PROCEEDINGS OF
RESEARCH CONFERENCE
Fifty-Sixth Annual Report
2011
Compiled and Edited By: Dr. Nick Gawel Tennessee State University School of Agriculture and Consumer Sciences Nursery Research Center 472 Cadillac Lane McMinnville, TN 37110
SNA Research Conference Vol. 56 2011
56th Annual Southern Nursery Association
Research Conference Proceedings 2011
Southern Nursery Association, Inc. 894 Liberty Farm Road, Oak Grove, VA 22443 Phone/Fax: (804) 224-9352 [email protected]
www.sna.org
Proceedings of the SNA Research Conference are published annually by the Southern Nursery Association.
It is the fine men and women in horticultural research that we, the Southern Nursery Association, pledge our continued support and gratitude for their tireless efforts in the pursuit of the advancement of our industry.
Additional Publication Additional Copies: 2011 CD-Rom Additional Copies: SNA Members $15.00* Horticultural Libraries $15.00* Contributing Authors $15.00* Non-Members $20.00* *includes shipping and handling
© Published August, 2011
ii SNA Research Conference Vol. 56 2011
Southern Nursery Association, Inc.
BOARD OF DIRECTORS
President Phone: (770) 953-3311 Randall Bracy Fax: (770) 953-4411 Bracy's Nursery, LLC 64624 Dummyline Rd. Director Chapter 4 Amite, LA 70422 Jeff Howell Voice: (985) 748-4716 Rocky Creek Nursery Fax: (985) 748-9955 229 Crenshaw Rd. [email protected] Lucedale, MS 39452 (601) 947 - 3635 Vice President/Treasurer [email protected] Director Chapter 3 Bill Boyd Immediate Past President Flower City Nurseries George Hackney P.O. Box 75 Hackney Nursery Company Smartt, TN 37378 3690 Juniper Creek Road Voice: (931) 668-4351 Quincey, FL 32330 [email protected] Voice: (850) 442-6115 Fax: (850) 442-3492 Director Chapter 1 [email protected] Eelco Tinga, Jr. Tinga Nursery, Inc. Executive Vice President (Interim) 2918 Castle Hayne Rd. Karen Summers Castle Hayne, NC 28429 Southern Nursery Association Voice: (910) 762-1975 894 Liberty Farm Road Fax: (910) 763-4231 Oak Grove, VA 22443 [email protected] Phone: 804.224.9352 Director Chapter 2 Mobile: 804.214.5303 Richard May [email protected] Southern Nursery Association 2498 Jett Ferry Road, Suite 201 Atlanta, GA 30338
RESEARCH CONFERENCE
Director of Horticultural Co-Chairman Research & Chairman Dr. Nick Gawel Dr. Donna Fare Tennessee State University USDA/ARS/FNPRU Nursery Research Center TSU Nursery Research Center 472 Cadillac Lane 472 Cadillac Lane McMinnville, TN 37110 McMinnville, TN 37110 [email protected] [email protected]
iii SNA Research Conference Vol. 56 2011
Acknowledgments
The Editor and Board of Directors of the Southern Nursery Association wish to express their sincere appreciation to Derald Harp, Cheryl Boyer, Scott W. Ludwig, Jean Woodward, Marco Palma, Gary Bachman, Gene Blythe, Yan Chen, Amy Wright, Guihong Bi, Donna Fare, Matthew Chappell and Mengmeng Gu for the fine job they did as Section Editors and Moderators. Thanks go to Gary Bachman for his efforts in selecting and instructing judges and Moderating the Bryson L. James Student Research Competition. Our very special thanks goes to Holly Hodges who spent many hours helping the Editor organize the program, and most importantly, preparing the manuscripts for publication. Without the efforts of all these people, the conference would not happen and this year’s Proceedings would not be published.
Special thanks are extended to the sponsors of the 2011 SNA Research Conference, Bennett’s Creek Nursery, Lancaster Farms, and the Horticultural Research Institute. Without the financial contributions of these sponsors, the conference could not be held. We would also like to thank the Gulf States Horticultural Expo for providing the venue and additional support for the 2011 SNA Research Conference.
We extend our gratitude to all the researchers and nurserymen who attended the 56th Annual SNA Research Conference and/or contributed to these Proceedings. You make this annual event a success.
Notice
Mention of a trademark name on a proprietary product does not constitute a guarantee and/or warranty of the product by the researcher(s) or their respective universities or the Southern Nursery Association and does not imply its approval to the exclusion of other products that may also be suitable.
Permission to reprint articles and quotations of portions of this publication is hereby granted on condition that full credit be given to both the author(s) and the publication, Proceedings of the SNA Research Conference, along with the date of the publication.
The Southern Nursery Association is not responsible for the statements and opinions printed in the Proceedings of the SNA Research Conference; they represent the views of the author(s).
iv SNA Research Conference Vol. 56 2011
Using Research Data Safely and Effectively
Good research is conducted under an exact set of controlled conditions, varying only the specific treatments which are to be evaluated. Results from the specific treatments are directly applicable to your operations only if all the conditions in your operation are controlled the same as in the research. Unfortunately, this seldom happens. However, this does not mean that you cannot benefit from the research. What it does mean is that you should use the research information on a trial basis if your plant species, soil type, watering method, size and age of plant, climatic region, etc. is different than that described by the researcher.
What an alert grower should expect to gain from these research reports is ideas – ideas as to the best control for insects, disease, nematodes and weeds – labor saving ideas such as chemical pruning and using growth regulators to minimize maintenance. Also, ideas on water management, nutrition, alternative growing media, new plants for landscaping and guides for improving profits and marketing skills can also be found.
Should you desire additional information on any report, please contact the author.
v SNA Research Conference Vol. 56 2011
THE PORTER HENEGAR MEMORIAL AWARD
for
HORTICULTURAL RESEARCH
The Southern Nursery Association (SNA) has honored Dr. Winston C. Dunwell, Extension Profesor of Horticulture at the University of Kentucky with the Porter Henegar Memorial Award during the 56th Annual SNA Research Conference. Dr. Gary Knox, a past winner of the award, made the presentation during the SNA Research Conference.
Originally known as the Research Award of Merit, the recognition was created in 1968 to honor those individuals who have made outstanding contributions to ornamental horticulture research and specifically to members of the association. In 1972, the award was renamed the Porter Henegar Memorial Award in honor of one of SNA’s former Executive Secretaries. Nominations are made each year by the SNA’s Director of Research and past award winners.
Dr. Winston Dunwell was born on Long Island in Southampton, NY . He grew up in East Quogue, NY where farming consisted of horticultural crops. He attended the State University of New York at Farmingdale and received his Associates Degree in Nursery Management. Following 4 years in the US Air Force he attended the University of Wyoming and received his Bachelors of Science in Plant Science/Horticulture. He earned his Ph.D. at the University of Idaho where he worked on the effects of cold stress on Ornamental Plants.
In 1979 Win accepted a position with The University of Kentucky as an Extension Horticulture Specialist for Nursery Crops. His area of interest is developing educational programs related to sustainable ornamental plant introduction, propagation, production, and utilization. Dr. Dunwell established the Nursery Crops Development Center to carry out trials on cultivated and native plants with unique characteristics of special interest to the nursery/landscape industry and the gardening public. The goal of the Center is to provide plants that will increase the product mix at the nursery, increase the number of plants available for the landscape designer's pallette, and be useful in environment conservation and restoration.
vi SNA Research Conference Vol. 56 2011
The Bryson L. James Student Research Competition 2011 Awards This long-standing program was renamed in August 1989, in honor of Dr. Bryson L. James, longtime Director of Horticultural Research for the Southern Nursery Association. As Dr. James has been an active participant and leader in the annual Research Conference for more than 50 years, the award, named in his honor, is a tribute to his tireless efforts on behalf of the researchers, the association and the industry. Listed below are guidelines for the Student Competition as well as this year's winners:
1. Any student of a university or a college Competition and to the appropriate "topic" having researchers that participate in the Section Editor no later than the specified Southern Nursery Association Research deadline. Conference, are not more than one (1) academic year removed from graduation 5. The paper must follow the guidelines for and whose research was completed prior format and subject matter as stated in the to graduation are eligible to compete. Call For Titles for the SNA Research Conference. 2. Research is to be that of the presenter and a part of his/her educational studies. 6. Student and advisor should be listed as Contract work, unless a part of a thesis or co-authors. classroom report (credit given), is not acceptable, as it may provide unlimited 7. Oral presentation must be limited to funding and an unfair advantage. seven (7) minutes. An additional three (3) minutes will be allotted for questions. A 3. The number of student papers from a penalty of two (2) points per minute or part single university or college may be limited, thereof for every minute over seven (7) should time restraints dictate. minutes will be assessed.
4. The student must have submitted a title to 8. Judging shall be based on preparation of the SNA Conference Editor by the the paper (50 points) and oral deadline specified in the Call For Titles. presentation (100 points) for a total of 150 The paper should then be submitted both points. to the Section Editor for the Student
2011 Bryson L. James Student Competition Award Winners
M.S. Candidates
1st Place Tyler Weldon Auburn University 2nd Place Cody W. Kiefer Auburn University 3rd Place Elizabeth Nyberg Clemson University
Ph.D. Candidates
1st Place Amanda Bayer University of Georgia 2nd Place Diana Cochrane Mississippi State University 3rd Place Jongyun Kim University of Georgia
vii SNA Research Conference Vol. 56 2011
Table of Contents
Origin Page(s) Title and Author(s)
Weed Control
MS 2-7 Effect of spent coffee grounds on germination of palmer amaranth, perennial rye, and white clover. Diana R. Cochran, Patricia R. Knight, and Mengmeng Gu
AL 8-10 Postemergence Control of English Ivy (Hedera Helix). Qian Yang, G. R. Wehtje and C. H. Gilliam
Plant Breeding and Evaluation
TN 12-15 Inheritance of Pink Flower Color in Styrax japonicus. Sandra M. Reed
TX 16-20 Seed Stratification, Germination, and Greenhouse Performance of Diverse Rosa Species. Xinwang Wang, Masum Akond, Raul Cabrera, and James A. Reinert
TN 21-23 Identification of Mechanisms for Cold Tolerance in Helleborus orientalis Lam. Zong Liu, Roger Sauve, Suping Zhou
Growth Regulators
TN 25-27 Effects of Plant Growth Regulators on Growth and Reproduction of Humulus lupulus. Chad Rowland and Roger Sauve
GA 28-34 Unexplained Wilting of Tomatoes after Exposure to Large Doses of Exogenous Abscisic Acid (ABA). Manuel G. Astacio and Marc van Iersel
Floriculture
TX 36-40 Influence of Storage Temperature on the Viability of Crape Myrtle (Lagerstroemia) Pollen. Masum Akond, Cecil Pounders, and Xinwang Wang
TX 41-45 Growth and Quality of Greenhouse Roses Subjected to Partial Rootzone Stresses. Raúl I. Cabrera
GA 46-51 Physiological Responses of Petunia to Different Levels of Drought Stress. Jongyun Kim, Anish Malladi, and Marc van Iersel
OR 52-56 The Effect of Organic Fertilizer Formulation and Rate on Greenhouse Transplant Production of Petunia. Sarah Sydow, James S. Owen, Jr., Heather M. Stoven, and Brian Krug
AL 57-60 Corncob as a Substitute for Perlite in Greenhouse Production. Tyler L. Weldon, Glenn B. Fain, Jeff L. Sibley, and Charles H. Gilliam
MS 61-63 Effects of Organic Fertilizers on Chrysanthemum nakingense. Yan Zhao, Guihong Bi, and Mengmeng Gu
TN 64-66 Selection of Gardenia Variants from Seeds. Suping Zhou, Sarabjit Bhatti, Roger Sauve, Jing Zhou, Zong Liu, and Brian D. Copeland viii
SNA Research Conference Vol. 56 2011
Table of Contents
Origin Page(s) Title and Author(s)
Entomology
LA 68-71 Effects Of Plant Age and Cultivar on Western Flower Thrips Damage Threshold for Impatiens wallerana. Yan Chen, Richard Story, Roger Hinson, and Allen D. Owings
NC 72-74 Fall and spring insecticide drenches to manage azalea lacebugs. Steven D. Frank
TN 75-84 Gleanings from a Five State Pest Management Strategic Plan and Crop Profile. Amy Fulcher, Craig Adkins, Greg Armel, Matthew Chappell, J.C. Chong, Steven Frank, Frank Hale, Kelly Ivors, William Klingeman III, Anthony LeBude, Joe Neal, Andrew Senesac, Sarah White, Jean Williams-Woodward, and Alan Windham
FL 85-88 Approaches in the Southern Region to Research and Extension for Sustainable Landscape Plant Production, Use and Pest Management. Gary W. Knox and Russell F. Mizell, III
TX 89-91 Chemical Control of Armored Scales. Scott W. Ludwig
MS 92-96 A New Method for Monitoring Strawberry Rootworm Populations in Nurseries. C. T. Werle and B. J. Sampson
NC 97-103 The black pearl pepper banker plant for biological control of thrips in greenhouses. Sarah Wong and Steven D. Frank
AL 109-113 Phenology Gardens in Alabama: Application of Plant Phenology to Pest Management. Raymond Young and David Held
Economics and Marketing
IN 115-120 An Analysis of Consumer Preference for Sustainably Produced Bedding and Potted Flowering Plants. Joyia T. Smith, Jennifer H. Dennis, and Roberto G. Lopez
FL 121-122 The State of the Green Industry: National Nursery Survey Results. Alan Hodges, Charlie Hall, and Marco Palma
MS 123-126 Color and Taste: Consumer Perceptions of Flavor. Christine E. H. Coker, Wes Schilling, and Mike Ely
GA 127-130 Rural Retail Lawn & Garden Market Benchmarks. Forrest Stegelin
TN 131-132 Economic Challenges Facing Nursery Growers in Warren County, Tennessee. F. Tegegne, S. P. Singh, E. Ekanem, and P. Dharma
Water Management
GA 134-138 Growth of ‘Panama Red’ Hibiscus in Response to Substrate Water Content. Amanda Bayer, Imran Mahbub, Matthew Chappell, John Ruter, and Marc van Iersel
ix
SNA Research Conference Vol. 56 2011
Table of Contents
Origin Page(s) Title and Author(s)
SC 139-145 Phosphorus Acquisition and Remediation of Simulated Nursery Runoff Using Golden Canna (Canna flaccida) in a Floating Wetland Mesocosm Study. J. Brad Glenn, Elizabeth T. Nyberg, Jonathan J. Smith, and Sarah A. White
TX 146-151 Salt Tolerance of Selected Bedding Plants. Genhua Niu and Denise S. Rodriguez
TX 152-156 Salt Tolerance of Five Wildflower Species. Genhua Niu, Denise S. Rodriguez, Cynthia McKenney
SC 157-161 Ecological Disinfestation: Evaluation of Substrates for Removal of Zoospores of Phytophthora nicotianae From Water. Elizabeth T. Nyberg, Inga M. Meadows, Steven N. Jeffers, Sarah A. White
GA 162-166 Water Consumption of Hydrangea macrophylla as Affected by Environmental Factors. Lucas O'Meara, Matthew Chappell, and Marc W. van Iersel
GA 167-172 Growth of Petunia as Affected by Substrate Moisture Content and Fertilizer Rate. Alem Peter, Paul A. Thomas, and Marc W. van Iersel
GA 173-179 Substrate Water Content Dynamics in Nurseries: Real-Time Monitoring Can Improve Irrigation Practices. Marc van Iersel, Will Ross, Sue Dove, Matthew Chappell, Paul Thomas, John Ruter, and Sherryl Wells
SC 180-186 Time-Course Nutrient Uptake by Three-Plant Species Established in Floating Wetlands. Sarah A. White, Jonathan J. Smith, Elizabeth T. Nyberg, J. Brad Glenn
Brazil 187-191 Monitoring And Controlling Subirrigation With Soil Moisture Sensors: A Case Study With Hibiscus. Rhuanito Soranz Ferrarezi and Marc W. van Iersel
Pathology and Nematology
MS 193-199 Determine the Efficacy of Biological Fungicides for Control of Pythium Stem and Root Rot in Poinsettia. Mengmeng Gu, Maria Tomaso- Peterson, Yan Zhao
TN 200-203 Survey for Bacterial Pathogens in Creeks at the Collins River Subwatershed. C. Korsi Dumenyo, Caleb Kersey, Sam Dennis, and Debbie Eskandarnia
AL 204-211 Organic Fungicides Compared for Foliar Disease Control on crape myrtle and hydrangea. A. K. Hagan, J. R. Akridge, J. W. Olive and J. Stephenson
AL 212-214 Reaction of Ornamental Switchgrass (Panicum virgatum) selections to rust and anthracnose. A. K. Hagan, J. R. Akridge, and K. L. Bowen
x
SNA Research Conference Vol. 56 2011
Table of Contents
Origin Page(s) Title and Author(s)
AL 215-217 Control of Rust on Panicum (switchgrass) with fungicides. A. K. Hagan and J. R. Akridge
TN 218-224 Perpetuation of Cherry Leaf Spot Disease in Flowering Cherry. Jacqueline Joshua, Margaret T. Mmbaga and Lucas A. Mackasmiel
TN 225-229 Efficacy and Methods of Application of Biological Control Agents Against Powdery Mildew in Dogwood. Mackasmiel, L. A., and Mmbaga, M. T.
TN 230-234 Spatial Analysis of Phytophthora Diseases in Nursery Production System in Warren County, TN. Katherine Kilbourne, Margaret Mmbaga and Robert Harrison
Container Grown Plant Production
KS 236-240 Cedar Substrate Particle Size Affects Growth of Container-Grown Rudbekia. Zachariah Starr, Cheryl Boyer, Jason Griffin
NC 241-245 Cotton Amended Substrates: Wrinkle Free? Elizabeth D. Bridges, Helen T. Kraus, Brian E. Jackson, and Ted E. Bilderback
KY 246-249 Differences in Pour-through Results from Two Plant Species and a No- plant Control. Winston Dunwell, Carey Grable, Dwight Wolfe, and Dewayne Ingram
AL 250-253 Allelopathic Influences of Fresh and Aged Pine Needle Leachate on Germination of Lactuca sativa. Whitney G. Gaches, Glenn B. Fain, Donald J. Eakes, Charles H. Gilliam, and Jeff L. Sibley
AR 254-259 Parboiled Rice Hulls Effect on Physical Properties of Amended Pine Bark Substrates During Long-term Nursery Crop Production. Celina Gómez and James Robbins
OR 260-265 Response of Containerized Hydrangea macrophylla 'Endless Summer' to a Mineral-polyacrylate Substrate Amendment and Reduced Overhead Water Application. Michael T. Kapsimalis, James S. Owen, Jr. and Heather M. Stoven
AL 266-269 Use of Neem Cake as an Organic Substrate Component. Cody W. Kiefer, Jeff L. Sibley, Dexter B. Watts, H. Allen Torbert, Glenn B. Fain, Charles H. Gilliam
OR 270-273 Non-Chemical Solutions To Reduce Root Escape In Pot-In-Pot Nursery Production. Jimmy Klick, James S. Owen, Jr. and Heather M. Stoven
NC 274-276 Pine Tree Substrate Properties: Before and After Production. Emily Lumpkin, Brian Jackson, Helen Kraus, Bill Fonteno, and Ted Bilderback
FL 277-282 Pruning Effects on Trade #3 Viburnum odoratissimum Growth and Leaf Area. Jeff Million, Tom Yeager and Joseph Albano
AL 283-287 Fertilizer Effects on Annual Growth in Sweetgum, Hickory, and Cedar Substrates. Anna-Marie Murphy, Charles H. Gilliam, Glenn B. Fain, Tom V. Gallagher, H. Allen Torbert, and Jeff L. Sibley
xi
SNA Research Conference Vol. 56 2011
Table of Contents
Origin Page(s) Title and Author(s)
AR 288-291 Evaluation of Eight Slow-release Fertilizers on the Growth of Container- grown Spiraea x bumalda L. ‘Anthony Waterer’. James Robbins and Celina Gomez
KS 292-296 Cedar Substrate Particle Size Affects Growth of Container-Grown Rudbekia. Zachariah Starr, Cheryl Boyer, Jason Griffin
VA 297-299 Pine Tree Substrate pH as Affected by Storage Time and Lime and Peat Moss Amendments. Linda L. Taylor, Alex X. Niemiera, and Robert D. Wright
AL 300-302 Utilization of Potato Sludge Waste as a Substrate Amendment in Horticulture Crop Production. Matthew S. Wilson and Jeff L. Sibley
Landscape
TX 304-307 Growth and Flowering Responses of Three Novel Landscape Plants to Summer Shade Levels in Central Texas. Michael A. Arnold, Andrew R. King, and Sean T. Carver
MS 308-311 Effects of Pre-plant Compost and Subsequent Fertigation on Landscape Performance of Organically-grown Marigold. Guihong Bi, William B. Evans, Mengmeng Gu and Vasile Cerven
TX 311-321 Evaluation of Landscape Plants for Use on Green Roofs in the Texas Gulf Coast Area. Anthony W. Camerino, Carol S. Brouwer and Astrid Volder
LA 322-327 Fertilizer Regimes during Production Affect Coleus Growth and Quality in the Landscape. Yan Chen, Allen Owings, Regina Bracy
GA 328-335 Market Demand for Smilax smalli? A Survey of Design Use in the South. Brad E. Davis
TN 336-340 Does potting depth of container grown maples affect landscape performance? Donna C. Fare
AL 341-344 Effect of Repeated Short Interval Flooding on Growth of Four Native Shrub Taxa. Kaye Jernigan and Amy Wright
AL 345-350 Soil Carbon as Affected by Horticultural Species and Growth Media. S. Christopher Marble, Stephen A. Prior, G. Brett Runion, H. Allen Torbert, Charles H. Gilliam, Glenn B. Fain, Jeff L. Sibley, and Patricia R. Knight
TX 351-357 Impact of Post-establishment Applied Organic Mulch on Gas Exchange and Growth of Two Oak Tree Species. Thayne Montague, Cynthia McKenney, Kaylee Decker
LA 358-360 LSU AgCenter People’s Choice Landscape Award Winners – Spring 2010. Allen Owings, Yan Chen, Roger Rosendale and Regina Bracy
FL 361-367 Landscape Performance and Invasive Potential of 12 Ligustrum sinense, Ligustrum lucidum and Ligustrum japonicum Cultivars Grown in North and South Florida. Sandra B. Wilson and Gary W. Knox
xii
SNA Research Conference Vol. 56 2011
Table of Contents
Origin Page(s) Title and Author(s)
NC 368-374 Evaluation of Evergreen Acer at the JC Raulston Arboretum. Mark Weathington
KS 374.1-374.4 Irrigation Frequency Affects Growth and Photosynthetic Capacity of Four Conifer Species.Joshua Pool, Jason Griffin, Cheryl Boyer, and Stuart Warren
Plant Propagation
NC 376-377 Grafting Fraser fir (Abies fraseri): Effect of Grafting Date, Shade, and Irrigation. Haley Hibbert-Frey, John Frampton, Frank A. Blazich, and L. Eric Hinesley
NC 377-384 Grafting Fraser fir (Abies fraseri): Effect of Scion Origin (Crown Position and Branch Order). Haley Hibbert-Frey, John Frampton, Frank A. Blazich, Doug Hundley, and L. Eric Hinesley
MS 382-384 Softwood Cutting Propagation of Agastache and Buddleja Using IBA and IBA+NAA Solutions. Eugene K. Blythe
AL 385-388 Improving the Success of Microcutting Establishment from Native Azaleas. K.L. Bowen
Mexico 389-392 Effect of Cell Size on Growth and Physiology of Mexican Fan Palm (Washingtonia robusta H. Wendland: Arecaceae) Seedlings. Andrés Adolfo Estrada-Luna; Horacio Claudio Morales Torres; Victor Olalde- Portugal; Esteban Camarena Olague; Carlos Romero González
AR 393-396 Rooting of Two Woody Ornamental Plants in Eight Propagation Substrates. Celina Gómez and James Robbins
MS 397-402 Direct Seed Germination Methods for Assessing Phytotoxicity of Alternative Substrates. Anthony L. Witcher, Eugene K. Blythe, Glenn B. Fain, Kenneth J. Curry and James M. Spiers
Engineering, Structures and Innovations
TN 404-410 Biomass Productivity Potential by Selected Cellulosic Herbaceous Perennials in Acid Impacted Soil. E. Kudjo Dzantor, Vallaban Murugesan, Roger Painter and Dafeng Hui
Mexico 411-414 Design and Construction of a Machine for Grafting Prickly-pear Cactus (Opuntia spp., Cactaceae) cladodes. Andrés Adolfo Estrada-Luna; Francisco Javier Martínez Serrano; Sergio Ortiz Mendoza; Manuel Domingo Vargas Aguayo, Carlos Patricio Achurra Sánchez
TN 415-420 Elucidating Rhizodegradation for Use in Phytoremediation of Synthetic Pyrethroids. Le, X., D1. Hui, and E.K. Dzantor
MS 421-428 Demonstration Results From Greenhouse Heating with Liquified Wood. Philip Steele, Don Parish and Jerome Cooper
AL 429-432 Integration of Aquaculture Waste with Horticulture Crop Production. Jeremy M. Pickens, Jesse A. Chappell, Jeff L. Sibley, Adam M. Sleeper, Wheeler G. Foshee and Sami Abdul Rhaman
xiii SNA Research Conference Vol. 56 2011
Weed Control
Mengmeng Gu Section Editor and Moderator
Weed Control 1
SNA Research Conference Vol. 56 2011
Effect of spent coffee grounds on germination of palmer amaranth, perennial rye, and white clover
Diana R. Cochran1, Patricia R. Knight2, and Mengmeng Gu1 1117 Dorman Hall, Mississippi State University, Mississippi State, MS 39762 2Coastal Research and Extension Center, Mississippi State University, Biloxi, MS 39532
Index Words: coffee residue, coffee, organic weed control
Significance to Industry: Spent coffee grounds (SCG), are the coffee residues after the brewing process, which are considered municipal solid waste and normally end up in landfills. There is a vast amount of SCG available locally and from the bottled and canned coffee manufactures. Many coffee shops across the United States have programs where they give free SCG to their patrons making SCG a low cost by-product available for the green industry.
