Profile of Rino Rappuoli

Total Page:16

File Type:pdf, Size:1020Kb

Profile of Rino Rappuoli PROFILE Profile of Rino Rappuoli ino Rappuoli grew up in the shadow of what he describes as a testament to the devastating impact of infectious disease: Rthe unfinished wall of the Siena Cathe- dral in Siena, Italy. When the plague hit the city in 1348, it slashed the popula- tion from 100,000 to 30,000. ‘‘It basically shut down one of the most powerful economies of the time, and that momen- tum was lost forever. I see it as an ex- ample of what could happen today with pandemic influenza,’’ says Rappuoli, whose current research focuses on devel- oping a vaccine for avian influenza. Rappuoli, currently the Global Head of Vaccines Research for Novartis Vaccines & Diagnostics (Siena, Italy), was elected as a foreign associate of the National Academy of Sciences in 2005. He has spent his career developing vaccines for pertussis, meningitis, and Helicobacter pylori and is jointly responsible for engi- neering the carrier protein used in many conjugate vaccines. He is credited with launching the field of reverse vaccinology, the first fruits of which are revealed in his Inaugural Article in this issue of PNAS Rino Rappuoli (1), where he describes a universal vaccine for serogroup B meningococcus. fellowship at Siena’s Sclavo Research to Alwin Pappenheimer, who became a Bucolic Beginnings Center, the Italian vaccine institute that mentor to Rappuoli. ‘‘He was one of Rappuoli was born in 1952, in Radicofani, had been developing and producing vac- the fathers of microbiology and immun- Italy, a village 40 miles south of Siena. cines for almost a century. ology....Heisanother person who really When he was 11, his family moved closer shaped my career,’’ says Rappuoli. Microbiology in America to Siena, enabling Rappuoli to attend high At Harvard Medical School, Rappuoli school in the city. He spent weekends and Almost immediately after joining the joined Murphy and Pappenheimer in summers helping his father produce Chi- institute, Rappuoli left to take on a their search for a new diphtheria vac- anti, the region’s signature red wine. As project in the United States. He knew cine. The project stemmed from work college approached, Rappuoli was torn that to work at the cutting edge of vac- Pappenheimer had done in 1972 (2, 3). between the desires to study poetry or cine science he needed to learn new Pappenheimer had mutagenized the science. ‘‘I chose science,’’ says Rappuoli. techniques in molecular biology and ge- diphtheria toxin gene and isolated a mu- ‘‘The moon landing and the sense of im- netic engineering. In 1979, he spent four tant with a single amino acid change. pending scientific revolution probably in- pivotal months at The Rockefeller Uni- This minute tweak rendered the mole- fluenced my thinking.’’ versity (New York, NY) as a visiting cule, called CRM197, nontoxic and ideal Rappuoli pursued his undergraduate scientist in the laboratory of Emil as a diphtheria vaccine. ‘‘This was a big studies at the University of Siena but Gotschlich, who pioneered meningococ- change in thinking because instead of yearned to experience science outside of cal vaccine studies in the 1960s. ‘‘He is using chemicals to detoxify the toxin, Italy. Wanderlust led him to Washington probably one of the smartest scientists you could modify the gene, and the bac- University in St. Louis, MO, where he I’ve ever met and probably the person teria would produce a molecule you studied bacterial mutagenesis during the who had the greatest impact on me,’’ wanted already to go for you. It is per- summer vacation after his third year of says Rappuoli. ‘‘He would just tell me haps the first example of rational design college. More important than the re- about science . how to approach the of natural molecules to yield efficient search, however, were his observations of problem and spend a lot of time teach- therapeutics or vaccines,’’ says Rappuoli. ing me. Sometimes you meet a person the bountiful conditions American scien- Conjugate Vaccines tists enjoyed. ‘‘In Italy, the theoretical who changes the way you think.’’ training was good, but the technology gap In 1980, Rappuoli spent a year at Har- In 1981, Rappuoli returned to Sclavo Re- was huge,’’ says Rappuoli, ‘‘and molecular vard Medical School (Boston, MA) in the search Center in Italy and launched his biology was 5 or 6 years behind the laboratory of John Murphy, who worked own laboratory. He continued his collabo- United States.’’ on Corynebacterium diphtheriae, which ration with Murphy and Pappenheimer After graduation, Rappuoli remained causes diphtheria. Murphy introduced at the University of Siena, where he Rappuoli to bacterial genetics and the This is a Profile of a recently elected member of the National earned a Ph.D. in biological sciences for world of bacterial toxins, and he helped Academy of Sciences to accompany the member’s Inaugural his NMR studies of proteins and tissue Rappuoli learn new techniques in microbi- Article on page 10834. membranes. In 1978, he was offered a ology. Murphy also introduced Rappuoli © 2006 by The National Academy of Sciences of the USA www.pnas.org͞cgi͞doi͞10.1073͞pnas.0604892103 PNAS ͉ July 18, 2006 ͉ vol. 103 ͉ no. 29 ͉ 10831–10833 Downloaded by guest on September 28, 2021 and was charged with mass-producing States and Europe to shift from use of the cloned the H. pylori toxin, identified the CRM197. He succeeded in 1982, using old pertussis vaccine to the new acellular mechanism of action, and made a vac- classical genetics, but CRM197 was never one. ‘‘That was a milestone in vaccination cine that went into clinical trials. But by used for a diphtheria vaccine. The current because it was a switch from traditional the end of Phase I studies, commercial diphtheria vaccine was developed in and whole-cell killed-bacterial vaccines to interest in the vaccine was low. has been in use since 1924. ‘‘That’s the more sophisticated, modern purified vac- Although the work did not yield a vaccine that we still use today,’’ says Rap- cines,’’ Rappuoli says. vaccine, Rappuoli found that H. pylori puoli, ‘‘in large part because regulatory The development of the pertussis first attached to the eukaryotic cell and agencies and companies did not want to vaccine was particularly satisfying for Rap- then injected toxin directly through a change something that had been working puoli. In 1993, Italy adopted the use of hole in the membrane. ‘‘It was a totally for a century.’’ Thus, CRM197 was not the new vaccine, and within 2 years the new mechanism,’’ he says (6). Chiron, pursued as a diphtheria vaccine. disease was essentially eliminated. ‘‘So which was acquired by the pharmaceuti- However, CRM197 found an even that is basically one of the most beautiful cal company Novartis, has continued to broader application than for diphtheria. things that can happen if you do my probe the basic biology of the microbe. During the 1980s, other vaccine makers job....That’s been my motivation ever ‘‘We are starting to understand how were developing conjugate vaccines for since,’’ Rappuoli says. bacteria can cause cancer at the molecu- Hemophilus influenzae. Research by lar level, but we don’t have the full story John B. Robbins had established that Eliminating Serotype C Meningococcus yet,’’ says Rappuoli. The H. pylori toxin linking a polysaccharide to a carrier pro- ‘‘The next [vaccine] I thought I could triggers molecular changes in the cell tein could transform it into a powerful tackle with my team was meningococcus,’’ that resemble early stages of cancer. vaccine. Robbins suggested to Rappuoli says Rappuoli. Five primary serotypes ex- The work has led to many productive that CRM197 might make a good car- ist for Neisseria meningitides, the bacteria partnerships, including one with long- rier. ‘‘You vaccinate an infant with a responsible for meningitis and septicemia: time collaborator and fellow National polysaccharide, and there is absolutely A, B, C, Y, and W135. Rappuoli knew Academy of Sciences member Stanley no response. You link the polysaccha- from Gotschlich that capsule polysaccha- Falkow, a microbiologist at Stanford ride to a protein [such as CRM197], and rides were protective against serotype C. University (Stanford, CA) (7, 8). the response is dramatic. It’s the basis of That knowledge had been used to pro- As Rappuoli studied bacterial patho- many vaccines to date,’’ explains Rap- duce the meningococcal C vaccine, but genesis, he became increasingly aware puoli. Today, Rappuoli estimates that that microbiologists were growing bacte- every child in the United States and Eu- ria under artificial conditions that barely rope probably receives four or five vac- Eradicating whooping mimicked the real situations when these cinations with CRM197. It is a carrier microbes encountered humans. ‘‘We re- molecule for vaccines such as H. influen- cough in Italy was “one alized that some very important viru- zae, pneumococcus, and meningococcus. lence factors are not expressed when of the most beautiful you study the bacteria under those New Generation of Vaccines conditions,’’ says Rappuoli. He and his As with diphtheria, the new generation of things that can happen colleagues coined the term ‘‘cellular mi- vaccines against pertussis (whooping crobiology’’ to signal to the scientific cough) was made from a toxin that had if you do my job.” community, mainly to cell biologists and been deactivated with formaldehyde. ‘‘I microbiologists, that these two disci- didn’t waste any time doing that. I cloned plines should fuse into one. The idea, and sequenced the gene for pertussis the vaccine was not effective in infants. In which was published in a short essay in toxin and did what Pappenheimer had 1989, encouraged by promising results of Science, was immediately popular (9). A done 15 years before with diphtheria,’’ the first conjugate of CRM197 with H.
