody and the ECLplus kit.

2.2.10 SDS-PAGE AND WESTERN BLOT ANALYSIS

Total protein was extracted from cells using lysis buffer (10 mM Tris-HCl, 10 % glycerol, 1 % SDS and 1 % CHAPS) with PIC for 30 min on ice. The cell

MATERIALS AND METHODS lysate was cleared by centrifugation at 20,000 x g for 10 min. Protein concentration was measured using the DC Protein Assay. Samples were dissolved in SDS-PAGE sample buffer containing 50 mM TCEP by incubation for 7 min at 45 °C and separated on 15 % PAA gels. Proteins were transferred onto a PVDF membrane using a semi-dry blot system. Blocking was performed for 1 h at RT or overnight at 4 °C in TBS supplemented with 0.1 % Tween and 5 % milk powder. Incubation with both primary (Cox17, VDAC, Cox1, Cox2, Cox4, Cox5 and Total OXPHOS human antibody cocktail) and secondary antibodies were performed at RT for 1 h, respectively, in the same solution as for the blocking. After each antibody incubation, blots were washed 3 x 10 min with TBS supplemented with 0.1 % Tween. Signals were detected using the ECLplus kit.

2.2.11 DIRECT STOCHASTIC OPTICAL RECONSTRUCTION

MICROSCOPY (DSTORM) dSTORM (Heilemann et al., 2008) of COX17 siRNA transfected HeLa cells labeled with Alexa Fluor 647 was performed on an Olympus IX-71 inverted microscope applying an objective-type total internal reflection fluorescence (TIRF) configuration using an oil-immersion objective (PlanApo 60×, NA 1.45, Olympus) (van de Linde et al., 2008). Two continuous wave laser beams (647 nm and 488 nm) of an argon–krypton laser (Innova 70C, Coherent) were selected by an acousto-optic tunable filter (AOTF) and used simultaneously for read-out and activation. The fluorescence was imaged on an EMCCD camera (Andor Ixon DU888) (Heilemann et al., 2008). Indirect immunocytochemistry was applied to stain Cox17 and COX of pTurboRFP-mito transfected HeLa cells. The cells were fixed using 3.7 % paraformaldehyde in PBS for 10 min. Afterwards, cells were washed and permeabilized in blocking buffer (PBS containing 5 % w/v normal goat serum and 0.5 % v/v Triton X-100) for 10 min. Cox17 were stained with rabbit polyclonal anti-Cox17 antibodies and with Alexa 647-labeled goat anti-rabbit F(ab’)2 fragments serving as secondary antibody. COX were stained with mouse monoclonal anti-complex IV subunit I and with Alexa 647-labeled goat anti-mouse F(ab’)2 fragments serving as secondary antibody, both for 60 min. Three washing steps using PBS

MATERIALS AND METHODS containing 0.1 % v/v Tween 20 were performed after each staining step. Prior to the dSTORM measurement, the PBS buffer in the fixed cell samples was replaced by switching buffer (PBS, pH 7.4, containing oxygen scavenger (oxygen was removed adding 0.5 mg/ml glucose oxidase, 40 µg/ml catalase, 10 % glucose and 50 mM β-mercaptoethylamine)). Laser powers used for dSTORM imaging were 0.02–0.5 kW/cm2 at 488 nm and 4–26 kW/cm2 at 647 nm with frame rates of 50–200 Hz recording 10,000–15,000 images with total acquisition times of 50–200 s (van de Linde et al., 2008). Fluorescent spots were identified in each image frame applying an intensity threshold, and were fit to a Gaussian function to determine their centers of mass (van de Linde et al., 2008).

2.2.12 FLOW CYTOMETRIC PHENOTYPING

The analysis were performed using a CyFlow®SL flow cytometer (Partec) equipped with an argon ion laser tuned at 488 nm with the FL1 (527 ± 15 nm) and FL2 (590 ± 25 nm) channels set for detection of the following parameters.

2.2.12.1 DETERMINATION OF CELL CYLE PHASE

Propidium iodide (PI) staining of DNA in permeabilized cells and its detection by flow cytometry is widely used to determine the percentage of cells in each phase of the cell cycle. Because PI intercalates in double-stranded DNA, the fluorescent intensity of a stained cell is directly proportional to the DNA content of the cell. For the determination of the cell cycle, 1 x 106 cells in 0.5 ml PBS were fixed with 0.5 ml 70 % ice-cold ethanol for 20 min and centrifuged at 1,000 rpm for 5 min. The pellet was resuspended in 0.5 ml of PI-RNase solution (50 µg/ml PI, 100 µg/ml RNase) and incubated for 20 min at RT in the dark. Cells were analyzed by flow cytometry using the FL2 channel for PI. Quantitative G1, S and G2/M peaks were identified in an one parameter DNA histogram by the peak fitting program of the Partec FloMax® FCM Data Acquisition and Analysis software (Figure 2.2).

MATERIALS AND METHODS

Figure 2.2. Quantification of cell cycle distribution of HeLa cells. Peak fitting to model the PI data was performed automatically using the modelling program of the Partec FloMax® FCM Data Acquisition and Analysis Software. In the image a typical cellular state with the majority of cells in the G0/G1 phase (blue) can be seen. The rightmost peak on the histogram shows the cells in the G2/M state (green). The area between these peaks indicates cells within S-phase (red).

2.2.12.2 IDENTIFICATION OF APOPTOTIC CELLS

To discriminate viable from apoptotic and dead cells, a double staining of HeLa cells with Annexin V-FITC and PI was used (Chen et al., 2008). During apoptosis, phosphatidylserine (PS) normally found on the inner leaflet of the plasma membrane, is translocated to the outer leaflet. Thereby, PS is exposed at the external surface of the cell. Annexin V is a 36 kDa Ca2+ dependent binding protein that has high affinity and selectivity for PS. The measurement of Annexin V-FITC binding to the cell surface is performed in conjunction with the vital dye PI to distinguish between non-apoptotic (Annexin V-FITC negative / PI negative), early apoptotic (Annexin V-FITC positive / PI negative) and late apoptotic or necrotic cells (Annexin V-FITC positive / PI positive) (Figure 2.3).

MATERIALS AND METHODS

Figure 2.3. Sample data using Annexin V-FITC Apoptosis Detection Kit. The cell populations in the lower left quadrants represent non-apoptotic cells (viable), in the lower right quadrants early apoptotic cells (apoptotic) and in the upper right quadrants late apoptotic or necrotic cells (necrotic).

For the identification of apoptotic cells, cultured cells were collected by centrifugation and washed once with cold PBS, centrifuged and resuspended in binding buffer (according to the manufacturer protocol). 100,000 cells were incubated together with 5 µl Annexin V-FITC and 5 µl PI for 20 min at RT in the dark. Cells were analyzed by flow cytometry using the FL1 and FL2 channels for detecting Annexin V-FITC and PI staining, respectively. For each measurement 20,000 events were collected, and cells were gated as viable, apoptotic and necrotic based on both their light scatter signals. Data were analyzed using Partec FloMax® FCM Data Acquisition and Analysis Software.

2.2.12.3 DETECTION OF ROS

Intracellular reactive oxygen species (ROS) generation was investigated using the cell-permeable fluorogenic probe 2', 7'-Dichlorodihydrofluorescin diacetate (DCFH-DA). In brief, DCFH-DA is diffused into cells and is deacetylated by cellular esterases to non-fluorescent 2’, 7’-Dichlorodihydrofluorescin (DCFH), which is rapidly oxidized to highly fluorescent 2’, 7’ Dichlorodihydrofluorescein (DCF) by ROS (LeBel et al., 1992; Gomes et al., 2005; Eruslanov and Kusmartsev, 2010). The fluorescence intensity is proportional to the ROS levels within the cell cytosol.

MATERIALS AND METHODS

6 To this end, 50 µM DCFH-DA in ethanolabs were added to 1x10 cells in 1 ml PBS and incubated for 15 min at 37 °C in the dark. Cells were washed with PBS and analyzed by flow cytometry using the FL1 channel.

Untreated HeLa cells (WT) treated with 20 mM paraquat for 12 h at 37 °C and

5 % CO2 were used as ROS positive control (Bus and Gibson, 1984) (Figure 2.4).

Figure 2.4. DCF fluorescence in HeLa cells.

HeLa cells were cultivated for 12 h at 37 C and 5 % CO2 with 20 mM paraquat. Cells were detached with trypsin, washed with PBS and incubated with 50 µM DCFH-DA in

ethanolabs for 15 min at 37 °C in the dark. Cellular ROS induction was analyzed by flow cytometry using the FL1 channel. Right: 0 mM paraquat, left; 20 mM paraquat. RN2 gated cells represent cellular ROS levels. A total of 10,000 cells were counted for each sample.

2.2.13 OXYGEN MEASUREMENT

Monitoring of oxygen (O2) concentration in cell culture was done by optical- chemical sensing. To this end, one day before transfection 30,000 HeLa cells /ml were plated in PreSens (OxoDish®) 24 well plates. The OxoDish®, which contains a polymeric oxygen sensor at the bottom of each well, was placed on the SensorDish reader (PreSens Precision Sensing GmbH, Germany) in the incubator. The sensor dish software provided a continuous visual

display of dissolved O2 data. The software was set to take readings of

dissolved O2 at 60 min intervals.

MATERIALS AND METHODS

To check that oxygen consumption was cyanide-sensitive, and thus related to mt activity, the respiration rates were monitored in cells exposed to 1 mM cyanide.

2.2.14 CU–HIS SUPPLEMENTATION

To investigate the effect of supplementation of copper ions, copper were added to the culture medium of COX17 siRNA and negative control siRNA transfected cells, as copper–histidine (Cu-His) complex (1:2 molar ratio). Cu–His was prepared according to the protocol of Kreuder et al. (1993) and stored at –80 °C at a stock concentration of 2 mg Cu–His/ml/vial. These preparations were used for a maximum of three months. Several final concentrations of copper (1, 15, 50, 75, 100, 150, 200 and 300 µM) were added to the cells one day before transfection, 24 h or 72 h post transfection. The cells were incubated for at least another 24 h up to 144 h after transfection.

RESULTS

3 RESULTS

The general goal of this thesis is to get more insights into pathways and responsible proteins for delivering copper to the cytochrome c oxidase during its maturation. For this purpose a reverse genetic approach is used that consists of gene silencing by RNAi followed by a variety of assays to measure the RNAi effect.

3.1 SUBCELLULAR LOCALIZATION OF COX17

Yeast COX17 was the first accessory factor that has been implicated in the delivery of copper to the CuA and CuB centers of COX via the copper-binding proteins Sco1 (Glerum et al., 1996b) and Cox11 (Horng et al., 2004), respectively. Cox17 has been reported to possess a dual intracellular localization in the cytosol and the mt IMS (Glerum et al., 1996a). Human Cox17 is mainly localized in mitochondria (Suzuki et al., 2003; Di Fonzo et al., 2009). To investigate the subcellular and submitochondrial localization of Cox17 in HeLa cells, mitochondria and cytoplasm of 3 x 107 cells were isolated. The mitochondria were purified and mitoplasts were generated (materials and methods 2.2.7). After incubation of the mitochondria and mitoplasts with or without proteinase K in the presence or absence of the detergent Triton X-100 (Figure 3.1 (a)), proteins were separated in a 15 % SDS-PAA gel and blotted onto a PVDF membrane. The purity of the isolated fractions was assessed by detection of cytoplasmic translation initiator factor eIF-4E, the IMM COX subunits Cox2 and Cox5a, the soluble mt matrix heat shock protein Hsp60 and the mt IMS protein cytochrome c. A small portion (~10 %) of Hsp60 is found in the cytoplasm, in accordance with the data of Gupta and Knowlton (2002).

RESULTS

(a)

(b)

Figure 3.1. Localization of human Cox17. (a) Mitochondria and mitoplasts were treated with 10 µg/ml of proteinase K in the presence or absence of 1 % Triton X-100. Proteins of cytoplasm, mitochondria and mitoplasts were separated by SDS-PAGE and detected with antibodies directed against Cox17. Specificity of the fractionation was tested with marker proteins of the cytoplasm (eukaryotic translation initiation factor 4E, eIF-4E), the mt matrix (heat shock protein 60, mtHsp60), the mt IMS (cytochrome c), and the IMM (COX subunits 2 (Cox2) and 5a (Cox5a)). (b) HeLa cells expressing pTurboRFP-mito (1) were fixed, permeabilized, incubated with polyclonal Cox17 antibody and subsequently labeled with an anti-rabbit IgG Alexa Fluor®488 antibody (2). The fluorescence images were recorded with a confocal inverse Leica SP 5 microscope and superimposed (3).

Cox17 was detected both in the cytosolic and the mt fraction, with a clear enrichment (~80 %) in the latter fraction. Upon treatment of intact mitochondria with proteinase K, Cox17 proved to be resistant as did the mt marker proteins. When mt membranes were solubilized with Triton X-100

RESULTS

Cox17 was completely digested, documenting that the protein per se is sensitive to proteinase K. After the formation of mitoplasts by hypo-osmotic treatment, Cox17 was degraded in presence of proteinase K, and thus behaves like the mt IMS marker cytochrome c. In contrast, the matrix protein Hsp60 and the IMM proteins Cox2 and Cox5a were still detectable. These data show that Cox17 has a dual localization, with the majority in the mt IMS and a small portion in the cytoplasm. The dual localization of Cox17 was further confirmed by confocal fluorescence microscopy (Figure 3.1 (b)). To this end, HeLa cells that express pTurboRFP-mito (Figure 3.1 (b1)) were immunocytochemically labeled with polyclonal Cox17 antibody and subsequently incubated with an anti-rabbit IgG Alexa Fluor®488 antibody (Figure 3.1 (b2)). The individual channel fluorescence images were acquired separately using a confocal inverse microscope (Leica SP 5) and superimposed (Figure 3.1 (b3)). Cox17 signals mainly appeared in the well- known structure of the mt network, and few spots were visible in the cytoplasm. Fluorescence of Cox17 and pTurboRFP-mito merged almost completely, confirming the mainly mt localization of Cox17.

3.2 TRANSIENT KNOCKDOWN OF COX17 IN HELA CELLS

Expression of COX17 in HeLa cells was transiently silenced with seven pre- designed siRNAs. The efficiency was tested by performing individual transient transfection, RT-PCR and Western blot analysis. Appropriate controls are essential for RNAi experiments. In this assay KIF11 (Eg5) and GAPDH were chosen as positive transfection controls. Eg5 encodes a motor protein that belongs to the kinesin-like protein family involved in chromosome positioning and bipolar spindle formation during mitosis (Valentine et al., 2006). Depletion of Eg5 results in mitotic arrest. Thus, cells treated with KIF11 siRNA appear rounded rather than flat, giving a visual indicator of successful siRNA delivery. The GAPDH siRNA sequence targets the 5' medial region of the GAPDH mRNA sequence. GAPDH mRNA level in transfected and non-transfected cells were determined by RT-PCR using total RNA isolated 48 h after transfection. GAPDH siRNA reduced the expression of GAPDH by ~90 % (data not shown). As negative controls, mock transfection (transfection reagent only) as well as transfection with negative siRNAs (negative control siRNAs S1 and S2), which do not target any gene in the

RESULTS genome, were used. Negative transfection controls have been tested and shown to have no significant impact on cell proliferation, apoptosis, or cell morphology (Figure 3.2).

Figure 3.2. siRNA transfection efficiency in HeLa cells. 48 h upon siRNA treatment the percentage of viable cells was calculated by trypan blue dye exclusion. HeLa cells were transfected with 4 µl Oligofectamin and 25 nM siRNA per well of a 6 well plate. Mean values of triplicates are given. Error bars indicate the resulting standard error of the mean (SEM).

Upon Eg5 depletion approximately 15 % of HeLa cells were left. Control siRNA (negative siRNA 1 and siRNA 2) and mock transfected cells showed hardly any side effects.

3.2.1 KNOCKDOWN OF COX17 MRNA

HeLa cells were transfected with siRNA triplicates in 6 well plates following the procedure described in materials and methods, chapter 2.2.2. Control transfection of two positive controls (Eg5 and GAPDH) and three negative controls (S1, S2, mock) were performed in parallel. After the indicated time points, cells were harvested, the RNA was isolated and transcribed into cDNA. To analyze the abundance of COX17 mRNA a semi-quantitative RT-PCR was employed. Briefly, cDNAs of COX17 siRNA transfected and negative control siRNA transfected cells were amplified with COX17 specific primers for 30 cycles. To define the optimal number of PCR cycles for linear amplification,

RESULTS an aliquot from each of the samples was taken at cycle eleven, and thereafter at every fourth further cycle. The human GAPDH, COX1, COX2 and COX4 specific primers were used in control reactions. The amplification products were analyzed by agarose gel electrophoresis (Figure 3.3 (a)).

(a)

(b)

Figure 3.3. Transient knockdown of COX17 mRNA. (a) COX17 mRNA was analyzed at the indicated time points by semi-quantitative RT- PCR in cells treated with either negative- or COX17 siRNA 2. The mRNA levels of GAPDH, of the two mt encoded subunits COX1 and COX2, and of one nuclear encoded subunit COX4 were monitored as control. (b) Quantitative RT-PCR. Percent gene expression was calculated in COX17 siRNA transfected cells normalized to GAPDH and compared to those transfected with negative control siRNA transfected cells normalized to GAPDH. Values represent average fold changes of three experiments and error bars correspond to the resulting SEM.

The effect of siRNA-mediated knockdown was specific: while the levels of control mRNAs remained constant, the COX17 mRNA level was decreased to

RESULTS

15 % after 24 h, and started to increase again after 96 h. 80 % of the negative control was reached 144 h post transfection. A slightly more pronounced decrease in COX17 transcript levels was observed by quantitative RT-PCR (Figure 3.3 (b)). High reproducibility was observed between the triplicates.

3.2.2 KNOCKDOWN OF COX17 PROTEIN

The expression of Cox17 was determined by Western blotting and immunodetection to confirm the RT-PCR results. As described above, HeLa cells were transfected with COX17 siRNAs and control siRNAs in triplicates in 6 well plates. After the indicated time points, cells were harvested and total protein was extracted according to materials and methods, chapter 2.2.10.

Figure 3.4. Effect of transient knockdown of COX17 in HeLa cells. For Western blot analysis, 20 µg of total cell lysates from control- or COX17 siRNA 2 transfected cells were detected with antibodies against Cox17 and VDAC, an OXPHOS Human Antibody Cocktail (which recognizes individual subunits of the indicated OXPHOS complexes), and with antibodies against Cox1, Cox4 and Cox5a. Only the result of COX17 siRNA 2 treatments is shown, the other COX17 siRNAs yielded similar results.

The Cox17 antibody recognized a single band with an estimated size of approximately 7-12 kDa. This is in accordance with published data (Miyayama

RESULTS

et al., 2009) and the calculated molecular weight of 6.9 kDa (UniProtKB/Swiss-Prot Q14061). The OMM protein VDAC was used as a normalization control of the samples and documented the specificity of the knockdown effect. Furthermore, results of the immunodetection could be compared directly to the RT-PCR results, since for each timepoint the same sample was used for both analyses.

As expected, HeLa cells transfected with COX17 siRNA 2 showed a substantial reduction in Cox17 protein levels (Figure 3.4). 24 h post transfection the signal of Cox17 was essentially undetectable. As for the COX17 mRNA a recovery of the Cox17 protein could be observed after 96 h, which reaches the initial concentration after 144 h.

3.2.3 EFFECT OF COX17 KNOCKDOWN ON THE STEADY-STATE

LEVELS OF OXPHOS SUBUNITS

The effect of COX17 knockdown on the steady-state levels of OXPHOS subunits was tested by use of the total OXPHOS human antibody cocktail (MitoScience). This cocktail is suitable for simultaneous analysis of the five OXPHOS complexes, as it comprises antibodies directed against complex I subunit NDUFB8, the 30 kDa complex II subunit, the core 2 subunit of complex III, subunit Cox2 of complex IV, and the α-subunit of complex V. The monoclonal antibodies in the cocktail are directed against subunits that are labile when the respective complex is not assembled (www.mitosciences.com) (Taanman et al., 1996).