Nature of Work: In 2005, individuals consumed 24.2 gallons of coffee per year in the United States alone (2). While this per capita is based on liquid consumption it does not account for the solid waste or coffee residue after the brewing process. It is estimated that the daily volume of coffee residue is 0.91 kg for each kilogram of soluble coffee (12). In 2006/2007 world coffee production was estimated at 134.3 million bags, over 8 billion kg (9).
Previous research has suggested that SCG can be used as alternative fuels (8), soil additives (12), metal adsorbents (10), vermicompost (6), landscape compost (5), mulch (4), and organic weed control (7). Morikawa and Saigusa (5) composted SCG with ferrous sulfate for 60 days in plastic bags. Their findings showed that this compost combination decreased pH in alkaline soils, increasing plant available Fe. Additionally, mulching with coffee husk has shown to conserve soil moisture enough to significantly promote vegetative growth in pineapples when moisture is a limiting factor (4). Subsequently, coffee husk mulch had 85.5% weed control compared to the non- weeded/non-mulched control. Studies conducted by Sciarrappa et al., (7) showed that mulching with SCG to a depth of 1.6 – 3.1” provided 95% weed control in organic blueberry production.
Local Starbucks® coffee shops in Starkville, MS provided SCG. Experiment 1 - Effect of aqueous coffee extract (ACE) on seed germination. Treatments included 4 concentrations of ACE and reverse osmosis water (RO) was used as control. Stock ACE was developed by mixing 231 g of spent coffee grounds with 600 mL of water and stirring for 48 hours on a stirrer plate (Corning Stirrer/Hotplate). The coffee solution (pH5.39, EC1.69 dS/m) was then filtered through cheese cloth. The ACE of various concentrations were formulated in 100 mL beakers as following: 25 % ACE consisted of 10 mL of the stock ACE and 30 mL of RO, 50 % consisted of 20 mL of stock ACE and 20 mL of RO, 75 % consisted of 30 mL of stock ACE and 10 mL of RO, and 100 % was
Weed Control 2
SNA Research Conference Vol. 56 2011
40 mL of stock ACE. Captain fungicide was added to each treatment based on recommended label rate of 1 ½ tbs/gal (0.088 g/40 mL). Whatman® #1 filter paper was placed on the Petri dishes. Four mL of solution was added to each Petri dish to saturate the filter paper and 25 seed of Amaranthus palmeri (palmer amaranth), Lolium perenne (perennial rye), and Trifolium repens (white clover) were placed in one Petri dish (3 species, 25 seed per plate). There were five Petri dishes for each of the four ACE treatments and the control, and there were a total number of 25 Petri dishes in the experiment. All Petri dishes were placed in a growth chamber with 20°C/15°C (day/night temperatures) and 16 hour photoperiod. Petri dishes were monitored daily, adding an additional mL of the corresponding ACE solution to each plate as needed to keep seeds from drying out. Data included the germination rate and germination development (white clover only presence of radicle, 1 leaf cotyledon, 2 leaf cotyledon). A seed was considered germinated once visible change in the seed was noticed (e.g. break in seed coat, radicle emerging).
Experiment 2 - Effect of SCG and pine bark (PB) on seed germination in containers. Trade gallon containers were filled with Sunshine #1 potting mix to 3” below the top of the container and watered accordingly. White clover were overseeded at 15 seed per container (one species per container) and then mulched with either SCG or PB to a depth of 0, 0.5, 1.0, 1.5 or 3” and watered accordingly. Data collected included the number of visible weeds at 3, 6, 10, 14 and 28 days after seeding (DAS) and shoot dry weight 28 DAS. Containers without SCG or PB were used as controls. Data were analyzed utilizing SAS 9.2 generalized linear model, with mean separation according to least significant difference test, alpha = 0.05.
Results and Discussion: Experiment 1 – White clover started germinating in all treatments 1 DAS (Table 1) and the 75 % ACE had statistically less white clover germination (22 %) compared to the control (17%). At 2 and 4 DAS all ACE-treated dishes had less germination compared to the control. At 5 DAS, all ACE treatments had less white clover germination compared to the control except the 25 % ACE treatment. Seven DAS all ACE treatments had similar white clover germination compared to the control exception the 100 % ACE solution. By 8 DAS nearly all white clover had germinated in all treatments and were statistically similar. While statistically there were no differences in treatments at 8 DAS, there were visual differences. As the percentage of ACE increased, the progression of seed growth was less advanced (Table 2). At 9 DAS, 77 % of the seed treated with 75 and 100 % ACE only had emerged radicles. Only 3 % of the seed had 1 or 2 cotyledons in 100 % ACE treatment. On the other hand, 14 % of the seed were in the 1 leaf cotyledon stage and 38 % in 2 leaf cotyledon stage for the control.
Perennial rye seed started germinating 4 DAS in the 0, 25 and 50% ACE treatments (Table 3). However there were no significant differences regardless of ACE treatments. At 6, 7, and 8 DAS all treatments with ACE had significantly less perennial rye than the control. The number of germinated perennial rye seeds tended to decrease as the percentage of ACE increased, respectively.
Weed Control 3
SNA Research Conference Vol. 56 2011
Palmer amaranth treated with higher percentage of ACE had lower seed germination rate than the control (Table 4). However, germinated seed was short lived, more than likely due to the small seeds being over saturated.
Experiment 2 - For white clover there was significantly less seedlings in all treatments with mulch than the control regardless of the depth or type (Table 5). Our results were similar to Sciarappa et al. (7) who reported that mulching with SCG is an effective weed control option in field blueberry production. Comparing mulch types, 0.5 and 1.0” SCG were not significantly different from 0.5 and 1.0” PB treatments, respectively. At 14 DAS white clover started emerging in the 1.5” PB treatment, however statistically there is no difference compared to the zero emergence in 1.5” SCG treatment. No weed emergence was observed in 3” SCG or PB mulch. As of 14 DAS only a few of palmer amaranth had only germinated in the 0” mulch (data not shown).
In conclusion, initial white clover germination was observed in all ACE treatments however development of the seedlings at 8 DAS were different, respectively. These results suggest that ACE might have some properties that inhibit white clover and perennial rye growth. Mulching with either SCG or PB had less seedlings than the non- mulched treatment. Moreover, mulching in containers is a technique used by Oregon growers especially in areas or crops susceptible to herbicide damage (1). Utilizing SCG as mulch in containers can provide an organic alternative to weed control in the container nursery industry. These results are ongoing and future research will focus on evaluating container plant growth with SCG mulch and evaluating SCG as a weed barrier.
Literature Cited: 1. Altland, J. and M. Lanthier. 2007. Influence of container mulches on irrigation and nutrient management. J. Environ. Hort. 25:234-238. 2. Buzby, J.C. and S. Haley. 2007. Coffee consumption over the last century. USDA. http://www.ers.usda.gov/AmberWaves/June07/Findings/Coffee2.htm. Accessed on August 26, 2010. 3. Contreras, E.P. M. Sokolov, G. Mejia, and J.E. Sanchez. 2004. Soaking of substrate in alkaline water as a pretreatment for the cultivation of Pleurotus ostreatus. J. Hort. Sci. Biotech. 79:234-240. 4. Eshetu, T., W. Tefera, and T. Kebede. 2007. Effect of weed management on pineapple growth and yield. Eth. J. Weed Mgt. 1:29-40. 5. Morikawa, C.K. and M. Saigusa. 2008. Recycling coffee and tea wastes to increase plant available Fe in alkaline soils. Plant Soil 304:249-255. 6. Orozco, F., J. Cegarra, L. Trujillo, and A. Roig. 1996. Vermicomposting of coffee pulp using the earthworm Eisenia fetida: Effects on C and N contents and the availability of nutrients. Biol. Fertil. Soils 22:162-166. 7. Sciarappa, W., S. Polavarapu, J. Barry, P. Oudemans, M. Ehlenfeldt, G. Pavlis, D. Polk, and R. Holdcraft. 2008. Developing an organic production system for highbush blueberry. HortSci. 43:51-57.
Weed Control 4
SNA Research Conference Vol. 56 2011
8. Silva, M.A., S.A. Nebra, M.J. Machado, and C.G. Sanchez. 1998. The use of biomass residues in the Brazilian soluble coffee industry. Biomass Bioenergy 14:457-467. 9. United States Department of Agriculture. 2007 Tropical products: World markets and trade. http://www.fas.usda.gov/htp/tropical/2007/June%202007/June%20Tropical.pdf. Accessed on August 28, 2010. 10. Utomo, H.D. and K.A. Hunter. 2006. Adsorption of divalent copper, zinc, cadmium and lead ions from aqueous solution by waste tea and coffee adsorbents. Env. Tech. 27:25-32. 11. Woods, T. 2008. Trained composters perk up ground with coffee grounds. OSU Extension. http://extension.oregonstate.edu/news/story.php?SNo=545&story Type=news. Accessed on August 29, 2010. 12. Yen, W., B. Wang, L. Chang, and P. Duh. 2005. Antioxidant properties of roasted coffee residues. J. Agric. Food Chem. 53:2658-2663.
Table 1. Effect of aqueous coffee extract (ACE) concentations on germination of Trifolium repens . Germination rate (%) Treatment ACE 1 DASz 2 DAS 4 DAS 5 DAS 6 DAS 7 DAS 8 DAS 10%y 17 ax 35a 56a 60a 73a 85a 82a 2 25% 10 ab 17 b 36 b 52 ab 61 ab 84 ab 80 a 3 50% 9 ab 18 b 26 bc 37 bc 58 ab 83 ab 86 a 4 75% 3 b 8 b 17 c 26 c 62 ab 82 ab 83 a 5 100% 7 ab 13 b 22 c 36 c 44 b 49 b 77 a zDAS = days after seeding. yPercentage of the ACE stock solution. The stock solution was obtained by mixing 231 g of coffee grounds with 600 mL of water and stirring for 48 hours on a shaker plate. xMeans within a column with the same letters are not significantly different, according to least significant difference test (α=0.05).
Weed Control 5
SNA Research Conference Vol. 56 2011
Table 2. Differences in Trifolium repens grown under aqueous coffee extracts (ACE), 9 days after seeding. Seed germination development (%) Treatment ACE Radiclez Cotyledony Leafx 10%w 32.0 bv 14.4 a 37.6 a 2 25% 52.0 ab 8.8 ab 27.2 ab 3 50% 64.8 a 12.0 a 12.0 bc 4 75% 76.8 a 8.0 ab 6.4 bc 5 100% 76.8 a 3.2 b 3.2 c zRadicle = only the radicle had emerged. yCotyledon = 1 leaf cotyledon stage. xLeaf = 2 leaf cotyledon stage. wPercentage of the ACE stock solution. The stock solution was obtained by mixing 231 g of coffee grounds with 600 mL of water and stirring for 48 hours on a shaker plate. vMeans within a column with the same letters are not significantly different, according to least significant difference test (α=0.05).
Table 3. Effect of aqueous coffee extract (ACE) concentations on germination of Lolium perenne . Germination rate (%) Treatment ACE 1 DASz 2 DAS 4 DAS 5 DAS 6 DAS 7 DAS 8 DAS 10%y --2ax 10a 32a 43a 52a 2 25% - - 1a 4a 11b 24b 28b 3 50% - - 1 a 1 a 8 b 18 bc 28 b 4 75% - - 0 a 0 a 3.2 b 10 cd 15 bc 5 100%- - 0a0a0b0.8d3.2c zDAS = days after seeding. yPercentage of the ACE stock solution. The stock solution was obtained by mixing 231 g of coffee grounds with 600 mL of water and stirring for 48 hours on a shaker plate. xMeans within a column with the same letters are not significantly different, according to least significant difference test (α=0.05).
Weed Control 6
SNA Research Conference Vol. 56 2011
Table 4. Effect of aqueous coffee extract (ACE) concentations on germination of Amaranthus palmeri . Germination rate (%) Treatment ACEz 1 DAS 2 DAS 4 DAS 5 DAS 6 DAS 7 DAS 8 DAS 10%y 1ax 6a 18a 27a 14aw 24 ab 20 a 2 25% 2a 6a 8b 13b 9.6a 29a 14a 3 50% 1a 3a 10ab 6b 10a 8.8ab 7.2b 4 75% 2a 2a 2b 6b 5.6a 4b 8b 5 100%3a2a4b5b7.2a4b6.4b zDAS = days after seeding. yPercentage of the ACE stock solution. The stock solution was obtained by mixing 231 g of coffee grounds with 600 mL of water and stirring for 48 hours on a shaker plate. xMeans within a column with the same letters are not significantly different, according to least significant difference test (α=0.05). wMeans lower than the value in the previous day was due to seed mortality which may have been caused by over saturation of the seeds.
Table 5. Efficacy of spent coffee grounds (SCG) and pinebark (PB) used as mulch for control of Trifolium repens . Mulch Number of emerged seedlings Treatment Depth (inches) Type 3 DASz 6 10 14 28 FWy 1 0.0 - 2.5 ax 7.0 a 7.5 a 9.0 a 11 a 1 a 2 0.5 SCG 0.8 b 3.0 bc 3.8 bc 4.0 bc 3.8 c 0 c 3 1.0 SCG 0.0 b 0.5 d 0.8 de 1.5 de 1 d 0 c 4 1.5 SCG 0.0 b 0.0 d 0.0 e 0.0 e 0 d 0 c 5 3.0 SCG 0.0 b 0.0 d 0.0 e 0.0 e 0 d 0 c 6 0.5 PB 0.5 b 3.8 b 5.3 b 5.8 b 7.3b 1 b 7 1.0 PB 0.0 b 1.3 cd 2.5 cd 2.5 cd 4 c 0 c 8 1.5 PB 0.0 b 0.0 d 0.0 e 0.3 e 0 d 0 c 9 3.0 PB 0.0 b 0.0 d 0.0 e 0.0 e 0 d 0 c zDAS - days after seeding. yFW - fresh weight in grams. xMeans within a column with the same letters are not significantly different, according to least significant difference test (α=0.05).
Weed Control 7
SNA Research Conference Vol. 56 2011
Postemergence Control of English Ivy (Hedera Helix)
Qian Yang, G. R. Wehtje and C. H. Gilliam Auburn University, Dept. of Horticulture, Auburn, AL, 36849
Index Words: English Ivy, Weed control, Herbicides
Significance to Industry: English ivy (Hedera Helix) is an evergreen vine growing on ground or climbing the trees which origins from European. This plant is almost disease free and good shade tolerant, and it is becoming an undesirable invasive weed in landscape in 18 States and the District of Columbia. This research indicates that English Ivy can be 78% postemergence controlled by Roundup applied at 3.0 lb ae/ A in August when the plant is actively growing. 2, 4-D was also effective, Vista and Milestone were much less effective than either Roundup or 2, 4-D.
Nature of Work: The best way to control English Ivy is to pull up the plant by hand (2), but the labor cost is too expensive to apply in landscape industry. A study done in 1985 on effects of timing and rate of Roundup application on selected woody ornamentals showed Roundup (glyphosate) applied at 3.0 kg ae/ha in March provided 100% control of English Ivy. June application provided 85% control at 3.0 kg ae/ha (3). Derr did 7 treatments on June 10, 1991, including Roundup at 2.2 and 4.5 kg ae/ha, Roundup at two rates with surfactant, 2, 4-D amine at 1.1 kg ae/ha, Banvel (Dicamba) at 0.6 kg ae/ha, and Garlon (Triclopyr) at 0.6 kg ae/ha. Result shows that Roundup applied at 4.5 kg ae/ha with surfactant provided almost 100% control. Roundup applied at 4.5 kg ae/ha provided 81% control of shoot fresh weight, but only 58% control at the 2.2 kg ae/ha rate. Addition of non-ionic surfactant did not further reduce growth. Shoot fresh weights were similar with Roundup (2.2 kg ae/ha), 2, 4-D, Banvel and Garlon. Roundup at 4.5 kg ae/ha rate with surfactant also controlled the weight of old growth (1). According to the Neal and Skroch (3), they obtained 85% control of English Ivy treated with Roundup in June at 3.0 kg ae/ha; similarly, Derr obtained 81% control with Roundup at 4.5 kg ae/A. Derr’s study also introduced three other herbicide, 2, 4-D, Banvel and Garlon. They are all hormone mimic (growth regulator) herbicides. Newer herbicides, such as Milestone (aminopyralid) and Vista (fluroxypyr), have similar modes of action and possibly control English Ivy. The objective of our study was to evaluate new herbicides chemistry with Roundup and 2, 4-D for English Ivy control at varied rates.
Liners of English Ivy were potted on May 7, 2010, 2 plants in one trade gallon pot containing pine bark: sand (6: 1 volume). Herbicides were applied on August 23, 2010 to actively growing English Ivy. All pots were hand weeded before treatment. Applied herbicides included Roundup at 3.0, 2.0, 0.15, 0.95, 0.53, and 0.3 lb ae/acre; 2, 4-D amine at 2.0, 1.34, 1.0, 0.63, 0.35, and 0.2 lb ae/acre; Vista at 0.5, 0.34, 0.25, 0.16, 0.09, and 0.05 lb ea/acre; and Milestone at 0.25, 0.17, 0.11, 0.08, 0.045, and 0.025 lb
Weed Control 8
SNA Research Conference Vol. 56 2011
ae/acre. Herbicides were applied as overhead foliar spray to English Ivy using a spray table delivering 30.1 GPA (Gallons per Acre) with Teejet 8002vs flat fan nozzles. The irrigation system was cut off until 24 hours after treatment. Plants were randomized and maintained outdoor under 40% shade cover and sprinkler irrigation system. The irrigation rate was 0.25 inch applied twice daily. Plant injury was rated at 7 (Aug 30), 15 (Sep 7), 30 (Sep 23), 45 (Oct 8) days after treatment. On a scale 1 to 10, 1 =no injury, 3 = distortion in terminal growth, 5 =burned growth and 10 =dead plant. Fresh shoot weights were recorded at 52 days (Oct 15) after treatment. Results were subjected to analysis variance with mean separation using the Least Significant Difference Test at p= 0.05.