Recommended publications
  • Vaccines, Emerging Viruses, and How to Avoid Disaster Rino Rappuoli
    Rappuoli BMC Biology 2014, 12:100 http://www.biomedcentral.com/1741-7007/12/100 INTERVIEW Open Access Vaccines, emerging viruses, and how to avoid disaster Rino Rappuoli Abstract Rino Rappuoli is a graduate of Siena University, where he also earned his PhD before moving to the Sclavo Research Center, the Italian vaccine institute, also in Siena. He then spent two years in the USA, mostly at Harvard with John Murphy and Alwin Pappenheimer working on a new diphtheria vaccine based on a non-toxic mutant of diphtheria toxin which has since become the basis for conjugate vaccines against haemophilus, meningococcus, and pneumococcal infections, before returning to the Sclavo Research Center where he developed an acellular vaccine based on a mutant pertussis toxin. With many achievements Rino Rappuoli in vaccine development to his credit, he is now Global Head of Vaccines Research and Development for Novartis Vaccines in Siena, and has most recently breaking out. Ebola virus is by far the most lethal that we pioneered reverse vaccinology, in which the genome have now, but all of the others are very dangerous. of the pathogen is screened for candidate antigenic and immunogenic vaccine components. We spoke to him about the potential for outbreaks of the kind we I know that there are ’flu vaccines, but are there are now seeing with Ebolavirus in West Africa, and licensed vaccines for any of the others? what can be done to prevent them. The answer is no - there are no vaccines for SARS, which emerged in 2003, there is no licensed vaccine for MERS, there is no licensed vaccine for Chikungunya, Ebolavirus disease has been much in the news there is no licensed vaccine for Ebola - so for most of recently because of the horrendous outbreak in these diseases there are no vaccines, because they are – West Africa but how many other rare, sporadic too rare to justify the economic investment.
    [Show full text]
  • THE EVOLVING VIRUS Everything You What It Means How Long Before Need to Know About for the Roll-Out This Is Just the New Variants of Vaccines Another Cold?
    THE HUMMING UNIVERSE Do gravitational waves permeate all of space-time? BEYOND LITHIUM Batteries you can make from common salt GENETIC EXCLUSION The diversity issue undermining medicine WEEKLY 23 January 2021 No3318 Australia $9.50 (Inc. GST) New Zealand NZ$9.50 (Inc. GST) Print Post Approved 100007877 COVID-19 THE EVOLVING VIRUS Everything you What it means How long before need to know about for the roll-out this is just the new variants of vaccines another cold? PARENTAL BURNOUT Why it’s time to take it seriously PLUS SAVING THE NORTHERN WHITE RHINO / UNSWATTABLE FLIES / BIN BAG SMELL / HOW TO SPOT A LIAR / OLDEST ANIMAL PAINTING News, ideas and innovation www.newscientist.com 210123_R_Cov_EvolvingVirus.indd 66 19/1/21 23:04 The leader Time to adapt As the coronavirus mutates, we will need to adjust our approach to it JUST one month ago, the world Now the virus has picked up need for tweaks to vaccines or new was already struggling to contain mutations that allow it to spread treatments (see page 10). the spread of the coronavirus. more easily and, in some cases, The news of these new variants has Now the challenge has become that could help it evade our coincided closely with the widespread even harder. The emergence of new immune system (see page 8). and very welcome roll-out of vaccines variants with different properties has A faster-spreading virus leads against covid-19. These vaccines offer changed the rules of engagement. to more infections, as has been seen us a way out of the pandemic, but we That the coronavirus should evolve already knew it would be a long road isn’t surprising – this is what viruses “ A virus that can evade our to vaccinating almost the entire adult do.