In no case the negative control siRNA had an effect on the concentrations of the analyzed proteins (Figure 3.4). In contrast, subunit Cox2 of complex IV became strongly reduced in COX17 siRNA transfected cells, reaching its minimal level at 72 h. In addition, the steady-state concentration of complex I subunit NDUFB8 seems to be slightly decreased at 48 h and 72 h, while the steady-state levels of complex II, III and V subunits were unaffected.

RESULTS

3.2.4 EFFECT OF COX17 KNOCKDOWN ON THE STEADY-STATE

LEVELS OF COPPER-BEARING COX SUBUNITS

To test whether the effect of Cox17 depletion on COX is specific for Cox2 or results in a reduced steady-state concentration of all or a subset of the COX subunits, the copper-bearing subunit Cox1 as well as subunits Cox4 and Cox5a were additionally analyzed. Interestingly, the steady-state concentration of the latter two proteins proved to be unchanged, whereas the concentration of Cox1 was reduced from 24 h to 72 h post transfection. Thereafter the signal intensity gradually rose until the end of the experiment (144 h) and reached levels of control cells (Figure 3.4).

3.2.5 SUBDIFFRACTION-RESOLUTION FLUORESCENCE IMAGING

Conventional fluorescence microscopy is limited by the diffraction barrier of light and because of this focusing of light always results in a blurred spot, whose size determines the resolution (Hofmann et al., 2005). Several recent improvements in microscopy techniques resulted in increased resolution and contrast to some extent. However, the first technique to really achieve a subdiffraction resolution was STED (Stimulated Emission Depletion) microscopy (Hell and Wichmann, 1994; Klar et al., 2000; Hell, 2003). Alternative methods were developed using stochastic activation of individual fluorophores such as stochastic optical reconstruction microscopy (STORM) (Rust et al., 2006; Huang et al., 2008) or direct dSTORM (Heilemann et al., 2008; van de Linde et al., 2008). Both STORM and dSTORM are based on the detection of single fluorescent molecules and the localization of these molecules with nanometer accuracy (Bates et al., 2007; Heilemann et al., 2008). After multiple activation cycles, the positions of numerous fluorophores are determined and used to construct a high-resolution image. Thereby, organic fluorophores such as Cy5 or Alexa 647 in combination with (STORM) (Bates et al., 2005) or without (dSTORM) (Heilemann et al., 2005) an activator fluorophore in close proximity are used. Especially, dSTORM is compatible with any fluorescence method that enables the labeling of target molecules with a reversible photoswitchable fluorophore (Heilemann et al., 2005; van de Linde et al., 2008). As demonstrated in Figure 3.5 (a) the emission of a fluorophore is read out at

RESULTS

647 nm until the fluorophore enters a non-fluorescent dark state. Through irradiation with 514 nm, the fluorophore can be switched back to the fluorescent state. This transition is reversible and it was demonstrated that this occurs with highly reliability up to hundred times per single fluorophore (Heilemann et al., 2005).

(a) (b) (d)

(c)

(e)

dSTORM

Alexa647 labeled Cox17

Figure 3.5. The principle of dSTORM image analysis. (a) A reversible photoswitchable fluorophore conjugated to a biomolecule is reversibly switched between a fluorescent and non-fluorescent state upon simultaneous illumination with two different wavelengths of light (here 647 and 514 nm). A typical fluorescence spot from a single fluorophore (b) can be fitted multiple times to Gaussian functions to determine its center of mass, which leads to a localization pattern (c). (d) The accuracy of localization, which determines the resolution of the method, was determined from over 1,000 single localizations that were overlaid yielding a resolution of 20 nm (van de Linde et al., 2008). (e) Fluorescence images of Alexa 647 labeled Cox17 were analyzed by dSTORM. The dSTORM image was further processed with a spot-finding algorithm, and individual locations of labeled molecules above a threshold are expressed as red spots.

In (b) a typical fluorescence spot from a single fluorophore can be seen, which can be fitted multiple times to Gaussian functions to determine its center of mass for each fluorophore. The localization of individual molecules in

RESULTS separate switching cycles can be summed up and used to determine the accuracy of localization (Figure 3.5 (c)).

High-resolution images were applied to analyze the effect of Cox17 depletion of the protein distribution of Cox17 and COX in collaboration with Prof. Dr. Markus Sauer (Applied Laser Physics and Laser Spectroscopy, Universität Bielefeld). For this purpose, COX17 transfected HeLa cells were plated in eight well chambered coverglass (Lab-Tex™, Nunc) and fixed using 3.7 % paraformaldehyde in PBS. In order to stain Cox17 or COX, cells were incubated either with polyclonal anti-Cox17 or with monoclonal anti- complex IV subunit Cox1 antibodies and subsequently with Alexa 647 labeled secondary antibody. The fluorescence spots emitted from single Alexa 647 labeled F’ab-fragments during each fluorescence cycle were identified in each image applying an intensity threshold and were fitted to a Gaussian function to determine the center of mass for each fluorophore (see Figure 3.4 (e)).

Immunofluorescence images and high-resolution dSTORM images of mitochondria with immunolabeled COX subunit Cox1 and Cox17 are shown in Figure 3.6 (a) and (b), respectively.

RESULTS

(a)

RESULTS

(b)

Figure 3.6. Subdiffraction-resolution imaging of immunolabeled pTurboRFP- mito HeLa cells transfected with COX17 siRNAs. (a) Fluorescence images of a section of pTurboRFP-mito HeLa cells (left), 24 h, 72 h and 120 h after transfection with COX17 siRNA 2, immunolabeled with Alexa Fluor 647 anti-complex IV subunit Cox1 (middle). The resolution of the immunofluorescence image is substantially improved applying dSTORM (right). (b) Fluorescence images of a section of pTurboRFP-mito HeLa cells (left), 24 h, 72 h and 120 h after transfection with COX17 siRNA 2, immunolabeled with Alexa Fluor 647 anti-Cox17 (middle). The reconstructed dSTORM images reveal structural details on the distribution of Cox17 upon COX17 knockdown (right). A magnified view of the fluorescence images and dSTORM image (yellow frame) is shown for the control cells.

RESULTS

Typical immunofluorescence images of mt structure were generated by objective type total internal reflection fluorescence microscopy and are shown in Figure 3.6 (a) left (pTurboRFP-mito) and middle (CIV-subunit Cox1 / Alexa 647) and (b) middle (Cox17 / Alexa 647). dSTORM was applied to generate high-resolution images of individual COX or Cox17 localizations ((a) and (b), respectively, right). The high-resolution images were constructed from a series of ~8,000 individual localizations of individual single F’ab- fragments. Clearly, a much finer structure is observed in the magnified view of the reconstructed images, compared to the fluorescence images (yellow frame), which demonstrate the strength of the dSTORM method in improvement of the resolution. In contrast to the conventional fluorescence images, the dSTORM images showed clearly separated clusters of localization, whereby each cluster corresponds to an individual protein molecule and resulting from repetitive localizations of a single Alexa 647 molecule over multiple switching cycles. Similarly to the results obtained for the COX17 knockdown on the mRNA and protein level, Cox17 localizations are markedly diminished 72 h post transfection (Figure 3.6 (b)). Thereafter, the Cox17 localizations gradually increase until the end of the experiment (120 h), reaching approximately 50 % of control levels. In contrast, the distribution of COX subunit Cox1 did not vary over the time of the experiment. This was unexpected, as steady- state levels of Cox1 became strongly reduced, reaching its minimal level at 72 h (Figure 3.4). However, in their native state, local clustering of a certain number of COX molecules (oligomerization) and the formation of COX- containing supercomplexes may lead to inaccessible antibody binding sites in immunocytochemistry. In contrast, Cox1 steady-state concentration has been accessed under denaturing and reducing conditions on SDS-PAGE.

3.3 PHENOTYPICAL CHARACTERIZATION

To describe the phenotype of COX17 knockdown cells different parameters were analyzed. Multi-parameter phenotypical profiling included (i) growth of cells on DMEM without glucose supplemented with 10 mM galactose, (ii) cell cycle analysis by propidium iodide (PI) staining, (iii) apoptosis assay by Annexin V-FITC / PI staining, (iv) ROS analysis with DCFH-DA and (v)

RESULTS determination of oxygen consumption. Each of these methods can measure changes in several cellular processes in order to systematically evaluate the effect of COX17 silencing.

3.3.1 GROWTH ANALYIS

To address the question whether COX17 knockdown affects growth of transfected HeLa cells, cell titers of vital HeLa cells transfected with negative control siRNA or COX17 siRNA 2 were compared with that of untransfected cells. As shown in Figure 3.7, knockdown of COX17 leads to a substantial reduction of the cell titer, indicating the importance of this copper chaperone for growth of the HeLa cells.

Figure 3.7. Growth of COX17 knockdown cells. Cell titers of untransfected HeLa cells (WT, ♦), and of cells transfected with negative control siRNA (▲) or COX17 siRNA 2 (•) were determined at the indicated time points after transfection (mean values of five measurements and minimum and maximum are given with error bars).

3.3.2 CELL CYCLE ANALYSIS

PI staining was used in order to identify phenotypic changes in the cell cycle. For this purpose, transfected and untransfected HeLa cells were permeabilized

RESULTS and incubated with PI. PI intercalates into cellular DNA and the fluorescent signal, which is directly proportional to the DNA content, can be analyzed by flow cytometry. Figure 3.8 (upper left), shows a typical distribution with the majority of cells in the G0/G1 phase (tallest peak). The small rightmost peak in the histogram shows the cells in the G2/M state, and the area between these peaks refers to cells within the S-phase. The following two histograms show the cell cycle state of negative control siRNA transfected cells 72 h and 144 h post transfection. The lower panels visualize cell cycle analysis of cells transfected with COX17 siRNA 2 24 h, 72 h and 144 h post transfection. A time-course study (24 h – 144 h) monitoring changes of the cell cycle can be seen in Appendix, Figure 5.1. PI data were quantified using the peak fitting program of the Partec FloMax® FCM Data Acquisition and Analysis Software (materials and methods, Figure 2.2). The results are visualized in the circular chart inside each histrogram.

Figure 3.8. Cell cycle analysis. HeLa cells transfected with negative control siRNA or COX17 siRNA 2 were analyzed with PI staining followed by flow cytometry. PI data were automatically modeled with the peak fitting program of the Partec FloMax® FCM Data Acquisition and Analysis Software. Circular chart: proportions of cells in each cell cycle phase. Data acquisition was conducted by collecting 20,000 cells per sample.

RESULTS

Cell cycle analysis indicates that knockdown of COX17 resulted in a distinct increase of cells in the sub-G1 phase (dead cells/cell debris), accompanied by a decrease in cells at G1 phase. The amount of cells in the sub-G1 phase gradually rose in the course of the experiment: while 24 h after transfection about ~5 % of cells were within the sub-G1 peak, an increase towards the sub-G1 phase could be observed after 72 h and 144 h with respective ratios of 14 % and 22 %. In contrast, the percentage of cells in S, G2 and mitosis is relatively uniform and unaffected by COX17 knockdown. These experiments indicated that downregulation of COX17 triggers apoptosis in HeLa cells.

3.3.3 APOPTOSIS ASSAY

To further verify that the cells showing an enrichment of sub-G1 indeed were undergoing apoptosis, COX17 siRNA and negative control siRNA treated cells were stained with Annexin V-FITC and PI (Figure 3.9). The measurement of Annexin V-FITC binding to the cell surface was performed in conjunction with the vital dye PI to distinguish between non- apoptotic (Annexin V-FITC negative / PI negative), early apoptotic (Annexin V-FITC positive / PI negative) and late apoptotic or necrotic cells (Annexin V- FITC positive / PI positive) (materials and methods, Figure 2.3) in one sample. Therefor, the same cell cultures used for the cell cycle analysis were analyzed by flow cytometry using the FL1 and FL2 channels for detection of Annexin V- FITC and PI staining, respectively.

RESULTS

Figure 3.9. Identification of apoptotic cells by flow cytometry. HeLa cells were transfected with COX17 siRNA 2 or negative siRNA for the indicated times. After detachment with trypsin, the cells were stained with CytoGLO™ Annexin V-FITC Apoptosis Detection Kit. The cell populations in the lower left quadrants represent non-apoptotic cells, in the lower right quadrants early apoptotic cells and in the upper right quadrants late apoptotic or necrotic cells. A total of 20,000 cells were counted for each sample. Additional time points (48 h, 96 h and 120 h) are summarized in Appendix, Figure 5.2.

Regular flow cytometric cell cycle analysis revealed a slight increase in the sub-G1 peak for COX17 knockdown cells, indicating apoptosis at 72 h post transfection. As analyzed by light microscopy, the COX17 transfected cells displayed significant apoptosis compared to control cells starting at 72 h post- transfection (data not shown). Figure 3.9 shows the representative results of three experiments to determine the kinetics of cell death caused by COX17 knockdown in HeLa cells by Annexin V-FITC / PI staining. Therein an increase of early-apoptotic cells over the time with a maximum at the end of the experiment is shown (52 % apoptotic cells at 144 h post transfection). The results are consistent with the observed cell proliferation rate and cell cycle analysis and suggest that COX17 knockdown cells are less viable due to an increase in apoptosis.

RESULTS

3.3.4 DETECTION OF ROS

ROS are reactive molecules that are formed as by-products of normal metabolism of aerobic organisms and have the potential to cause cellular damage. COX is higly efficient at reducing oxygen to water, and it releases very few partly reduced intermediates. However, during respiration a small amount of electrons leaks from the electron carriers and passes directly onto − oxygen, giving the superoxide radical,·O2• , best documented for Complex I and Complex III (Turrens, 2003). The term ROS is used for short-lived diffusible entities such as hydroxyl (•OH), alkoxyl (RO•) or peroxyl (ROO•) radicals and for some radical species of medium lifetime such as superoxide

− (O2• ) or nitroxyl radical (NO•). It also includes the non-radicals hydrogen peroxide (H2O2), organic hydroperoxides (ROOH) and hypochlorous acid (HOCl) (Simon et al., 2000). Cells are usually able to defend themselves against ROS through a variety of antioxidant defences and repair enzymes (e.g., reduced glutathione, catalase, and superoxide dismutase). However, if generated in excess, ROS can mediate cellular oxidative stress often leading to programmed cell death. To investigate the involvement of ROS in the regulation of apoptosis in COX17 knockdown cells, the extent of cellular ROS was assayed using DCFH-DA. Briefly, non-fluorescent DCFH-DA is taken up by cells, and once inside the cell, the diacetate residues are cleaved by intracellular esterases, liberating DCFH (Gomes et al., 2005). DCFH reacts predominantly with highly oxidizing species of ROS such as hydroxyl radicals and peroxynitrite. Highly fluorescent DCF is formed, which can be analyzed by flow cytometry.

In order to confirm the principal function of the assay, HeLa cells treated with paraquat (a known generator of intracellular ROS) were analyzed by flow cytometry using the FL1 channel (materials and methods, Figure 2.4). Although a defined mechanism underlying paraquat toxicity has not been described yet, it is widely acknowledged that a cyclic single-electron reduction/oxidation is a critical mechanistic event (Bus and Gibson, 1984). Paraquat radicals are formed as a consequence and donate their electrons to

− molecular O2, producing O2• radicals, which are supposed to be the primary mediator of the biological toxicity of paraquat (Krall et al., 1988).

RESULTS

Figure 3.10. ROS production in HeLa cells. HeLa cells were transfected with negative control siRNA or COX17 siRNA 2 and harvested at the indicated time points. The cells were washed with PBS and incubated for 15 min with 50 µM DCFH-DA in ethanolabs at 37 °C in the dark. Cellular ROS induction was analyzed by flow cytometry using the FL1 channel. A total of 10,000 cells were counted for each sample.

As shown in Figure 3.10, COX17 knockdown induced a time-dependent increase in cellular ROS levels as defined by DCF fluorescence (RN2). While untreated and negative control siRNA transfected cells show no fluorescence of RN2 (upper panels), COX17 knockdown cells produce high fluorescence of RN2 at 72 h post transfection, indicating increased ROS production (lower middle panel). Remarkably, 144 h after COX17 transfection a strong shift toward the RN2 peak could be observed. The generation of ROS upon COX17 silencing might be one important trigger mechanism responsible for the observed increase in apoptotic cells. This is in line with the growing evidence that ROS are important for the induction of apoptosis due to the disruption of the mt membrane potential (Zamzami et al., 1995).

RESULTS

3.3.5 OXYGEN MEASUREMENT

To have a closer look on the effect of COX17-targeting RNAi on the functioning of mt OXPHOS, cell culture oxygen consumption rates of untreated, control and COX17 siRNA transfected HeLa cells were determined. For this purpose HeLa cells were seeded in 24 well OxoDish®plates, containing a polymeric oxygen sensor at the bottom of each well. The 24 well plates were placed on a SensorDish® reader (PreSens Precision Sensing) and

dissolved O2 was measured online without removing or damaging cells during cultivation. Readings were taken in 60 min intervals. Figure 3.11 represents the results obtained for oxygen measurement of untreated, COX17 siRNA 2 and negative control siRNA transfected cells, 24 – 144 h after transfection in relation to the number of living cells.

Figure 3.11. Respiration rate in COX17 knockdown cells.

Rate of dissolved O2 was measured by optical-chemical sensor for untreated (WT,♦), negative siRNA (▲) and COX17 siRNA 2 (•) transfected cells. Oxygen consumption per cell number was calculated for the indicated time points. (Mean values of three measurements and minimum and maximum are given in error bars).

The results show a significantly lower rate of oxygen consumption in cells with decreased levels of Cox17, compared to untransfected and negative siRNA transfected cells. In the presence of 1 mM cyanide, an effective inhibitor of COX, oxygen uptake was almost completely inhibited, demonstrating that the

RESULTS observed oxygen consumption can be attributed to the mt respiratory chain (data not shown). Maintenance of cellular activities of COX17 knockdown cells at diminished O2 consumption may explain their reduced growth rate.

3.4 CYTOCHROME C OXIDASE ACTIVITY

Yeast cells harboring a COX17 null mutant fail to grow on non-fermentable carbon sources and are respiratory deficient. In general, the rate of growth of a strain on a non-fermentable medium reflects its COX activity (Punter and Glerum, 2003). To determine whether the growth rate of the COX17 siRNA transfected HeLa cells correlates with the enzymatic activity of COX, mitochondria of untreated cells, COX17 and negative control siRNA transfected HeLa cells were isolated and the COX activity was measured photometrically. This assay is based on the decrease in absorbance at 550 nm of reduced cytochrome c upon its oxidation by COX.

Figure 3.12. COX activity of COX17 knockdown cells. Enzymatic activity of COX in mitochondria of cells treated with siRNA against COX17 was normalized to the activity of citrate synthase and related to the activity to cells transfected with negative control siRNA (100 %) (Mean values of three measurements and minimum and maximum are given in error bars).

RESULTS

COX activity of negative control was set to 100 %. As can be seen in Figure 3.12, COX activity gradually declined to ~60 % within the first 72 h after transfection and then remained almost constant up to 144 h. The observed decline in COX activity is in line with the half life of COX of about three days (Stiburek et al., 2006), which was determined by activity measurement upon treatment of cells with cyanide.

3.5 CHARACTERIZATION OF MT OXPHOS COMPLEXES

The Blue native (BN)-PAGE is a useful tool for isolating intact membrane- associated protein complexes and for investigating the molecular organization of mt respiratory complexes (Schägger, 1995). The OXPHOS complexes retain enzyme activity upon separation by BN-PAGE (Schägger and von Jagow, 1991), whereby the protein complexes as well as the assembled supercomplexes can be easily detected by in gel activity staining. A major advantage of the method is that the activity of different organized forms of the complexes are readily ascertained and that non-specific activities do not interfere, because they are unlikely to have the same size and mobility as the complex of interest (Nijtmans et al., 2002).