Result and Discussion English Ivy control with Roundup at 3.0 lb ae/A was the best of the four herbicides, and the results varied with applied rates (Table 1). Roundup at 3.0 lb ae/A provided 78% control at 53 days after treatment, while 2.0 lb ae/ A provided 71% control. English Ivy injury declined as the rate of Roundup application declined. Visual injury data followed a similar trend as the fresh weight. 2, 4-D provided approximately 60% control at rate≥ 1.34 lb ae/A. According to the LSD, there is no significant difference when 2, 4-D rate ranges from 0.35 to 2.00 lb ae/A. The visual injury also increased with increasing 2, 4-D rates. Vista provided poor control, and no effect for most rates application except 0.50 lb ae/A. Milestone also provided only poor control, and no significant different between all rates.
Overall, both Roundup and 2, 4-D provided fairly good postemergence control of actively growing English Ivy when applied in August. Conversely, Vista and Milestone were largely ineffective. The mean of each herbicide indicated 2, 4-D provided average best control in the four herbicides evaluated, while Roundup at 3.0 lb ae/A provided the highest individual treatment control.
Literature Cited 1. Derr, J. F. 1993 English ivy (Hedera Helix) response to postemergence herbicides. J. Environ. Hort. 11(2): 45-48. 2. Matthew, S. B. and Christopher, W. B. 2007. Effect of method of English Ivy removal and seed addition on regeneration of vegetation in Southeastern Piedmont Forest. Amer. Midland Natl. 158(1): 206-220. 3. Neal, J. C. and W.A. Skroch. 1985. Effects of timing and rate of glyphosate application on toxicity to selected woody ornamentals. J. Amer. Soc. Hort. Sci. 110: 860-864.
Weed Control 9
SNA Research Conference Vol. 56 2011
Table1 Performance of selected herbicide treatment on English Ivy control
Teatment Plant Injury F.W.x Controlv Herbicide Rate(ae/Az) 7DATy 15DATy 30DATy 45DATy (g) (%) Control 0 1.0w 1.0 1.0 1.0 68 0u
Roundup 0.30 2.2 2.6 1.8 1.0. 70 0 0.53 2.2 2.8 1.6 1.0 60 11 0.95 1.8 3.0 2.4 1.8 36 46 1.50 2.4 3.4 3.2 3.6 33 51 2.00 2.6 4.2 3.4 4.2 19 71 3.00 3.0 4.6 4.4 5.6 15 78 Mean 2.4 3.4 2.8 2.9 39 42
2, 4-D 0.20 1.8 1.0 1.6 1.0 48 29 0.35 2.2 2.0 1.8 1.0 44 35 0.63 1.8 1.4 1.8 2.4 36 47 1.00 2.2 2.2 2.0 3.2 36 46 1.34 2.8 2.6 3.0 5.0 26 61 2.00 2.2 2.4 3.0 5.2 28 59 Mean 2.2 1.9 2.2 3.0 36 46
Vista 0.05 2.0 1.6 1.2 1.0 68 0 0.09 2.0 1.6 1.6 1.0 55 19 0.16 1.8 1.6 1.0 1.0 62 9 0.25 2.2 2.6 1.6 1.0 72 0 0.34 2.0 2.2 1.4 1.0 45 33 0.50 2.6 3.0 2.4 2.0 37 45 Mean 2.1 2.1 1.5 1.2 57 17
Milestone 0.025 2.0 1.4 1.2 1.8 41 40 0.045 1.8 1.1 1.2 1.0 58 14 0.08 2.0 1.0 1.4 1.6 50 26 0.11 1.2 0.4 1.2 1.0 45 34 0.17 2.0 0.7 1.2 1.2 49 28 0.25 2.0 0.7 1.2 1.6 51 25 Mean 1.8 1.7 1.2 1.4 50 28 t LSD0.05 0.9 0.9 0.7 1.0 19 28 zae/A= pounds of active equivalents per acre yDAT= days after treatment xF.W.= fresh weight in grams at 53 days after treatment. wMeans of five replications of visual rating, 1= no injury; 3= distortion in terminal growth 5= burned termin vControl %= non-treated weight-treated weight)/ non-treated weight* 100. uNo control, fresh weight higher than, or equal to the control. tValue for comparison between any two individual treatments within a column.
Weed Control 10
SNA Research Conference Vol. 56 2011
Plant Breeding and Evaluation
Matthew Chappell Section Editor and Moderator
Plant Breeding and Evaluation 11
SNA Research Conference Vol. 56 2011
Inheritance of Pink Flower Color in Styrax japonicus
Sandra M. Reed
USDA, ARS, U.S. National Arboretum, Floral and Nursery Plants Research Unit TSU Nursery Research Center, 472 Cadillac Lane, McMinnville, TN 37110
Index Words: Japanese snowbell, breeding
Significance to Industry: Combining pink flower color and other ornamental traits, such as weeping plant form, in Styrax japonicus Sieb. et. Zucc. could result in superior cultivars for the market. Because efforts to transfer pink flower color from ‘Pink Chimes’ via controlled pollinations have not been successful, it has been speculated that the deep pink flower color of this cultivar is chimeral in nature. By producing and examining ‘Pink Chimes’ selfed progeny, this study demonstrated that the deep pink color of ‘Pink Chimes’ flowers is heritable and that a breeding effort to combine flower color with other desirable traits is feasible.
Nature of Work: Styrax japonicus (Japanese snowbell) is a small deciduous tree that is cultivated as an ornamental. Native to Japan, China, Korea, Taiwan and the Philippines, it was introduced into the U.S. in 1862 (1). The species grows from 6 to 9 m (20 to 30 ft) in height with a similar spread, making it a valuable plant for use in small residential landscapes or under utility lines. Flowers are bell-shaped, approximately 2 cm (0.8 in) in diameter, and very fragrant. They are produced in mid-spring and hang beneath the foliage in three- to six-flowered racemes.
While most S. japonicus cultivars produce white flowers, a few pink-flowered forms have been reported. ‘Pink Chimes’ is the most widely grown pink-flowered form and the only S. japonicus cultivar with deep pink flowers that hold their color even under hot growing conditions (1, 3). Over the past 12 years, we have made numerous crosses for the purpose of combining the deep pink flower color of ‘Pink Chimes’ with other ornamental traits, especially weeping plant habit. Although we have recovered plants with pale pink flowers, we have never found any plant with flowers similar in intensity to those of ‘Pink Chimes’. In addition, two new introductions that have been described as pink-flowered, weeping forms have been disappointing. The flowers of ‘Rubra Pendula’ and ‘Pink Cascade’ develop only a pale pink color when grown in the heat of the southeastern U.S. (2, personal observation). Because of the rarity of deep pink flower color in S. japonicus, it has been speculated that ‘Pink Chimes’ is a periclinal chimera. The objective of this study was to determine if the deep pink flower color of ‘Pink Chimes’ is heritable or chimeral in nature.
Four white-flowered selections (G258-20, G258-90, G258-98 and G259-36) were hybridized with ‘Pink Chimes’. When F1s flowered, pink-flowered plants from two
Plant Breeding and Evaluation 12
SNA Research Conference Vol. 56 2011
groups of progeny (G258-98 × ‘Pink Chimes’ and G259-36 × ‘Pink Chimes’) were used for making full-sib crosses. ‘Pink Chimes’ was also self-pollinated. Controlled cross- and self-pollinations were performed as previously described (4).
Styrax seeds exhibit double dormancy and thus require both a heat and cold treatment for germination (1). Seeds from pollinations were collected in early fall, sown immediately in a pine-bark based medium and kept damp in a warm greenhouse for 5 months. Seeds were then placed in a refrigerated chamber for 3 months, after which they were moved back to the greenhouse. Seedlings were initially grown in containers, but were transplanted to the field in Fall 2008.
Flower color was rated in spring 2008 and 2009 on a scale of 1 to 5, where 1= white, 2 = very pale pink, 3 = pale pink, 4 = medium pink, and 5 = deep pink. A rating of 5 was considered to be equal to the flower color of ‘Pink Chimes’. Mean flower color rating was determined for each F1 and F2 plant.
Results and Discussion: Flower color among F1 plants ranged from white to pale pink, with 67% having white, 21% very pale pink and 12% pale pink flowers. Mean flower color ratings and flower color distribution were similar between F1 and full-sib F2 populations (Table 1; Fig. 1). Flower color among the full-sib F2s ranged from white to medium pink, with the majority of plants (68%) having white flowers. Distribution of flower color was considerably different among full-sib and selfed F2 populations (Fig. 1). Flower color among ‘Pink Chimes’ self-progeny ranged from white to deep pink, but almost half of the plants in this population had flowers rated as medium pink or darker. Five ‘Pink Chimes’ selfed plants (18%) had flowers comparable in color intensity to those of ‘Pink Chimes’.
This study, to some extent, utilized plants developed for breeding purposes and was not designed to elucidate mode of inheritance of pink flower color in S. japonicus. However, the production of plants with flowers similar in color intensity to those of ‘Pink Chimes’ following self-pollination indicates that the deep pink flower color of this cultivar is inheritable. While the data indicates that flower color is not a simply inherited trait, additional generations and larger numbers of progeny are necessary to determine numbers of genes involved in determining S. japonicus flower color. Large F2 populations will likely be needed for recovering progeny with both deep pink flower color and other desired traits; these may best be produced using bee-mediated pollinations.
Literature Cited 1. Dirr, M.A. 2009. Manual of Woody Landscape Plants. Stipes Publishing, Champaign, Ill. 2. Lasseigne, T. 2001. Display of new and interesting acquisitions. Friends of the JC Raulston Arboretum. 5 (4):5-9. 3. Raulston, J.C. 1991. Styrax evaluations in the NCSU Arboretum. Proc. SNA Research Conf. 36: 305-310. 4. Reed, S.M. 2003. Self-fertility and time of stigma receptivity in Styrax japonicum. HortScience 38:429-431.
Plant Breeding and Evaluation 13
SNA Research Conference Vol. 56 2011
Table 1. Flower color in F1 and F2 populations of Styrax japonicus.
Generationz No. plants Color rating, mean ± s.e.y F1 G258-22 × ‘Pink Chimes’ 3 1.7 ± 0.67 G258-90 × ‘Pink Chimes’ 10 1.4 ± 0.27 G258-98 × ‘Pink Chimes’ 6 1.8 ± 0.33 G259-36 × ‘Pink Chimes’ 5 1.4 ± 0.25 F2 (G258-98 × ‘Pink Chimes’) full-sib crosses 58 1.4 ± 0.08 (G259-36 × ‘Pink Chimes’) full-sib crosses 20 1.6 ± 0.18 ‘Pink Chimes’ self-pollinations 28 3.5 ± 0.23
zG258-22, G258-90, G258-98 and G259-36 are white-flowered selections of S. japonicus.
yFlower color is a mean of 2008 and 2009 data. Flower color was rated on a scale of 1 to 5, where: 1 = white; 2 = very pale pink; 3 = pale pink; 4 = medium pink; and, 5 = deep pink. A rating of 5 was considered equivalent to the color of ‘Pink Chimes’.
Plant Breeding and Evaluation 14
SNA Research Conference Vol. 56 2011
Fig. 2. Distribution of flower color among full-sib and selfed F2 Styrax japonicus progeny.
Plant Breeding and Evaluation 15
SNA Research Conference Vol. 56 2011
Seed Stratification, Germination and Greenhouse Performance of Diverse Rosa Species
Xinwang Wang, Masum Akond, Raul Cabrera, and James A. Reinert
Texas AgriLife Research and Extension Center, Texas A&M System Dallas, TX 75252-6599
Significance to Industry: There are more than 130 recognized species in the genus Rosa (1). However, only about 7-10 species of Rosa are found in the background of most modern rose cultivars (3). Research into breeding systems (sexual reproduction) and pollination relationships with only a few exceptions has concentrated mostly on cultivar development (2). To expand the genetic background for modern roses, breeders should more extensively explore wild rose resources. A better knowledge of wild rose resources will make it possible to incorporate many valuable traits into garden rose breeding programs and to develop improved garden rose cultivars that are more broadly adapted. The unexplored wild rose species included in these experiments may have many potential horticultural traits and resistance or tolerance to stresses. They have potentially not been evaluated under the environmental extremes present in Texas along with the Southeast and Southern plains. Rose spp. that we are currently evaluating is likely to have potential as breeding materials as well as for direct commercial marketability. Therefore, this research was conducted with two primary objectives: 1) investigate the influence of stratification on seed germination and the performance of seedlings in growing media or substrate, and 2) evaluate aphid and powdery mildew susceptibility of seedlings growing under greenhouse conditions.
Nature of Work: Seeds of wild rose species (provided by Dr. Kevin Conrad, Curator, U.S. National Arboretum, Washington DC) were placed in plastic bags containing moistened, clean, washed quartz sand and moss (1:1 ratio). The plastic bags were sealed and stratified in a refrigerator at approximately 4° C (40° F) until seeds sprouted (about 6 months for most species). For best germination, care was taken that the seeds never dried-out once they were placed in bags and were never held in standing water. If not enough seeds germinated after 4 months, cold stratification (same plastic bag returns to refrigerator) was continued until seeds sprouted. After stratification, seeds were carefully removed from the sand-moss mixture by hand or by sieving through a screen. Sprouted seeds were sown immediately in 18 holed sheet pots (3.5″-18 count 3″ deep) using a soilless substrate (for example, peat-based mixture or pine bark and moss based substrate). Pots were kept at room temperature (ca. 21°C, or 70°F) for two days and then transferred to the greenhouse. Fresh seeds without stratification were also sown in the same two substrate/media.
Plant Breeding and Evaluation 16
SNA Research Conference Vol. 56 2011
Results and Discussion: The purpose of this study was to develop methods to increase germination percentage, shorten germination time, provide more synchronous germination, and to result in more efficient seed propagation techniques for rose. Data indicated that fresh (without stratification) seeds of wild rose have high physiological dormancy and did not germinate in either of the two medias. We treated 99 Rosa species for cold stratification. So far, however, only 26 species sprouted during the stratification process (4-6 months) (Table 1). Rose can be produced in one week following sowing of stratified seeds in peat based media. Higher percent of seedlings emergence and better growing performance was observed in a peat based substrate than in the pine bark based substrate (Fig. 1). Peat-based media are useful for seed germination because they are relatively sterile, light in texture and weight, and are uniform. The light texture enables seed to readily germinate and emerge, allows tender roots to elongate, and makes transplanting seedlings easier. We developed 235 plants from 11 species of roses (Table 1) among the 40 wild rose species. Genotypes for these 11 species vary in leaves, plant types, and thorns, indicating significant genotypic diversity (Fig. 2).
Gardeners may choose to grow thornless roses for a variety of reasons. Four thornless (code as ‘0’) rose species (Table 1, Fig. 3), produced from this collection along with additional plants that may germinate later, will be our potential breeding parents for thornless rose breeding. Roses are host to a wide range of insect and disease pests. For most rose genotypes, aphids and black spot leaf fungus are the main pest and disease concerns. Until now, no aphid and black spot infestation have been observed in the genotypes resulting from the hybridizations in this study, but it is still very early in this set of experiments. Infections from powdery mildew, however, have been observed in some species. This disease covers new leaves and flower buds with a distinctive white, powder-like growth (Fig. 3). Eight wild roses exhibit resistance to this disease (Fig. 3). Plants will be evaluated for alkalinity tolerance and aphid resistance as more plant material is available for each of the test plants.
Acknowledgement: This project is funded by USDA-Specific Cooperative Agreement (SCA) (58-1230-0- 469) (project # 1230-21000-051-07S).
Literature Cited: 1. Cairns, T. 2000. Modern Roses XI, The World Encyclopedia of Roses, Academic Press. San Diego, CA. 2. MacPhail, V.J. and P.G. Kevan. 2009. Review of the Breeding Systems of Wild Roses (Rosa spp.). In: Zlesak DC (ed.). Roses. Floriculture and Ornamental Biotechnology 3 (Special Issue 1), 1-13. 3. Zlesak, D.C. 2007. Rose. Rosa x hybrida, p. 695-740. In Flower Breeding and Genetics. N.O. Anderson (ed.). Springer, Dordrecht, The Netherlands.
Plant Breeding and Evaluation 17
SNA Research Conference Vol. 56 2011
Table 1: Rose species, country of origin/ collector’s notes, no. of plants and their some features.
Acc Species Country of origin/Collector's No. of Powder Thorn No Notes Plants mildew R13 Rosa canina Ukraine, Sumy 2 R 1 No 1 R15 Rosa canina Ukraine, Sumy 29 R 0 No 0 R22 Rosa gymnosperm Wash. Pk. Arb. U. of Wash. 2 Seattle WA R24 Rosa henryi unknown 1 R 2 No 1 R27 Rosa majalis Uppsala, Sweden 1 R 2 Yes 5 R31 Rosa moschata Local name: 'Ching' 4 R40 Rosa pimpinellifolia Wild Collected USSR 22 R 0 Yes 5 R41 Rosa pisocarpa unknown 3 R47 Rosa rugosa unknown 2 R 1 Yes 5 R49 Rosa rugosa unknown 19 R 2 No 0 R55 Rosa rugosa Wild Collected Russia/ dark 23 pink flower R57 Rosa rugosa unknown 3 S 4 Yes 5 R58 Rosa rugosa Matthare B.G. Anne Arbor, 4 S 3 Yes 5 Michigan R59 Rosa rugosa Chollipo Arb. Seoul, Korea 1 R69 Rosa woodsii G-13105 mont. 1965--1964 4 R 0 Yes 4 seed R71 Rosa woodsii G-13106 Mont. 4 R72 Rosa woodsii unknown 2 R73 Rosa woodsii unknown 7 R 0 Yes 4 R74 Rosa woodsii 72NC323895ai01 5 S 3 No 1 R75 Rosa woodsii Colorado 14 S 3 Yes 3 R78 Rosa sp. unknown 7 S 4 Yes 5 R83 Rosa sp. Albania / Ned Garvey 17 S 3 Yes 3 R87 Rosa sp. Ames 25538 40 S 4 No 0 R90 Rosa sp. unknown 12 R 0 Yes 4 R96 Rosa sp. 1965 ERJensen NMSU 5 S 5 No 0 Hort.G14990 sd. strat:65 R99 Rosa sp. 1964-1965 seed G13107 2 Montan. 26 11 235
Note: plants with most powdery mildew susceptible (5) and most resistant (0); most thorned (5) and thornless (0)
Plant Breeding and Evaluation 18
SNA Research Conference Vol. 56 2011
Fig. 1: Rose seedlings in peat based (a), pine based (b) media; seedlings susceptible (c) and resistant (d) to powdery mildew disease.
Fig. 2. Thorn characteristics (A- thornless code “0”; B- thornless code “1”; C- thornless code “2”; D- thorn code “3”; E- thorn code “4” and F- thorn code “5” in Table 1).
A B C
DEF
D E F
Plant Breeding and Evaluation 19
SNA Research Conference Vol. 56 2011
Fig. 3. Powdery mildew infestation (A- resistant code “0”; B-resistant code “1”; C- resistant code “2”; D- susceptible code “3”; E- susceptible code “4” and F-susceptible code “5” in Table 1).
A B C
D E F
Plant Breeding and Evaluation 20
SNA Research Conference Vol. 56 2011
Identification of Mechanisms for Cold Tolerance in Helleborus orientalis Lam.
Zong Liu, Roger Sauve, Suping Zhou
School of Agriculture and Consumer Sciences Tennessee State University 3500 John A. Merritt Blvd, Nashville, TN 37209
Significant to the Industry: The purpose of this research was to isolate genes in H. orientalis that allow its flower buds to survive extreme cold temperature fluctuations. Cold induced genes were successfully isolated and identified from flower buds and molecular models for cold tolerance were formulated based on the putative function of identified genes. The results of this work will be useful in the development of mechanisms that illustrate how H. orientalis is able to survive extreme cold fluctuations. Mechanisms that confer cold tolerance in plants are needed for the development of new ornamental plants that are able to survive such cold stresses.
Nature of Work: Damage caused by late winter and early spring freezing temperatures affects the commercial values of most plants. Helleborus orientalis (Lenten-rose) is an evergreen ornamental that can withstand multiple freezing-thawing cycles without encountering significant damage. The goal of this research project was to identify molecular mechanisms and genes in flower buds of Lenten-rose that provide protection from tissue damage caused by low temperature fluctuations.
Lenten-rose flower buds used in this study were collected on three days in March 2008. On March 9th, there was a freezing event; maximum temperature remained at or below -5˚C. On March 10th, the temperature was above 0˚C and by the 14th, it was above 10˚C.
Collected flower buds were flash frozen in liquid nitrogen and kept frozen until analyzed. Total RNA was isolated from each flower bud sample and reverse-transcribed into single strand cDNAs. Transcript populations from samples collected at different dates were compared using fluorescent differential display RNAspectra Red Kits from Genhunter Company (Nashville, TN) following the protocol described previously (1,2 ). Differentially expressed cDNA fragments were identified, cloned, sequenced and their putative functions were determined using bioinformatics analysis. The expression of each clone was validated using quantitative RT-PCR analysis.