    [Show full text]
  • Drugs and Vaccines Will Be Necessary to Control Tuberculosis
    applied sciences Editorial Drugs and Vaccines Will Be Necessary to Control Tuberculosis Rino Rappuoli 1,2,3 1 GSK, 53100 Siena, Italy; [email protected] 2 Monoclonal Antibody Discovery Lab, Fondazione Toscana Life Sciences, 53100 Siena, Italy 3 Imperial College London, London SW7 2AZ, UK Received: 5 June 2020; Accepted: 9 June 2020; Published: 10 June 2020 For most infectious diseases, vaccines are used to prevent infection and drugs are used for acute therapy and eradication of established infections. This is not the case for tuberculosis, where BCG, the vaccine against tuberculosis, which is given to most children in low- and middle-income countries, does not prevent infection, but it is only effective in decreasing infant mortality. The consequence is that infection occurs in one third of the global population and, following infection, the bacterium establishes a lifelong chronic presence. More than 2 billion people today are chronically infected. The immune system of the chronically infected individuals is effective to keep the bacterium at bay for most of the time, however there are circumstances where the immune system becomes temporarily or permanently weaker and the bacterium escapes the immunity and causes severe disease. The consequence are 1.5 million deaths every year. In addition to the only partially effective BCG vaccine against tuberculosis, also the available therapies for tuberculosis are suboptimal. They require months to eradicate the infection and they are largely ineffective due to the increasing rate of bacteria resistant to antibiotics. The question we have is why in 2020 we still rely on a vaccine developed a century ago (in 1922) and why we do not have better drugs.
    [Show full text]
  • Curriculum Vitae
    CURRICULUM VITAE RINO RAPPUOLI Business address GSK Vaccines Via Fiorentina, 1 53100 Siena – ITALY Office: +39-0577-243414 Email: [email protected] Current positions 2015 - to date Chief Scientist and Head External R&D, GlaxoSmithKline Vaccines (Siena, Italy). Previous positions 2017 - 2019 Professor of Vaccines Research, Faculty of Medicine, Imperial College (London, United Kingdom) 2014 Global Head Research and Development, Novartis Vaccines (Siena, Italy). 2007-2015 Founder and chairman of the Board of the Novartis Vaccines Institute for Global Health (Siena, Italy). 2006 Global Head Vaccines Research, Novartis Vaccines & Diagnostics (Siena, Italy). 2003 Chief Scientific Officer and Vice President Vaccines Research, Chiron Corporation (Emeryville, USA). 1996 Vice President Vaccines Research, Chiron Corporation (Emeryville, USA). 1992 Head of Research of IRIS, the Chiron S.p.A. Research Institute (Siena, Italy). 1988-1991 Head of the Sclavo Research and Development (Siena, Italy). 1985-1987 Head of the laboratory of Bacterial Vaccines at the Sclavo Research Center. Worked on the molecular genetics of Bordetella pertussis and the development of a new vaccine against whooping cough. 1982-1984 Sclavo Research Center, Worked on the molecular biology of Corynebacterium diphtheriae and the development of a new vaccine against diphtheria. 1980-1981 Visiting scientist at the Harvard Medical School (Boston, USA). Worked on the molecular biology of bacteriophages of Corynebacterium diphtheriae in the laboratory of John Murphy. 1979 Visiting scientist for four months at the Rockefeller University (New York, USA). Worked on the purification of gonococcal antigens in the laboratory of Emil Gotschlich. 1978-1984 Staff scientist at the Sclavo Research Center (Siena, Italy).