To address the question whether depletion of Cox17 affects activity of RC complexes and their supramolecular organization, mt protein complexes were analyzed by BN-PAGE and subsequently detected either by their enzymatic activity (first dimension), or with antibodies after separation in a SDS-gel (second dimension).

3.5.1 BN-PAGE/IN GEL ACTIVITY ASSAYS

Native separation of mt membrane complexes of untransfected HeLa cells, negative siRNA and COX17 siRNA 2 transfected HeLa cells was performed to monitor changes of the OXPHOS complexes during COX17 knockdown. In gel activity staining was used to define the activity of NADH dehydrogenase, cytochrome c oxidase and lactate dehydrogenase (LDH). Mitochondria isolated from transfected or untransfected HeLa cells were solubilized by the non-ionic detergent digitonin and loaded on a non-

RESULTS denaturing BN-gel. Apparent molecular masses were determined by using molecular mass markers. Figure 3.13 shows the result of the complex I, complex IV and LDH in gel activity assays. In gel activity staining of complex I (by NADH dehydrogenase activity) was displayed by purple bands at a MW above 1 MDa resulting from formazan precipitation (1*) (Grandier-Vazeille and Guerin, 1996; Krause et al., 2004). In untransfected cells and control samples faint bands with approximately the same distance to each other indicate the formation of the known supercomplexes I1III2IV0-4 (Schägger and Pfeiffer, 2000). Complex IV activity (2*) was determined by the cytochrome c dependent oxidation of diaminobenzidine to brown oxide and indamine precipitates (Guerin et al., 1979; Wittig and Schägger, 2007). COX activity was detected at approximately 440 kDa, which represents the complex IV dimer (Krause et al., 2005). With cytochrome c as substrate, active bands were not obtained for mitochondria treated with COX17 siRNA for 72 h.

Figure 3.13. BN-PAGE/in gel activity of digitonin solubilized mitochondria. Mt membrane proteins (200 µg) of untransfected HeLa cells (WT) and of HeLa cells transfected with either negative siRNA (control) or COX17 siRNA 2 (48 h and 72 h post transfection) were solubilized by digitonin (detergent:protein ration of 4:1) for 15 min. OXPHOS complexes were separated by BN-PAGE (3 %-13 %) and subsequently subjected to NADH dehydrogenase (1*), COX (2*) and LDH (3*) in gel activity staining.

RESULTS

Interestingly, activity staining of LDH (Figure 3.13 (3*)) revealed an increase in LDH activity 72 h after transfection. In gel activity assay was adapted following the instruction described for the pyruvate dehydrogenase (PDH) (Gey et al., 2008), using lactic acid as substrate instead of pyruvate. LDH activity was detected at approximately 120–160 kDa, representing different isoenzymes. In most tissues LDH is composed of five isoenzymes with a molecular weight of ~140 kDa, as estimated by gel-filtration chromatography (Massaro, 1970). The increase of the LDH activity could indicate that the knockdown of COX17 leads to an impaired RC activity and a concomitant increase in anaerobic glycolysis, which results in elevated lactate production.

However, the most interesting information is the time course of supercomplex changes, as visualized by NADH dehydrogenase activity (1*). In order to follow the time-dependent changes in supercomplex formation, one focus of this thesis was to optimize the in gel activity assays to facilitate comparative analysis of the specific activities of supercomplexes; this was done using bovine heart mitochondria (BHM).

3.5.2 SUPRAMOLECULAR ORGANIZATION OF COX

BN-PAGE/in gel activity assays were used to confirm the functional integrity of supercomplex components by using digitonin as solubilizing detergent. Therefore, NADH dehydrogenase activity of complex I and cytochrome c oxidase activity of complex IV, respectively, were visualized by in gel activity staining. Only the results of the complex I activity staining are shown in Figure 3.14. Staining of supercomplexes for complex IV activity was too faint to be visualized in photographs. The various bands were assigned according to characterized supercomplexes (Schägger and Pfeiffer, 2000). In gel activity staining of complex I of BHM, untreated and control HeLa cells revealed the typical pattern of supercomplexes with four major bands that represent different assemblies of complexes I, III and IV as described by Schägger & Pfeiffer (2000). Based on the nomenclature of these authors, supercomplexes of HeLa cells were assigned in the molecular mass range between 1.5 and

2.1 MDa as supercomplexes SC a–d (SC a: I1III2; SC b: I1III2IV1; SC c:

I1III2IV2; SC d: I1III2IV3, with SC b at ~1.7 MDa being the major physiological module of the mammalian RC (Schägger and Pfeiffer, 2001).

RESULTS

48 h, and more pronounced 72 h after transfection of COX17 siRNA, SC d and SC c+d, respectively, are no longer detectable, while the abundance of SC b and SC a seems to be constant or even slightly increase.

Figure 3.14. Supramolecular organization of RC complexes. Mt proteins of bovine heart (BHM), untransfected HeLa cells (WT) and of HeLa cells transfected with either negative siRNA (control) or COX17 siRNA 2 (48 h and 72 h post transfection) were isolated and solubilized with digitonin. In gel NADH dehydrogenase activity was determined after BN-PAGE. Supercomplex composition, MW and nomenclature were assigned according to Schägger and Pfeiffer (2000).

3.5.3 MOLECULAR ORGANIZATION OF COX17

Two dimensional gelelectrophoresis (2D-BN/SDS-PAGE) was used to study the molecular organization of Cox17. Therefore, mitochondria of COX17 siRNA and negative control siRNA transfected HeLa cells were subjected to BN-PAGE with an additional second dimension under denaturing conditions. For this purpose, the gel strips from the first dimension were incubated in SDS and TCEP and assembled on a SDS-PAA gel followed by Western blot analysis (materials and methods, chapter 2.2.9.2 and 2.2.10). The native complexes dissociate into their subunits and can be detected immunologically. The resulting patterns of proteins detected in the digitonin solubilized mitochondria are shown in Figure 3.15 (a) + (b)). As expected the strong signals observed in control HeLa cells (a) disappeared upon COX17 knockdown (b), documenting the siRNA specificity. Depending on the applied reducing agents, signals resolved in the second dimension (SDS-PAGE) differed: under standard conditions (reduction with mercaptoethanol or DTT) only a strong diffuse signal of 30-50 kDa [3] was visible. In the presence of TCEP additional minor bands of 10-15 kDa [1] and 25-30 kDa [2] were detected that might correspond to mono- and oligomeric forms of Cox17. The various migration forms of Cox17 might be due to

RESULTS inefficient denaturating and reducing conditions during equilibration of the first dimension gel strips and eventual reoxidation during electrophoresis of the cysteine-rich Cox17 as reported for gel filtration analysis (Voronova et al., 2007a). With regard to the first dimension (native gel) Cox17 forms [1] and [2] and most of form [3] are part of a ~150 kDa complex. Part of form [3] is organized in additional complexes.

3.5.4 MOLECULAR ORGANISATION OF COPPER-BEARING COX

SUBUNITS COX1 AND COX2

Molecular organisation of OXPHOS complexes in control cells and COX17 knockdown cells was examined by use of the OXPHOS antibodies mixture (Figure 3.15 (a) + (b)). The positions of supercomplexes were assigned as supercomplexes a-d as describe above. RC complexes are given as Roman numbers (complex I (CI), complex II (CII), complex III (CIII), complex IV (CIV) and complex V (CV). Complex I seems to be exclusively organized in supercomplexes a-d.

F1F0 ATPase was mainly present at 750 and 1,300 kDa, possibly reflecting its mono- and dimeric form. Complex III was preferentially observed as part of the SCs a-d, as well as of two complexes at ~700 and 900 kDa, both co- migrating with complex IV. According to Schägger and Pfeiffer (2000), the latter two could represent supercomplexes III2IV1 and III2IV2, respectively. The majority of complex IV was detected at ~440 kDa, most likely representing its dimeric form, and as component of SCs b-d. Contrary to the results of Acin-Pérez et al. (2008) complex II could not be detected as part of SCs. Instead, complex II was exclusively detected at ~150 kDa, corresponding to its monomeric form. The OMM protein VDAC that served as internal loading control was represented by a number of spots ranging from 50 to 500 kDa, probably indicating its different supramolecular assemblies (Hoogenboom et al., 2007). Overall, the gross organization of RC complexes was not affected by COX17 knockdown. A marked alteration was observed with Cox2 antibody, revealing reduced level of SCs, especially of the III2IV2 complex. In order to analyze COX organization in more detail, Western blots were additionally probed with Cox1 antibody. As indicated in Figure 3.15 ((a) + (b))

RESULTS

Cox17 depletion had a remarkable effect on the organisation of Cox1. In addition to the strong reduction of the signals at the position of SC b-d a novel complex of ~150 kDa was observed. The comparable sizes of this complex and of the above described Cox17-containing complex may hint at the simultaneous presence of both proteins.

(a) (b)

Figure 3.15. 2D-BN/SDS-PAGE of OXPHOS complexes. (a, b) 2D-BN/SDS-PAGE of RC-complexes of cells transfected with either negative siRNA (b) or COX17 siRNA 2 (c) 24 h post transfection. Proteins were blotted and probed with antibodies against Cox17 and VDAC, an OXPHOS Human Antibody Cocktail (which recognizes the following individual subunits of the indicated OXPHOS complexes: ATP synthase subunit alpha (CV), complex III subunit Core 2 (CIII), complex II-FeS subunit 30 kDa (CII), complex IV subunit Cox2 (CIV-Cox2) and complex I subunit NDUFB8 (CI), and with an antibody against complex IV subunit Cox1 (CIV-Cox1). Positions of SCs (a,b,c,d) and RC complexes (Roman numbers) are given. Due to the low intensity of the SCs long exposure times were applied, that resulted in saturation of the 440 kDa signal.

3.5.5 SUPRAMOLECULAR ORGANIZATION OF RC COMPLEXES

To study the effect of COX17 knockdown on COX assembly in more detail, a time resolved analysis was performed with the total OXPHOS human antibody

RESULTS cocktail and Cox1 antibody. Since no differences were observed for complexes II, III and V and VDAC, only the signals of complex IV (CIV-Cox1 and Cox2) and of complex I (CI) are shown in Figure 3.16. Complex I signals were detected in the control cells at the positions of SCs a-d, with the strongest signal corresponding to SC b. Complex I signals associated with SC d disappeared in the course of the experiment and were no longer detectable at 120 and 144 h. At these time points, complex I signals at the position of SC c are also markedly decreased. These findings are in accordance with the results of the complex I in gel activity staining (Figure 3.14), and confirm the effect of COX17 knockdown on the supramolecular organization of RC. Detection with COX-specific antibodies likewise revealed alterations in the SC organisation. Starting from 24 h after transfection of siRNA until the end of the experiment (144 h), the Cox1, but not the Cox2 antibody detected the above described 150 kDa complex. Concomitantly, substantial decreases of Cox1 and Cox2 signals in SC b-d were noticed. Already at 24 h both COX subunits are no longer visible in the area of SC d. After additional 48 h, they are also not detectable at the positions of SC b and c.

The Cox1 and Cox2 signals in III2IV1 and III2IV2, respectively, progressively decreased up to 96 h post transfection. Interestingly, weak signals reappeared after 120 h, indicating the formation of new complexes. In contrast, the steady-state concentrations of Cox1 and Cox2 in the COX dimer of 440 kDa seems to be unaffected by COX17 knockdown.

RESULTS

Figure 3.16. Molecular organization of RC complexes. Time course of the molecular organization of complex IV (CIV) and complex I (CI) in COX17 siRNA 2 transfected cells. Proteins were separated by 2D-BN/SDS-PAGE, blotted and probed with antibodies against Cox1 (CIV-Cox1), Cox2 (CIV-Cox2) and NDUFB8 subunit of complex I (CI). Positions of SCs (a,b,c,d) and RC complexes (Roman numbers) are given. Due to the low intensity of the SCs long exposure times were applied, that resulted in saturation of the 440 and 150 kDa signals.

3.5.6 DSTORM OF SUPERCOMPLEXES

Supercomplexes are described as the most efficient form of the RC to generate energy, and advantages of such multienzyme complexes over individual activities has been proposed: substrate channelling, catalytic

RESULTS enhancement, and sequestration of reactive intermediates (Bianchi et al.,

2004; Schägger et al., 2004). Calculated 3D maps of I1III2IV1 were already generated upon electron microscopy analysis and gave first insights into the positions and interactions of the individual RC when assembled into SCs (Schäfer et al., 2007).

To non-invasively image intracellular SC formation in HeLa cells, subdiffraction-resolution fluorescence images were taken.

Figure 3.17. dSTORM of supercomplexes. Total internal reflection fluorescence images of pTurboRFP-mito HeLa cells (upper left) with a magnified view of a mt structure (upper right). HeLa cells were transfected with COX17 siRNA 2 72 h and immunolabeled with Alexa Fluor 647 anti - MitoProfile® Total OXPHOS Human WB Antibody Cocktail. The reconstructed dSTORM image (lower left) reveals structural details on the distribution of supercomplexes in the IMM (lower right).

To perform dSTORM imaging of SCs in the IMM, immunocytochemistry was used. In Figure 3.17 (upper left), a typical immunofluorescence image of pTurboRFP transfected HeLa cells is shown. The cells were incubated with the

RESULTS total OXPHOS human antibody cocktail that comprises antibodies against subunits of all OXPHOS complexes, and dSTORM was applied (lower left). The magnified view exhibits an obviously higher resolution of the protein distribution along the IMM. Thus, dSTORM may represent a novel method to provide structural information of SCs.

Differences between control and COX17 siRNA transfected HeLa cells were not observed. One reason for this may be that epitopes recognized by the different antibodies may be hidden due to the SC formation.

3.6 COPPER SUPPLEMENTATION

Growth of S. cerevisiae COX17 mutant on non-fermentable substrates could be restored by addition of copper. To test, whether increased copper concentrations could also rescue the COX17 phenotype in HeLa cells, COX17 knockdown cells were incubated with copper histidine (Cu–His). Cu-His presents copper in a physiologically suitable form, as it is suggested that copper uptake by hepatocytes and brain tissue is mediated by histidine (Barnea et al., 1990; Katz and Barnea, 1990; Harris, 1991). Clinical benefit of Cu-His therapy has been documented in several patients with Menkes disease (Kreuder et al., 1993; Sarkar et al., 1993). Different concentrations of Cu-His were added either one day before transfection or 24 h or 72 h after transfection with COX17 siRNAs. The cells were incubated for at least another 24 h up to 144 h after transfection. COX activity of isolated mitochondria was determined spectrophotometrically and steady-state levels of COX subunits Cox1 and Cox2 were analyzed by Western blot. No differences were observed between COX17 siRNA transfected cells incubated with or without Cu-His (data not shown). The applied concentrations of added copper were not able to rescue COX17 deficiency in HeLa cells. At higher concentrations of Cu–His increased cell death was observed in both, untreated and COX17 siRNA-treated cells, probably reflecting copper toxicity.

DISCUSSION

4 DISCUSSION

Assembly of COX, the terminal enzyme of the eukaryotic RC, involves the interplay of two different genomes and requires the assistance of a number of assembly factors acting at several levels of the process. The function of COX is crucial for the regulation of ATP production within mitochondria and has a major impact in human health (Barrientos et al., 2002). The knowledge of delivery and insertion of copper into COX during holoenzyme biogenesis is still limited, although an extensive set of data describing structural and functional features of this complicated process is available. So far, a total of eight soluble (Cox17, Cox19, Cox23, Pet191, Cmc1-4) and three integral membrane (Cox11, Sco1, Sco2) proteins with essential roles in copper delivery to COX have been identified in yeast, all of them having human orthologues (Leary, 2010). These proteins are either exclusively localized in mitochondria or possess a dual localization in the cytoplasm and mt IMS. Moreover, depletion of most of them results in respiratory deficiency and often in disassembly of COX subunits (Khalimonchuk and Rödel, 2005), indicating that the successful delivery of metals to the site of COX assembly and their proper insertion are important steps in the complex formation.

This thesis focuses on human Cox17 and provides a systematic examination of the effect of COX17 knockdown in HeLa cells. Using transient siRNA transfection, HeLa cells contain ~90 % reduced COX17 mRNA and protein levels. Remarkably, COX17 knockdown cells showed a vastly reduced COX activity, an increased level of ROS and apoptotic cells and a markedly decreased level of OXPHOS supercomplexes. This raises the question on the role of Cox17 in the stability and assembly of the enzyme complexes.

4.1 DUAL LOCALIZATION OF HUMAN COX17

Involvement of Cox17 in copper homeostasis was originally implicated by the observation that the respiratory defect of yeast COX17 null mutants was suppressed by high exogenous copper levels (Glerum et al., 1996a). Based on its dual localization in the cytoplams and the mt IMS, yeast Cox17 was initially

DISCUSSION proposed to act as a copper shuttle between these two compartments (Beers et al., 1997). In accordance with this proposal, confocal fluorescence microscopy of HeLa cells expressing pTurboRFP-mito labeled with Cox17 antibodies and Western blot analysis of subcellular fractions of HeLa cells showed that Cox17 is highly enriched in mitochondria and only a small portion (< 20 %) resides in the cytoplasm. In addition, investigations of the submitochondrial localization of Cox17 through the formation of mitoplasts by hypo-osmotic treatment revealed that Cox17 and the mt IMS marker cytochrome c show an identical distribution. These results support the idea on Cox17 being a shuttle for copper ions to the mitochondria.

However, in view of the results that tethering of yeast Cox17 to the IMM does not cause any respiration defect (Maxfield et al., 2004) and that twin Cx9C motif containing mt IMS proteins are imported into the mt IMS by the Mia40 pathway (Mesecke et al., 2005; Mesecke et al., 2008), this proposal probably has to be revised. Hence, the observed distribution possibly reflects the equilibrium of the reduced cytosolic form (Cox170S-S) and the oxidized form

(Cox172S-S) residing in the mt IMS, as described by Voronova et al. (2007b). It strongly supports the current hypothesis that the fully reduced Cox17 protein present in the cytoplasm enters the mt IMS where it is then oxidized by Mia40 to Cox172S-S. Partially oxidized Cox172S-S is the functional species in the mt IMS, where it is able to bind a single copper ion and enters the pathway of copper delivery to COX (Banci et al., 2008b; Sideris et al., 2009). Although it is generally suggested that Cox17 donates copper for the biogenesis of COX CuA and CuB sites, it is still an open question how copper reaches Cox17 in the mt IMS. The existence of a bioactive copper pool within the mt matrix is a possible source (Cobine et al., 2006a) and it is proposed that a non-proteinaceous copper ligand exports copper to the mt IMS. Copper is then chaperoned by Cmc1 or other, yet unidentified metallochaperones to Cox17 and subsequently to the COX copper site-specific Sco1/Sco2 and Cox11 (Arnesano et al., 2005; Leary, 2010).

DISCUSSION

4.2 COX17 KNOCKDOWN AFFECTS STEADY-STATE LEVELS

OF COPPER-BEARING COX SUBUNITS COX1 AND COX2

Yeast cells harboring a mutant COX17 gene are respiratory deficient associated with COX deficiency (Glerum et al., 1996a). To investigate whether mammalian Cox17 has the same impact on respiration, silencing of COX17 in HeLa cells was performed using RNAi. RNAi is a powerful molecular genetic tool to elucidate gene function, and it is an easy-to-use technique, which was initially thought to be highly specific (Elbashir et al., 2001). The major disadvantage of RNAi by siRNA is known as so-called off-target effects, which are described as unintended protein downregulation upon siRNA treatment (Svoboda, 2007). Several data suggest that siRNAs specificity is not absolute and off-target gene silencing can occur through different mechanisms, including global up/down-regulation of genes using high concentrations of siRNA (Persengiev et al., 2004; Semizarov et al., 2004), the induction of an interferon response (Sledz et al., 2003), micro- RNA-like inhibition of translation (Doench et al., 2003; Saxena et al., 2003; Zeng et al., 2003; Bartel, 2004; Scacheri et al., 2004), and mRNA degradation mediated by partial sequence complementation (Jackson et al., 2003). In this thesis several aspects were considered to avoid off-target effects. Seven different pre-designed siRNAs targeting human COX17 and two scrambled siRNAs which are not complementary to any gene in HeLa cells were used to analyze gene specific changes in the expression profiles. Off- target effects would be seen as siRNA specific rather than gene specific changes in gene expression patterns (Dillin, 2003; Jackson et al., 2003; Semizarov et al., 2003). The final concentration of siRNA was decreased as low as possible due to the usage of highly potent ‘Silencer Select siRNAs’, resulting in effective target knockdown at lower concentration than older generation siRNAs (www.ambion.com). Off-target effects often occur in association with toxic side effects (Fedorov et al., 2006), thus the volume of transfection reagent was reduced.