Through these analyses, it was discovered that the gene expression patterns in H. orientalis flower tissue changed after being subjected to freezing and thawing cycle. Response and tolerance mechanisms observed included changes in sugar and secondary protection mechanisms, protease activity, photosynthetic machinery, signal transduction and cell growth. When gene sequences were searched in both the nucleotide and the protein databases (NCBI (National Center for Biotechnology
Plant Breeding and Evaluation 21
SNA Research Conference Vol. 56 2011
Information, http://www.ncbi.nlm.nih.gov/), few clones had match sequences in the databases. The lack of database matches indicated that the flower buds of Lenten-rose contained cold-responsive genes that have not been reported. In general, expression levels were lower for most genes isolated from flower tissues that had been frozen prior to collection. Some genes had no expression or reduced expression when the ambient temperature increased from -5˚C to 10˚C. Results obtained through these analyses are providing basic information on molecular survival mechanisms in Lenten-rose that allow flower bud tissues to survive freezing. For the development of cold resistant plants, these genes could potentially be introduced into susceptible species to improve their tolerance or resistance to freezing and thawing cycles.
Results and Discussion: Gene IDs for some clones were identified by blasting against NCBI nucleotide database. Peptide sequences were then searched in the protein database and also for conserved domain at (PROSITE profiles) [prf], Pfam HMMs (local models) [pfam_fs], Pfam HMMs (global models) [pfam_ls] (3).
A total of 103 gene fragments were sequenced. Among these, 82 could not be identified due to low homology with reported sequences in the database(s). The 21 identified genes were putatively involved in the following cellular processes: 1. Aquaporin for preserving cellular water balance; 2. Chloroplast component proteins; 3. Maintaining integrity of photosystem I and II; 4. Transcriptional factor for modulating gene expression; 5. Peptidases for removal of toxic peptides; 6. Ascorbate oxidase for increasing antioxidant activity; 7. Other cellular processes;
The relative expression levels of genes were further confirmed using real-time quantitative PCR (qPCR) method following the protocol for Two-Step-RT-PCR with SYBR Green chemistry (4). One gene (clone 428, primer 76), which expressed at stable level under all the temperature regimes, was chosen as the housekeeping gene, or endogenous reference gene. All the genes were corrected by normalization to the housekeeping gene before comparing between different temperature treatments. The fold change in target gene expression was calculated using the 2-∆∆CT method (5 ). According to the fold difference between cold treatments (-5 and 0˚C) and control (10˚C), cloned genes were divided into seven groups.
Group one consisted of ten genes that had stable expressions as the temperature warmed from below freezing to 0˚C and 10˚C. Group two had low gene expression at temperature below freezing, and increased significantly at warmer temperature (10˚C). Group three consisted of nine genes that had low expression during freezing. However, the gene expressions of this group were activated when the temperature increased to 0˚C, and remained at that same expression level as temperature increased to 10˚C. Group four consisted of one protein-protein interaction motif PCI domain containing protein, one myrcene synthase gene, and one unidentified gene. Group five consisted of four genes; with the exception of two unidentified genes, the ammonia transporter
Plant Breeding and Evaluation 22
SNA Research Conference Vol. 56 2011
gene was 1.5-2.0 folds higher at -5 and 0˚C compared to 10˚C. Group six consisted of fifteen genes that increased their expression as the temperature increased from below freezing to 0˚C and to 10˚C. Group seven consisted of nine genes. These genes were activated as temperature decreased to 0˚C, and were down-regulated as the temperature increased to 10˚C.
Literature Cited: 1. Liang, P., L. Averboukh, and A.B. Pardee. 1994. Method of differential display. Methods in Molecular Genetics. 5:3-16. 2. Liang, P. and A.B. Pardee. 1992. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science. 3. Zhou, S., F. Chen, and R. Sauve. 2007. Structure and Temperature Regulated Expression of A Cysteine Protease Gene in Pachysandra terminalis Sieb. & Zucc. J. Amer. Soc. Hort. Sci. 132:1-5. 4. Applied Biosystems. 2005. 7300/7500 Fast Real-Time PCR System Relative Quantization Using Comparative CT Getting Started Guide (PN 4347824). 5. Livak K., J. and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆CT method. Methods25: 402–408, doi:10.1006/meth.2001.1262, available online at http://www.idealibrary.com on
Plant Breeding and Evaluation 23
SNA Research Conference Vol. 56 2011
Growth Regulators
Yan Chen Section Editor and Moderator
Growth Regulators 24
SNA Research Conference Vol. 56 2011
Effects of Plant Growth Regulators on Growth and Reproduction of Humulus lupulus
Chad Rowland and Roger Sauve
Tennessee State University 3500 John A. Merritt Blvd., Nashville, TN 37209
Index Words: Plant growth regulator (PGR), Sumagic, Humulus lupulus ‘Cascade’, hydroponic table.
Significance to Industry: Hops are one of the four main ingredients used in beer production. Over ninety-four million pounds of hops (including ‘Cascade’) were produced in the United States during the 2009 growing season. The hop cultivar Cascade selected for this study is grown primarily in Idaho, Oregon, and Washington State where environmental conditions of the Northwestern U.S. are most favorable for its production. The use of plant growth regulators (PGR) in greenhouse for hop production makes it possible to control their height along with conditions that can be manipulated in greenhouses such as temperature and light to best suit the exact needs of a specific cultivar. Hydroponics technology allows for precise nutrient formulation to be applied to plants in increments or continuously to satisfy the requirement of a specific cultivar. Thus, combining hydroponics and the proper application of PGR allows for a northern cultivar to be grown anywhere. For example, nurseries in Tennessee that do not use their greenhouses during the summer months could use them to grow hops by using the techniques described in this paper to supplement income.
Nature of Work: Humulus lupulus ‘Cascade’ is an herbaceous perennial grown annually in the Northwest under field conditions. In 2009 over two thousand acres were planted in Washington State and Oregon (1). Applications of PGRs have only been recommended for use in greenhouse production of vegetable and ornamental crops. A previous evaluation of PGRs on hops indicated that uniconazol (Sumagic) suppressed hop vine growth better than A- rest, B-9, and Cycocell (C. Rowland, Unpublished data). The objective of this study was to reduce the height of “Cascade” hop vines to allow it to be grown under greenhouse conditions using PGR while maintaining adequate yield.
Randomized complete block design was used in this experiment. There were four blocks each was a 4’x 8’ hydroponic table. Each table was connected to a reservoir containing 170 gallons of nutrient solution. The solutions were maintained at 1000 ppm, (total concentration for all elements in the solution) and a pH at 6.0. All reservoirs contained the same fertilizer solution. Cuttings were taken from large ‘Cascade’ mother plants and rooted in the same nutrient solution. PGR treatments were Sumagic applied at 0, 0.62, 1.25, 2.5, and 5 ppm. A total of 16 cuttings were randomly chosen from a group of plants for each treatment. Sumagic was applied with a hand sprayer.
Growth Regulators 25
SNA Research Conference Vol. 56 2011
Treatments were applied using a hand sprayer. Two applications were applied prior to flowering. The first application was applied two weeks after rooting on May 10, 2010. The second application was applied sixteen days following the first application after internodes on vines were measured. A trellis system was used to support the vines. When cones were matured, all vines were harvested and evaluated for length and fresh weight yield. The total length measurements were done after harvesting the vine using a standard 30’ carpenter’s tape.
Results and Discussion: Sumagic was effective in controlling the height of ‘Cascade’. The most effective concentration was the 5 ppm that reduced vine height without affecting the mean yield of the crop. The average height of vines treated with 5 ppm Sumagic was 165.525 inches (Graph 1). However, the mean yield was slightly less than that of the control. Plants treated with 2.5 ppm Sumagic were slightly taller than plants treated with 5 ppm and had a slightly lower mean yield than the control treatment (Fig 2).
In summary, plants that were treated with the highest concentration of Sumagic had the shortest lateral branching length. Shorter lateral growths made it easier to harvest and manage the vines during the experiment. By using PGR, up to three vines could be grown in the space of one vine without PGR. More vines in production would result in increase yield.
Literature Cited: 1. USDA, . "USDA NASS June 2010 Hop Acreage Report." usahops. N. p., 01 Jun 2010. Web. 3 Nov 2010.
Growth Regulators 26
SNA Research Conference Vol. 56 2011
Fig.1. Mean height of hop vines treated with Sumagic at various concentrations.
Fig. 2. Hop yield (as fresh weight) of vines treated with various concentrations of Sumagic.
Growth Regulators 27
SNA Research Conference Vol. 56 2011
Unexplained Wilting of Tomatoes after Exposure to Large Doses of Exogenous Abscisic Acid (ABA)
Manuel G. Astacio and Marc van Iersel The University of Georgia, Department of Horticulture, Athens, GA 30602
Index Words: hydraulic conductance, stomatal conductance, transpiration
Significance to Industry: It is common for plants in the retail market to receive inadequate water and lose aesthetic value within a short period of time. The plant hormone abscisic acid (ABA) is a natural growth regulator that has recently presented itself as a commercially feasible and effective method to help plants maintain their salability longer. However, it has the potential to impart negative side effects. One of the more peculiar side effects is wilting that may occur when plants are given high doses of ABA, even though the substrate is wet. This study examined the physiological effects of ABA on tomato (Solanum lycopersicum). We found that ABA reduces the hydraulic conductance of root systems, but not of the stems. We also found that the relative water content of leaves is not affected by ABA, even if those leaves exhibit wilting symptoms. Although the ABA effect on roots suggest that the cause of the wilting symptoms is related to root functionality, the finding that wilted leaves still have a high water content casts doubt on this theory. Since wilting symptoms generally do not appear when ABA is applied as a spray, that application method allows growers to get the benefits of ABA without the risk of wilting symptoms.
Nature of Work: Inadequate watering rapidly diminishes a plant’s salability and drastically shortens its shelf life (1). The hormone ABA has the potential to act as a transpiration inhibitor and extend the shelf life of plants during retail. Normally, ABA is produced by plants in response to drought conditions, accumulating in the leaves and causing the guard cells to respond by either closing stomates or preventing them from opening (5, 6), thus reducing transpiration (4). The effects of exogenous ABA applications on shoots have been well-documented. However, comparatively little work has been done to evaluate the effects of high concentrations of ABA on roots and stems. Previous research has reported contradictory results. Hose et al (3) examined excised cells of maize with cell pressure probes and concluded that ABA transiently increased hydraulic conductance of roots for a few hours by stimulating water channels (aquaporins) in the cell membranes. Conversely, earlier work indicated that ABA limits root hydraulic conductance as a means of protecting the membranes from cold stress damage (7).
Recent studies have demonstrated that an unexplained wilting can occur when certain plants are drenched with high concentrations of exogenous ABA (2). The plants will begin to wilt, even though the substrate is still moist. The cause of this wilting is not understood, but may be related to an inhibition of water transportation to the leaves.
Growth Regulators 28
SNA Research Conference Vol. 56 2011
The objectives of this study were to evaluate the effects of various ABA rates on the hydraulic conductance of stems and roots and to gather preliminary information on leaf physiology in an attempt to elucidate the cause of the unexplained wilting. Tomatoes were used as the model crop because they are sensitive to ABA applications and wilt rapidly when exposed to high ABA concentrations.
Study 1: Root and stem conductance. Tomatoes ‘Supersweet 100’ were seeded in 72- cell trays. Following germination, plants were transplanted into 4” round pots filled with soilless substrate (Fafard 2P, Conrad Fafard Inc., Agawam, MA) and grown under an overhead irrigation system. The plants each received 2.6 grams of Osmocote 14-14-14 (Scotts, Marysville, OH).
An ABA stock solution (10% w/v s-ABA, the biologically-active form of ABA, VBC- 30101, Valent BioSciences, Long Grove, IL) was diluted with deionized water to yield concentrations of 0, 62.5, 125, 250, 500, and 1000 ppm. At the commencement of the experiment, the pots were well-watered. Shoots were cut off approximately 5-6 cm above the substrate surface, and then about 4 cm long stem sections were cut off from the remaining shoots. The stem sections and root systems were then inserted into plastic tubes connected to a vacuum pump which served to simulate the effects of transpirational pull (Fig. 1). The stems and root systems were sealed to the inside of the tubing with a silicone gel (3140 RTV coating, Dow Corning, Midland, MI) and then wrapped with Parafilm to prevent leaks. The base of the stem sections was placed in beakers with 100 ml of deionized water. Once the pump was turned on, initial readings of water movement through the root systems and stem sections were taken prior to ABA application to determine an untreated conductance baseline. All ABA applications to the root systems were made as a drench, with each pot receiving 100 ml of solution. For the stem sections, the deionized water in the beakers was replaced with 100 ml of ABA solution. The water levels in the tubes were marked at various times, and these marks were used to determine the cumulative water flow through the roots or stems. At the end of the study, the root systems were washed off and examined for any detrimental side effects that may have been caused by ABA. The experiment was a randomized complete block design with a split plot. The main treatment factor was the ABA concentration (6 rates) and the split consisted of root systems versus stem sections. Each treatment was replicated twice and individual root systems or stem sections were the experimental unit. The study was conducted twice, and both trials returned similar results. Data were analyzed using regression analysis.
Study 2: Leaf water relations. Tomatoes were seeded and grown as described above. Two plants were drenched with 100 mL of 2,000 ppm ABA, while two other plants served as controls. This concentration was chosen because it quickly imparts the wilting symptoms in the plants. Plants were placed in a growth chamber (21 °C, photosynthetic photon flux: 406 µmol·m-2·s-1) approximately 1 day after ABA application. Leaf gas exchange (photosynthesis, transpiration, stomatal conductance) was then measured with a leaf photosynthesis system (Ciras-2, PP Systems, Amesbury, MA) every 5 minutes for a 4 hour period. Data from this 4-hour period were averaged.
Growth Regulators 29
SNA Research Conference Vol. 56 2011
Leaf discs were taken from the plants at the end of the leaf gas exchange study. A cork borer was used to sample leaf discs ½” in diameter. The fresh weight of the discs was recorded, after which the discs were floated on deionized water in Petri dishes overnight. The discs were then blotted dry with filter paper and their turgid weight was recorded. Finally, the discs were oven dried at 80 °C and their dry weights were recorded. Relative water content was determined as (fresh weight – dry weight) / (turgid weight – dry weight) × 100 %. Two replications were used for this initial study. The experimental unit was an individual plant. Additionally, one plant was treated with ABA 30 minutes after the leaf photosynthesis measurements were started. Gas exchange was measured every 5 minutes, and the objective was to determine how quickly the stomates closed following ABA application.
Results and Discussion: As ABA concentration increased, cumulative water flow through the roots decreased (Fig. 2, P = 0.00001), indicating a decrease in root conductance. Treatment effects were obvious within 12 hours. These findings corroborate our previous study that showed an ABA-induced reduction in the hydraulic conductance of root systems (2). At the termination of the experiment, the cumulative flow through roots of the control plants was 27.4 mL, whereas the cumulative flow of plants treated with 1,000 ppm ABA was only 4.8 mL, a reduction of 83 %. There were no visible symptoms of ABA-induced side effects on the appearance of the roots. Unlike the root systems, the stem sections were unaffected by the ABA (Fig. 3, P = 0.26). Cumulative water flow through the stem sections was between 29.6 and 36.5 mL, with no trend of an ABA-related effect. By the termination of the experiment, some of the stem sections were beginning to break down and decompose. The combination of the reduction of root conductance without an ABA effect on stem conductance suggests that the cause of the ABA-induced unexplained wilting may be in the root system.
Results from the preliminary leaf physiology study yielded promising data. One day after the application of 2000 ppm ABA, plants showed wilting symptoms, as well as mild chlorosis and abscission of lower leaves. The results show a clear difference between the ABA-treated and control plants regarding stomatal conductance, transpiration, and photosynthesis (Table 1). The control plants averaged a transpiration rate of 1.97 mmol·m-2·s-1, whereas the ABA treatments averaged 0.27 mmol·m-2·s-1, 86% less. This effect on transpiration is related to changes in stomatal conductance, with the control plants averaging 121.8 mmol·m-2·s-1, compared to 12.6 mmol·m-2·s-1 for the ABA-treated plants, a 90% reduction. Net photosynthesis of ABA-treated plants was negative, indicating that respiration exceeded photosynthesis. The ABA is clearly causing the stomates of the plants to close tightly, thus limiting transpiration and photosynthetic rates.
There were no changes in the relative water content of the leaf discs as a result of ABA applications. Leaves of ABA-treated plants had a relative water content of 75.2%, compared to 77.3% in control leaves. Because the relative water content was similar in both treatments, the wilting of ABA treated plants does not seem to be caused by a decrease in leaf water content. Interestingly, the fresh and turgid weights of the leaf
Growth Regulators 30
SNA Research Conference Vol. 56 2011 discs from the ABA treatment were approximately 30% greater than those of the controls (results not shown), indicating that ABA-treated leaves contained more water. However, the wilting symptoms were apparent in ABA-treated plants, suggesting that their turgor pressure was reduced. This could indicate that the water in the leaves of ABA-treated plants was not contained within cells, pointing to a potential decrease in cell membrane integrity.
Results from the study where a plant was treated 30 minutes after the start of the gas exchange measurements show that ABA reduced stomatal conductance quickly, within 15 minutes after application (Fig. 4). Although this research suggests that reductions in root conductance may hinder water transportation to the shoots, our results also suggest that the unexplained wilting may not be caused by a lack of water in the leaves. To confirm these ABA effects on leaf physiology, a full scale study will be conducted. Further studies will need to look at the relationship between exposure to high levels of exogenous ABA and its effect on cell membrane integrity to determine whether or not this has contributed to the unexplained wilting being noticed in past research.
Literature Cited: 1. Armitage, A.M. 1983. Keeping quality of bedding plants. Florists' Review 171(4461):63-66. 2. Astacio, M. and M. van Iersel. 2010. Root hydraulic conductance of tomatoes is reduced when exposed to abscisic acid. HortScience 45(8):S52. 3. Hose, E., E. Steudle, and W. Hartung. 2000. Abscisic acid and hydraulic conductivity of maize roots: a study using cell- and root-pressure probes. Planta 211:874-882. 4. Jiang, F. and W. Hartung. 2008. Long-distance signaling of abscisic acid (ABA): the factors regulating the intensity of the ABA signal. J. Exp. Bot. 59:37-43 5. Kim, J. and M.W. van Iersel. 2008. ABA drenches induce stomatal closure and prolong shelf life of Salvia splendens. Proc. SNA Res. Conf. 53:107-111. 6. Mahdieh, M. and A. Mostajeran. 2009. Abscisic acid regulates root hydraulic conductance via aquaporin expression modulation in Nicotiana tabacum. J. Plant Physiol. 166: 1993-2003. 7. Markhart III, A.H., E.L. Fiscus, A.W. Naylor, and P.J. Kramer. 1979. Effects of abscisic acid on root hydraulic conductivity. Plant Physiol. 64:611-614.
Growth Regulators 31
SNA Research Conference Vol. 56 2011
Table 1: Transpiration rate, stomatal conductance, and photosynthetic rate for control plants and plants drenched with 1200 ml of a 2,000 ppm ABA solution. Values represent the mean ± sd (n=2). Treatment Transpiration rate Stomatal Photosynthetic rate (mmol·m-2·s-1) conductance (µmol·m-2·s-1) (mmol·m-2·s-1) ABA treatment 0.27 ± 0.05 12.6 ± 3.2 -0.48 ± 0.20 Control 1.96 ± 1.45 121.8 ± 94.3 4.3 ± 4.1
Figure 1: An image of the tube and vacuum system used to simulate the effects of transpirational pull on stem sections and root systems. Note: all leaves were removed for the experiment and the vacuum pump is not shown.
Growth Regulators 32
SNA Research Conference Vol. 56 2011
30 0 ppm 62.5 ppm 25 125 ppm 250 ppm 500 ppm 1000 ppm 20
15
10
5 Cumulative Flow (mL/root system) Cumulative
0 0134678 Time (days) Figure 2: Cumulative water flow through decapitated root systems during an eight day period following drenches with various ABA concentrations. Flow was reduced by ABA (P = 0.00001).
40
30
20
0 ppm 62.5 ppm 10 125 ppm 250 ppm Cumulative Flow (mL/stem section) (mL/stem Flow Cumulative 500 ppm 1000 ppm 0 0134678 Time (days) Figure 3: Cumulative water flow through stem sections during an eight day period following drenches with various ABA concentrations. There was no treatment effect (P = 0.26).
Growth Regulators 33
SNA Research Conference Vol. 56 2011
600
500 )
-1 400 s . -2 m . 300 (mmol
s 200 g
100
0 -10123456
Time (hours) Figure 4: Stomatal conductance (gs) over time for a plant drenched with 100 ml of 2,000 ppm ABA solution. The ABA was applied at time 0.
Growth Regulators 34
SNA Research Conference Vol. 56 2011
Floriculture
Guihong Bi Section Editor and Moderator
Floriculture 35
SNA Research Conference Vol. 56 2011
Influence of Storage Temperature on the Viability of Crape Myrtle (Lagerstroemia) Pollen
Masum Akond1, Cecil Pounders2, and Xinwang Wang1
1Texas AgriLife Research and Extension Center, Texas A&M System, Dallas, TX 75252 2USDA-ARS Thad Cochran Southern Horticultural Laboratory, Box 287, 810 HWY 26 West, Poplarville, MS 39470
Index Words: Lagerstroemia, crape myrtle, pollen, storage temperature, viability
Significance to Industry: Crape myrtle (Lagerstroemia spp.) is a high valued ornamental due to its wide assortment of inflorescence colors, diversity of growth habits, and long summer flowering period (up to 120d). Most cultivars selected before the latter part of the 20th century were chance seedlings chosen for unique color or growth habit (5). Commercial crape myrtle production in the U.S. is primarily by means of asexual propagation of named cultivars (1). Self-pollination can be useful to plant breeders for producing homozygous lines for traits but the available commercial colorful crape myrtles are the result of many years of breeding and hybridization. A continued supply of new cultivar is needed for ongoing genetic improvement of crape myrtle to support U.S. horticulture industry’s economy and environment. Here, the conditions to store crape myrtle pollen for a long period of time are studied. Such methodology is useful to efficiently plan hybridizations between cultivars flowering very separately in time. This study will help breeders to provide new cultivars for creating new business and employment in the U.S. nursery industries.