    [Show full text]
  • Deploy Vaccines to Fight Superbugs
    PROGRAM ON THE GLOBAL DEMOGRAPHY OF AGING AT HARVARD UNIVERSITY Working Paper Series Deploy Vaccines to Fight Superbugs Rino Rappuoli, David E. Bloom, and Steve Black December 2017 PGDA Working Paper No. 142 http://www.hsph.harvard.edu/pgda/working/ Research reported in this publication was supported by the National Institute on Aging of the National Institutes of Health under Award Number P30AG024409. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. COMMENT WEATHER Research must HEALTH How people with MEDICINE Sanctions leave long OBITUARY Ronald Breslow, adapt to the demands Lyme disease were shadow for users of blood- pioneering organic chemist, of society p.168 finally vindicated p.174 clotting factor in Iran p.175 remembered p.176 EDUARDO SOTERAS/AFP/GETTY EDUARDO Vaccines can have an effect on antimicrobial resistance by reducing the number of ill people and avoiding unnecessary antibiotic prescriptions. Deploy vaccines to fight superbugs Immunizations combined with antibiotics could be our best shot at combating drug-resistant microbes, argue Rino Rappuoli, David E. Bloom and Steve Black. acteria, viruses, parasites and fungi Antimicrobials alone won’t be able to stakeholders need to see antibiotics and that are resistant to drugs cause mitigate the threat. The supply of naturally vaccines as complementary tools. Here we 700,000 deaths each year. By 2050, such occurring antibiotics seems thin. And efforts focus on antibiotic-resistant bacteria, for B‘superbugs’, inured to treatments, could cause to engineer new ones have floundered. which the need for solutions is most urgent.
    [Show full text]
  • Sitting Down with Johannes Khinast
    APRIL 2021 # 74 Upfront In My View NextGen Sitting Down With The risk profile of Analyzing capsids for Unit-level traceability of Johannes Khinast – the only pharma-grade whey gene therapy glass containers science is good science 07 12 38 – 42 50 – 51 www.themedicinemaker.com Value beyond the vial When you have questions, we have answers. When evaluating your product against a reference standard, questions arise. Give yourself a cushion of confidence. When you need expert advice or are seeking a training course to help you with our reference standards, you’ll always have access to answers when you need them — with USP. Move forward with more confidence: Contact USP. 1-301-881-0666 | usp.org/chemical-medicines A Roadmap for Access We must secure sustainable markets to ensure patient Editorial access to generic and biosimilar medicines he pandemic has presented a unique challenge to healthcare systems and infrastructure, including the generic drug supply chain. Generic drug Tmanufacturers have met this challenge, ensuring a stable supply of life-saving medicines for patients throughout the pandemic. However, the long-term sustainability of the generic and emerging biosimilars medicines market faces threats. Policymakers should consider and address the unique challenges facing generics and biosimilars to maintain long-term access to cost savings for patients. In its latest paper, Securing Sustainable Markets, the Association for Accessible Medicines (AAM) announced a series of policy proposals intended to ensure patient access to lower-cost medicines (1). Generic drugs face competitive imbalances in the market, such as a highly consolidated drug purchasing system controlled by a few major organizations, combined with ill-advised government policies.
    [Show full text]
  • Vaccines for the Twenty-First Century Society
    PERSPECTIVES expectancy is above 80 years and, bearing SCIENCE AND SOCIETY in mind that predictions of a ceiling to life expectancy have been repeatedly wrong, Vaccines for the twenty-first century we can extrapolate that it could reach 100 years in six decades2. A major reason society for the steady increase of life expectancy is greater control of infectious diseases — this has led to decreased early mortality Rino Rappuoli, Christian W. Mandl, Steven Black and Ennio De Gregorio (only one in four children used to reach the Abstract | Vaccines have been one of the major revolutions in the history of age of 20) and has also provided a longer lifespan in adults by decreasing their expo- mankind and, during the twentieth century, they eliminated most of the childhood sure to acute and chronic inflammatory diseases that used to cause millions of deaths. In the twenty-first century, vaccines processes1. will also play a major part in safeguarding people’s health. Supported by the Vaccination served extremely well the innovations derived from new technologies, vaccines will address the new needs needs of our twentieth-century society, of a twenty-first century society characterized by increased life expectancy, members of which had a life expectancy of approximately 55–65 years. By eliminating emerging infections and poverty in low-income countries. many infectious diseases that used to cause millions of deaths, vaccination contributed Health is probably the most important value average lifespan was 35 years in 1750 to the increase in our lifespan (FIG. 1). of our society, which enjoys an unprecedented (REF.