The knockdown of COX17 was verified by qRT-PCR and Western blot analysis. COX17 mRNA level was specifically decreased to ~15 % and resulted in strongly reduced steady-state levels of Cox17 protein already 24 h post

DISCUSSION transfection. Depletion of Cox17 was accompanied by a decrease in COX activity, which is in accordance with the respiratory deficient phenotype of COX17 yeast null mutants (Glerum et al., 1996a). It is likely that the reduced COX activity, eventually resulting in a decreased energy supply, explains the observed effect of Cox17 depletion on cell proliferation. Reduced growth was also observed upon depletion of either COX subunits Cox4 and Cox5a in Caenorhabditis elegans (Suthammarak et al., 2009), and upon deletion of the COX assembly protein Cox10 in a mouse fibroblast cell line (Diaz et al., 2006). Knockdown of COX17 leds to reduced steady-state levels of the copper- bearing subunits Cox1 and Cox2, but not of subunits Cox4 and Cox5a. A temporal decrease of the mt encoded subunits of COX was already observed in SCO1 patients due to a defective Cox17 mediated copper metallation of Sco1 (Paret et al., 2000; Cobine et al., 2006b). The authors suggest that an inefficient maturation of the CuA site is the basis for the inefficient assembly of the COX complex and results in rapid degradation of unassembled subunits in the matrix. This is supported by the finding that mitochondria contain an evolutionary conserved ATP-dependent protease system in the IMM, which rapidly degrades mt proteins that are not incorporated into nascent enzyme complexes (Arnold and Langer, 2002; Williams et al., 2004). Within this context, it seemed that the COX17 knockdown had a much stronger impact on Cox2 than on Cox1. Similar differences in the stability of the two COX subunits have been observed in pulse-chase experiments of yeast cells lacking the COX assembly factor Sco1 (Schulze and Rödel, 1989; Krummeck and Rödel, 1990). As outlined by Rossmanith et al. (2008), co-translational incorporation of mt encoded subunits into pre-existing subcomplexes may account for their stability. The higher stability of Cox1 compared to Cox2 may result from the sequential COX assembly, with the first assembly intermediate containing Cox1, Cox4 and Cox5a (Fernandez-Vizarra et al., 2009). Subunits of RC complexes II, III and V were not affected, whereas steady- state concentration of complex I subunit NDUFB8 was slightly reduced. This effect may be attributed to a secondary destabilization of complex I by COX defects, as previously reported (D'Aurelio et al., 2006; Li et al., 2007). Loss of COX in knockout mice lacking COX subunit 10, which is involved in heme a synthesis, also resulted in the loss of complex I (Diaz et al., 2006). This supports the prevailing hypothesis, that presence of COX in substantial

DISCUSSION amounts is needed for the formation of respirasomes (Schäfer et al., 2006; Vonck and Schäfer, 2009).

Subdiffraction-resolution fluorescence imaging (dSTORM) was applied to analyze the effect of Cox17 depletion of the protein distribution of Cox17 and COX. dSTORM images provided clearly separated individual protein molecules, which in case of Cox17 substantially declined upon COX17 siRNA transfection, confirming the results obtained by Western blot analysis as well as the specificity of the COX17 siRNAs. The localization pattern of COX molecules did not vary over the time of the experiment, which can be explained with inaccessible antibody binding sites due to local clustering of a certain number of COX molecules and the formation of COX containing supercomplexes. Within this context, quantification and co-localization studies of Cox17 and COX remains an aspect to consider. This should be addressed by dSTORM in combination with multi-color high resolution technique, as this offers an approach to study protein-protein interaction and protein-aggregation in even shorter distances accessible by Fluorescence resonance energy transfer (FRET) (Heilemann et al., 2009). Additionally, subdiffraction-resolution fluorescence imaging methods might be used for structural analysis of supercomplexes.

4.3 SUPRAMOLECULAR ORGANIZATION OF RC IS AFFECTED

AS AN EARLY RESPONSE TO COX17 KNOCKDOWN

To investigate the involvement of Cox17 in the biogenesis of OXPHOS in HeLa cells, BN-PAGE/in gel activity assays and 2D-BN/SDS-PAGE were performed. After applying solubilized mitochondria of COX17 silenced HeLa cells to BN- PAGE, subsequent in gel activity assay revealed a strong reduction of COX activity between 48 h and 72 h post transfection, supporting the photometric results. However, oxygen consumption measurement indicates a rather slight effect on the respiration capacity. Based on this finding, the suggestion, that even low levels of active COX are able to maintain substantial RC function, can be made. This is in accordance with the observation of Letellier et al. (1993), who have shown that a minimal COX activity can sustain an appreciable flux of respiration and that the respiratory rate is not directly

DISCUSSION proportional to COX activity. Interestingly, activity staining of the LDH revealed that reduction in COX activity is accompanied by a simultaneous increase in LDH activity 72 h after transfection. The role of mt LDHs was already described 1999 by Brooks and co-workers and extended by studies of astrocytoma cells (Lemire et al., 2008). The results confirmed the presence of mt LDH isoenzymes and supported the role for mt LDH in tissue lactate oxidation associated with mt energy production (Brooks et al., 1999). The increase of the LDH activity in the COX17 siRNA transfected cells may maintain the energy supply and could indicate an impaired RC activity as well as a concomitant increase in anaerobic glycolysis, which results in elevated lactate production. However, further studies are needed to confirm these observations. This includes the photometrical measurement of the LDH activity with specific inhibitors of the mt LDHs (Brooks et al., 1999). Additionally, the lactate concentration in the cell culture supernatant should be examined to unveil a possible compensatory metabolic effect upon COX17 knockdown. Most important, NADH dehydrogenase activity analysis revealed an impairment of the supramolecular assemblies of the COX complex upon

COX17 depletion. COX-containing supercomplexes I1III2IV1-3 disappeared as an early response to reduced levels of Cox17. With some delay, the concentrations of SC III2IV1 and III2IV2 are also reduced (Figure 3.16). The observed effects on SCs were unexpected, as SCs are discussed as the most efficient form of the RC to generate energy, due to the enhanced electron transfer between complexes and the elevated stability of complexes (Schägger and Pfeiffer, 2000; Bianchi et al., 2004; Schägger et al., 2004).

It is widely accepted that exposure of mitochondria to excessive ROS can affect the respiratory activity and supercomplex formation of the enzyme complexes (Paradies et al., 2002; Zhang et al., 2002; Petrosillo et al., 2003; Paradies et al., 2004; Lenaz and Genova, 2007). The mt RC constitutes the main intracellular source of ROS in most tissues and a variety of antioxidant defenses and repair enzymes maintains the steady-state levels of these oxidants at non-toxic levels (Boveris, 1977; St-Pierre et al., 2002; Starkov et al., 2004). An imbalance between defense and ROS production by either deficient antioxidant defenses, inhibition of electron flow or exposure to xenobiotics may mediate cellular oxidative stress, often leading to apoptosis

DISCUSSION and cell death (Green and Reed, 1998; Kowaltowski et al., 2001; Kim et al., 2003; Turrens, 2003). Moreover, evidences are accumulating that supercomplexes are altered with age, and in some pathological cases, related to oxidative stress (Dencher et al., 2007). That indicates that the assemblies of RC supercomplexes might be modulated by an age- or disease-dependent increase in membrane viscosity caused by ROS stimulated lipid peroxidation. In consistency with these data, disassembly of SCs was accompanied by increased ROS levels and a considerable induction of apoptotic cells upon COX17 knockdown. The central idea is that depletion of COX17 results in an overall cellular imbalance associated with cumulative cellular stress due to an inefficient transport of copper. As free copper has the potential to generate ROS via Fenton reaction (Spasojevic et al., 2010), it is likely that an impaired copper delivery either from cytosol to mitochondria or within mitochondria leads to a disassembly of COX-containing SCs and initiation of the apoptotic pathway by increasing the permeability of the OMM (Liu et al., 1996; Li et al., 1997). As an alternative scenario, depletion of Cox17 may primarily lead to an impairment of the SC formation and subsequently to the induction of ROS. SCs are thought to increase the electron transfer rate to minimize the leakage of electrons that can potentially generate ROS (Panov et al., 2007; Vonck and Schäfer, 2009). Studies on superoxide generation by complex I suggest that loss of supercomplex organization induces excessive ROS formation (Dencher et al., 2007; Lenaz and Genova, 2007), although no specific study has been yet addressed this question. Complex I and III are considered as significant sources of ROS (Turrens, 1997; Liu et al., 2002; Genova et al., 2003), and in isolated complex I, flavin mononucleotide (FMN) is proposed to be the major electron donor to oxygen to form superoxide anion (Esterhazy et al., 2008). FMN only becomes exposed to oxygen when complex I is dissociated from complex III (Lenaz et al., 2010). In this context, the effect of the COX17 knockdown mediated induction of ROS of the mt localized SOD (Cu/Zn-SOD or SOD1 and Mn/SOD or SOD2) should be taken into account for further experiments. The SOD2 is a key mt antioxidant enzyme, which functions in the formation of superoxide into hydrogen peroxide and diatomic oxygen (Kokoszka et al., 2001). One would assume that the induction of mt ROS is reflected in an increase of SOD2 expression. Although the role of mt SOD1 in mt function is not known, its

DISCUSSION localization in the IMS suggests that the enzyme has a functional relationship with the occurrence of superoxide in this compartment (Inarrea et al., 2007). Induction of apoptosis in COX17 knockdown cells might also indicate an indispensable role for Cox17 in cell survival. Homozygous disruption of mouse COX17 gene leads to COX deficiency, followed by embryonic death (Takahashi et al., 2002). Interestingly, many apoptotic cells were observed in the COX17 (-/-) embryo and the authors suggest that Cox17 is essential for COX activation and early embryogenesis. The finding of embryonic lethality in mouse COX17 mutants may provide an explanation for the lack of obvious candidates of human diseases. In contrast, COX deficiency due to mutations in several COX assembly factors such as SURF1, SCO1, SCO2, and COX10 are associated with a wide range of encephalomyopathic disorders (Shoubridge, 2001). The unsuccessful attempts to generate a stable COX17 knockdown cell line (that will be discussed in more details below) may also attribute to this finding.

4.4 COX17 IS PRIMARILY ENGAGED IN COPPER DELIVERY

TO SCO1/SCO2

2D-BN-PAGE/SDS-PAGE analysis revealed an impairment of the supramolecular assemblies of the COX complex upon Cox17 depletion, while the 440 kDa COX dimer seems to be unaffected. Hence, it can be assumed that the decrease in COX activity is predominantly caused by this disassembly of COX-containing SCs. There is evidence to suggest that the SCs are not formed by a simple association of completely assembled RC complexes. In that case the COX dimer, whose concentration is unchanged despite the COX17 knockdown, could serve as a source to generate novel SCs. Instead SC formation is observed only from 120 h on, i.e. after recovery of Cox17, maybe depending on newly synthesized COX subunits and/or COX assembly intermediates. It is tempting to speculate that the observed 150 kDa complex (Figure 3.16) could act as such a precursor form whose maturation requires the activity of Cox17. In accordance with such a scenario, Lazarou et al. (2009) recently concluded from their data that complex I may associate into SCs prior to its completion.

DISCUSSION

What is the exact role of Cox17 in this process? Obviously, based on the known role of Cox17 in early steps of COX assembly (Horn and Barrientos, 2008), knockdown of COX17 blocks the formation of COX and thus the delivery of newly synthesized COX subcomplexes for SC assembly. Although it cannot be excluded that Cox17 may play an additional role in the SC assembly process, the results obtained in this thesis strongly argue in favor of a role of Cox17 in COX assembly before subunit Cox2 is inserted. Cox17 depletion results in the accumulation of a subcomplex of ~150 kDa, which contained Cox1 but not Cox2. Such an intermediate COX complex may be identical with the previously described COX assembly core denoted as S2 by Nijtmans et al. (1998; 2009). These authors proposed that COX biogenesis is initiated by the formation of a pre-assembled subcomplex of subunits Cox1, Cox4, and Cox5a. Attachment of heme a, heme a3 and the incorporation of copper into subunit Cox1, delivered by Cox11, is a prerequisite for the formation of this subcomplex. Subsequently Cox2, loaded with copper by Sco1/Sco2, is incorporated. Yeast Cox17 is proposed to deliver copper to Cox11 and to Sco1/Sco2 for metallation of Cox1 and Cox2, respectively (Glerum et al., 1996b; Horng et al., 2004). However, the absence of Cox2 in the 150 kDa subcomplex, but not Cox1, suggests an impairment of copper delivery to Cox2 (via Sco1/Sco2), but not to Cox1 (via Cox11). Metallation of Cox1 and Cox2 is essential for stability, since the absence of the copper centers leads to a rapid degradation of the proteins (Horn and Barrientos, 2008). Additionally, copper insertion into the membrane-buried CuB center of Cox1 in yeast is proposed to occur simultaneously with its translation and folding (Khalimonchuk and Rödel, 2005). Therefore it is appropriate to assume that the Cox1 protein in the ~150 kDa subcomplex represents its copper loaded form. The observation that Cox11- mediated maturation of Cox1 is possible in the absence of Cox17 may indicate that Cox11 can recruit copper by different means. By contrast, the subsequent incorporation of Cox2, loaded with copper by Sco1/Sco2, seems to be interrupted. In accordance with this idea the phenotype of SCO1- and SCO2-deficient cells is similar to that of COX17-deficient cells in that fully assembled COX is reduced (Leary et al., 2004; Stiburek et al., 2005), whereas the Cox1-Cox4-Cox5a containing COX subcomplex (S2) accumulates (Williams et al., 2004). This confirms that Cox17 acts upstream of Sco1/Sco2,

DISCUSSION and may also explain that the 150 kDa complex is lacking Cox2. The specific need for metallation of the Sco proteins by Cox17 could also account for the observation that the screen for suppressors of a yeast COX17 mutation identified only SCO1/SCO2 but not COX11 (Glerum et al., 1996b) as multicopy suppressors.

The data argues in favor of Cox17 being primarily engaged in copper delivery to Sco1/Sco2 and not to Cox11. Alternatively, Cox17 may be involved in copper transfer to both Cox11 and Sco1/2 and possesses a higher affinity for Cox11 than for Sco1. In that case the residual Cox17 in the knockdown cells may be sufficient for copper delivery to Cox11, but not to Sco1/Sco2. In addition to reveal a preferential role of Cox17 for Sco1/Sco2, the studies in this thesis point to a so far unknown complexity in the formation of SCs. The data indicates that different routes are used for the formation of COX complexes organized in SCs and of the COX dimer. It is proposed that a step acting downstream of the Cox17-mediated maturation of the ~150 kDa complex is decisive for the route towards SCs.

4.5 COPPER SUPPLEMENTATION ALONE CANNOT RESCUE

THE COX17 PHENOTYPE

Menkes disease is caused by defects of the evolutionarily conserved copper- transporting ATPase (Atp7A) (Chelly et al., 1993; Kaler et al., 1994), which is required for the copper transport into the trans golgi network for incorporation into copper requiring enzymes. So far, very promising results were reported in several patients with Menkes disease treated from a very early age on with a copper-histidine complex. In addition, respiratory growth of yeast COX17 null mutants and COX deficiency of human SCO2 mutant myoblasts and fibroblasts could be rescued by the addition of copper to the culture medium (Glerum et al., 1996a; Jaksch et al., 2001; Salviati et al., 2002a). To examine whether increased intracellular copper concentrations could also rescue the COX deficiency observed in COX17 depleted HeLa cells, copper- histidine was added in different concentrations and at different timepoints (before and after transfection with COX17 siRNAs) to the cell culture medium.

DISCUSSION

In contrast to the data of Jaksch et al. (2001) higher concentrations of Cu–His resulted in increased cell death, whereas lower concentrations did not show any significant changes in COX activity or cell proliferation. Likewise, the decrease of the steady-state concentration of Cox1 and Cox2 remained unchanged. Therefore, it is not clear whether the exogenous applied copper reaches the CuA and CuB sites. It remains unclear whether the uptake of copper into the cell, the transport to/into the mitochondria or the chaperone mediated insertion of the cofactor into COX is limited.

4.6 OUTLOOK

The characterization of COX17 knockdown HeLa cells showed the importance of Cox17 in the processes of COX assembly and supercomplex formation.

2D-DIGE protein expression profiling To examine the function of Cox17 in these processes in more detail, one way would be to analyze the mt proteome upon depletion of COX17. Initial 2D- DIGE (2D Fluorescence Difference Gel Electrophoresis) and MALDI-TOF/TOF (Matrix Assisted Laser Desorption/Ionisation; Time Of Flight) mass spectrometer analysis were already performed with the service offered by Applied Biomics (Hayward, CA). The ability to directly compare two samples on the same gel avoid problems of gel-to-gel variation and made the 2D-DIGE the technique of choice for a rapid and accurate analysis of protein differences between two samples. Thirteen proteins, whose amount was found to be significantly changed after COX17 siRNA transfection (Appendix Figure 5.3 (a)) were recovered from the gel and subjected to MALDI-TOF analysis after trypsin digestion. These proteins were identified with high confidence having ion scores between 67 and 340 by NCBInr database, but most proteins had no obvious correlation. Results revealed that spots 25 and 55 correspond to heat shock protein 60 (Hsp60) and NADH dehydrogenase subunit NDUFB9, respectively (Appendix, Table 1). In the present study, Hsp60, a chaperonin that facilitates bidirectional traffic between the mitochondria and the cytoplasm, was down- regulated and may have an adverse effect on protein folding. Cabiscol et al. (2002) showed that Hsp60 deficient cells presented increased ROS levels and they proposed that Hsp60 plays a role in protection against both endogenous

DISCUSSION and exogenous oxidative stress. In light of these data, one would have expected that Hsp60 is up-regulated following COX17 knockdown mediated stress. However, flow analysis revealed, that only a subpopulation of cells showed increased ROS. Hence, the observed decrease in Hsp60 levels upon COX17 knockdown might reflect the protein level of the heterogeneous mixture of cell, in different stages of apoptotis as well as viable cells. NDUFB9 was 2.5 fold up-regulated in COX17 siRNA transfected cells compared to negative control siRNA transfected cells. The NDUFB9 is a 22 kDa nuclear encoded accessory subunit of the mt complex I and its function remains unclear. However, as mutations in the gene encoding NDUFB9 may be responsible for a specific mitochondrial dysfunction disease, branchio-oto- renal (BOR) syndrome, it may regulate complex I activity (Lin et al., 1999). In line with this, elevated expression of several complex I subunit genes, including NDUFB9, was observed in cell lines and tissues from patients with various genetically determined OXPHOS defects (Cizkova et al., 2008). The majority of the remaining spots were identified as proteins of the cytoskeleton and the extracellular matrix. Unexpectedly, proteins which are directly or indirectly involved in the metallation or assembly of COX, proteins regulating cell growth, differentiation, apoptosis or oxidative stress could not be identified (Lee et al., 1999; Limatola et al., 1999; Amills and Bouzat, 2003; Chalmers et al., 2007). In view of this fact, the defined effect of COX17 knockdown on the stability of supramolecular organization of RC complexes is particularly noteworthy and indicates that short-term COX17 knockdown may affect first the molecular organization of complexes rather than their steady- state levels. However, the stability of the Cox17 affected proteins upon transient transfection remains to be considered. Cell sorting to separate heterogeneous cells populations prior to proteomic analysis may be taken into account for further experiments.