Nature of Work: Pollen viability may decrease quickly depending upon the storage conditions and needs adequate storage conditions to avoid losing viability. In the present study, we focused on seven crape myrtles that are characterized by different types of deceptive pollination. To our knowledge, this is the first report demonstrating a clear relationship between pollen viability and storage time and condition. Pollen of seven crape myrtle cultivars representing different species namely, ‘Cheyenne’, ‘Kiowa’, ‘Wichita’, ‘NA40181’, ‘L. limii’, ‘L. speciosa- pink’ and ‘Catawba (pollen from antesepalous and antepetalous stamen; Fig. 1a)’ were used in this study. Flowers at crape myrtle showing the stamens were collected from the greenhouse (Texas AgriLife Research and Extension Center, Dallas, TX and Thad Cochran Southern Horticultural Laboratory, Poplarville, MS) and carried to the laboratory. Anthers were removed from flowers and immediately dehydrated (Fig. 1c) in a chamber under room temperature during 24-28 hours. After desiccation, about 15 mg pollen samples were placed in 1.5 ml eppendorf tubes and stored at room temperature (20 to 25°C; RT), 4°C, –20°C or – 80°C. Pollen samples were taken at 0, 7, 15, 45, 75 or 105 days of storage for all cultivars. Pollen of L. limii and L. specoisa pink were tested two days after collection because they were collected and shipped from the USDA-ARS Thad Cochran Southern
Floriculture 36
SNA Research Conference Vol. 56 2011
Horticultural center, MS. Pollen was dusted onto Petri dishes with 25 ml of a medium containing 15% sucrose and 1.2% bactoagar (9, 13). Since the appropriate temperature for other plant’s pollen germination was found between 22°C and 25°C (2), dishes were incubated for 20 hours at room temperature. To evaluate pollen germination, an optical microscope with a 40x ocular was used and pollen grains were considered as germinated when the length of the pollen tube exceeded its diameter (Fig. 1d). For each treatment combination (pollen genotype, temperature and storage time), germination was recorded by counting five different ocular fields with a similar number of pollen grains (20-30 each one), to avoid a possible effect of high pollen density on germination (7, 8). Each count was considered as a replicate.
Results and Discussion: There were differences observed among pollen germination in different temperatures and time of storage, therefore the effect of storage time on pollen viability was analyzed separately for each cultivar and storage temperature. Differences in pollen performance have been found in different cultivars of crape myrtle and agreement with the study in other Prunus species such as apricot (4) and almond (12). Under RT, fresh pollen (same day of collection before storage) of ‘Cheyenne’ showed highest pollen germination (79.90%; Fig. 2), for the rest of cultivars, pollen germination ranged from 43.84% (L. specoisa pink) to 77.07% (Kiowa). The relatively low germination percentages found with L. limii and L. specoisa pink cultivars was because they were tested two days after collection (we collected pollen from the USDA- ARS Thad Cochran Southern Horticultural center). However, results from this work are in agreement with those found by Bargioni and Cossio (3) who found germination values between 70% and 80% for the cherry cultivars. Pollens of all cultivars lost their viability within seven days of storage at room temperature (RT). In this study, for most cultivars pollen completely lost viability after only 45 days of storage at 4°C. Remarkably, ‘L. specoisa pink’ and ‘Wichita’ maintained viable pollen in relatively low percentages up to one more month at this temperature (Fig. 2). Low temperature storage of pollen has been studied in some species, Martínez-Gómez et al. (11) indicated that pollen of two almond cultivars was viable during 8 weeks when stored at 4°C. However, pollen remained viable in most cultivars up to 75 days of storage at – 20°C or -80°C. Higher temperature reduced pollen germination, pollen of cultivar L. limii remain viable (4% - 6%) after 105 days of storage at -20°C or -80°C. Although care was taken to uniformly distribute pollen grains and to choose ocular field where a similar number of pollen grains was present, small differences could explain this kind of result observed.
Most flowers of crape myrtle range from 2 to 5 cm in diameter and have dimorphic pollen (Fig. 1a). Six solitary stamens with thick, long, purple-red filaments and large red anthers that bear dry green pollen are located in front of sepals (antesepalous) on the floral tube. Many smaller stamens are positioned opposite the petals (antepetalous) and slightly higher in the tube, and have shorter filaments and anthers that contain large amounts of sticky yellow pollen. The ante-petalous stamens provide an abundant pollen reward to insects attracted to the nectarless flowers while antesepalous pollen affects pollination (6, 10). When the fresh antesepalous and antepetalous pollen of cultivar ‘Catwaba’ were studied separately, antesepalous showed (Fig. 2) higher pollen
Floriculture 37
SNA Research Conference Vol. 56 2011
germination (89.90%) than antepetalous pollen (71.96%). Antesepalous pollen lost their viability in all temperature regimes within 45 days and earlier than antepetalous pollen. From results in this work it can be concluded that breeders can use viable crape myrtle pollen for their pollination program storing pollen at 4°C up to 45 days and at –20°C and –80°C for 75 to 105 days. A procedure to appropriately conserve pollen, maintaining a good viability, may allow a better planning of controlled crosses and also provide a way of exchanging pollen between breeding programs.
Literature Cited: 1. Byers, M.D. 1997. Crapemyrtle: A grower's thoughts. Owl Bay PubI., Auburn, Ala. 2. Bargioni, G. 1980. La pollinisation du cerisier. Proc. Intl. Symp. La culture du cerisier. Gembloux, France. pp. 178-190. 3. Bargioni, G. and F. Cossio. 1980. Cited by Lichou et al., in Le cerisier, 1990. Ed. Ctifl, Paris, France. pp. 56-58. 4. Egea, J., L. Burgos, N. Zoroa, and L. Egea. 1992. Influence of temperature on the in vitro germination of pollen of apricot (Prunus armeniaca L.). J Hort. Sci. 67:247-250. 5. Egolf, D.R. and A.O. Andrick. 1978. The Lager-stroemia handbook/checklist. Amer. Assn. Bot.Gardens and Arboreta, Inc. 6. Faegri, K. and L. van der PijI. 1979. The principles of pollination ecology. 3rd ed. Pergamon Press, Oxford, U.K. 7. Giulivo, C. and A. Ramina. 1974. Effeto di masa de azione del calcio sulla germinazione del polline di alcune specie arboree da frutto. Riv Ortoflorofrutt It. 58:3- 13. 8. Kwack, B.H. 1965. The effect of calcium on pollen germination. Proc. Amer. Soc. Hort. Sci. 86:818-823. 9. Remy, P. 1953. Contribution a l’etude du pollen der arbres fruitiers a noyau, genre Prunus. Ann Amelior Plantes 3:351-388. 10. Nepi, M., M. Guamieri, and E. Pacini. 2003. Real andfeed pollen of Lagerstroemia indica: ecophysi-ological differences. Plant Biol. 5:311-314. 11. Martinez-Gomez, P., T.M. Gradziel, E. Ortega, and F. Dicenta. 2000. Short-term storage of almond pollen. HortScience 35:1151-1152. 12. Martinez-Gomez, P., T.M. Gradziel, E. Ortega, and F. Dicenta. 2002. Low temperature storage of almond pollen. HortScience 37:691-692. 13. Parfitt, D.E. and A. Almehdi. 1984. Liquid nitrogen storage of pollen from five cultivated Prunus species. HortScience 19:69-70.
Floriculture 38
SNA Research Conference Vol. 56 2011
Fig. 1. (a) Crape myrtle flower showing antepetalous stamen (b) antesepalous stament (c) dehydrated anthers showing pollen (d) germinated pollen on medium, and (e) non- germinated pollen.
Floriculture 39
SNA Research Conference Vol. 56 2011
80 80 70 70 60 Cheyenne L. limii 60 50 50 40 40 30 30 20 20 10 10 Germination percentage 0 0 0 7 15 45 75 105 0 7 15 45 75 105 Days of storage
80 80 70 70 60 60 Kiowa NA40181 50 50 40 40 30 30 20 20 10 10 0 0 0 7 15 45 75 105 0 7 15 45 75 105
80 80 70 70 L. speciosa - pink Wichita 60 60 50 50 40 40 30 30 20 20 10 10 0 0 0 7 15 45 75 105 0 7 15 45 75 105 80 100 70 90 80 Catawba- Antesepalous pollen 60 Catawba- Antipetalous pollen 70 50 60 RT 40 50 4C 40 30 neg 20C 30 neg 80C 20 20 10 10 0 0 0 7 15 45 75 105 0 7 15 45 75 105
Fig. 2. In vitro germination of pollen of seven crape myrtle cultivars after storage at different temperature and periods.
Floriculture 40
SNA Research Conference Vol. 56 2011
Growth and Quality of Greenhouse Roses Subjected to Partial Rootzone Stresses
Raúl I. Cabrera
Texas A&M AgriLife Research, Horticultural Sciences, 17360 Coit Road Dallas, TX 75252
Index Words: alkalinity, boron, nitrogen, salinity, localized stress
Significance to Industry: The production of cut roses is a most intensive cropping system that relies on astounding water and nutrient inputs that are forcing the industry to look into the capture and re-utilization of drainage and the use of poor-quality irrigation water. This study evaluates the effects of water-quality related stresses (salinity, alkalinity, high boron, high ammonium) applied to partial (localized) sections of the root system in roses. Results to date indicate that greenhouse rose plants, particularly those grafted on ‘Natal Briar’, remain fairly sensitive to rootzone salinity and alkalinity conditions even when afflicting only a partial or localized zone of the root system. Further information is needed on rose performance of plants over other rootstocks, the identification of maximum thresholds for rootzone chemical-physical stress tolerance, and the most adequate management practices needed to deal with them under commercial production conditions.
Nature of Work: The greenhouse production of roses for cut flowers is a very intensive operation that receives large water, fertilizer and chemical inputs, coupled with high energy and labor requirements and costs. Greenhouse rose production is based primarily on grafted plants growing in soilless substrates that are continuously fertigated with nutrient solutions (1, 2). About two decades ago the American rose industry switched overnight to the rootstock ‘Natal Briar’, which significantly eased plant propagation and boosted flower productivities and quality (1, 5). Recent research results (5) and reports by growers in some areas suggest that this rootstock’s performance under stressful rootzone conditions, like salinity and high pH conditions can be negatively affected. Despite the intensive nature of fertigation in rose production and an apparent homogeneity of the growing medium used (1), the literature indicates that the physical and chemical conditions of a soil/substrate can be very heterogeneous (differential “patchiness”) within the confines of the rhizosphere surrounding a root system, particularly as you get closer to the surface of the roots (8). This means that the rootzone physicochemical variables monitored in roses, electrical conductivity (EC), pH and select mineral nutrients (2), often and mostly reflect or provide an average of the growing medium and bulk soil solution and not necessarily the zones of more influence, i.e. closer, to the roots. Therefore, it is likely that significant portions of the root system are experiencing stressful conditions (both in time and space) but these are not being detected by these monitoring practices. Scarcity of good quality water in large amounts,
Floriculture 41
SNA Research Conference Vol. 56 2011
and current environmental pressures forcing the greenhouse industry to recycle/recirculate drainage effluents (2, 4, 5) are further increasing the potential for temporal and spatial chemical stresses in local or global zones of the rhizosphere. The objective of this study was to evaluate the effect of localized chemical stresses in the rootzone of roses employing an experimental split-root system.
Mini-plants of rose ‘Revival’ on ‘Natal Briar’ rootstock were transplanted to 5-gallon containers filled with a peat: pine bark: sand medium (3:1:1 by volume), and fertigated with a base ½ strength Hoagland formulation until they reached a commercial production size. On September 2009 they were transplanted to square Dutch rose pots (5 quarts each) that were paired, physically dividing the root system in two, and each half effectively growing on one of the adjacent square pots. The plants were allowed to acclimate to this split root system, using the same nutrient solution for irrigation in both root halves. In March 2010 the plants started to be fertigated with differential nutrient solutions on each one of their split root sections. The nutrient solutions consisted of a control 0.5X Hoagland solution plus another set of stressing nutrient solutions supplemented with high alkalinity (pH), high boron, high nitrogen (as urea) and high salt (as NaCl) (Table 1). One half of the root systems in each plant (i.e. one Siamese square pot) continued to receive the standard (control) 0.5X Hoagland solution and the other half root section (square pot) received one of the stressing solutions. Each root container was individually irrigated with Roberts spitters (one per pot) hooked to the tanks containing the five nutrient solutions (Table 1). Enough solution volumes were applied to all treatments to produce target leaching fractions of ~25%. Leachate samples have been collected for chemical analyses.
A total of eight plants (replicates) were randomly assigned to each treatment, arranged on metal benches inside a climate-controlled glasshouse (25°C and 18°C day and night targets, respectively). The plants have been managed through pruning practices to produce synchronized flushes of growth and flowering. Data collected include harvested (cut flower) dry biomass and number of cut flowers per plant, flower stem length and leaf chlorophyll (SPAD) index. Some preliminary data on stem water potential and leaf stomatal conductance has also been obtained. Preliminary results after three flowering flushes are reported here.
Results and Discussion: As in previous studies on nutrient/water management in roses (3, 4, 5), we have found that it takes 1-2 flower flushes after onset of treatments to begin to see trends or significant differences in flower productivity and quality. The first flower flush (data not shown), which happened in late spring, produced the best quality flowers and highest productivities across all treatments. The effect of the stressing nutrient solutions started to be appreciated by the third flower flush. It should be noted that the 2nd and 3rd flowering flushes occurred with the onset of the highest daily greenhouse temperatures (summer season), which required more frequent irrigation intervals to meet the higher evapotranspiration demands.
Floriculture 42
SNA Research Conference Vol. 56 2011
Looking at the cumulative data for these first three harvests (Table 2), there were no differences on cumulative flower yields across treatments, and only plants having one- half of their root system supplied with the urea-enriched solution had the highest cumulative biomass yields. In addition, this treatment also had the highest average stem dry weights and the highest average chlorophyll index readings. These responses were attributed to the supplemental nitrogen (N) provided as urea, which breaks down readily + into ammonium (NH4 ) in soil solution, and whose excess was expected to produce some potential ammonium-induced toxicity. Our previous research on the nitrogen nutrition of roses indicates that the application of ~25% of the total N as ammonium produces the highest biomass and flower yields (6, 7). In this case, the urea supplementation treatment to one-half the root system provided an ammonium fraction of 42% of the total N, which was also higher by 98 ppm compared to the total N concentration in the control solutions. It is hypothesized that contrary to the expectation of ammonium-toxicity symptoms, the coupling of higher solar radiation conditions in the summer months maximized productivity with the supplemental NH4-N derived from urea breakdown in the substrate. The literature and practice do suggest, however, that such scenario could be very different in the winter months, where diminished carbohydrate production (reduced photosynthesis by lower light levels) could not metabolize the excess ammonium (≥ 10% of total N in winter) and lead to toxicity symptoms (3, 6, 7, 8). We will have to wait for additional flowering cycles to see the longer term effects of such higher N concentrations and ammonium fractions on flower productivity and quality. Interestingly, the EC from leachates collected from the half-root sections receiving the urea solutions have averaged the highest values (8.2 dS/m) along with the NaCl- supplemented solutions (7.2 dS/m). A previous long-term study on N fertilization in roses indicated that fertigation solutions exceeding 200 ppm N resulted in depressed biomass and flower yields compared to concentrations between 90 and 150 ppm, observation associated with both a higher osmotic stress due to NO3-N accumulations in the rootzone, and some nutrient imbalances that were not detected by conventional nutrient analyses procedures (3).
It should be noted that although there were no apparent reductions in cumulative biomass and flower yields in the plants receiving high NaCl in one-half of their roots, the average length and dry weight of individual flower stems were the lowest for plants in this treatment (Table 2). In addition, by the third harvest the beginning of classical salt burn damage to the lower (older) leaves (4, 5) was clearly appreciated, along with some of the lowest leaf chlorophyll indices. This observation suggests that rose plants are still remain fairly sensitive to NaCl salt stress even when it is only partially localized in one- half of the root system, and that the half receiving the control (non-saline) solution apparently can not offset those partial rootzone salinity effects on the above-ground tissues. It is hypothesized that this effect is more heavily associated with specific ion toxicity (Na, Cl) effects than an overall osmotic effect (5). Interestingly the plants receiving high boron concentrations in one-half of their roots have not shown any apparent B toxicity symptoms by the end of the third flowering flush. Plants receiving high pH (alkalinity) in one half of their root system started to show lighter colored leaves by the third harvest, observation supported by the relatively lower chlorophyll levels
Floriculture 43
SNA Research Conference Vol. 56 2011
recorded, which suggests the likely onset of chlorosis (9). A more severe chlorosis is expected in future harvests.
While data from further flower harvest is being collected to have a better assessment of these partial rootzone stresses on flower yield and quality, the results to date suggest that greenhouse rose plants (particularly those grafted on ‘Natal Briar’) remain fairly sensitive to rootzone salinity and alkalinity conditions even when afflicting only partial or localized zones of the root system. Further information is needed on rose performance of plants over other rootstocks, and the identification of maximum thresholds for rootzone chemical-physical stress tolerance, and the most adequate management practices needed to deal with them under commercial production conditions.
Literature Cited: 1. Applied Plant Research. 2001. Handbook for Modern Greenhouse Rose Cultivation. The Netherlands. 2. Cabrera, R.I. 2003. Mineral nutrition. p. 573-580. In: A. Roberts, S. Gudin and T. Debener (Eds.). Encyclopedia of Rose Science. Academic Press, London, UK. 3. Cabrera, R.I. 2000. Evaluating yield and quality of roses with respect to nitrogen fertilization and leaf tissue nitrogen status. Acta Hort. 511:133-141. 4. Cabrera, R.I. and P. Perdomo. 2003. Reassessing the salinity tolerance of greenhouse roses under soiless production conditions. HortScience 38:533-536. 5. Cabrera, R.I., A.R. Solís-Pérez, and J.J. Sloan. 2009. Greenhouse rose yield and ion accumulation responses to salt stress as modulated by rootstock selection. HortScience 44:2000-2008. 6. Cabrera, R.I., R.Y. Evans, and J.L. Paul. 1996. Nitrate and ammonium uptake by greenhouse roses. Acta Hort. 424:53-57. 7. Cabrera, R.I., R.Y. Evans, and J.L. Paul. 1993. Leaching losses of N from container- grown roses. Scientia Hort. 53:333-345. 8. Marschner, H. 1995. Mineral Nutrition of Higher Plants, 2nd Edition. Academic Press. 9. Reed, D.W., Y.T. Wang and B.H. Pemberton. 1992. Field screening of Rosa rootstocks for tolerance to alkaline soil. HortScience 27:635.
Floriculture 44
SNA Research Conference Vol. 56 2011
Table 1. Solutions, and some of their chemical variables, used in the rose split-root system. EC Nitrogen Boron NaCl Solutions pH (dS/m) (ppm) (ppm) (mM) Control Solution 1.7 6.5 133 ≤ 0.6 1.5 + High pH 1.9 8.1 133 ≤ 0.6 1.5 + High 1.7 6.1 133 1.6 - 1.8 1.5 Boron + Urea 1.8 6.5 133 (+ 98 ≤ 0.6 1.5 urea) + NaCl 4.7 5.8 133 ≤ 0.6 31.5 Notes: The tap water used to prepare solutions had pH = 7.6, EC = 0.46 dS/m, B = 0.15 ppm and NaCl = 1.5 mM. The EC and pH values above are averages of actual readings on final solutions. All solutions had all nutrients at ½ Hoagland concentrations, plus the supplemental (stressor) levels of high pH, boron, urea and NaCl salt listed above.
Table 2. Biomass, flower productivity and quality in ‘Revival’ rose plants (on ‘Natal Briar’ rootstock) growing on a split-root system fertigated with different nutrient solutions. Results are the plant sums/averages after three flower harvest cycles. Treatment Harvested Harvested Stem Stem Leaf Solutions DW Stems Length DW Chlorophyll Pot 1 Pot 2 (g/plant) (per plant) (cm) (g/stem) (SPAD) Control Control 118.5 b 25 a 34.4 a 4.8 ab 44.2 ab Control High pH 114.2 b 24 a 33.1 ab 5.0 a 42.8 b Control High B 112.4 b 25 a 33.2 a 5.0 a 44.1 ab Control Urea 141.3 a 28 a 33.2 a 5.2 a 45.1 a Control NaCl 110.5 b 26 a 31.2 b 4.2 b 43.3 b Mean values (n = 8) having similar letters within a column are not significantly different from each other (Duncan’s LSD @ 0.05).
Floriculture 45
SNA Research Conference Vol. 56 2011
Physiological Responses of Petunia to Different Levels of Drought Stress
Jongyun Kim, Anish Malladi, and Marc van Iersel
Department of Horticulture, The University of Georgia, Athens, GA 30602
Index Words: acclimation, growth, photosynthesis, physiology, substrate water content, stomatal conductance, transpiration
Significance to Industry: Plants get exposed to drought stress commonly, either during the production cycle or in the landscape. However, the responses of plants to drought, and especially how the severity of the drought stress affects the plants’ responses, are not fully understood. Our objective was to quantify plant growth and physiological responses of petunia in response to different severities of drought stress. To do this, plants were irrigated using a soil moisture sensor-controlled irrigation system that allowed for precise control of volumetric substrate water content (θ). Not surprisingly, drought stress reduced plant growth (shoot fresh and dry weight) and affected the morphology (smaller leaves). However, plants also showed a distinct ability to acclimate to drought. Leaf photosynthesis increased significantly over a one week period in plants that were exposed to a mild drought (θ of 0.2 or 0.3 m3·m-3). However, plants exposed to severe drought (θ of 0.1 m3·m-3) showed no acclimation. Our results suggest that severe drought should be avoided, but that plants can at least partially recover from a mild drought stress.