    [Show full text]
  • Vaccinology in the Genome Era
    Vaccinology in the genome era C. Daniela Rinaudo, … , Rino Rappuoli, Kate L. Seib J Clin Invest. 2009;119(9):2515-2525. https://doi.org/10.1172/JCI38330. Review Series Vaccination has played a significant role in controlling and eliminating life-threatening infectious diseases throughout the world, and yet currently licensed vaccines represent only the tip of the iceberg in terms of controlling human pathogens. However, as we discuss in this Review, the arrival of the genome era has revolutionized vaccine development and catalyzed a shift from conventional culture-based approaches to genome-based vaccinology. The availability of complete bacterial genomes has led to the development and application of high-throughput analyses that enable rapid targeted identification of novel vaccine antigens. Furthermore, structural vaccinology is emerging as a powerful tool for the rational design or modification of vaccine antigens to improve their immunogenicity and safety. Find the latest version: https://jci.me/38330/pdf Review series Vaccinology in the genome era C. Daniela Rinaudo, John L. Telford, Rino Rappuoli, and Kate L. Seib Novartis Vaccines, Siena, Italy. Vaccination has played a significant role in controlling and eliminating life-threatening infectious diseases through- out the world, and yet currently licensed vaccines represent only the tip of the iceberg in terms of controlling human pathogens. However, as we discuss in this Review, the arrival of the genome era has revolutionized vaccine develop- ment and catalyzed a shift from conventional culture-based approaches to genome-based vaccinology. The availabili- ty of complete bacterial genomes has led to the development and application of high-throughput analyses that enable rapid targeted identification of novel vaccine antigens.
    [Show full text]
  • Bacterial Genetics in Meningitis: Associating Meningococcal and Pneumococcal Genes with Clinical Outcome
    UvA-DARE (Digital Academic Repository) Bacterial genetics in meningitis: Associating meningococcal and pneumococcal genes with clinical outcome Piet, J.R. Publication date 2016 Document Version Final published version Link to publication Citation for published version (APA): Piet, J. R. (2016). Bacterial genetics in meningitis: Associating meningococcal and pneumococcal genes with clinical outcome. General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons). Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible. UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl) Download date:23 Sep 2021 AAGCAAAAAAAATAAATAAATACCTATGCAATACACCTGCTTTATGCACTTGAGCAGGGAAGAAATCCACAAGGACTCACCAGTCTCCTGGTCTGCAGAGAAGACAGAATCAACATGAGCACAGCAGGAAAAGTAAGCAAAAAATATA TTACTGTTGGAACTATATTCTCATCAATATAACAAAGAAAGTAATACAGTATTTGATGAATCATTTAAAATTCATATCTAAATTAGAAATGATACACTGAAATATGATATGCAATATATGCTATAATATGTAATGTATACTGAACTACAG
    [Show full text]
  • Curriculum Vitae David E
    CURRICULUM VITAE DAVID E. BLOOM April 2018 PRESENT POSITION Harvard T.H. Chan School of Public Health Clarence James Gamble Professor of Economics and Demography (since July 2001) Professor of Economics and Demography, July 1999–June 2001 Professor of Population and Health Economics, July 1996–June 1999 Contact information: Department of Global Health and Population Harvard T.H. Chan School of Public Health 665 Huntington Avenue Boston, Massachusetts 02115 Phone: (+1) 617-432-0866; (+1) 617-432-1168 Email: [email protected] (work) Email: [email protected] (personal) PREVIOUS POSITIONS Harvard Business School Visiting Professor (August 2011–June 2012) Harvard University, School of Public Health Chair, Department of Global Health and Population (September 2001–August 2011) Harvard University, Harvard Institute for International Development Deputy Director, July 1996–June 1999 Acting Executive Director, July 1995–June 1996 Columbia University, Department of Economics Chairman, July 1990–December 1993 Professor of Economics, July 1987–June 1996 Russell Sage Foundation Scholar-in-Residence, 1989–1990 academic year Harvard University, Department of Economics Visiting Professor of Economics, July 1987–March 1988 Paul Sack Associate Professor of Political Economy, July 1985–June 1987 Assistant Professor of Economics, July 1982–June 1985 Carnegie-Mellon University, School of Urban and Public Affairs Assistant Professor of Economics, September 1980–June 1982 PROFESSIONAL EXPERIENCE • Member, Lahore University of Management Sciences (LUMS) International Advisory Board (January 2018–present) • Founding Co-Editor, Journal of the Economics of Ageing (June 2012–present) • Member, Editorial Board, Demography India (2012–present) • Research Fellow, Institute of Labor Economics (IZA), Bonn, Germany (February 2012– present) • Member, Population Services International (PSI) Board of Trustees (February 2010– January 2016) • Member, John Snow Inc.