Silencing of COX17 by tetracycline (Tet) inducible short hairpin (sh)- RNA expression In light of the accumulating evidence that Cox17 is essential for the proper regulation and assembly of mammalian COX, a stable COX17 silenced HeLa cell line would be necessary. This would enable (i) the identification of phenotypes upon long term depletion of Cox17, (ii) the access to sufficient material for subsequent biochemical assays, and (iii) the analysis of the

DISCUSSION

(suppressive) effect of transient overexpression of other components. To this end, the cloning of the necessary expression constructs for Tet-inducible RNAi was performed (Appendix 5.4) (Kappel et al., 2007). The transient transfection of the inducible RNAi system resulted in the expression of COX17 shRNAs that efficiently induce gene silencing 72 h post transfection. However, the data of COX17 silencing via an integrated doxycycline (dox) inducible RNAi cassette appear to be inconsistent and not reproducible. The cultivation of several clones was not successful indicating that permanent loss of Cox17 may be lethal, confirming the reduced growth of the transiently silenced cells. The majority of clones showed a reduced growth after incubation with dox. The impact of the inducible COX17 shRNA expression was monitored on RNA and protein level. Initial results revealed no or only marginal differences between the Tet-off and Tet-on state after induction with dox. Most likely, differences in the copy number of the integrated shRNA-expression cassette and/or the impact of the chromosomal integration sites on expression might be responsible for the marginal extent of target suppression.

Knockdown of additional genes In terms of better understanding the routing of copper to the mitochondrion in mammalian cells, knockdown of additional individual genes (CMC1; COX19; COX23) and combinations of genes (COX17 + CMC1 or COX11 or SCO1/2) need to be further examined. Thereby, the existence of the bioactive copper pool (Cobine et al., 2004) within the mt matrix that is used at least in part to metallate both COX and SOD1 should be considered (Cobine et al., 2006a). So far, it is not clear how copper ions enter the matrix and can be eventually recruited later to the mt IMS. Six additional soluble mt IMS proteins with

highly conserved twin Cx9C motifs that are crucial to COX assembly have been identified (Horn and Barrientos, 2008; Longen et al., 2009). One candidate of special interest is Cmc1, since ablation of Cmc1 in yeast shifts the relative proportion of catalytically active COX and mt IMS-localized SOD1 (Horn et al., 2008). Recent data suggest that copper is bound by a small non- proteinaceous ligand, which passively diffuses across the OMM into the mt IMS. Copper is then chaperoned by Cmc1 or other, yet unidentified metallochaperones to Cox17, which uses distinct interfaces to transfer copper

to Sco1/Sco2 for maturation of the CuA site of Cox2 and to Cox11 for

maturation of the CuB site of Cox1 (Leary, 2010).

APPENDIX

5 APPENDIX

Appendix, Figure 5.1. Cell cycle analysis by flow cytometry. HeLa cells were transfected with COX17 siRNA 2 or negative control siRNA for the indicated times. Effect of COX17 knockdown on the proportions of cells in each cell cycle phase was determined with PI. A total of 20,000 cells were counted for each sample.

APPENDIX

Appendix, Figure 5.2. Identification of apoptotic cells by flow cytometry. HeLa cells were transfected with COX17 siRNA 2 or negative control siRNA for the indicated times. Cells were detached with trypsin and stained with CytoGLO™ Annexin V-FITC Apoptosis Detection Kit. A total of 20,000 cells were counted for each sample.

2D-DIGE analysis of COX17 knockdown cells The preparation of mitochondria was carried out according to materials and methods, chapter 2.2.6.1 and to standard Applied Biomics protocol. Briefly, 500 µg mitochondria of negative control siRNA and COX17 siRNA 2 transfected cells 72 h post transfection were isolated, resuspended in 75 µl CL 1 buffer (250 mM sucrose, 30 mM MOPS, pH 7.2) and flash-frozen in ethanol- dry ice bath. The samples were shipped on dry ice to Applied Biomics. Samples were labeled with either Cy3 or Cy5 and simultaneously separated on a single 2-D gel, using isoelectric focusing (IEF) in the first dimension (pH gradient 3–10) and SDS-PAGE (10.5 % acrylamide) in the second dimension. After electrophoresis, the gel was scanned using Typhoon scanner to obtain a comparative analysis and accurate measurement of differential protein expression. Proteins of interest were automatically picked out from the 2D gel with Ettan Spot Picker and transferred for protein identification. The protein spots were then subjected to in gel digestion to enable identification by MALDI-TOF/TOF Mass Spectrometer.

APPENDIX

(a)

APPENDIX

(b) (c)

Appendix, Figure 5.3. 2D-DIGE analysis of COX17 knockdown cells. Mt were isolated 72 h post transfection and were analyzed by 2D-DIGE (Applied Biomics). (a) Thirteen proteins changed significantly when 2D-gel of control cells (negative siRNA transfected cells) was compared to 2D-gel of COX17 siRNA transfected cells (overlay gel images). (b) DeCyder Analysis and 3-D image of the spots of interest. (c) Increase or decrease of each spot, spots with indicated ratios were analyzed by MALDI/TOF.

APPENDIX

Appendix, Table 1. 2D-DIGE and mass spectrometry analysis of mitochondria of COX17 knockdown cells 72 h post transfection.

Spot Top Ranked Protein Name Accession Protein Protein Protein Protein Score number (Species) No. MW PI Score C.I.% Chain A, crystal structure of the extracellular segment gi|16975253 105707.8 5.2 70 97.7 2 of integrin alpha/beta 3 3 Non-muscle myosin heavy chain (NMHC) gi|189036 144995.8 5.2 91 100.0 5 Catenin, alpha 1 [Homo sapiens] gi|55770844 100008.5 6.0 72 98.5 25 Heat shock protein 60 [Homo sapiens] gi|77702086 61174.4 5.7 295 100.0 27 Vimentin gi|340219 53681.1 5.0 222 100.0 28 Keratin 17 [Homo sapiens] gi|4557701 48076.0 5.0 337 100.0 36 Cytokeratin 18 (424 AA) [Homo sapiens] gi|30311 47305.2 5.3 363 100.0 Chain A, crystal structure of H3 alpha-hydroxysteroid gi|150261301 36373.9 7.6 137 100.0 43 dehydrogenase type 3 mutant Y24a 44 Annexin A2 isoform 1 [Homo sapiens] gi|50845388 40385.7 8.5 291 100.0 Rho GDP dissociation inhibitor (GDI) alpha [Homo gi|4757768 23192.7 5.0 265 100.0 48 sapiens] 53 KRT17 protein [Homo sapiens] gi|47939651 40292.4 4.9 67 95.8 NADH dehydrogenase (ubiquinone) 1 beta gi|6274550 21816.8 8.6 214 100.0 55 subcomplex, 9, 22kDa [Homo sapiens] Chain A, secypa complexed with hagpia (pseudo- gi|2981743 17789.7 7.8 115 100.0 61 symmetric monomer)

APPENDIX

Tetracycline inducible shRNA expression Two different siRNA target sequences were identified by an algorithm that optimizes the Pol III promoter-based prediction of shRNA sequences, that efficiently degrade specific target transcripts via shRNA, offered by a design tool from Prof. Dr. K. Strebhardt (www.molgyn.kgu.de) (Kappel et al., 2007). The output provided a sequence of 70 nt with a 5´ BamHI site, a sequence of 19 nt representing the sense strand of the shRNA, a sequence of 9 nt representing the loop of the hairpin structure for the processing of shRNAs that would generate a high frequency of siRNA, a region of 19 nt representing the antisense strand, a termination signal for Pol III consisting of five consecutive thymidine residues, and a 3´ HindIII site (Appendix, Figure 5.4 (c)). psiRNA-hH1neo G2 vector was used as a backbone for the following three-step cloning procedure: (i) excision of the wt H1 promoter, (ii) insertion of the wt H1 promoter flanked by the appropriate restriction sites for the subsequent insertion of inducible promoter variants and (iii) replacement of the wt H1 promoter by inducible promoter variants (Appendix, Figure 5.4 (a) + (b)). Following synthesis and annealing of the DNA oligonucleotides for COX17 shRNA expression, the molecules are ligated into the expression plasmid downstream of the inducible H1 promoter derivatives. For the generation of stable cells harboring the inducible RNAi cassette, T-REx™-HeLa cells* (Invitrogen) were transfected with 1 µg recombinant plasmid DNA (Kappel et al., 2007). The cells were cultivated in selection medium (1.5 mg/ml neomycin) for 20 days. After selection of single clones, cells were cultivated in the absence or presence of dox (1, 5 and 10 µg/ml). The cultivation of a couple of clones with 10 µg/ml of dox was not successful indicating that permanent loss of Cox17 may be lethal and would be in accordance with the reduced growth of the transiently silenced cells. The majority of clones showed a reduced growth after incubation with dox. The impact of the inducible COX17 shRNA expression was monitored on RNA and protein level. Initial results showed no reproducible and at the same time only marginal differences between the Tet-off and Tet-on state after induction with 10 µg/ml dox (data not shown). Further experiments have to be performed to confirm that silencing of COX17 is based on activation of tetracycline inducible shRNA expression.

* T-REx-HeLa cells stably express the tetracycline repressor protein

APPENDIX

(a) (b)

APPENDIX

(c)

Appendix, Figure 5.4. Silencing of mammalian genes by tetracycline inducible shRNA expression. (a) Map of the expression vector pwtH1. The vector psiRNA-hH1neo G2 was used as backbone and contains a wt H1 promoter (red) for expression of shRNA, a prokaryotic resistance gene against kanamycin (green) and a eukaryotic resistance gene against neomycin/Geneticin (G418) (also green). (b) The wt H1 promoter was replaced with Tet-inducible variants using the SpeI and BamHI restriction sites. The three sequence elements, which contribute to full promoter activity, are located adjacent to the transcription start site (+1): distal sequence element (DSE, magenta), proximal sequence element (PSE, blue) and TATA-box (TATA, orange). In the Tet - inducible variants of the H1 promoter the TetO sequence (TetO, dark green) is inserted upstream or/and downstream of the TATA-box. (c) For the expression of COX17 shRNAs the corresponding DNA fragment contains a 19 nt sense strand, a 9 nt loop and a 19 nt antisense strand. The expression is blocked by a termination signal containing five thymidine residues (TERM, red). This fragment is inserted into BamHI (5´) and HindIII (3´) sites of the expression vectors containing the wt H1 promoter or its Tet-inducible variants (taken in part from Kappel et al. (2007)).

PHD PUBLICATION RECORD

6 PHD PUBLICATION RECORD

Work, that was done during the time period of this thesis appeared in the following publication and were presented at the following conferences:

Publication

Oswald, C., Krause-Buchholz, U., Rödel, G., (2009). Knockdown of human COX17 affects assembly and supramolecular organization of cytochrome c oxidase. J Mol Biol. 389, 470–479

Posters Krause-Buchholz, U., Löschner, C., Rödel, G., (2007). Essential role of cytochrome c oxidase in the development and maintenance of neuronal cells. CRTD Summer Conference on Regenerative Medicine, Dresden

Oswald, C., Schulz, C., Krause-Buchholz, U., Rödel, G., (2008). Effects of silencing of the human assembly factors COX17 and SURF1 on cytochrome c oxidase. 2nd CRTD Summer Conference on Regenerative Medicine, Dresden

Oswald, C., Schulz, C., Krause-Buchholz, U., Rödel, G., (2008). Silencing of the human mitochondrial assembly factors COX17 and SURF1. 5th International PhD Student Symposium, Göttingen

Oswald, C., Krause-Buchholz, U., Rödel, G., (2009). Knockdown of human COX17 affects assembly and supramolecular organization of cytochrome c oxidase. Annual Conference of the German Genetics Society (GfG), Cologne

REFERENCES

7 REFERENCES

Acin-Pérez, R., Bayona-Bafaluy, M.P., Fernandez-Silva, P., Moreno- Loshuertos, R., Perez-Martos, A., Bruno, C., Moraes, C.T., Enriquez, J.A., (2004). Respiratory complex III is required to maintain complex I in mammalian mitochondria. Mol Cell 13, 805-815.

Acin-Pérez, R., Fernandez-Silva, P., Peleato, M.L., Perez-Martos, A., Enriquez, J.A., (2008). Respiratory active mitochondrial supercomplexes. Mol Cell 32, 529-539.

Agostino, A., Invernizzi, F., Tiveron, C., Fagiolari, G., Prelle, A., Lamantea, E., Giavazzi, A., Battaglia, G., Tatangelo, L., Tiranti, V., Zeviani, M., (2003). Constitutive knockout of SURF1 is associated with high embryonic lethality, mitochondrial disease and cytochrome c oxidase deficiency in mice. Hum Mol Genet 12, 399-413.

Amaravadi, R., Glerum, D.M., Tzagoloff, A., (1997). Isolation of a cDNA encoding the human homolog of COX17, a yeast gene essential for mitochondrial copper recruitment. Hum Genet 99, 329-333.

Amills, M., Bouzat, J.L., (2003). Characterization of the bovine BCL2L1 gene and related pseudogenes. Anim Genet 34, 457-461.

Anderson, S., Bankier, A.T., Barrell, B.G., de Bruijn, M.H., Coulson, A.R., Drouin, J., Eperon, I.C., Nierlich, D.P., Roe, B.A., Sanger, F., Schreier, P.H., Smith, A.J., Staden, R., Young, I.G., (1981). Sequence and organization of the human mitochondrial genome. Nature 290, 457-465.

Ankel-Simons, F., Cummins, J.M., (1996). Misconceptions about mitochondria and mammalian fertilization: implications for theories on human evolution. Proc Natl Acad Sci U S A 93, 13859-13863.

Antonicka, H., Leary, S.C., Guercin, G.H., Agar, J.N., Horvath, R., Kennaway, N.G., Harding, C.O., Jaksch, M., Shoubridge, E.A., (2003a). Mutations in COX10 result in a defect in mitochondrial heme A biosynthesis and account for multiple, early-onset clinical phenotypes associated with isolated COX deficiency. Hum Mol Genet 12, 2693-2702.

Antonicka, H., Mattman, A., Carlson, C.G., Glerum, D.M., Hoffbuhr, K.C., Leary, S.C., Kennaway, N.G., Shoubridge, E.A., (2003b). Mutations in COX15 produce a defect in the mitochondrial heme biosynthetic pathway, causing early-onset fatal hypertrophic cardiomyopathy. Am J Hum Genet 72, 101-114.

Arnesano, F., Balatri, E., Banci, L., Bertini, I., Winge, D.R., (2005). Folding studies of Cox17 reveal an important interplay of cysteine oxidation and copper binding. Structure 13, 713-722.

Arnold, I., Langer, T., (2002). Membrane protein degradation by AAA proteases in mitochondria. Biochim Biophys Acta 1592, 89-96.

REFERENCES

Arnold, S., Kadenbach, B., (1997). Cell respiration is controlled by ATP, an allosteric inhibitor of cytochrome-c oxidase. Eur J Biochem 249, 350-354.

Babcock, G.T., Wikstrom, M., (1992). Oxygen activation and the conservation of energy in cell respiration. Nature 356, 301-309.

Bach, D., Pich, S., Soriano, F.X., Vega, N., Baumgartner, B., Oriola, J., Daugaard, J.R., Lloberas, J., Camps, M., Zierath, J.R., Rabasa-Lhoret, R., Wallberg-Henriksson, H., Laville, M., Palacin, M., Vidal, H., Rivera, F., Brand, M., Zorzano, A., (2003). Mitofusin-2 determines mitochondrial network architecture and mitochondrial metabolism. A novel regulatory mechanism altered in obesity. J Biol Chem 278, 17190-17197.

Banci, L., Bertini, I., Ciofi-Baffoni, S., Hadjiloi, T., Martinelli, M., Palumaa, P., (2008a). Mitochondrial copper(I) transfer from Cox17 to Sco1 is coupled to electron transfer. Proc Natl Acad Sci U S A 105, 6803-6808.

Banci, L., Bertini, I., Ciofi-Baffoni, S., Janicka, A., Martinelli, M., Kozlowski, H., Palumaa, P., (2008b). A structural-dynamical characterization of human Cox17. J Biol Chem 283, 7912-7920.

Banci, L., Bertini, I., Ciofi-Baffoni, S., Leontari, I., Martinelli, M., Palumaa, P., Sillard, R., Wang, S., (2007). Human Sco1 functional studies and pathological implications of the P174L mutant. Proc Natl Acad Sci U S A 104, 15-20.

Barnea, A., Hartter, D.E., Cho, G., Bhasker, K.R., Katz, B.M., Edwards, M.D., (1990). Further characterization of the process of in vitro uptake of radiolabeled copper by the rat brain. J Inorg Biochem 40, 103-110.

Barrell, B.G., Bankier, A.T., Drouin, J., (1979). A different genetic code in human mitochondria. Nature 282, 189-194.

Barrientos, A., Barros, M.H., Valnot, I., Rotig, A., Rustin, P., Tzagoloff, A., (2002). Cytochrome oxidase in health and disease. Gene 286, 53-63.

Barros, M.H., Johnson, A., Tzagoloff, A., (2004). COX23, a homologue of COX17, is required for cytochrome oxidase assembly. J Biol Chem 279, 31943-31947.

Barros, M.H., Nobrega, F.G., Tzagoloff, A., (2002). Mitochondrial ferredoxin is required for heme A synthesis in Saccharomyces cerevisiae. J Biol Chem 277, 9997-10002.

Barros, M.H., Tzagoloff, A., (2002). Regulation of the heme A biosynthetic pathway in Saccharomyces cerevisiae. FEBS Lett 516, 119-123.

Bartel, D.P., (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.

Bartnikas, T.B., Gitlin, J.D., (2001). How to make a metalloprotein. Nat Struct Biol 8, 733-734.

Bates, M., Blosser, T.R., Zhuang, X., (2005). Short-range spectroscopic ruler based on a single-molecule optical switch. Phys Rev Lett 94, 108101.

REFERENCES

Bates, M., Huang, B., Dempsey, G.T., Zhuang, X., (2007). Multicolor super- resolution imaging with photo-switchable fluorescent probes. Science 317, 1749-1753.

Beers, J., Glerum, D.M., Tzagoloff, A., (1997). Purification, characterization, and localization of yeast Cox17p, a mitochondrial copper shuttle. J Biol Chem 272, 33191-33196.

Bianchi, C., Genova, M.L., Parenti Castelli, G., Lenaz, G., (2004). The mitochondrial respiratory chain is partially organized in a supercomplex assembly: kinetic evidence using flux control analysis. J Biol Chem 279, 36562-36569.

Bien, M., Longen, S., Wagener, N., Chwalla, I., Herrmann, J.M., Riemer, J., (2010). Mitochondrial disulfide bond formation is driven by intersubunit electron transfer in Erv1 and proofread by glutathione. Mol Cell 37, 516-528.

Bourgeron, T., Rustin, P., Chretien, D., Birch-Machin, M., Bourgeois, M., Viegas-Pequignot, E., Munnich, A., Rotig, A., (1995). Mutation of a nuclear succinate dehydrogenase gene results in mitochondrial respiratory chain deficiency. Nat Genet 11, 144-149.

Boveris, A., (1977). Mitochondrial production of superoxide radical and hydrogen peroxide. Adv Exp Med Biol 78, 67-82.

Brooks, G.A., Dubouchaud, H., Brown, M., Sicurello, J.P., Butz, C.E., (1999). Role of mitochondrial lactate dehydrogenase and lactate oxidation in the intracellular lactate shuttle. Proc Natl Acad Sci U S A 96, 1129-1134.

Budde, S.M., van den Heuvel, L.P., Janssen, A.J., Smeets, R.J., Buskens, C.A., DeMeirleir, L., Van Coster, R., Baethmann, M., Voit, T., Trijbels, J.M., Smeitink, J.A., (2000). Combined enzymatic complex I and III deficiency associated with mutations in the nuclear encoded NDUFS4 gene. Biochem Biophys Res Commun 275, 63-68.

Bus, J.S., Gibson, J.E., (1984). Paraquat: model for oxidant-initiated toxicity. Environ Health Perspect 55, 37-46.