Nature of Work: Drought is one of the most common stresses plants get exposed to. For ornamental plants, drought can occur during the production cycle or after plants have been placed in the landscape. Drought stress during production is a common method to try to reduce shoot elongation, and thus to improve plant quality. Drought stress also can be imposed on plants before sale to harden them off, in the hope that such hardened plants will perform better in the landscape. The ability of plants to acclimate to drought is well-known and short-term responses to drought may differ from long-term responses because of plants’ ability to acclimate (1). However, there is very little information on how the severity of drought stress affects the plants’ acclimation. The objective of this study was to quantify the short and long-term effects of drought stress on the growth and physiology of petunia. Short-term effects are indicative of plants’ immediate responses to drought, while long-term responses are indicative of acclimation.
Plant material. Eight Petunia x hybrida ‘Apple Blossom’ seedlings were transplanted into 8 liter trays filled with soilless substrate (Fafard 2P; 60% peat and 40% perlite; Fafard, Anderson, SC) with controlled-release fertilizer (13 lbs/yd3, Osmocote 14-14-14 Scotts Co., Marysville, OH) incorporated. Plants were grown for three weeks (Mar. 23 to Apr. 14, 2010) in a greenhouse using a soil moisture sensor-based, automated irrigation
Floriculture 46
SNA Research Conference Vol. 56 2011
system (2) maintaining θ levels of 0.4 m3·m-3. During the experiment, average temperature and relative humidity in the greenhouse were 69 ± 1.7 °F and 57 ± 10 %, and average daily light integral in the greenhouse was 29.8 ± 10.0 mol·m-2·day-1 (mean ± s.d.).
Automatic irrigation system and treatments. Each tray was watered using a custom drip irrigation grid connected to two pressure-compensated emitters (8L/h, Netafim, Fresno, CA) and the irrigation was controlled by the automated irrigation system. Two dielectric soil moisture sensors (EC-5; Decagon Devices, Pullman, WA) were placed diagonally in each tray and connected to a datalogger (CR10; Campbell Scientific, Logan, UT) via a multiplexer (AM16/32; Campbell Scientific) to monitor and control θ. When the average reading of two soil moisture sensors in a tray dropped below the set moisture level, the datalogger opened the corresponding solenoid valve to irrigate that tray for 20 seconds (approximately 90 mL per application). The different θ set points were 0.4, 0.3, 0.2, and 0.1 m3·m-3.
Physiological measurements. CO2 gas exchange rate (Pn), transpiration (E), stomatal conductance (gs) and the quantum yield of photosystem II (ΦPSII) were measured with a leaf photosynthesis system (CIRAS-2; PP Systems, Amesbury, MA) at the time the various treatments reached their target θ and again one week later to determine the ability of the plants to acclimate. During these measurements, PPF was 1000 µmol·m- 2 -1 ·s and the CO2 concentration was 388 ppm. All the plants were harvested 16 days after the start of the treatments. At harvest, relative water content of the uppermost fully expanded leaves was measured. Leaf area was measured on eight uppermost fully expanded leaves per tray using a leaf area meter (LI-3100; Li-Cor, Lincoln, NB). Shoot dry weight was obtained after 4 days at 70 °C in a drying oven.
Experimental design and data analysis. The experimental design was a randomized complete block with four replications. Data were analyzed using ANOVA with mean separation using Fisher’s protected LSD0.05, or, in the case of significant interaction, pair-wise comparisons.
Results and Discussion: The irrigation system performed well throughout the study and was able to maintain θ slightly above the threshold for irrigation (Fig. 1). It took 3, 4, and 9 days for the 0.3, 0.2, and 0.1 m3·m-3 treatments to reach their irrigation thresholds, after which the irrigation system started the automated watering. Fluctuations in θ were greater in treatments with lower θ (Fig. 1), which is consistent with previous findings (3) and may be related to a decrease in hydraulic conductivity of peat-based substrates as they dry out.
Substrate water content affected the area of the uppermost fully expanded leaf, relative water content, shoot fresh weight and shoot dry weight (Fig. 2). The most dramatic effect of θ was on shoot fresh weight, which was reduced by approximately 80% in the 0.1 m3·m-3 treatment as compared to the 0.4 m3·m-3 treatment. The area of the uppermost fully expanded leaf also was a sensitive indicator of drought stress, with a
Floriculture 47
SNA Research Conference Vol. 56 2011
clear reduction in leaf area with lower θ. The relative water content of the leaves was 3 -3 the least sensitive among these parameters and reduced only in the 0.1 m ·m treatment.
Leaf physiology was greatly affected by the different θ treatments. Stomatal conductance, transpiration, ΦPSII, and leaf photosynthesis were all low at low θ (Fig. 3). Averaged over all θ set points, leaf transpiration was lower at the time the substrate reached its θ set point than one week later (P = 0.035). Whether this is a true indicator of acclimation to drought is not clear, since this difference in transpiration may also have been caused by different environmental conditions among the different measurement times. There were no significant differences in stomatal conductance between the measurement times, further suggesting that the difference in transpiration between the measurement times was not due to acclimation. Photosynthesis, on the other hand, did acclimate to drought stress, since there was an interactive effect of θ and measurement time (P = 0.023). Photosynthesis in the 0.2 and 0.3 m3·m-3 treatments increased significantly during the week after these treatments reached their set points. No such change was seen in the 0.1 or 0.4 m3·m-3 treatments. No change in the photosynthetic rate of plants in the 0.4 m3·m-3 treatment was expected, since θ did not change. The lack of an increase in photosynthesis in the 0.1 m3·m-3 treatment suggests that the level of drought stress may have been too severe for the plants to acclimate. The ability of plants to acclimate to drought is well-known [see review by Chavez et al. (1)], but there is little information on how drought stress severity affects the ability of plants to acclimate. Our findings suggest that petunia has the ability for photosynthetic acclimation to mild drought stress, but that acclimation may not occur when plants are exposed to severe drought. The finding that petunia plants have the ability to acclimate to drought does not imply that drought does not reduce plant growth. Although acclimation may play an important role in helping petunias tolerate drought stress, some plant responses, such as reduced leaf size are irreversible, and will limit growth for long periods.
Acknowledgements: Funding for this research was provided by USDA-NIFA-SCRI award no. 2009-51181-05768.
Literature Cited: 1. Chavez, M.M., J.P. Maroco, and J.S. Pereira. 2003. Understanding plant responses to drought – from genes to the whole plant. Functional Plant Biol. 30: 239 – 264. 2. Nemali, K.S., and M.W. van Iersel. 2006. An automated system for controlling drought stress and irrigation in potted plants. Scientia Hort. 110:292-297. 3. van Iersel, M.W., S. Dove, J.G. Kang, and S.E. Burnett. 2010. Growth and water use of petunia as affected by substrate water content and daily light integral. HortScience 45:277-282.
Floriculture 48
SNA Research Conference Vol. 56 2011
Fig. 1. Substrate water content as maintained by the soil moisture sensor-based, automated irrigation system. On day 0, set points for substrate water content were set to 0.1, 0.2, 0.3, or 0.4 m3·m-3. Note that it took 3, 4, and 9 for the substrate to dry to 0.3, 0.2, and 0.1 m3·m-3, respectively.
Floriculture 49
SNA Research Conference Vol. 56 2011
Fig. 2. The effect of substrate water content on (A) area of the uppermost fully expanded (UMFE) leaf, (B) leaf relative water content, (C) shoot fresh weight, and (D) shoot dry weight of Petunia × hybrida at 16 days after treatment. Bars indicate means ± standard error. Mean separation was done using Fisher’s LSD0.05.
Floriculture 50
SNA Research Conference Vol. 56 2011
Fig. 3. (A) Stomatal conductance, (B) transpiration, (C) quantum yield of photosystem II (ΦPSII), and (D) leaf photosynthesis of Petunia × hybrida ‘Apple blossom’ on the day that the substrate water content reached its set point (black bars) and after the substrate water had been at the set point for one week (grey bars). Bars indicate means ± standard error. There were no interactive effects of substrate water content and measurement time on stomatal conductance, transpiration, and ΦPSII. Uppercase letters indicate differences among substrate water contents. There was an interactive effect of substrate water content and measurement time on photosynthesis, and those means were separated using pair-wise comparisons, as indicated by lowercase letters.
Floriculture 51
SNA Research Conference Vol. 56 2011
The Effect of Organic Fertilizer Formulation and Rate on Greenhouse Transplant Production of Petunia
Sarah Sydow1, James S. Owen, Jr.1, Heather M. Stoven1, and Brian Krug2
1Oregon State University, North Willamette Research and Extension Center 15210 NE Miley Road, Aurora, OR 97002 2University of New Hampshire, Spaulding Hall, Durham, NH 03824
Index Words: floriculture, chicken manure, feather meal, nutrition, nitrogen rate, electrical conductivity, pH
Significance to Industry: An increased knowledge base on the effectiveness of organic fertilizer products will assist growers interested in serving the organic market to choose the most efficacious rates and products for growing a salable crop. Petunias grown using organic fertilizer were comparable in size to plants produced under conventional liquid fertilization practices. When using organic fertilizer, the largest plants were produced at a rate of 0.6 to 0.9 kg N•m-3. The highest N foliar content occurred in -3 the plants fertilized with organic fertilizer at 1.2 kg N•m . The use of organic fertilizers resulted in increased pH, which is hypothesized to result in chlorosis from pH induced micronutrient deficiency. Organic fertilizers have the potential to produce a marketable petunia crop within 40 days. Additional research to investigate pH adjustment or the use of supplemental micronutrients is needed
Nature of Work: In the United States, organic products are quickly rising in popularity. Currently, organic produce makes up more than 34% of the total organic product market (7). Organic vegetable sales in the United States have significantly risen from $3.6 billion in 1997 to $21.1 billion in 2008 (7). In 2005, U.S. consumers spent $16 million on organic flowers, making this the fastest growing sector of the non-food organic market (4).
In order to fulfill the increased demand for organic products, transplant growers will have to determine new methods of production that meet organic standards. Many growers have expressed concerns over the feasibility of organic production due to a perceived lack of efficiency in organic pesticides and effectiveness of organic fertilizers which could negatively affect the appearance, and in turn, sales of the final crop (4, 7).
While the effects of organic fertilizer have been studied at length in the field, the use of soy based, and animal based fertilizers is still being examined in a greenhouse setting (5, 6). Organic farmers have traditionally used chicken manure as a soil amendment to improve organic matter, microbial activity and available nutrients, but reported results have been mixed (5). While manure serves as a source of quick release organic nitrogen, often a blend of manure and feather meal are combined to provide both fast
Floriculture 52
SNA Research Conference Vol. 56 2011
and slow release nitrogen for a longer lasting fertilizer (1). Also, bone meal may be added as an organic source of slow release phosphorus (1), making chicken waste fertilizers more appealing to growers by providing more than just nitrogen. Chicken farms are spread throughout the United States, and they produce up to 484,000 tons of excess nitrogen in chicken litter per year (3). This excess nitrogen is an accessible and local source that can be used alone or with feather and blood meal in organic transplant production. The purpose of this experiment is to determine the best rate at which to apply a local or regional organic fertilizer derived from chicken production that can produce a high quality organic transplant for flower crops. Petunias were chosen for this experiment due to their popularity with consumers and widespread production in the floriculture industry.
Petunia Dreams Series ‘Apple Blossom’ (Petunia × hybrida) were transplanted from a 72 count tray (55 mL cell volume) to a 12 cm container (1.6 L) on May 24, 2010. Petunia transplants were potted into a soilless substrate consisting of 40% (by vol.) sphagnum peat moss, 30% (by vol.) fine aged fir bark <10mm (<3/8 inch), 30% (by vol.) screened pumice (by vol.) and 89 mL (3 oz) of a non-organic wetting agent. Substrate was amended with 1.2 kg·m-3 (2.0 lbs•yd-1) #10 Ag dolomite, 0.9 kg•m-3 (1.5 lbs•yd-1) #65 Ag dolomite, 0.9 kg•m-3 (1.5 lbs•yd-1) flour lime and 0.3 kg•m-3 (0.5 lbs•yd-1) gypsum. All fertilizer was incorporated into the soilless substrate before plugs were transplanted. Petunia transplants were fertilized with PAR4 9-3-7 (9N-0.4P-5.8K; O&E Farms, Ltd, Drayton, ON, Canada), Nutri-Rich 8-2-4 (8N-0.9P-3.3K) or Nutri-Rich 4-3-3 (4N-1.3P- 2.5K) (Stutzman Farms, Canby, OR) fertilizer derived from feather meal or chicken manure at a rate of 0.3, 0.6, 0.9, 1.2 kg N•m-3 (0.5, 1.0, 1.5 and 2.0 lbs N•yd-3). PAR4 and Nutri-Rich fertilizers are certified by Organic Materials Review Institute (OMRI). A control treatment was included that received conventional liquid fertilization of 20-20-20 (20N-8.7P-17.9K; J.R. Peters, Inc., Allentown, PA) at 150 mg N•L-1.
Petunias were grown in a climate controlled Quonset greenhouse at 21°C (69°F) and irrigated two times daily via 1.9 L•hr-1 (0.5 gph) pressure compensated dripper delivered by an angle barbed drip Stake (Netafim, Fresno, CA) to maintain minimal leaching. Pour-through samples were collected (8) bimonthly to monitor pH and electrical conductivity (EC) of the substrate solution (7). EC and pH data reported herein only include data from pour thrus conducted on June 13, 2010. A SPAD meter (Konica Minolta Sensing Inc., Ramsey, NJ) was used to measure leaf color as an indicator of leaf chlorophyll content. Recently expanded leaves were removed, rinsed with DI water, dried, and analyzed for nitrogen by Brookside Laboratories (New Knoxville, Ohio). The plants were harvested after 40 days on July 2, 2010 at which time shoots and roots were harvested, roots were washed, roots and shoots were dried for minimum of 72 hrs and weighed.
Plants were arranged in a completely randomized design with 8 individual plant replications per treatment. Data was analyzed with SAS 9.2 (Cary, NC) using Proc GLM statement for univariate analysis of variance (ANOVA) to determine influence of main effects and interaction on individual parameters. Linear and curvilinear trends of plant
Floriculture 53
SNA Research Conference Vol. 56 2011
dry mass were analyzed using contrast statements. Means separation with Fisher’s protected least significant difference test (α = 0.05) were used where appropriate.
Results and Discussion: The main effects, fertilizer type and nitrogen application rate were significant when investigating plant response, substrate chemical properties, and foliar nutrient concentration, however there was no interaction of fertilizer type x nitrogen application rate. The petunia total dry mass increase was curvilinear as N application rate of organic fertilizer treatments increased with the calculated maximum occurring at 0.8 kg N•m-3. The root:shoot ratio of petunia growth using organic fertilizer decreased 0.10 as N application rate increased (Table 1). This inverse relationship of fertilizer application rate and root:shoot ratio indicates plant nutrients became less limiting and therefore more carbon was allocated to shoot growth. Petunia grown using conventional liquid fertilizer yielded a similar total dry mass to plants grown with organic fertilizer at a rate of 0.6 to 0.9 kg N•m-3, however root:shoot ratio was greater (0.24) (data not presented).
Substrate EC decreased over time regardless of fertilizer treatment. On June 13, 2010, substrate amended with PAR4 9-3-7 had the highest EC (3.1 dS•m-1), followed by both Nutri-Rich fertilizers (approx. 2.7 dS•m-1) (Table 2). The lowest substrate EC was the control (2.1 dS•m-1) (Table 2). Substrate EC increased with increasing nitrogen application rate. On July 1, 2010, EC had decreased to 0.4 and 1.0 dS•m-1 for the organically fertilized substrates and control, respectively (Data not presented). Substrate amended with fertilizer containing some or all chicken manure had a higher EC at the end of the study than those substrates containing only feather meal-based fertilizer, possibly due to a lesser amount of readily available nitrogen and other nutrients.
Petunia foliar N concentration increased from 2.1% to 3.8% with increasing N rate (data not presented). N foliar concentration was greater in PAR4 9-3-7 and Nutri-Rich 8-2-4 fertilizer (approx. 3.2%) when compared to the control (2.9%), whereas the use of Nutri- Rich 4-3-3 (2.6%) resulted in lesser foliar N concentration than the control. This increase in foliar N is most likely due to the use of feather meal in both PAR4 9-3-7and Nutri-Rich 8-2-4 that resulted in a higher percent of available N.
Foliar chlorosis was present in all organic fertilizer treatments at harvest at varying degrees. The plants fertilized with Nutri-Rich 4-3-3 was the most chlorotic, being most severe at 1.2 kg N•m-3, followed by the Nutri-Rich 8-2-4 and Par 4 9-3-7. Chlorosis being observed in only the organic treatments results in the hypotheses that the chlorosis is a result of approximately a two unit increase in pH of the substrate and reduces plant nutrient availability (Table 2). The ideal pH range for petunias is between 5.5 and 6.2. Substrate pH above 6.2 can result in iron deficiency (2). Substrate pH of the control on June 13, 2010 was 5.3 (Table 2), where as the substrate pH of all organically fertilized petunias ranged from 6.9 to 7.7 (Table 1). Substrate pH linearly increased approximately 0.8 units with the increased addition of organic fertilizer.
Floriculture 54
SNA Research Conference Vol. 56 2011
Based on our results we hypothesize that it is feasible to produce a salable crop of organically grown petunia transplants within 40 days, however additional research is needed to correct pH and sufficiently supply micronutrients. Foliar chlorosis of petunia grown with organic fertilizer significantly affected the overall appearance of the crop, thus making it less marketable to the consumer. It may be possible to adjust the pH and prevent a micronutrient deficiency by omitting lime, pre-incorporation of elemental sulfur, or providing supplemental micronutrients. Research needs to be continued to optimize petunia transplant fertilization when using organic fertilizers.
Acknowledgements: We would like to thank Wade E. Pruett for identifying the research need and technical assistance, Phillips’ Soil Products for mixing and providing soilless substrate and Stutzman Environmental Products for providing Nutri-Rich fertilizer. This research was in part funded by Oregon Department of Agriculture and Phillips’ Soil Products.
Literature Cited: 1. Buckwalter, C. and C. Fake. 2003. Using organic amendments. University of California Cooperative Extension 31-072C. 2. Erwin, J. 2002. Optimal pH requirements for different species. University of Minnesota/Minnesota Nursery & Landscape Association Commercial Flower Growers Bulletin, Minneapolis, MN. October 23, 2010. 3. Gollehon, N., M. Caswell, M. Ribaudo, R. Kellogg, C. Lander, and D. Letson. 2001. Confined animal production and manure nutrients. United States Department of Agriculture, Economic Research Service, Washington, DC Agricultural Information Bulletins 33763. 4. Hall, T.J., R.G. Lopez, M.I. Marshall, and J.H. Dennis. 2010. Barriers to adopting sustainable floriculture certification. HortScience 45:778-783. 5. Malik, N.S.A. and J.M. Bradford. 2007. Plant growth regulatory effects of chicken litter extract. J. Sustainable Agric. 30:5-14. 6. Nelson, P.V., C.E. Niedziela Jr., D.S. Pitchay, and N.C. Mingis. 2010. Effectiveness, ammonium impact and potassium adequacy of soybean-base liquid fertilizer on bedding plants. J. Plant Nutr. 33:724-735. 7. United States Department of Agriculture Economic Research Service. 2009. Organic agriculture: Organic market overview. USDA, August 11, 2010. http://www.ers.usda.gov/Briefing/Organic/Demand.htm. 8. Wright, R.D. 1986. The pour-through nutrient extraction procedure. HortScience 21:227-229.
Floriculture 55
SNA Research Conference Vol. 56 2011
Table 1. Plant response of ‘Apple Blossom’ petunia and chemical properties of bark and -3 peat soilless substrate grown at four nitrogen rates (kg N•m ) pooled across 3 organic fertilizers.
Total dry Electrical Nitrogen rate weight Root:shoot conductivity (kg N/m-3) (g) ratio (dS•m-1) pH
0.3 8.1 bz 0.25 a 1.30 c 6.85 c 0.6 10.4 a 0.22 a 2.30 b 7.14 b 0.9 11.4 a 0.16 b 3.40 a 7.66 a 1.2 8.3 b 0.14 b 4.00 a 7.69 a
Contrasts
Linear 0.929 0.701 0.001 0.001 Quadratic 0.001 0.001 0.361 0.065
zletters in column signify a difference using Fishers LSD (α < 0.05)
Table 2. Main effect for fertilizer type on ‘Apple Blossom’ petunia plant response and chemical properties of bark and peat soilless substrate containing PAR4 9-3-7, Nutri- Rich 8-2-4, Nutri-Rich 4-3-3 or grown conventionally using liquid fertilizer at 150 mg N•L-1 (control).
Total dry Electrical weight conductivity Fertilizer type (g) (dS•m-1) pH
Control 10.5 az 2.10 b 5.28 c Nutri-Rich 4-3-3 9.7 ab 2.69 ab 7.13 b Nutri-Rich 8-2-4 8.7 b 2.48 ab 7.42 a PAR4 9-3-7 10.3 a 3.12 a 7.44 a
Significance 0.0257 0.0796 0.0001
zletters in column signify a difference (α < 0.05) across products using Fishers LSD
Floriculture 56
SNA Research Conference Vol. 56 2011
Corncob as a Substitute for Perlite in Greenhouse Production
Tyler L. Weldon, Glenn B. Fain, Jeff L. Sibley, and Charles H. Gilliam
Auburn University, Department of Horticulture, Auburn, Al 36830
Index Words: Impatiens walleriana ‘Dazzler Cranberry’, Petunia xhybrida ‘Dreams Rose’, greenhouse, alternative media
Significance to the Industry: Perlite (PL) is a component in most soilless greenhouse substrates. Perlite takes significant energy to produce and transport and is known to be an eye and lung irritant. These studies evaluated corncob particles as a possible alternative to PL. Impatiens walleriana ‘Dazzler Cranberry’ and Petunia xhybrida ‘Dreams Rose’ were grown in substrates consisting of a pinebark:peat (PB:P) mix amended with either corncob (CC) or perlite. Results showed plants to have equal or greater growth in substrates containing CC when compared to PL. These studies indicate that CC might be a viable alternative to PL. Additional advantages of CC are its potential to be regionally available and more carbon neutral.