    [Show full text]
  • Year in Review
    Year in review For the year ended 31 March 2017 Trustees2 Executive Director YEAR IN REVIEW The Trustees of the Society are the members Dr Julie Maxton of its Council, who are elected by and from Registered address the Fellowship. Council is chaired by the 6 – 9 Carlton House Terrace President of the Society. During 2016/17, London SW1Y 5AG the members of Council were as follows: royalsociety.org President Sir Venki Ramakrishnan Registered Charity Number 207043 Treasurer Professor Anthony Cheetham The Royal Society’s Trustees’ report and Physical Secretary financial statements for the year ended Professor Alexander Halliday 31 March 2017 can be found at: Foreign Secretary royalsociety.org/about-us/funding- Professor Richard Catlow** finances/financial-statements Sir Martyn Poliakoff* Biological Secretary Sir John Skehel Members of Council Professor Gillian Bates** Professor Jean Beggs** Professor Andrea Brand* Sir Keith Burnett Professor Eleanor Campbell** Professor Michael Cates* Professor George Efstathiou Professor Brian Foster Professor Russell Foster** Professor Uta Frith Professor Joanna Haigh Dame Wendy Hall* Dr Hermann Hauser Professor Angela McLean* Dame Georgina Mace* Dame Bridget Ogilvie** Dame Carol Robinson** Dame Nancy Rothwell* Professor Stephen Sparks Professor Ian Stewart Dame Janet Thornton Professor Cheryll Tickle Sir Richard Treisman Professor Simon White * Retired 30 November 2016 ** Appointed 30 November 2016 Cover image Dancing with stars by Imre Potyó, Hungary, capturing the courtship dance of the Danube mayfly (Ephoron virgo). YEAR IN REVIEW 3 Contents President’s foreword .................................. 4 Executive Director’s report .............................. 5 Year in review ...................................... 6 Promoting science and its benefits ...................... 7 Recognising excellence in science ......................21 Supporting outstanding science .....................
    [Show full text]
  • Bridge Linking Engineering and Society
    Summer 2016 ISSUES AT THE TECHNOLOGY/ POLICY INTERFACE The BRIDGE LINKING ENGINEERING AND SOCIETY In Plain View: A Transparent Systems Approach for Enhancing Health Policy Decisions Guru Madhavan, Charles E. Phelps, Rita R. Colwell, Rino Rappuoli, and Harvey V. Fineberg Thinking Big to Address Major Challenges: Design and Problem-Solving Patterns for High- Impact Innovation Joseph V. Sinfield and Freddy Solis The Corrosion Crisis in Flint, Michigan: A Call for Improvements in Technology Stewardship John R. Scully NACE International’s IMPACT Study Breaks New Ground in Corrosion Management Research and Practice Gretchen A. Jacobson Charging Mechanisms for Road Use: An Interface between Engineering and Public Policy Bismark R. Agbelie, Samuel Labi, and Kumares C. Sinha Leveraging Technology in the Coteaching Model for STEM Education Kelly J. Grillo, Jane Bowser, and Tanya Moorehead Cooley Electric Power and DC’s Renaissance Lionel O. Barthold and Dennis A. Woodford The mission of the National Academy of Engineering is to advance the well-being of the nation by promoting a vibrant engineering profession and by marshalling the expertise and insights of eminent engineers to provide independent advice to the federal government on matters involving engineering and technology. The BRIDGE NATIONAL ACADEMY OF ENGINEERING Charles O. Holliday, Jr., Chair C. D. Mote, Jr., President Corale L. Brierley, Vice President Thomas F. Budinger, Home Secretary Ruth A. David, Foreign Secretary Martin B. Sherwin, Treasurer Editor in Chief: Ronald M. Latanision Managing Editor: Cameron H. Fletcher Production Assistant: Penelope Gibbs The Bridge (ISSN 0737-6278) is published quarterly by the National Aca d emy of Engineering, 2101 Constitution Avenue NW, Washington, DC 20418.
    [Show full text]