Cabiscol, E., Belli, G., Tamarit, J., Echave, P., Herrero, E., Ros, J., (2002). Mitochondrial Hsp60, resistance to oxidative stress, and the labile iron pool are closely connected in Saccharomyces cerevisiae. J Biol Chem 277, 44531- 44538.

Campuzano, V., Montermini, L., Lutz, Y., Cova, L., Hindelang, C., Jiralerspong, S., Trottier, Y., Kish, S.J., Faucheux, B., Trouillas, P., Authier, F.J., Durr, A., Mandel, J.L., Vescovi, A., Pandolfo, M., Koenig, M., (1997). Frataxin is reduced in Friedreich ataxia patients and is associated with mitochondrial membranes. Hum Mol Genet 6, 1771-1780.

Capaldi, R.A., (1982). Arrangement of proteins in the mitochondrial inner membrane. Biochim Biophys Acta 694, 291-306.

REFERENCES

Capaldi, R.A., (1990). Structure and assembly of cytochrome c oxidase. Arch Biochem Biophys 280, 252-262.

Carr, H.S., George, G.N., Winge, D.R., (2002). Yeast Cox11, a protein essential for cytochrome c oxidase assembly, is a Cu(I)-binding protein. J Biol Chem 277, 31237-31242.

Carr, H.S., Maxfield, A.B., Horng, Y.C., Winge, D.R., (2005). Functional analysis of the domains in Cox11. J Biol Chem 280, 22664-22669.

Carr, H.S., Winge, D.R., (2003). Assembly of cytochrome c oxidase within the mitochondrion. Acc Chem Res 36, 309-316.

Casareno, R.L., Waggoner, D., Gitlin, J.D., (1998). The copper chaperone CCS directly interacts with copper/zinc superoxide dismutase. J Biol Chem 273, 23625-23628.

Chalmers, C.J., Gilley, R., March, H.N., Balmanno, K., Cook, S.J., (2007). The duration of ERK1/2 activity determines the activation of c-Fos and Fra-1 and the composition and quantitative transcriptional output of AP-1. Cell Signal 19, 695-704.

Chan, D.C., (2006). Mitochondria: dynamic organelles in disease, aging, and development. Cell 125, 1241-1252.

Chance, B., Williams, G.R., (1955). A method for the localization of sites for oxidative phosphorylation. Nature 176, 250-254.

Chelly, J., Tumer, Z., Tonnesen, T., Petterson, A., Ishikawa-Brush, Y., Tommerup, N., Horn, N., Monaco, A.P., (1993). Isolation of a candidate gene for Menkes disease that encodes a potential heavy metal binding protein. Nat Genet 3, 14-19.

Chen, S., Cheng, A.C., Wang, M.S., Peng, X., (2008). Detection of apoptosis induced by new type gosling viral enteritis virus in vitro through fluorescein annexin V-FITC/PI double labeling. World J Gastroenterol 14, 2174-2178.

Chen, W.J., Douglas, M.G., (1987). The role of protein structure in the mitochondrial import pathway. Unfolding of mitochondrially bound precursors is required for membrane translocation. J Biol Chem 262, 15605-15609.

Chen, X., Prosser, R., Simonetti, S., Sadlock, J., Jagiello, G., Schon, E.A., (1995). Rearranged mitochondrial genomes are present in human oocytes. Am J Hum Genet 57, 239-247.

Cizkova, A., Stranecky, V., Ivanek, R., Hartmannova, H., Noskova, L., Piherova, L., Tesarova, M., Hansikova, H., Honzik, T., Zeman, J., Divina, P., Potocka, A., Paul, J., Sperl, W., Mayr, J.A., Seneca, S., Houstek, J., Kmoch, S., (2008). Development of a human mitochondrial oligonucleotide microarray (h-MitoArray) and gene expression analysis of fibroblast cell lines from 13 patients with isolated F1Fo ATP synthase deficiency. BMC Genomics 9, 38.

100

REFERENCES

Cobine, P.A., Ojeda, L.D., Rigby, K.M., Winge, D.R., (2004). Yeast contain a non-proteinaceous pool of copper in the mitochondrial matrix. J Biol Chem 279, 14447-14455.

Cobine, P.A., Pierrel, F., Bestwick, M.L., Winge, D.R., (2006a). Mitochondrial matrix copper complex used in metallation of cytochrome oxidase and superoxide dismutase. J Biol Chem 281, 36552-36559.

Cobine, P.A., Pierrel, F., Leary, S.C., Sasarman, F., Horng, Y.C., Shoubridge, E.A., Winge, D.R., (2006b). The P174L mutation in human Sco1 severely compromises Cox17-dependent metallation but does not impair copper binding. J Biol Chem 281, 12270-12276.

D'Aurelio, M., Gajewski, C.D., Lenaz, G., Manfredi, G., (2006). Respiratory chain supercomplexes set the threshold for respiration defects in human mtDNA mutant cybrids. Hum Mol Genet 15, 2157-2169.

De Freitas, J., Wintz, H., Kim, J.H., Poynton, H., Fox, T., Vulpe, C., (2003). Yeast, a model organism for iron and copper metabolism studies. Biometals 16, 185-197. de Lonlay, P., Valnot, I., Barrientos, A., Gorbatyuk, M., Tzagoloff, A., Taanman, J.W., Benayoun, E., Chretien, D., Kadhom, N., Lombes, A., de Baulny, H.O., Niaudet, P., Munnich, A., Rustin, P., Rotig, A., (2001). A mutant mitochondrial respiratory chain assembly protein causes complex III deficiency in patients with tubulopathy, encephalopathy and liver failure. Nat Genet 29, 57-60.

De Meirleir, L., Seneca, S., Lissens, W., De Clercq, I., Eyskens, F., Gerlo, E., Smet, J., Van Coster, R., (2004). Respiratory chain complex V deficiency due to a mutation in the assembly gene ATP12. J Med Genet 41, 120-124.

Dencher, N.A., Frenzel, M., Reifschneider, N.H., Sugawa, M., Krause, F., (2007). Proteome alterations in rat mitochondria caused by aging. Ann N Y Acad Sci 1100, 291-298.

Di Fonzo, A., Ronchi, D., Lodi, T., Fassone, E., Tigano, M., Lamperti, C., Corti, S., Bordoni, A., Fortunato, F., Nizzardo, M., Napoli, L., Donadoni, C., Salani, S., Saladino, F., Moggio, M., Bresolin, N., Ferrero, I., Comi, G.P., (2009). The mitochondrial disulfide relay system protein GFER is mutated in autosomal- recessive myopathy with cataract and combined respiratory-chain deficiency. Am J Hum Genet 84, 594-604.

Diaz, F., Fukui, H., Garcia, S., Moraes, C.T., (2006). Cytochrome c oxidase is required for the assembly/stability of respiratory complex I in mouse fibroblasts. Mol Cell Biol 26, 4872-4881.

Dillin, A., (2003). The specifics of small interfering RNA specificity. Proc Natl Acad Sci U S A 100, 6289-6291.

Distler, A.M., Kerner, J., Hoppel, C.L., (2008). Proteomics of mitochondrial inner and outer membranes. Proteomics 8, 4066-4082.

101

REFERENCES

Doench, J.G., Petersen, C.P., Sharp, P.A., (2003). siRNAs can function as miRNAs. Genes Dev 17, 438-442.

Eisses, J.F., Stasser, J.P., Ralle, M., Kaplan, J.H., Blackburn, N.J., (2000). Domains I and III of the human copper chaperone for superoxide dismutase interact via a cysteine-bridged Dicopper(I) cluster. Biochemistry 39, 7337- 7342.

Elbashir, S.M., Lendeckel, W., Tuschl, T., (2001). RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev 15, 188-200.

Elliott, H.R., Samuels, D.C., Eden, J.A., Relton, C.L., Chinnery, P.F., (2008). Pathogenic mitochondrial DNA mutations are common in the general population. Am J Hum Genet 83, 254-260.

Enter, C., Muller-Hocker, J., Zierz, S., Kurlemann, G., Pongratz, D., Forster, C., Obermaier-Kusser, B., Gerbitz, K.D., (1991). A specific point mutation in the mitochondrial genome of Caucasians with MELAS. Hum Genet 88, 233- 236.

Eruslanov, E., Kusmartsev, S., (2010). Identification of ROS using oxidized DCFDA and flow-cytometry. Methods Mol Biol 594, 57-72.

Esterhazy, D., King, M.S., Yakovlev, G., Hirst, J., (2008). Production of reactive oxygen species by complex I (NADH:ubiquinone oxidoreductase) from Escherichia coli and comparison to the enzyme from mitochondria. Biochemistry 47, 3964-3971.

Fedorov, Y., Anderson, E.M., Birmingham, A., Reynolds, A., Karpilow, J., Robinson, K., Leake, D., Marshall, W.S., Khvorova, A., (2006). Off-target effects by siRNA can induce toxic phenotype. RNA 12, 1188-1196.

Fernandez-Vizarra, E., Tiranti, V., Zeviani, M., (2009). Assembly of the oxidative phosphorylation system in humans: what we have learned by studying its defects. Biochim Biophys Acta 1793, 200-211.

Fontanesi, F., Soto, I.C., Horn, D., Barrientos, A., (2006). Assembly of mitochondrial cytochrome c-oxidase, a complicated and highly regulated cellular process. Am J Physiol Cell Physiol 291, C1129-1147.

Frey, T.G., Murray, J.M., (1994). Electron microscopy of cytochrome c oxidase crystals. Monomer-dimer relationship and cytochrome c binding site. J Mol Biol 237, 275-297.

Fridovich, I., (1995). Superoxide radical and superoxide dismutases. Annu Rev Biochem 64, 97-112.

Genova, M.L., Pich, M.M., Biondi, A., Bernacchia, A., Falasca, A., Bovina, C., Formiggini, G., Parenti Castelli, G., Lenaz, G., (2003). Mitochondrial production of oxygen radical species and the role of Coenzyme Q as an antioxidant. Exp Biol Med (Maywood) 228, 506-513.

102

REFERENCES

Gey, U., Czupalla, C., Hoflack, B., Rödel, G., Krause-Buchholz, U., (2008). Yeast pyruvate dehydrogenase complex is regulated by a concerted activity of two kinases and two phosphatases. J Biol Chem 283, 9759-9767.

Giles, R.E., Blanc, H., Cann, H.M., Wallace, D.C., (1980). Maternal inheritance of human mitochondrial DNA. Proc Natl Acad Sci U S A 77, 6715-6719.

Gilkerson, R.W., Selker, J.M., Capaldi, R.A., (2003). The cristal membrane of mitochondria is the principal site of oxidative phosphorylation. FEBS Lett 546, 355-358.

Glerum, D.M., Shtanko, A., Tzagoloff, A., (1996a). Characterization of COX17, a yeast gene involved in copper metabolism and assembly of cytochrome oxidase. J Biol Chem 271, 14504-14509.

Glerum, D.M., Shtanko, A., Tzagoloff, A., (1996b). SCO1 and SCO2 act as high copy suppressors of a mitochondrial copper recruitment defect in Saccharomyces cerevisiae. J Biol Chem 271, 20531-20535.

Glerum, D.M., Shtanko, A., Tzagoloff, A., (1996a). Characterization of COX17, a yeast gene involved in copper metabolism and assembly of cytochrome oxidase. J Biol Chem 271, 14504-14509.

Glerum, D.M., Shtanko, A., Tzagoloff, A., (1996b). SCO1 and SCO2 act as high copy suppressors of a mitochondrial copper recruitment defect in Saccharomyces cerevisiae. J Biol Chem 271, 20531-20535.

Gomes, A., Fernandes, E., Lima, J.L., (2005). Fluorescence probes used for detection of reactive oxygen species. J Biochem Biophys Methods 65, 45-80.

Goto, Y., Nonaka, I., Horai, S., (1990). A mutation in the tRNA(Leu)(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies. Nature 348, 651-653.

Grandier-Vazeille, X., Guerin, M., (1996). Separation by blue native and colorless native polyacrylamide gel electrophoresis of the oxidative phosphorylation complexes of yeast mitochondria solubilized by different detergents: specific staining of the different complexes. Anal Biochem 242, 248-254.

Green, D.R., Reed, J.C., (1998). Mitochondria and apoptosis. Science 281, 1309-1312.

Grivell, L.A., Artal-Sanz, M., Hakkaart, G., de Jong, L., Nijtmans, L.G., van Oosterum, K., Siep, M., van der Spek, H., (1999). Mitochondrial assembly in yeast. FEBS Lett 452, 57-60.

Guerin, B., Labbe, P., Somlo, M., (1979). Preparation of yeast mitochondria (Saccharomyces cerevisiae) with good P/O and respiratory control ratios. Methods Enzymol 55, 149-159.

Gupta, S., Knowlton, A.A., (2002). Cytosolic heat shock protein 60, hypoxia, and apoptosis. Circulation 106, 2727-2733.

103

REFERENCES

Gupte, S., Wu, E.S., Hoechli, L., Hoechli, M., Jacobson, K., Sowers, A.E., Hackenbrock, C.R., (1984). Relationship between lateral diffusion, collision frequency, and electron transfer of mitochondrial inner membrane oxidation- reduction components. Proc Natl Acad Sci U S A 81, 2606-2610.

Hackenbrock, C.R., Chazotte, B., Gupte, S.S., (1986). The random collision model and a critical assessment of diffusion and collision in mitochondrial electron transport. J Bioenerg Biomembr 18, 331-368.

Hamza, I., Faisst, A., Prohaska, J., Chen, J., Gruss, P., Gitlin, J.D., (2001). The metallochaperone Atox1 plays a critical role in perinatal copper homeostasis. Proc Natl Acad Sci U S A 98, 6848-6852.

Harris, E.D., (1991). Copper transport: an overview. Proc Soc Exp Biol Med 196, 130-140.

Harris, E.D., (2000). Cellular copper transport and metabolism. Annu Rev Nutr 20, 291-310.

Hatefi, Y., (1985). The mitochondrial electron transport and oxidative phosphorylation system. Annu Rev Biochem 54, 1015-1069.

Haut, S., Brivet, M., Touati, G., Rustin, P., Lebon, S., Garcia-Cazorla, A., Saudubray, J.M., Boutron, A., Legrand, A., Slama, A., (2003). A deletion in the human QP-C gene causes a complex III deficiency resulting in hypoglycaemia and lactic acidosis. Hum Genet 113, 118-122.

He, Y., Wu, J., Dressman, D.C., Iacobuzio-Donahue, C., Markowitz, S.D., Velculescu, V.E., Diaz, L.A., Jr., Kinzler, K.W., Vogelstein, B., Papadopoulos, N., (2010). Heteroplasmic mitochondrial DNA mutations in normal and tumour cells. Nature 464, 610-614.

Heaton, D., Nittis, T., Srinivasan, C., Winge, D.R., (2000). Mutational analysis of the mitochondrial copper metallochaperone Cox17. J Biol Chem 275, 37582-37587.

Heilemann, M., Margeat, E., Kasper, R., Sauer, M., Tinnefeld, P., (2005). Carbocyanine dyes as efficient reversible single-molecule optical switch. J Am Chem Soc 127, 3801-3806.

Heilemann, M., van de Linde, S., Schuttpelz, M., Kasper, R., Seefeldt, B., Mukherjee, A., Tinnefeld, P., Sauer, M., (2008). Subdiffraction-resolution fluorescence imaging with conventional fluorescent probes. Angew Chem Int Ed Engl 47, 6172-6176.

Hell, S.W., (2003). Toward fluorescence nanoscopy. Nat Biotechnol 21, 1347- 1355.

Hell, S.W., Wichmann, J., (1994). Breaking the diffraction resolution limit by stimulated emission: stimulated-emission-depletion fluorescence microscopy. Opt Lett 19, 780-782.

104

REFERENCES

Henderson, R., Capaldi, R.A., Leigh, J.S., (1977). Arrangement of cytochrome oxidase molecules in two-dimensional vesicle crystals. J Mol Biol 112, 631- 648.

Hiser, L., Di Valentin, M., Hamer, A.G., Hosler, J.P., (2000). Cox11p is required for stable formation of the Cu(B) and magnesium centers of cytochrome c oxidase. J Biol Chem 275, 619-623.

Hofmann, M., Eggeling, C., Jakobs, S., Hell, S.W., (2005). Breaking the diffraction barrier in fluorescence microscopy at low light intensities by using reversibly photoswitchable proteins. Proc Natl Acad Sci U S A 102, 17565- 17569.

Hollenbeck, P.J., Saxton, W.M., (2005). The axonal transport of mitochondria. J Cell Sci 118, 5411-5419.

Holt, I.J., Lorimer, H.E., Jacobs, H.T., (2000). Coupled leading- and lagging- strand synthesis of mammalian mitochondrial DNA. Cell 100, 515-524.

Hoogenboom, B.W., Suda, K., Engel, A., Fotiadis, D., (2007). The supramolecular assemblies of voltage-dependent anion channels in the native membrane. J Mol Biol 370, 246-255.

Horn, D., Al-Ali, H., Barrientos, A., (2008). Cmc1p is a conserved mitochondrial twin CX9C protein involved in cytochrome c oxidase biogenesis. Mol Cell Biol 28, 4354-4364.

Horn, D., Barrientos, A., (2008). Mitochondrial copper metabolism and delivery to cytochrome c oxidase. IUBMB Life 60, 421-429.

Horng, Y.C., Cobine, P.A., Maxfield, A.B., Carr, H.S., Winge, D.R., (2004). Specific copper transfer from the Cox17 metallochaperone to both Sco1 and Cox11 in the assembly of yeast cytochrome c oxidase. J Biol Chem 279, 35334-35340.

Huang, B., Wang, W., Bates, M., Zhuang, X., (2008). Three-dimensional super-resolution imaging by stochastic optical reconstruction microscopy. Science 319, 810-813.

Hudson, G., Chinnery, P.F., (2006). Mitochondrial DNA polymerase-gamma and human disease. Hum Mol Genet 15 Spec No 2, R244-252.

Iborra, F.J., Kimura, H., Cook, P.R., (2004). The functional organization of mitochondrial genomes in human cells. BMC Biol 2, 9.

Inarrea, P., (2002). Purification and determination of activity of mitochondrial cyanide-sensitive superoxide dismutase in rat tissue extract. Methods Enzymol 349, 106-114.

Inarrea, P., Moini, H., Han, D., Rettori, D., Aguilo, I., Alava, M.A., Iturralde, M., Cadenas, E., (2007). Mitochondrial respiratory chain and thioredoxin reductase regulate intermembrane Cu,Zn-superoxide dismutase activity: implications for mitochondrial energy metabolism and apoptosis. Biochem J 405, 173-179.

105

REFERENCES

Jackson, A.L., Bartz, S.R., Schelter, J., Kobayashi, S.V., Burchard, J., Mao, M., Li, B., Cavet, G., Linsley, P.S., (2003). Expression profiling reveals off-target gene regulation by RNAi. Nat Biotechnol 21, 635-637.

Jaksch, M., Ogilvie, I., Yao, J., Kortenhaus, G., Bresser, H.G., Gerbitz, K.D., Shoubridge, E.A., (2000). Mutations in SCO2 are associated with a distinct form of hypertrophic cardiomyopathy and cytochrome c oxidase deficiency. Hum Mol Genet 9, 795-801.

Jaksch, M., Paret, C., Stucka, R., Horn, N., Muller-Hocker, J., Horvath, R., Trepesch, N., Stecker, G., Freisinger, P., Thirion, C., Muller, J., Lunkwitz, R., Rödel, G., Shoubridge, E.A., Lochmuller, H., (2001). Cytochrome c oxidase deficiency due to mutations in SCO2, encoding a mitochondrial copper-binding protein, is rescued by copper in human myoblasts. Hum Mol Genet 10, 3025- 3035.

Johnson, D.T., Harris, R.A., French, S., Blair, P.V., You, J., Bemis, K.G., Wang, M., Balaban, R.S., (2007). Tissue heterogeneity of the mammalian mitochondrial proteome. Am J Physiol Cell Physiol 292, C689-697.