Nature of Work: Soilless substrates used in the production of greenhouse grown crops are often constructed from a combination of peatmoss, perlite and vermiculite (1, 2). Substrate components are mixed at different rates to meet water holding capacity (WHC) and air space (AS) required by selected crops. Peatmoss is derived from sphagnum peatbogs and is mostly imported from Europe and Canada, which can be expensive. Vermiculite, which is still used, has become less popular due to the concern identified with the asbestos in the mines of Montana (9). Perlite, an inorganic volcanic rock, produces fine dust particles that have known to cause irritation of the lung and eye (4). Problems with traditional soilless substrates have created interest in alternative components that can provide the same function at a lower cost as well as being more worker and environmentally friendly. Alternatives to vermiculite and perlite include ricehulls, calcined clay, and polystyrene (6, 10, 5). Other alternatives which may reduce or eliminate the need for perlite as a component are Wholetree, Clean Chip Residual, and Chipped Pine Logs (7, 3, 11). A possible new alternative to perlite can be the use of processed corncobs. Corncobs are readily available after the annual harvest of the corn industry and are often never utilized. Nationally only about 10% of the CC are utilized for such products as chemical and pesticide absorbent, abrasive materials, and bedding for animals. Corncobs are a domestic product found near areas of horticultural production, which could lower transportation cost in some regions. The objective of this study was to evaluate the possibility of CC as a possible alternative to PL in greenhouse production.
Experiments were set up on June 18, 2010 at the Paterson Greenhouse Complex at Auburn University. A base substrate of 70:30 pinebark:peat (v:v) was amended with CC (The Andersons Inc. Maumee, OH) or PL at rates of 10%, 20%, and 30%. The
Floriculture 57
SNA Research Conference Vol. 56 2011
substrates were amended with 5 lbs/yd3 of Dolomitic Limestone, 1.5 lbs/yd3 of Micromax 3 (The Scotts Company, Marysville, OH) and 2.5 lbs/yd of N from Sta-green 12-6-6 fertilizer (Pursell Industries, Inc. Sylacauga, AL). Containers (6” azalea pots) were filled with substrates and planted with 2 plugs (200 cell flat) of Impatiens walleriana “Dazzler Cranberry” or Petunia xhybrida “Dreams Rose”. Containers were placed on a raised bench in a twin wall polycarbonate greenhouse and watered as needed. Species were arranged as separate experiments.
Data collected included substrate pH and EC every 7 days using the pour-through method (12), and final growth measurements collected at 35 days after planting (DAP) including growth index [(height + width + perpendicular width ) / 3], bloom counts (BC) and shoot-dry weight (SDW) (oven dried at 70o for 72 h). Data was arranged in a complete randomized block design with 12 single pot replicates. Data collected were subjected to analysis of variance using the general linear models procedure and a multiple comparison of means was conducted using Tukey’s Studentized Range Test (version 9.1: SAS Institute, Cary, NC).
Results and Discussion: Results for pH at 14 and 21 DAP showed substrates containing 20% and 30% PL having the highest pH (data not shown). These results differed from treatments containing 20% and 30% CC in which pH was the lowest of all treatments. EC readings for 14 DAP and 21 DAP were similar among all treatments (data not shown). At 28 DAP pH and EC for 30% PL were higher than all treatments containing CC. At termination pH of substrates that contained CC were generally lower than PL while EC readings were similar among all treatments.
Petunia GI was similar among all substrate treatments (Table 1). However SDW, a better indicator of accumulated plant growth, revealed that growth of petunias in a substrate containing 30% PL were 28-30% smaller than in all other substrates. Petunia BC for the 10% CC substrate was higher than any substrate containing PL, while the 30% PL substrate had less blooms than all of the CC substrates.
Growth index of impatiens grown in 10% and 20% CC or PL were similar to each other (Table 2). Impatiens BC was similar among all treatments. Impatiens SDW for 10% and 20% CC was similar to those with PL, while substrates containing 30% CC were smaller than all other treatments.
Results of this study indicate that growth of impatiens and petunias in substrates containing CC with the exception of 30% CC, was equal or of greater than crops grown in substrates containing PL. Results show that substrates containing corncob can produce marketable crops that is both cost efficient and environmentally friendlier than crops produced in PL containing substrates.
Literature Cited: 1. Baker, K.F. 1957. The U.C. system: a general summary. The U.C. system for producing healthy container grown plants. Calif. Agric. Exp. Stn. Man. 23.
Floriculture 58
SNA Research Conference Vol. 56 2011
2. Boodley, J.W. and J.R Sheldrake. 1977. Cornell peat-lite mixes for commercial plant growing. Cornell Informational Bulletin Number 43. 3. Boyer, C.R., G.B. Fain, C.H. Gilliam, T.V. Gallagher, H.A. Torbert, and J.L. Sibley. 2008. Clean chip residual: A substrate component for growing annuals. HortTechnology 18:423-432. 4. Chung-Li, D.J. P. Wang, Chu, and Y.L. Guo. 2010. Acute expanded perlite exposure with persistent reactive airway dysfunction syndrome. Industrial Health 48:119-122. 5. Cole, J.C. and D.E. Dunn. 2002. Expanded polystyrene as a substitute for perlite in rooting substrate. J. Environ. Hort. 20:7-10. 6. Evans, M.R. and M. Gachukia. 2004. Fresh parboiled rice hulls serve as an alternative to perlite in greenhouse crop substrates. HortScience 39:232-235. 7. Fain, G.B., C.H. Gilliam, J.L. Sibley, and C.H. Boyer. 2008. Wholetree substrates derived from three species of pine in production of annual vinca. HortTechnology 18:13-17. 8. Kämpf, A.N. and M. Jung. 1991. The use of carbonized rice hulls as a horticultural substrate. Acta Hort. 294:271-283. 9. Peipins, L.A., M. Lewin, S. Campolucci, J.A. Lybarger, A. Miller, D. Middleton, C. Weis, M. Spence, B. Black, and V. Kapil. 2003. Radiographic abnormalities and exposure to asbestos-contaminated vermiculite in the community of Libby, Montana, USA. Environmental Health Perspective 111:1753-1759. 10. Pickens, J.M., J.L. Sibley, G.B. Fain, C.H. Gilliam, and J.W. Olive. 2009. The lightweight aggregate hydrocks as perlite substitute. Proc. Southern Nursery Assn. Res. Conf. 54:401-403. 11. Wright, R.D. and J.F. Browder. 2005. Chipped pine Logs: A potential substrate for greenhouse and nursery Crops. HortScience 40:1513-1515. 12. Wright, R.D. 1986. The pour-through nutirent extraction procedure. Hortscience 21:227-229.
Floriculture 59
SNA Research Conference Vol. 56 2011
Table 1. Effects of Proccessed Corncob on Growth of Petunias. Petunia xhybrida 'Dreams Rose' z y x Treatments GI Bc SDW t u 10% CC 28.3a 26.8a 13.6a 20% CC 36.0a 22.8ab 13.2a 30% CC 33.3a 21.1ab 11.2ab 10% PL 29.6a 17.4bc 12.5a 20% PL 30.9a 17.4bc 11.6ab 30% PL 30.7a 13.2c 8.4b z Growth index = [(height + width + perpendicular width)/3] (cm). y Bloom count = number of blooms or buds showing color at 35 days after potting. x Shoot dry weight measured in grams. t 70:30 PB:P substrate amended with Corncob(CC) or Perlite (PL) u Tukeys Studentized Test (P < 0.05, n = 12).
Table 2. Effects of Proccessed Corncob on Growth of Impaitens. Impatiens walleriana 'Dazzler Cranbery' z y x Treatments GI Bc SDW t u 10% CC 28.3a 18.6a 12.2abc 20% CC 27.2ab 17.8a 11.8abc 30% CC 24.2b 16.6a 7.8c 10% PL 28.8a 18.3a 13.5ab 20% PL 27.4ab 18.3a 13.8a 30% PL 26.8ab 14.5a 9.33bc z Growth index = [(height + width + perpendicular width)/3] (cm). y Bloom count = number of blooms or buds showing color at 35 days after potting. x Shoot dry weight measured in grams. t 70:30 PB:P substrate amended with Corncob (CC) or Perlite (PL) u Tukeys Studentized Test (P < 0.05, n = 12).
Floriculture 60
SNA Research Conference Vol. 56 2011
Effects of Organic Fertilizers on Chrysanthemum Nakingense
Yan Zhao, Guihong Bi, and Mengmeng Gu
Mississippi State University, Department of Plant and Soil Science Mississippi State, MS 39762
Index Words: organic fertilizer, inorganic fertilizer, chrysanthemum nakingense
Significance to Industry: Organic farming has emerged in the U.S. to meet the increasing consumer demand for organic products in both local and national markets. More U.S. producers are considering organic farming systems in an effort to capture these high-value markets, boost farm income, and conserve natural resources (3). Organic fertilizers are a source of macro and micronutrients in available forms to improve both the physical and the biological properties of the soil. Nutrients contained in organic fertilizers are released more slowly in the soil ensuring a long residual effect, supporting better root development, and leading to potential higher crop yields (1, 2). Improvement of environmental conditions and public health as well as the need to reduce costs of fertilizer are also important reasons for advocating increased use of organic materials (4). In this study, the effects of different organic fertilizers and vermicompost tea on growth of container-grown chrysanthemum were evaluated. Result showed that the effects of organic fertilizers were comparable with inorganic fertilizer when applied at the same nitrogen rate, except, vermicompost tea which did not show any growth promotion in chrysanthemum.
Nature of Work: The inorganic fertilizer used in this study include slow release fertilizer (SRF) osmocote 13-13-13 (13N-5P-10K, Scotts Co., Marysville, OH) and liquidfeed Peter's 20-10-20 (20N-4K-16K, Scotts Co., Marysville, OH). The organic fertilizer used in this study include SRF Bradfield Bone Meal 9-7-1 (9N-3P-0.8K, Bradfield Organics, Brentwood, MO), Nature Safe 10-0-0 (10N-0P-0K, Nature Safe, Cold Spring, KY) and liquid feed MegaGreen 2-3-1 (2N-1.2P-0.8K, Hydrolysate Co. Isola, MS). Wormwise (Wormwise, Church Hill, MS) was used in combination with both organic and inorganic fertilizers.
This study was conducted in Dorman Greenhouses in Starkville, MS. Treatments were divided into two groups, based on the fertilizer application method (Table1): pre-plant substrate incorporation (Trt. No. 2-10) and fertigation (Trt. No. 11-19). SRFs were applied at 0.4 g N/pot and 0.8 g N/pot. Peter's 20-10-20 was applied at 150 ppm and 300 ppm weekly. MegaGreen was applied at 150 ppm and 300 ppm once or twice a week. Extra 100 ml Wormwise was applied to Trt. 8-10, 17-19 weekly. Chrysanthemum cuttings (rooted) were planting in 6'' pot (1020 ml, Fafard 3B Mix (Conrad Fafard, Inc., Agawam, MA) on July 12, 2010 and then pruned back to 5 cm above pot rim on July 13, 2010. Plants were arranged in a randomized complete block design with 6 replications. Water was applied as needed. Plant growth index [GI = (height + widest width + perpendicular width) / 3] and SPAD reading (SPAD-502, Konica Minolta Sensing Inc., Ramsey, NJ) was recorded at 17
Floriculture 61
SNA Research Conference Vol. 56 2011 days after planting (DAP), 35 DAP and 49 DAP. Plants were harvested 49 days after transplanting. Fresh weights (FW) were measured at harvest. Samples were then oven- dried at 60° and dry weights (DW) were measured. Data were analyzed by Duncan's test at 5% confidence level.
Results and Discussion: Plants treated with Bone Meal had significantly lower FW than Osmocote at both low and high rates (Table 1). Plants treated with Nature Safe had similar FW as Osmocote at both low and high rates. Plants treated with Osmocote had significantly higher DW than Bone Meal and Nature Safe at low rate, but not at high rate. Plants treated with MegaGreen once a week had similar FW and DW as Peter's 20-10-20 at both low and high rates. Plants treated with MegaGreen twice a week had higher FW than Peter's 20-10- 20 at low and high rates. Plants treated with MegaGreen twice a week had higher DW at high rate, but similar DW at low rate compared with Peter's 20-10-20. Wormwise did not promote growth in FW or DW when applied in combination with low rate of organic or inorganic SRFs. When applied in combination with MegaGreen, plants treated with Wormwise did not grow as much in FW and DW than plants without it. Wormwise did not promote growth in FW or DW when applied in combination with Peter's 20-10-20.
The results on SPAD and GI of 17 DAP, 35 DAP and 49 DAP had similar trends, so only 49 DAP is presented here. Plants treated with organic fertilizers had similar SPAD compared with inorganic fertilizers at low and high rates. Plants treated with SRFs in combination with Wormwise did not affect SPAD readings, but plants treated with Wormwise in combination with liquid feed fertilizers had lower SPAD compared with plants without Wormwise.
Plants treated with organic and inorganic SRFs had similar GI. Plants treated with Osmocote and Bone Meal in combination with Wormwise had similar GI compared with plants without Wormwise, however, plants treated with Nature Safe in combination with Wormwise did not grow as well as plants without it. Plants treated with MegaGreen once or twice a week at low rate had similar GI compared with plants treated with Peter's 20-10-20 once a week at low rate. When applied at high rate, plants treated with MegaGreen once a week had similar GI compared with Peter's 20-10-20, but plants treated with MegaGreen twice a week had higher GI than plants treated with Peter's 20-10-20. Plants treated with Peter's 20-10-20 once a week and MegaGreen twice a week at low rate in combination with Wormwise did not grow as well as plants without Wormwise. Plants treated with MegaGreen once a week at low rate in combination with Wormwise had similar GI compared with plants without Wormwise.
Literature Cited: 1. Abou El-Magd, M.A. 2006. Effect of organic manure with or without chemical fertilizers on growth, yield, and quality of Broccoli plants. J. Appl. Sci. Res 2:791-798. 2. Edwards, C.A. 2006. Effect of vermicompost teas on plant growth and disease. Biocycle 47(5):28-31. 3. Greene, C.R. 2004. Recent trends in organic production. Agricultural Forum Outlook. 4. Rosen, C.J. and D.L. Allan. 2007. Exploring the benefits of organic nutrient sources for crop production and soil quality. HortTechnology 17:422-430.
Floriculture 62
SNA Research Conference Vol. 56 2011
Table 1. Effect of fertilizers on fresh weight (FW), dry weight (DW), leaf SPAD value, and plant growth index (GI) of Chrysanthemum nakingense. Nitrogen (N) Trt Fertilizer Rate Note* FW(g) DW(g) SPAD GI(cm)
1 Control 0 10.4 h 3.0 h 20.68f 18.2f 31.43ab 2 Osmocote 13-13-13 0.4gN/pot 45.1 bcd 13.1 ab c 29.1abc
3 Osmocote 13-13-13 0.8gN/pot 52.0 b 14.4 a 33.82ab 30.9ab Bradfield Bone Meal 9- 4 7-1 0.4gN/pot 23.2 efg 7.0 d-g 25.63c-f 26.6b-e Bradfield Bone Meal 9- 11.6 30.77ab 5 7-1 0.8gN/pot 36.3 cd abc c 29.7abc 27.75b- 6 Nature Safe 13-0-0 0.4gN/pot 32.8 def 8.9 c-f e 30.1abc 11.0 29.33a- 7 Nature Safe 13-0-0 0.8gN/pot 43.1 bcd abc d 30.8ab 11.0 29.87a- 8 Osmocote 13-13-13 0.4gN/pot W/w 41.3 bcd abc d 29.8abc Bradfield Bone Meal 9- 9 7-1 0.4gN/pot W/w 20.6 fgh 5.9 e-h 23.02ef 24.9cde
10 Nature Safe 13-0-0 0.4gN/pot W/w 21.0 fgh 6.3 e-h 22.33ef 23.6de
11 20-10-20 150 ppm Weekly 33.4 de 9.4 b-e 33.78ab 27.3bcd 10.3 12 20-10-20 300 ppm Weekly 44.4 bcd bcd 33.43ab 27.7bcd 11.1 13 MegaGreen 2-3-1 150ppm Twice 47.5 bc abc 34.70a 31.3ab
14 MegaGreen 2-3-1 300ppm Twice 65.8 a 14.6 a 34.30a 33.6a 11.6 30.08ab 15 MegaGreen 2-3-1 150ppm Weekly 39.9 bcd abc c 30.3ab 12.4 16 MegaGreen 2-3-1 300ppm Weekly 46.3 bc abc 31.97ab 28.6a-d
17 20-10-20 150 ppm W/w 24.2 efg 6.1 e-h 23.02ef 22.1ef 23.88de 18 MegaGreen 2-3-1 150ppm Bi/w 15.4 gh 4.0 gh f 17.8f
19 MegaGreen 2-3-1 150ppm W/w 18.8 gh 5.5 fgh 22.48ef 23.4de * Fertilizers in Trt. 2-10 were incorporated in substrate before planting. W/w indicates weekly application of 100 ml Wormwise per container. Weekly indicates fertigation was applied weekly. Twice indicates fertigation was applied twice a week. Bi/twice indicates fertigation was applied twice a week and 100 ml Wormwise once a week. Treatments with same letter in the same column are not significantly different with Duncan's test at 5% confidential level.
Floriculture 63
SNA Research Conference Vol. 56 2011
Selection of Gardenia Variants from Seeds
Suping Zhou, Sarabjit Bhatti, Roger Sauve, Jing Zhou, Zong Liu, and Brian D. Copeland
Tennessee State University, School of Agriculture and Consumer Sciences, Department of Agricultural Sciences, 3500 John A Merritt Blvd, Nashville, TN 37209
Index Words: Gardenia, tissue culture, variants, plant height
Significance to the Industry: Gardenia (Gardenia jasminoides) is a genus of 142 species of flowering plants in the coffee family, Rubiaceae. Plants of the evergreen species have appealing leaves that are broad, dark green and glossy with a leathery texture, and white flowers that are highly fragrant. Gardenia is a self-pollinating plant and is widely used in gardens in warm temperate and subtropical climates. This study was done to determine the types of variants from the seeds.
Nature of Work: Two red gardenia berries were collected from a garden plant. Upon cutting open the berries, some seeds were found to be dark, almost black and fully mature while the others had a lighter color. These seeds were surface sterilized in 10% commercial bleach for 10 min. After rinsing with autoclaved water, seeds were placed on agar plates and incubated at 24ºC under light conditions.
The lighter colored seeds germinated within one week, and the darker seeds germinated about three weeks later. There was a 100% germination rate. After two months, the seedlings were transferred into 6 inch pots containing fafard 2, a peat- based commercial potting mix and placed under a mist system in the greenhouse with temperature set at 24ºC. After one month when new growth appeared, these plants were transferred to 1/2 gallon pots and were grown in the greenhouse (Fig. 1) to observe phenotypes of the plants.
Results and Discussion: During the initial stage of growth when the seedlings had only two-three leaves, the variation appeared as whitish spots on the leaf surface of some plants. This trait disappeared as plants grew bigger. All the leaves turned smooth and glossy green, however, the depth of the green color varied among plants.
Gardenia plants started to bloom after two years. The blooms appeared on only a few plants in the spring of 2010 and lasted to the end of June. No plants bloomed in August and September. Around the end of October and the beginning of November 2010, most (> 90%) of the plants had a large number of blooms (Fig. 6). Short day photoperiods of 9 hours duration for 4 weeks have been found to be necessary to obtain highest flower counts (1).
The phenotypes of the blooming plants (2 year old) were examinated. The main distinction was in plant height, and the branching habit of the plants. This was evident
Floriculture 64
SNA Research Conference Vol. 56 2011 early on when the plants were still young (Fig. 2). Plants belonging to the taller group have very straight and strong stems (Fig. 4). The shorter group (Fig. 3) is characterized by more branching. As the plants matured, the differences became more pronounced. Figs. 5 and 6 show a representative plant of each group. The average height of the plant on the right, representing the taller group, is 75 cm and the one on the left representing the shorter group has an average height of 45 cm.
Mutation frequencies in natural populations vary greatly in different plants. A study in Thailand reported on somaclonal variation in Gardenia leaf tissue after receiving 2iP in vitro (2), even though 2iP is not recognized as a mutagenic agent. In the current study, two types of mature gardenia plants grown from seeds were selected. The one bearing a straight and tall stem may be more suitable for use as an outdoor plant, particularly as a hedge plant. The shorter one is compact and thus appears to be more suitable for growth as a potted indoor plant.
Literature Cited: 1. Conover, C.A., T.J.Sheehan, and R.T. Poole. 1968. Flowering of Gardenias as affected by photoperiod, Cyclocel and B-9. Florida Agricultural Experiment Station Journal series No. 3116. 2. Chuenboonngarm, N., S. Charoonsote, and S. Bhamarapravati. 2001. Effect of BA and 2iP on shoot proliferation and somaclonal variation of Gardenia jasminoides Ellis in vitro culture. ScienceAsia 27:137-141.
Floriculture 65
SNA Research Conference Vol. 56 2011
Fig.1. Gardenia plant at 24 weeks. Fig.2. Differences in height and branching pattern in 24 week old gardenia plants.
Fig.3. Two year old plants with profuse Fig.4. Two year old gardenia plants showing branching. upright single stem.
Figs.5 & 6. Differences between the two gardenia types at different stages of growth. The plants on the left are shorter with an average height of 45 cm and have more branching, while the ones on the right are taller with an average height of 75 cm.