Kadenbach, B., Huttemann, M., Arnold, S., Lee, I., Bender, E., (2000). Mitochondrial energy metabolism is regulated via nuclear-coded subunits of cytochrome c oxidase. Free Radic Biol Med 29, 211-221.

Kaler, S.G., Gallo, L.K., Proud, V.K., Percy, A.K., Mark, Y., Segal, N.A., Goldstein, D.S., Holmes, C.S., Gahl, W.A., (1994). Occipital horn syndrome and a mild Menkes phenotype associated with splice site mutations at the MNK locus. Nat Genet 8, 195-202.

Kappel, S., Matthess, Y., Kaufmann, M., Strebhardt, K., (2007). Silencing of mammalian genes by tetracycline-inducible shRNA expression. Nat Protoc 2, 3257-3269.

Katz, B.M., Barnea, A., (1990). The ligand specificity for uptake of complexed copper-67 by brain hypothalamic tissue is a function of copper concentration and copper:ligand molar ratio. J Biol Chem 265, 2017-2021.

Khalimonchuk, O., Bird, A., Winge, D.R., (2007). Evidence for a pro-oxidant intermediate in the assembly of cytochrome oxidase. J Biol Chem 282, 17442- 17449.

Khalimonchuk, O., Rödel, G., (2005). Biogenesis of cytochrome c oxidase. Mitochondrion 5, 363-388.

Kim, J.S., He, L., Lemasters, J.J., (2003). Mitochondrial permeability transition: a common pathway to necrosis and apoptosis. Biochem Biophys Res Commun 304, 463-470.

Kira, Y., Sato, E.F., Inoue, M., (2002). Association of Cu,Zn-type superoxide dismutase with mitochondria and peroxisomes. Arch Biochem Biophys 399, 96-102.

106

REFERENCES

Kirches, E., Michael, M., Warich-Kirches, M., Schneider, T., Weis, S., Krause, G., Mawrin, C., Dietzmann, K., (2001). Heterogeneous tissue distribution of a mitochondrial DNA polymorphism in heteroplasmic subjects without mitochondrial disorders. J Med Genet 38, 312-317.

Kirkwood, S.P., Munn, E.A., Brooks, G.A., (1986). Mitochondrial reticulum in limb skeletal muscle. Am J Physiol 251, C395-402.

Klar, T.A., Jakobs, S., Dyba, M., Egner, A., Hell, S.W., (2000). Fluorescence microscopy with diffraction resolution barrier broken by stimulated emission. Proc Natl Acad Sci U S A 97, 8206-8210.

Klomp, L.W., Lin, S.J., Yuan, D.S., Klausner, R.D., Culotta, V.C., Gitlin, J.D., (1997). Identification and functional expression of HAH1, a novel human gene involved in copper homeostasis. J Biol Chem 272, 9221-9226.

Koehler, C.M., Leuenberger, D., Merchant, S., Renold, A., Junne, T., Schatz, G., (1999). Human deafness dystonia syndrome is a mitochondrial disease. Proc Natl Acad Sci U S A 96, 2141-2146.

Kokoszka, J.E., Coskun, P., Esposito, L.A., Wallace, D.C., (2001). Increased mitochondrial oxidative stress in the Sod2 (+/-) mouse results in the age- related decline of mitochondrial function culminating in increased apoptosis. Proc Natl Acad Sci U S A 98, 2278-2283.

Kowaltowski, A.J., Castilho, R.F., Vercesi, A.E., (2001). Mitochondrial permeability transition and oxidative stress. FEBS Lett 495, 12-15.

Krall, J., Bagley, A.C., Mullenbach, G.T., Hallewell, R.A., Lynch, R.E., (1988). Superoxide mediates the toxicity of paraquat for cultured mammalian cells. J Biol Chem 263, 1910-1914.

Krause, F., Reifschneider, N.H., Goto, S., Dencher, N.A., (2005). Active oligomeric ATP synthases in mammalian mitochondria. Biochem Biophys Res Commun 329, 583-590.

Krause, F., Scheckhuber, C.Q., Werner, A., Rexroth, S., Reifschneider, N.H., Dencher, N.A., Osiewacz, H.D., (2004). Supramolecular organization of cytochrome c oxidase- and alternative oxidase-dependent respiratory chains in the filamentous fungus Podospora anserina. J Biol Chem 279, 26453-26461.

Kreuder, J., Otten, A., Fuder, H., Tumer, Z., Tonnesen, T., Horn, N., Dralle, D., (1993). Clinical and biochemical consequences of copper-histidine therapy in Menkes disease. Eur J Pediatr 152, 828-832.

Krishnan, K.J., Reeve, A.K., Samuels, D.C., Chinnery, P.F., Blackwood, J.K., Taylor, R.W., Wanrooij, S., Spelbrink, J.N., Lightowlers, R.N., Turnbull, D.M., (2008). What causes mitochondrial DNA deletions in human cells? Nat Genet 40, 275-279.

Krummeck, G., Rödel, G., (1990). Yeast Sco1 protein is required for a post- translational step in the accumulation of mitochondrial cytochrome c oxidase subunits I and II. Curr Genet 18, 13-15.

107

REFERENCES

Lang, B.F., Gray, M.W., Burger, G., (1999). Mitochondrial genome evolution and the origin of eukaryotes. Annu Rev Genet 33, 351-397.

Lazarou, M., Thorburn, D.R., Ryan, M.T., McKenzie, M., (2009). Assembly of mitochondrial complex I and defects in disease. Biochim Biophys Acta 1793, 78-88.

Leary, S., (2010). Redox regulation of Sco protein function: controlling copper at a mitochondrial crossroad. Antioxid Redox Signal.

Leary, S.C., Cobine, P.A., Kaufman, B.A., Guercin, G.H., Mattman, A., Palaty, J., Lockitch, G., Winge, D.R., Rustin, P., Horvath, R., Shoubridge, E.A., (2007). The human cytochrome c oxidase assembly factors SCO1 and SCO2 have regulatory roles in the maintenance of cellular copper homeostasis. Cell Metab 5, 9-20.

Leary, S.C., Kaufman, B.A., Pellecchia, G., Guercin, G.H., Mattman, A., Jaksch, M., Shoubridge, E.A., (2004). Human Sco1 and Sco2 have independent, cooperative functions in copper delivery to cytochrome c oxidase. Hum Mol Genet 13, 1839-1848.

Leary, S.C., Sasarman, F., Nishimura, T., Shoubridge, E.A., (2009a). Human Sco2 is required for the synthesis of CO II and as a thiol-disulphide oxidoreductase for Sco1. Hum Mol Genet 18, 2230-2240.

Leary, S.C., Winge, D.R., Cobine, P.A., (2009b). "Pulling the plug" on cellular copper: the role of mitochondria in copper export. Biochim Biophys Acta 1793, 146-153.

LeBel, C.P., Ischiropoulos, H., Bondy, S.C., (1992). Evaluation of the probe 2',7'-dichlorofluorescin as an indicator of reactive oxygen species formation and oxidative stress. Chem Res Toxicol 5, 227-231.

Lee, J., Pena, M.M., Nose, Y., Thiele, D.J., (2002). Biochemical characterization of the human copper transporter Ctr1. J Biol Chem 277, 4380-4387.

Lee, S.R., Kim, J.R., Kwon, K.S., Yoon, H.W., Levine, R.L., Ginsburg, A., Rhee, S.G., (1999). Molecular cloning and characterization of a mitochondrial selenocysteine-containing thioredoxin reductase from rat liver. J Biol Chem 274, 4722-4734.

Legros, F., Malka, F., Frachon, P., Lombes, A., Rojo, M., (2004). Organization and dynamics of human mitochondrial DNA. J Cell Sci 117, 2653-2662.

Leigh, D., (1951). Subacute necrotizing encephalomyelopathy in an infant. J Neurol Neurosurg Psychiatry 14, 216-221.

Lemire, J., Mailloux, R.J., Appanna, V.D., (2008). Mitochondrial lactate dehydrogenase is involved in oxidative-energy metabolism in human astrocytoma cells (CCF-STTG1). PLoS ONE 3, e1550.

Lenaz, G., Baracca, A., Barbero, G., Bergamini, C., Dalmonte, M.E., Del Sole, M., Faccioli, M., Falasca, A., Fato, R., Genova, M.L., Sgarbi, G., Solaini, G.,

108

REFERENCES

(2010). Mitochondrial respiratory chain super-complex I-III in physiology and pathology. Biochim Biophys Acta.

Lenaz, G., Genova, M.L., (2007). Kinetics of integrated electron transfer in the mitochondrial respiratory chain: random collisions vs. solid state electron channeling. Am J Physiol Cell Physiol 292, C1221-1239.

Letellier, T., Malgat, M., Mazat, J.P., (1993). Control of oxidative phosphorylation in rat muscle mitochondria: implications for mitochondrial myopathies. Biochim Biophys Acta 1141, 58-64.

Li, P., Nijhawan, D., Budihardjo, I., Srinivasula, S.M., Ahmad, M., Alnemri, E.S., Wang, X., (1997). Cytochrome c and dATP-dependent formation of Apaf- 1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91, 479- 489.

Li, Y., D'Aurelio, M., Deng, J.H., Park, J.S., Manfredi, G., Hu, P., Lu, J., Bai, Y., (2007). An assembled complex IV maintains the stability and activity of complex I in mammalian mitochondria. J Biol Chem 282, 17557-17562.

Li, Z., Okamoto, K., Hayashi, Y., Sheng, M., (2004). The importance of dendritic mitochondria in the morphogenesis and plasticity of spines and synapses. Cell 119, 873-887.

Lightowlers, R.N., Chinnery, P.F., Turnbull, D.M., Howell, N., (1997). Mammalian mitochondrial genetics: heredity, heteroplasmy and disease. Trends Genet 13, 450-455.

Limatola, C., Mileo, A.M., Giovannelli, A., Vacca, F., Ciotti, M.T., Mercanti, D., Santoni, A., Eusebi, F., (1999). The growth-related gene product beta induces sphingomyelin hydrolysis and activation of c-Jun N-terminal kinase in rat cerebellar granule neurones. J Biol Chem 274, 36537-36543.

Lin, X., Wells, D.E., Kimberling, W.J., Kumar, S., (1999). Human NDUFB9 gene: genomic organization and a possible candidate gene associated with deafness disorder mapped to chromosome 8q13. Hum Hered 49, 75-80.

Liu, X., Kim, C.N., Yang, J., Jemmerson, R., Wang, X., (1996). Induction of apoptotic program in cell-free extracts: requirement for dATP and cytochrome c. Cell 86, 147-157.

Liu, Y., Fiskum, G., Schubert, D., (2002). Generation of reactive oxygen species by the mitochondrial electron transport chain. J Neurochem 80, 780- 787.

Lode, A., Kuschel, M., Paret, C., Rödel, G., (2000). Mitochondrial copper metabolism in yeast: interaction between Sco1p and Cox2p. FEBS Lett 485, 19-24.

Lode, A., Paret, C., Rödel, G., (2002). Molecular characterization of Saccharomyces cerevisiae Sco2p reveals a high degree of redundancy with Sco1p. Yeast 19, 909-922.

109

REFERENCES

Loeffen, J., Smeitink, J., Triepels, R., Smeets, R., Schuelke, M., Sengers, R., Trijbels, F., Hamel, B., Mullaart, R., van den Heuvel, L., (1998). The first nuclear-encoded complex I mutation in a patient with Leigh syndrome. Am J Hum Genet 63, 1598-1608.

Longen, S., Bien, M., Bihlmaier, K., Kloeppel, C., Kauff, F., Hammermeister, M., Westermann, B., Herrmann, J.M., Riemer, J., (2009). Systematic analysis of the twin Cx(9)C protein family. J Mol Biol 393, 356-368.

Macmillan, C., Lach, B., Shoubridge, E.A., (1993). Variable distribution of mutant mitochondrial DNAs (tRNA(Leu[3243])) in tissues of symptomatic relatives with MELAS: the role of mitotic segregation. Neurology 43, 1586- 1590.

Mannella, C.A., (1992). The 'ins' and 'outs' of mitochondrial membrane channels. Trends Biochem Sci 17, 315-320.

Martelli, A., Wattenhofer-Donze, M., Schmucker, S., Bouvet, S., Reutenauer, L., Puccio, H., (2007). Frataxin is essential for extramitochondrial Fe-S cluster proteins in mammalian tissues. Hum Mol Genet 16, 2651-2658.

Martins, L.J., Jensen, L.T., Simon, J.R., Keller, G.L., Winge, D.R., (1998). Metalloregulation of FRE1 and FRE2 homologs in Saccharomyces cerevisiae. J Biol Chem 273, 23716-23721.

Massaro, E.J., (1970). Horseshoe crab lactate dehydrogenase: tissue distribution and molecular weight. Science 167, 994-996.

Maxfield, A.B., Heaton, D.N., Winge, D.R., (2004). Cox17 is functional when tethered to the mitochondrial inner membrane. J Biol Chem 279, 5072-5080.

McBride, H.M., Neuspiel, M., Wasiak, S., (2006). Mitochondria: more than just a powerhouse. Curr Biol 16, R551-560.

McEwen, J.E., Hong, K.H., Park, S., Preciado, G.T., (1993). Sequence and chromosomal localization of two PET genes required for cytochrome c oxidase assembly in Saccharomyces cerevisiae. Curr Genet 23, 9-14.

Mesecke, N., Bihlmaier, K., Grumbt, B., Longen, S., Terziyska, N., Hell, K., Herrmann, J.M., (2008). The zinc-binding protein Hot13 promotes oxidation of the mitochondrial import receptor Mia40. EMBO Rep 9, 1107-1113.

Mesecke, N., Terziyska, N., Kozany, C., Baumann, F., Neupert, W., Hell, K., Herrmann, J.M., (2005). A disulfide relay system in the intermembrane space of mitochondria that mediates protein import. Cell 121, 1059-1069.

Miyayama, T., Suzuki, K.T., Ogra, Y., (2009). Copper accumulation and compartmentalization in mouse fibroblast lacking metallothionein and copper chaperone, Atox1. Toxicol Appl Pharmacol 237, 205-213.

Morris, A.A., Leonard, J.V., Brown, G.K., Bidouki, S.K., Bindoff, L.A., Woodward, C.E., Harding, A.E., Lake, B.D., Harding, B.N., Farrell, M.A., Bell, J.E., Mirakhur, M., Turnbull, D.M., (1996). Deficiency of respiratory chain complex I is a common cause of Leigh disease. Ann Neurol 40, 25-30.

110

REFERENCES

Naess, K., Freyer, C., Bruhn, H., Wibom, R., Malm, G., Nennesmo, I., von Dobeln, U., Larsson, N.G., (2009). MtDNA mutations are a common cause of severe disease phenotypes in children with Leigh syndrome. Biochim Biophys Acta 1787, 484-490.

Nijtmans, L.G., Henderson, N.S., Holt, I.J., (2002). Blue Native electrophoresis to study mitochondrial and other protein complexes. Methods 26, 327-334.

Nijtmans, L.G., Taanman, J.W., Muijsers, A.O., Speijer, D., Van den Bogert, C., (1998). Assembly of cytochrome-c oxidase in cultured human cells. Eur J Biochem 254, 389-394.

Nobrega, M.P., Bandeira, S.C., Beers, J., Tzagoloff, A., (2002). Characterization of COX19, a widely distributed gene required for expression of mitochondrial cytochrome oxidase. J Biol Chem 277, 40206-40211.

O'Halloran, T.V., Culotta, V.C., (2000). Metallochaperones, an intracellular shuttle service for metal ions. J Biol Chem 275, 25057-25060.

Okado-Matsumoto, A., Fridovich, I., (2001). Subcellular distribution of superoxide dismutases (SOD) in rat liver: Cu,Zn-SOD in mitochondria. J Biol Chem 276, 38388-38393.

Palumaa, P., Kangur, L., Voronova, A., Sillard, R., (2004). Metal-binding mechanism of Cox17, a copper chaperone for cytochrome c oxidase. Biochem J 382, 307-314.

Panov, A., Dikalov, S., Shalbuyeva, N., Hemendinger, R., Greenamyre, J.T., Rosenfeld, J., (2007). Species- and tissue-specific relationships between mitochondrial permeability transition and generation of ROS in brain and liver mitochondria of rats and mice. Am J Physiol Cell Physiol 292, C708-718.

Papadopoulou, L.C., Sue, C.M., Davidson, M.M., Tanji, K., Nishino, I., Sadlock, J.E., Krishna, S., Walker, W., Selby, J., Glerum, D.M., Coster, R.V., Lyon, G., Scalais, E., Lebel, R., Kaplan, P., Shanske, S., De Vivo, D.C., Bonilla, E., Hirano, M., DiMauro, S., Schon, E.A., (1999). Fatal infantile cardioencephalomyopathy with COX deficiency and mutations in SCO2, a COX assembly gene. Nat Genet 23, 333-337.

Paradies, G., Petrosillo, G., Pistolese, M., Di Venosa, N., Federici, A., Ruggiero, F.M., (2004). Decrease in mitochondrial complex I activity in ischemic/reperfused rat heart: involvement of reactive oxygen species and cardiolipin. Circ Res 94, 53-59.

Paradies, G., Petrosillo, G., Pistolese, M., Ruggiero, F.M., (2002). Reactive oxygen species affect mitochondrial electron transport complex I activity through oxidative cardiolipin damage. Gene 286, 135-141.

Paret, C., Lode, A., Krause-Buchholz, U., Rödel, G., (2000). The P(174)L mutation in the human hSCO1 gene affects the assembly of cytochrome c oxidase. Biochem Biophys Res Commun 279, 341-347.

111

REFERENCES

Parfait, B., Chretien, D., Rotig, A., Marsac, C., Munnich, A., Rustin, P., (2000). Compound heterozygous mutations in the flavoprotein gene of the respiratory chain complex II in a patient with Leigh syndrome. Hum Genet 106, 236-243.

Pena, M.M., Puig, S., Thiele, D.J., (2000). Characterization of the Saccharomyces cerevisiae high affinity copper transporter Ctr3. J Biol Chem 275, 33244-33251.

Persengiev, S.P., Zhu, X., Green, M.R., (2004). Nonspecific, concentration- dependent stimulation and repression of mammalian gene expression by small interfering RNAs (siRNAs). RNA 10, 12-18.

Petrosillo, G., Ruggiero, F.M., Di Venosa, N., Paradies, G., (2003). Decreased complex III activity in mitochondria isolated from rat heart subjected to ischemia and reperfusion: role of reactive oxygen species and cardiolipin. FASEB J 17, 714-716.

Petruzzella, V., Tiranti, V., Fernandez, P., Ianna, P., Carrozzo, R., Zeviani, M., (1998). Identification and characterization of human cDNAs specific to BCS1, PET112, SCO1, COX15, and COX11, five genes involved in the formation and function of the mitochondrial respiratory chain. Genomics 54, 494-504.

Pierrel, F., Cobine, P.A., Winge, D.R., (2007). Metal Ion availability in mitochondria. Biometals 20, 675-682.

Pohjoismaki, J.L., Holmes, J.B., Wood, S.R., Yang, M.Y., Yasukawa, T., Reyes, A., Bailey, L.J., Cluett, T.J., Goffart, S., Willcox, S., Rigby, R.E., Jackson, A.P., Spelbrink, J.N., Griffith, J.D., Crouch, R.J., Jacobs, H.T., Holt, I.J., (2010). Mammalian mitochondrial DNA replication intermediates are essentially duplex but contain extensive tracts of RNA/DNA hybrid. J Mol Biol 397, 1144-1155.

Polyak, K., Li, Y., Zhu, H., Lengauer, C., Willson, J.K., Markowitz, S.D., Trush, M.A., Kinzler, K.W., Vogelstein, B., (1998). Somatic mutations of the mitochondrial genome in human colorectal tumours. Nat Genet 20, 291-293.

Poyton, R.O., McEwen, J.E., (1996). Crosstalk between nuclear and mitochondrial genomes. Annu Rev Biochem 65, 563-607.

Prohaska, J.R., Broderius, M., Brokate, B., (2003). Metallochaperone for Cu,Zn-superoxide dismutase (CCS) protein but not mRNA is higher in organs from copper-deficient mice and rats. Arch Biochem Biophys 417, 227-234.

Puig, S., Thiele, D.J., (2002). Molecular mechanisms of copper uptake and distribution. Curr Opin Chem Biol 6, 171-180.

Punter, F.A., Adams, D.L., Glerum, D.M., (2000). Characterization and localization of human COX17, a gene involved in mitochondrial copper transport. Hum Genet 107, 69-74.

Punter, F.A., Glerum, D.M., (2003). Mutagenesis reveals a specific role for Cox17p in copper transport to cytochrome oxidase. J Biol Chem 278, 30875- 30880.

112

REFERENCES

Reifschneider, N.H., Goto, S., Nakamoto, H., Takahashi, R., Sugawa, M., Dencher, N.A., Krause, F., (2006). Defining the mitochondrial proteomes from five rat organs in a physiologically significant context using 2D blue- native/SDS-PAGE. J Proteome Res 5, 1117-1132.

Reitzer, L.J., Wice, B.M., Kennell, D., (1979). Evidence that glutamine, not sugar, is the major energy source for cultured HeLa cells. J Biol Chem 254, 2669-2676.

Rizzuto, R., Pinton, P., Carrington, W., Fay, F.S., Fogarty, K.E., Lifshitz, L.M., Tuft, R.A., Pozzan, T., (1998). Close contacts with the endoplasmic reticulum as determinants of mitochondrial Ca2+ responses. Science 280, 1763-1766.

Robberson, D.L., Kasamatsu, H., Vinograd, J., (1972). Replication of mitochondrial DNA. Circular replicative intermediates in mouse L cells. Proc Natl Acad Sci U S A 69, 737-741.

Rossignol, R., Gilkerson, R., Aggeler, R., Yamagata, K., Remington, S.J., Capaldi, R.A., (2004). Energy substrate modulates mitochondrial structure and oxidative capacity in cancer cells. Cancer Res 64, 985-993.

Rossmanith, W., Freilinger, M., Roka, J., Raffelsberger, T., Moser-Thier, K., Prayer, D., Bernert, G., Bittner, R.E., (2008). Isolated cytochrome c oxidase deficiency as a cause of MELAS. J Med Genet 45, 117-121.

Rust, M.J., Bates, M., Zhuang, X., (2006). Sub-diffraction-limit imaging by stochastic optical reconstruction microscopy (STORM). Nat Methods 3, 793- 795.

Salviati, L., Hernandez-Rosa, E., Walker, W.F., Sacconi, S., DiMauro, S., Schon, E.A., Davidson, M.M., (2002a). Copper supplementation restores cytochrome c oxidase activity in cultured cells from patients with SCO2 mutations. Biochem J 363, 321-327.

Salviati, L., Sacconi, S., Rasalan, M.M., Kronn, D.F., Braun, A., Canoll, P., Davidson, M., Shanske, S., Bonilla, E., Hays, A.P., Schon, E.A., DiMauro, S., (2002b). Cytochrome c oxidase deficiency due to a novel SCO2 mutation mimics Werdnig-Hoffmann disease. Arch Neurol 59, 862-865.

Sarkar, B., Lingertat-Walsh, K., Clarke, J.T., (1993). Copper-histidine therapy for Menkes disease. J Pediatr 123, 828-830.

Saxena, S., Jonsson, Z.O., Dutta, A., (2003). Small RNAs with imperfect match to endogenous mRNA repress translation. Implications for off-target activity of small inhibitory RNA in mammalian cells. J Biol Chem 278, 44312- 44319.

Scacheri, P.C., Rozenblatt-Rosen, O., Caplen, N.J., Wolfsberg, T.G., Umayam, L., Lee, J.C., Hughes, C.M., Shanmugam, K.S., Bhattacharjee, A., Meyerson, M., Collins, F.S., (2004). Short interfering RNAs can induce unexpected and divergent changes in the levels of untargeted proteins in mammalian cells. Proc Natl Acad Sci U S A 101, 1892-1897.

113

REFERENCES

Schäfer, E., Dencher, N.A., Vonck, J., Parcej, D.N., (2007). Three-dimensional structure of the respiratory chain supercomplex I1III2IV1 from bovine heart mitochondria. Biochemistry 46, 12579-12585.

Schäfer, E., Seelert, H., Reifschneider, N.H., Krause, F., Dencher, N.A., Vonck, J., (2006). Architecture of active mammalian respiratory chain supercomplexes. J Biol Chem 281, 15370-15375.

Schägger, H., (1995). Native electrophoresis for isolation of mitochondrial oxidative phosphorylation protein complexes. Methods Enzymol 260, 190-202.

Schägger, H., (1996). Electrophoretic techniques for isolation and quantification of oxidative phosphorylation complexes from human tissues. Methods Enzymol 264, 555-566.

Schägger, H., (2001). Blue-native gels to isolate protein complexes from mitochondria. Methods Cell Biol 65, 231-244.

Schägger, H., Bentlage, H., Ruitenbeek, W., Pfeiffer, K., Rotter, S., Rother, C., Bottcher-Purkl, A., Lodemann, E., (1996). Electrophoretic separation of multiprotein complexes from blood platelets and cell lines: technique for the analysis of diseases with defects in oxidative phosphorylation. Electrophoresis 17, 709-714.

Schägger, H., de Coo, R., Bauer, M.F., Hofmann, S., Godinot, C., Brandt, U., (2004). Significance of respirasomes for the assembly/stability of human respiratory chain complex I. J Biol Chem 279, 36349-36353.

Schägger, H., Pfeiffer, K., (2000). Supercomplexes in the respiratory chains of yeast and mammalian mitochondria. Embo J 19, 1777-1783.

Schägger, H., Pfeiffer, K., (2001). The ratio of oxidative phosphorylation complexes I-V in bovine heart mitochondria and the composition of respiratory chain supercomplexes. J Biol Chem 276, 37861-37867.

Schägger, H., von Jagow, G., (1991). Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form. Anal Biochem 199, 223-231.

Scheffler, I.E., (2001). A century of mitochondrial research: achievements and perspectives. Mitochondrion 1, 3-31.

Schon, E.A., Rizzuto, R., Moraes, C.T., Nakase, H., Zeviani, M., DiMauro, S., (1989). A direct repeat is a hotspot for large-scale deletion of human mitochondrial DNA. Science 244, 346-349.

Schulze, M., Rödel, G., (1989). Accumulation of the cytochrome c oxidase subunits I and II in yeast requires a mitochondrial membrane-associated protein, encoded by the nuclear SCO1 gene. Mol Gen Genet 216, 37-43.

Sciacco, M., Bonilla, E., Schon, E.A., DiMauro, S., Moraes, C.T., (1994). Distribution of wild-type and common deletion forms of mtDNA in normal and respiration-deficient muscle fibers from patients with mitochondrial myopathy. Hum Mol Genet 3, 13-19.

114

REFERENCES

Semizarov, D., Frost, L., Sarthy, A., Kroeger, P., Halbert, D.N., Fesik, S.W., (2003). Specificity of short interfering RNA determined through gene expression signatures. Proc Natl Acad Sci U S A 100, 6347-6352.

Semizarov, D., Kroeger, P., Fesik, S., (2004). siRNA-mediated gene silencing: a global genome view. Nucleic Acids Res 32, 3836-3845.

Shoffner, J.M., Lott, M.T., Lezza, A.M., Seibel, P., Ballinger, S.W., Wallace, D.C., (1990). Myoclonic epilepsy and ragged-red fiber disease (MERRF) is associated with a mitochondrial DNA tRNA(Lys) mutation. Cell 61, 931-937.

Shoubridge, E.A., (2001). Cytochrome c oxidase deficiency. Am J Med Genet 106, 46-52.

Sideris, D.P., Petrakis, N., Katrakili, N., Mikropoulou, D., Gallo, A., Ciofi- Baffoni, S., Banci, L., Bertini, I., Tokatlidis, K., (2009). A novel intermembrane space-targeting signal docks cysteines onto Mia40 during mitochondrial oxidative folding. J Cell Biol 187, 1007-1022.

Simon, H.U., Haj-Yehia, A., Levi-Schaffer, F., (2000). Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis 5, 415-418.

Sledz, C.A., Holko, M., de Veer, M.J., Silverman, R.H., Williams, B.R., (2003). Activation of the interferon system by short-interfering RNAs. Nat Cell Biol 5, 834-839.

Spasojevic, I., Mojovic, M., Stevic, Z., Spasic, S.D., Jones, D.R., Morina, A., Spasic, M.B., (2010). Bioavailability and catalytic properties of copper and iron for Fenton chemistry in human cerebrospinal fluid. Redox Rep 15, 29-35.

Speno, H., Taheri, M.R., Sieburth, D., Martin, C.T., (1995). Identification of essential amino acids within the proposed CuA binding site in subunit II of cytochrome c oxidase. J Biol Chem 270, 25363-25369.

Spinazzola, A., Zeviani, M., (2005). Disorders of nuclear-mitochondrial intergenomic signaling. Gene 354, 162-168.

St-Pierre, J., Buckingham, J.A., Roebuck, S.J., Brand, M.D., (2002). Topology of superoxide production from different sites in the mitochondrial electron transport chain. J Biol Chem 277, 44784-44790.

Starkov, A.A., Fiskum, G., Chinopoulos, C., Lorenzo, B.J., Browne, S.E., Patel, M.S., Beal, M.F., (2004). Mitochondrial alpha-ketoglutarate dehydrogenase complex generates reactive oxygen species. J Neurosci 24, 7779-7788.

Stiburek, L., Hansikova, H., Tesarova, M., Cerna, L., Zeman, J., (2006). Biogenesis of eukaryotic cytochrome c oxidase. Physiol Res 55 Suppl 2, S27- 41.

Stiburek, L., Vesela, K., Hansikova, H., Pecina, P., Tesarova, M., Cerna, L., Houstek, J., Zeman, J., (2005). Tissue-specific cytochrome c oxidase assembly defects due to mutations in SCO2 and SURF1. Biochem J 392, 625- 632.

115

REFERENCES

Suomalainen, A., Majander, A., Wallin, M., Setala, K., Kontula, K., Leinonen, H., Salmi, T., Paetau, A., Haltia, M., Valanne, L., Lonnqvist, J., Peltonen, L., Somer, H., (1997). Autosomal dominant progressive external ophthalmoplegia with multiple deletions of mtDNA: clinical, biochemical, and molecular genetic features of the 10q-linked disease. Neurology 48, 1244-1253.

Suthammarak, W., Yang, Y.Y., Morgan, P.G., Sedensky, M.M., (2009). Complex I Function Is Defective in Complex IV-deficient Caenorhabditis elegans. J Biol Chem 284, 6425-6435.

Suzuki, C., Daigo, Y., Kikuchi, T., Katagiri, T., Nakamura, Y., (2003). Identification of COX17 as a therapeutic target for non-small cell lung cancer. Cancer Res 63, 7038-7041.

Svoboda, P., (2007). Off-targeting and other non-specific effects of RNAi experiments in mammalian cells. Curr Opin Mol Ther 9, 248-257.

Taanman, J.W., Burton, M.D., Marusich, M.F., Kennaway, N.G., Capaldi, R.A., (1996). Subunit specific monoclonal antibodies show different steady-state levels of various cytochrome-c oxidase subunits in chronic progressive external ophthalmoplegia. Biochim Biophys Acta 1315, 199-207.

Takahashi, Y., Kako, K., Kashiwabara, S., Takehara, A., Inada, Y., Arai, H., Nakada, K., Kodama, H., Hayashi, J., Baba, T., Munekata, E., (2002). Mammalian copper chaperone Cox17p has an essential role in activation of cytochrome c oxidase and embryonic development. Mol Cell Biol 22, 7614- 7621.

Tiranti, V., Galimberti, C., Nijtmans, L., Bovolenta, S., Perini, M.P., Zeviani, M., (1999). Characterization of SURF-1 expression and Surf-1p function in normal and disease conditions. Hum Mol Genet 8, 2533-2540.

Tiranti, V., Hoertnagel, K., Carrozzo, R., Galimberti, C., Munaro, M., Granatiero, M., Zelante, L., Gasparini, P., Marzella, R., Rocchi, M., Bayona- Bafaluy, M.P., Enriquez, J.A., Uziel, G., Bertini, E., Dionisi-Vici, C., Franco, B., Meitinger, T., Zeviani, M., (1998). Mutations of SURF-1 in Leigh disease associated with cytochrome c oxidase deficiency. Am J Hum Genet 63, 1609- 1621.

Triepels, R.H., Van Den Heuvel, L.P., Trijbels, J.M., Smeitink, J.A., (2001). Respiratory chain complex I deficiency. Am J Med Genet 106, 37-45.

Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R., Yoshikawa, S., (1996). The whole structure of the 13-subunit oxidized cytochrome c oxidase at 2.8 A. Science 272, 1136-1144.

Turrens, J.F., (1997). Superoxide production by the mitochondrial respiratory chain. Biosci Rep 17, 3-8.

Turrens, J.F., (2003). Mitochondrial formation of reactive oxygen species. J Physiol 552, 335-344.

116

REFERENCES

Tzagoloff, A., Akai, A., Needleman, R.B., Zulch, G., (1975). Assembly of the mitochondrial membrane system. Cytoplasmic mutants of Saccharomyces cerevisiae with lesions in enzymes of the respiratory chain and in the mitochondrial ATPase. J Biol Chem 250, 8236-8242.

Tzagoloff, A., Capitanio, N., Nobrega, M.P., Gatti, D., (1990). Cytochrome oxidase assembly in yeast requires the product of COX11, a homolog of the P. denitrificans protein encoded by ORF3. EMBO J 9, 2759-2764.

Valentine, M.T., Fordyce, P.M., Block, S.M., (2006). Eg5 steps it up! Cell Div 1, 31.

Valnot, I., Osmond, S., Gigarel, N., Mehaye, B., Amiel, J., Cormier-Daire, V., Munnich, A., Bonnefont, J.P., Rustin, P., Rotig, A., (2000a). Mutations of the SCO1 gene in mitochondrial cytochrome c oxidase deficiency with neonatal- onset hepatic failure and encephalopathy. Am J Hum Genet 67, 1104-1109.

Valnot, I., von Kleist-Retzow, J.C., Barrientos, A., Gorbatyuk, M., Taanman, J.W., Mehaye, B., Rustin, P., Tzagoloff, A., Munnich, A., Rotig, A., (2000b). A mutation in the human heme A:farnesyltransferase gene (COX10) causes cytochrome c oxidase deficiency. Hum Mol Genet 9, 1245-1249. van de Linde, S., Sauer, M., Heilemann, M., (2008). Subdiffraction-resolution fluorescence imaging of proteins in the mitochondrial inner membrane with photoswitchable fluorophores. J Struct Biol 164, 250-254.

Van Goethem, G., Dermaut, B., Lofgren, A., Martin, J.J., Van Broeckhoven, C., (2001). Mutation of POLG is associated with progressive external ophthalmoplegia characterized by mtDNA deletions. Nat Genet 28, 211-212.

Vander Heiden, M.G., Chandel, N.S., Li, X.X., Schumacker, P.T., Colombini, M., Thompson, C.B., (2000). Outer mitochondrial membrane permeability can regulate coupled respiration and cell survival. Proc Natl Acad Sci U S A 97, 4666-4671.

Vonck, J., Schäfer, E., (2009). Supramolecular organization of protein complexes in the mitochondrial inner membrane. Biochim Biophys Acta 1793, 117-124.

Voronova, A., Kazantseva, J., Tuuling, M., Sokolova, N., Sillard, R., Palumaa, P., (2007a). Cox17, a copper chaperone for cytochrome c oxidase: expression, purification, and formation of mixed disulphide adducts with thiol reagents. Protein Expr Purif 53, 138-144.

Voronova, A., Meyer-Klaucke, W., Meyer, T., Rompel, A., Krebs, B., Kazantseva, J., Sillard, R., Palumaa, P., (2007b). Oxidative switches in functioning of mammalian copper chaperone Cox17. Biochem J 408, 139-148.

Wai, T., Teoli, D., Shoubridge, E.A., (2008). The mitochondrial DNA genetic bottleneck results from replication of a subpopulation of genomes. Nat Genet 40, 1484-1488.

Wallace, D.C., (1992). Diseases of the mitochondrial DNA. Annu Rev Biochem 61, 1175-1212.

117

REFERENCES

Wallace, D.C., (1999). Mitochondrial diseases in man and mouse. Science 283, 1482-1488.

White, H.E., Durston, V.J., Seller, A., Fratter, C., Harvey, J.F., Cross, N.C., (2005). Accurate detection and quantitation of heteroplasmic mitochondrial point mutations by pyrosequencing. Genet Test 9, 190-199.

Wikstrom, M.K., (1977). Proton pump coupled to cytochrome c oxidase in mitochondria. Nature 266, 271-273.

Williams, S.L., Valnot, I., Rustin, P., Taanman, J.W., (2004). Cytochrome c oxidase subassemblies in fibroblast cultures from patients carrying mutations in COX10, SCO1, or SURF1. J Biol Chem 279, 7462-7469.

Wittig, I., Schägger, H., (2007). Electrophoretic methods to isolate protein complexes from mitochondria. Methods Cell Biol 80, 723-741.

Wong, P.C., Waggoner, D., Subramaniam, J.R., Tessarollo, L., Bartnikas, T.B., Culotta, V.C., Price, D.L., Rothstein, J., Gitlin, J.D., (2000). Copper chaperone for superoxide dismutase is essential to activate mammalian Cu/Zn superoxide dismutase. Proc Natl Acad Sci U S A 97, 2886-2891.

Yoshikawa, S., Shinzawa-Itoh, K., Tsukihara, T., (1998). Crystal structure of bovine heart cytochrome c oxidase at 2.8 A resolution. J Bioenerg Biomembr 30, 7-14.

Zamzami, N., Marchetti, P., Castedo, M., Decaudin, D., Macho, A., Hirsch, T., Susin, S.A., Petit, P.X., Mignotte, B., Kroemer, G., (1995). Sequential reduction of mitochondrial transmembrane potential and generation of reactive oxygen species in early programmed cell death. J Exp Med 182, 367- 377.

Zeng, Y., Yi, R., Cullen, B.R., (2003). MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms. Proc Natl Acad Sci U S A 100, 9779-9784.

Zeviani, M., Di Donato, S., (2004). Mitochondrial disorders. Brain 127, 2153- 2172.

Zhang, M., Mileykovskaya, E., Dowhan, W., (2002). Gluing the respiratory chain together. Cardiolipin is required for supercomplex formation in the inner mitochondrial membrane. J Biol Chem 277, 43553-43556.

118

DECLARATION

I herewith declare that I have produced this thesis without the prohibited assistance of third parties and without making use of aids other than those specified; notions taken over directly or indirectly from other sources have been identified as such. This thesis has not previously been presented in identical or similar form to any other German or foreign examination board.

The thesis work was conducted from September 2006 to April 2010 under the supervision of Prof. Dr. Gerhard Rödel at the Institute of Genetics, TU- Dresden.

Hiermit versichere ich, dass ich die vorliegende Arbeit ohne unzulässige Hilfe Dritter und ohne Benutzung anderer als der angegebenen Hilfsmittel angefertigt habe; die aus fremden Quellen direkt oder indirekt übernommenen Gedanken sind als solche kenntlich gemacht. Die Arbeit wurde bisher weder im Inland noch im Ausland in gleicher oder ähnlicher Form einer anderen Prüfungsbehörde vorgelegt.

Die Dissertation wurde von Prof. Dr. Gerhard Rödel am Institut für Genetik der TU Dresden betreut und von September 2006 bis April 2010 verfasst.

Meine Person betreffend erkläre ich hiermit, dass keine früheren erfolglosen Promotionsverfahren stattgefunden haben.

Ich erkenne die Promotionsordnung der Fakultät für Mathematik und Naturwissenschaften, Technische Universität Dresden an.

Dresden, April 2010

CORINA OSWALD