Floriculture 66
SNA Research Conference Vol. 56 2011
Entomology
Scott W. Ludwig Section Editor and Moderator
Entomology 67
SNA Research Conference Vol. 56 2011
Effects of plant age and cultivar on western flower thrips damage threshold for Impatiens wallerana
Yan Chen1*, Richard Story2, Roger Hinson3, and Allen D. Owings1
1LSU AgCenter Hammond Research Station, 21549 Old Covington Highway, Hammond, LA 70403; 2LSU AgCenter Department of Entomology, Baton Rouge, LA 70803 3LSU AgCenter Department of Agricultural Economics and Agribusiness, Baton Rouge, LA 70803
Index Words: bedding plant, pest susceptibility, vegetative growth, reproductive growth, economic threshold
Significance to Industry: Western flower thrips is one of the most challenging insect pests for bedding plant production. Impatiens ‘Dazzler Violet’ and ‘Super Elfin Red’ are relatively susceptible and resistant to thrips feeding damage, respectively. Plants at 3, 6, or 9 weeks into production were inoculated with 0, 25, 50, or 75 female adult thrips and evaluated for thrips damage for four weeks. Number of leaves showing damage and visual damage ratings increased with increasing numbers of thrips inoculated. Plant age at the time of thrips infestation significantly affected the severity of damage and the ability of plants to recover from the damage. These results suggest that thrips infestation levels and plant age are important factors to consider when developing action thresholds.
Nature of Work: Western flower thrips (Frankliniella occidentalis) has become a significant pest problem in bedding plant production. Alternative strategies are needed to manage this pest because of the limited number of effective insecticides currently available (1, 2). Impatiens cultivars that are relatively resistant to thrips have been reported (3). It has also been reported that level of thrips damage to impatiens is affected by the growing stages. Plants with flowers sustain much less visual damage to the foliage than plants at vegetative stage (4). However, information on interactions between cultivar, plant age, and thrips infestation level is lacking. Therefore, the objective of this study was to assess thrips damage on susceptible and resistant cultivars at three growing stages to help develop action thresholds. ‘Dazzler Violet’ and ‘Super Elfin Red’ were chosen for this study because the former is more susceptible to thrips damage and both cultivars are popularly grown by the industry (3).
Seeds were sown and transplanted at different dates to obtain plants of different ages (3-, 6-, and 9-week old) and for four replications overtime. A total of 24 plants were used for each treatment replication (2 cultivars x 3 ages x 4 subsamples). Single-plant cages were constructed using 5-gal plastic buckets purchased from The HomeDepot. Four
Entomology 68
SNA Research Conference Vol. 56 2011
windows, each 6 x 12 inches were cut on the sidewall of a bucket and covered with no- thrips screen (GreenTek, Janesville, WI). The top of bucket was covered by a muslin cloth and held in place by rubber bands. Plants were placed inside the buckets and watered by drip irrigation via a tube snuggly fit through a hole drilled on the sidewall. Plants were inoculated with 0, 25, 50, or 75 on 4 different inoculation dates as four treatment replications. Female adult thrips were selected from a colony reared on green beans under laboratory conditions at the research station and placed into a 2-ml petit tube with cap closure. Tubes were then taken to the greenhouse, opened, and placed on the plant inside each bucket. Thrips were allowed to feed and develop for 7 days and were removed by an insecticide spray. Plants were taken out of cages and grown on benches for evaluation during a 4-week period. Thrips damage was assessed by counting the number of damaged leaves and a visual damage rating using a scale from 1 to 10, where 0 = no damage, 1 to 3 = minor damage, 4 to 6 = moderate damage, 7 to 9 = severe damage, and 10 = complete dead. At week 4 of the evaluation, plants were cut and placed into an oven for dry weight measurements. These treatments were replicated 4 times over time.
Results and discussions: Significant interactions were found between cultivar and plant age for all variables, therefore, data are presented by cultivar. ‘Dazzler Violet’, the cultivar more susceptible to thrips feeding damage had more damaged leaves and fewer flowers than ‘Super Elfin Red’ (Fig. 1, flower data not shown). However, damage ratings of the two cultivars were similar throughout the evaluation (Fig. 2). This suggests that visual damage ratings may be less effective than counting damaged leaves in detecting differences among cultivars. Both number of damaged leaves and visual damage ratings increased with increased thrips densities (Fig. 1 and 2). Overall, damage ratings decreased from week 1 to week 3 because of new growth and new leaves that replaced damaged leaves (Fig. 2). This recovery (decrease in damage ratings) was negatively correlated with thrips inoculation density (r = 0.49, p = 0.0352) and plants inoculated with 25 thrips generally recovered more quickly than those inoculated with 75 thrips.
Plant age at the time of thrips infestation significantly affected both number of damaged leaves and damage ratings (Fig. 1 and 2). Younger plants (3-week old at inoculation) had fewer damaged leaves than older plants. This is most likely due to the fact that smaller plants have fewer leaves (Fig. 1). Three-week old ‘Super Elfin Red’ had higher damage ratings than six- and 9-week old plants when infested with 75 thrips and rated at 2 or 3 weeks after thrips removal, and three-week old ‘Dazzler Violet’ had higher damage rating than six- or nine-week old when infested with 75 thrips at 3 weeks after thrips removal (Fig. 2). Infestation with 75 thrips per plant reduced dry weight for plants that were three- or six-week old at inoculation 4 weeks after thrips removal compared to plants infested with 25 or 50 thrips (Data not shown). Dry weight of plants that were 9- week old at the inoculation was not affected.
These results suggest that thrips infestation levels and plant age are important factors to consider when developing action thresholds. The number of damaged leaves, as has been used in developing action threshold for bedding plants, may not be an accurate
Entomology 69
SNA Research Conference Vol. 56 2011
action threshold indicator for young plants. Instead, percentage of damaged leaves may serve as a better indicator.
Literature: 1. Immaraju, J.A. T.D. Paine, J.A. Bethte, K.L. Robb, and J.P. Newman. 1992. Western flower thrips (Thysanoptera: Thripisae) resistance to insecticides in coastal California greenhouses. J. Econ. Entomol. 85:9-14. 2. Loughner, R.L., D.F. Warnock, and R.A. Cloyd. 2005. Resistance of greenhouse, laboratory, and native populations of western flower thrips to spinosad. HortScience 40:146-149. 3. Herrin, B. and D. Warnock. 2002. Resistance of impatiens germplasm to western flower thrips feeding damage. HortScience 37:802-804. 4. Chen, Y., K.A. Williams, B.K. Harbaugh, and M.B. Bell. 2004. Effects of tissue phosphorus and nitrogen in Impatiens wallerana on western flower thrips (Frankliniella occidentalis) population levels and plant damage. HortScience. 39(3): 545-550.
Figure 1. Number of damaged leaves on ‘Dazzler Violet’ and ‘Super Elfin Red’ impatiens 3 weeks after thrips were removed by insecticide spray. Plants were 3-, 6-, or 9-week old at the time of thrips inoculation, and 7, 10, and 12 weeks old at the time of this evaluation
Entomology 70
SNA Research Conference Vol. 56 2011
Figure 2. Visual damage ratings of ‘Super Elfin Red’ and ‘Dazzler Violet’ impatiens at weeks 1, 2 and 3 after thrips had been removed from plants. Plants were inoculated with 0, 25, 50, and 75 western flower thrips prior to evaluation and thrips were allowed to feed for 7 days.
Entomology 71
SNA Research Conference Vol. 56 2011
Fall and spring insecticide drenches to manage azalea lacebugs
Steven D. Frank
North Carolina State University, Department of Entomology, Campus Box 7613, Raleigh, NC 27695
Index words: Stephanitis pyrioides, Acelepryn, Merit, DPX-HGW86, azalea
Significance to Industry: We investigated the efficacy of fall versus spring drenches of Merit (imidacloprid), Acelepryn (chlorantraniliprole), and DPX-HGW86 (Cyantraniliprole)against azalea lacebug in ornamental landscapes. This is significant to the nursery industry because imidacloprid provided good control when applied in the fall. Fall insecticide applications would reduce the amount of work in the busy spring season. In addition, if applications are made in the fall there is no chance that growers will miss the onset of lacebug activity and incur damage that will be sustained for years on evergreen azaleas. Fall applications of imidacloprid and other systemic insecticides could provide good protection of other in-ground and container grown crops.
Nature of Work: Azalea lacebug, Stephanitis pyrioides, is an important pest of azaleas in production nurseries and ornamental landscapes. Azalea lacebugs damage plants by piercing leaf tissue and sucking out leaf contents. This results in stippling damage that reduces the aesthetic and monetary value of plants. A number of insecticides are available to reduce azalea lacebug abundance and damage. Chemical applications are generally timed to lacebug activity in the spring. However, if applications are made after lacebugs become active plants will incur injury. Since evergreen azaleas retain their leaves, damage also persists for many years. Therefore, we investigated the use of fall drench applications of imidacloprid, Acelepryn, and DPX-HGW86 to prevent lacebug damage in spring.
This experiment was conducted using azaleas planted in ornamental landscapes on the campus of North Carolina State University in Raleigh, NC. Plants were assigned to treatments within a randomized complete block design with 5 replicates of 17 treatments. All plants were 2 feet high. Applications were made on 14 October 2009 or 5 March 2010 using a soil basal drench. A shallow trench was made around each Azalea prior to treatment to ensure the solution stayed near the root flare.
Data was collected 26 May 2010 by beating 2 samples of foliage from each plant 10 times each into an 8 x 12 inch white plastic tray. The number of lace bugs in the tray was counted. Since this was conducted at the end of the first generation of lace bugs all insects sampled were adults. In addition, ten leaves from the current years’ growth were randomly selected from each plant and returned to the laboratory. The percent of
Entomology 72
SNA Research Conference Vol. 56 2011 the leaf surface with lace bug damage was estimated visually. This is an estimate of the accumulated feeding by lace bugs since they emerged in spring and a measure of aesthetic damage. Under a dissecting scope the number of fecal spots on each leaf was counted. This is also a measure of accumulated lace bug activity on leaves and fecal spots compromise plant aesthetics. The mean value of the ten leaves per plant was the data point for each plant.
Data were log(x+1) transformed prior to analysis to meet assumptions of ANOVA. In addition, block 5 was removed from analysis because only one insect was captured on these plants and so they provided no data.
Results and Discussion: There was no significant difference in number of lacebugs per plant (Table 1). Merit was the only product applied in fall that significantly reduced feeding damage compared to the untreated check (Table 1). Spring applications of Merit or DPX-HGW86 reduced lacebug feeding damage in spring. Using fecal spots as another measure of lacebug activity, spring applications of Merit or the experimental reduced the number of fecal spots that accumulate on leaves. Plants treated with Acelepryn tended to have more damage and fecal spots than other treatments (Table 1). Although some treatments were effective, statistical power is limited by the number of treatments and replicates so further work may be needed to refine recommendations.
An interesting result of this study is that lacebug abundance was quite variable between treatments but feeding damage and fecal spots differed between treatments. This suggests movement of lacebugs between plants. Lacebugs move from plants in response to competition or predators (1). However, it appears if they land on plants treated with Merit they feed very little and do not remain long enough to deposit much fecal material. Merit applied in the fall or spring generally reduced lacebug activity on landscape azalea plants.
References 1. Shrewsbury , P.M. & Raupp, M.J. 2006. Do top-down or botton-up forces determine Stephanitis pyroides abundance in urban landscapes? Ecological Applications 16, 262- 272.
Acknowledgements: This work was funded by Dupont and carried out in cooperation with Chuck Silcox. Assistance was provided by Alan Stephenson and Adam Dale.
Entomology 73
SNA Research Conference Vol. 56 2011
Table 1. The number of lacebugs, fecal spots, and percent feeding damage on azaleas after fall and spring drench applications of systemic insecticides. Treatments with different letters within a column are significantly (P<0.05) different.
# No # Fecal % Treatment Rate Rate Unit Lacebug . Spots Damage s Fall Applications fl oz/ plant 1 Acelepryn 0.0625 1.9 a 5.8 a-d 10.25 a-d ft. fl oz/ plant bc 2 Acelepryn 0.125 7.3 a 3.0 a-d 6.25 ft. d 3 Acelepryn 0.25 fl oz/ plant 4.0 a 4.8 a-d 10.63 a-d bc 4 DPX-HGW86 0.0625 fl oz/plant ft. 2.0 a 3.5 a-d 6.00 d fl oz/ plant 5 DPX-HGW86 0.125 2.5 a 4.0 a-d 14.00 a-d ft. fl oz/ plant 6 DPX-HGW86 0.25 2.0 a 6.8 a-d 13.38 a-d ft. 7 Merit 0.0345 oz / plant ft. 4.3 a 2.3 a-d 3.50 cd 8 Merit 0.069 oz / plant ft. 0.8 a 0.0 d 0.13 d Spring
Applications fl oz/ plant 9 Acelepryn 0.0625 7.8 a 24.5 a 32.50 ab ft. fl oz/ plant 10 Acelrpryn 0.125 2.0 a 21.0 ab 36.38 a ft. fl oz/ plant ab ab 11 Acelepryn 0.25 3.0 a 18.8 22.75 ft. c c fl oz/ plant 12 DPX-HGW86 0.0625 0.0 a 0.5 cd 1.53 cd ft. fl oz/ plant 13 DPX-HGW86 0.125 0.0 a 0.0 d 3.50 cd ft. fl oz/ plant bc 14 DPX-HGW86 0.25 1.0 a 1.3 3.00 cd ft. d 15 Merit 0.0345 oz / plant ft. 0.8 a 0.0 d 0.13 d 16 Merit 0.069 oz / plant ft. 6.0 a 4.5 a-d 10.75 cd Untreated ab 17 4.5 a 7.3 a-d 19.13 Check c Treatment F 1.294 1.870 2.680 Treatment Prob(F) 0.2405 0.0484 0.0043
Entomology 74
SNA Research Conference Vol. 56 2011
Gleanings from a Five State Pest Management Strategic Plan and Crop Profile Amy Fulcher1, Craig Adkins2, Greg Armel1, Matthew Chappell3, J.C. Chong4, Steven Frank5, Frank Hale6, Kelly Ivors7, William Klingeman III1, Anthony LeBude7, Joe Neal8, Andrew Senesac9, Sarah White10, Jean Williams-Woodward11, and Alan Windham6
1University of Tennessee, 2431 Joe Johnson Drive, Rm. 252 PSB, Knoxville, TN 37996-4561 2NCSU, Caldwell County Extension Office, 120 Hospital Ave NE/Suite 1, Lenoir, NC 28645 3University of Georgia, 211 Hoke Smith Building, Athens, GA 30602 4Clemson University, Pee Dee Research and Education Center, 2200 Pocket Road, Florence, SC 29506-9727 5NCSU, 3318 Gardner Hall, Box 7613, Raleigh, NC 27695-7613 6University of Tennessee, Soil, Plant and Pest Center, 5201 Marchant Drive, Nashville, TN 37211-5112 7NCSU, Mountain Horticultural Crops, Research & Extension Center, 455 Research Drive, Mills River, NC 28759 8NCSU, 262 Kilgore Hall, Box 7609, Raleigh, NC 27695-7609 9Cornell University, Long Island Horticultural Research & Extension Center, 3059 Sound Avenue, Riverhead, NY 11901 10Clemson University, E-143 Poole Agricultural Center, PO Box 340319, Clemson, S.C. 29634 113313 Miller Plant Science Bldg., Athens, GA 30602-7274
[email protected] Index words: disease, insect, integrated pest management, nursery crop, weed
Significance to the Industry Pest problems can cause substantial lost revenue (dead and unhealthy/unmarketable plants) and increased inputs (labor, fuel, and pesticide) for ornamental plant producers. A focus group composed of industry and academic members identified and prioritized Extension, research, and regulatory issues for the nursery crop industry. This information will help growers, land grant professionals and administrators, and government officials focus resources on the most relevant pests. Additionally, this information will allow regional comparisons of serious nursery crop pests and will allow for temporal comparisons of pertinent nursery crop pests.
Nature of Work Growers face many challenges to growing a healthy, profitable nursery crop. Pests can cause substantial losses to the nursery industry. For example, In North Carolina, the green industry reported annual losses of $91,000,000 due to insects and diseases (2). A regional group of Extension professionals formed in October 2008 to address nursery crop production needs through integrated pest management (IPM) programming. The group, the Southern Nursery IPM Working Group (SNIPM),
Entomology 75
SNA Research Conference Vol. 56 2011 represented five states: Georgia, Kentucky, North Carolina, South Carolina, and Tennessee. The initial goal of the working group was to acquire funding to develop a five state nursery crop pest management strategic plan (PMSP) and crop profile (CP) and to subsequently create these two documents that could be used to define research and Extension objectives.
So that the PMSP and CP would accurately reflect current needs of the nursery crop industry, growers (two per state) were invited to form a focus group with the Extension professionals. Growers were selected to broadly represent the respective state’s nursery industry. In advance of the meeting, growers identified their top insect, weed and disease problems.
A two-day facilitated sharing session and needs assessment took place with the focus group on July 30-31, 2009 in Mills River, NC. At the meeting, Extension professionals provided overviews of the production characteristics and metrics for each respective state. Growers provided an overview of their nursery followed by common pest problems and challenges to managing those problems. Growers again prioritized pests within each pest category (insect, disease, weed) as follows:
Insect pests - For insect pests, growers ranked the previously identified pests using a ballot system. Specifically, each focus group member was issued 10 votes and was permitted to use them at his or her discretion to vote for insect pests based on difficulty to control and prevalence. All votes could be used on one pest or divided among several insect pests. Not all votes had to be cast.
Disease pests - In order to rank diseases, the facilitator guided the focus group in a consensus-building process to rank the pests, greatest to least.
Weed pests - To rank weeds, the facilitator guided the focus group in a process to review and modify, as needed, the pre-meeting weed rankings to reflect the current group consensus.
Growers also identified specific emerging pests as well as issues influencing insect, disease, and weed control such as contaminated irrigation water, and non pest issues, (e.g. water availability, water rights, etc). Finally, growers were asked to identify Extension, research, and regulatory priorities for each pest category and overall priorities through facilitation and a consensus-building process. These data were assimilated into a five state pest management strategic plan and crop profile (1).
Results and Discussion Focus groups developed final pest rankings for insects, diseases, and weeds (both container and field production)(Tables 1-4).
Insect pests - Insects were ranked for both difficulty to control and prevelence. Borers (flatheaded and clearwing), granulate ambrosia beetle, mites and scales accounted for 91% and 73% of the difficult to control and prevelence pest votes, respectively (Table 1).
Entomology 76
SNA Research Conference Vol. 56 2011
Disease pests - Diseases ranged from leaf spots and mildew, bacterial and fungal blights, root rots, and cankers (Table 2). Root rots (Phytophthora and Pythium) were the most highly ranked disease problem.
Weed pests - Ten weed species were identified as major nursery pests (Table 3). More weed species were listed for container production than for field production. Marestail [horseweed; Conyza canadensis (L.) Cronquist] was listed in field production specifically because of concern regarding glyphosate-resistant plants. An additional 12 weed, algae and liverwort species were identified as emerging or potential pests for nursery producers in the southeast (Table 4).
Based on the focus group discussion, 34 Extension and research priorities were developed for insect, disease, and weed pests (Tables 5-10). Overall Extension, research, and regulatory priorities were often very specific, but spanned a broader range of concepts than previously discussed by the focus group, sometimes including issues outside of pest management (Tables 11-13).
A focus group of field and container nursery crop producers and Extension professionals identified and prioritized major nursery pests. The focus group was also able to develop priorities for Extension programming and applied research for five southeastern U.S. states. These priorities can be used to develop state-wide or multi- state strategic plans, define research and Extension objectives, and support grant proposals.
Acknowledgments The authors gratefully acknowledge funding provided by the Southern Region IPM Center and the assistance of Mr. Steve Toth and Ms. Patty Lucas.
Literature Cited 1. Adkins, C., G. Armel, M. Chappell, J.C. Chong, S. Frank, A. Fulcher, F. Hale, W. Klingeman, K. Ivors, A. LeBude, J. Neal, A. Senesac, S. White, J. Williams- Woodward, and A. Windham. 2010. Pest Management Strategic Plan for Container and Field-Produced Nursery Crops in Georgia, Kentucky, North Carolina, South Carolina and Tennessee. A. Fulcher (ed.). Southern Region IPM Center.
Entomology 77
SNA Research Conference Vol. 56 2011
Table 1. SNIPM focus group identification of arthropod pests in the southeast based on grower-perceived difficulty to control and prevelance in field and container nursery production.
Arthropod Difficulty to Control Prevalence (votes) (votes) Scales 261 202 Borers 17 17 Granulate ambrosia 15 12 beetle Mites 14 16 Root grubs/weevils 5 3 Caterpillars 1 1 Leafhoppers 1 7 Aphids 0 6 Japanese beetle 0 5 Flea/leaf beetles 0 2
1 Number of votes cast by insect, greater number of votes indicates more focus group members identified this as a problem insect. 2Number of votes cast indicating how frequently focus group members encounter the pest.
Table 2. SNIPM focus group ranking of diseases in the southeast by grower-perceived importance.
Disease Rank1 Root rots (Phytophthora and Pythium spp.) 1
Fungal leaf spots 2 Powdery mildew 3 Downy mildew 4 Phomopsis 5 Black root rot 6 Botryosphaeria 7 Cedar rusts 8 Passalora needle blight, Cercosporidium needle 9 blight or Cercospora blight) Fire blight 10
1Rank = 1 greatest importance, 10 lowest importance.
Entomology 78
SNA Research Conference Vol. 56 2011
Table 3. SNIPM focus group ranking of container and field production weeds in the southeast by grower-perceived importance.
Container Production Field Production Level of Weed Species Priority Importance (votes) Weed Species (votes) Spurge 91 Yellow Nutsedge 12 Oxalis/woodsorrel 7 Crabgrass 7 Bittercress 6 Marestail/horseweed 7 Liverwort 5 Groundsel 5 Eclipta 4 Annual bluegrass 2
1Greater numbers of votes indicates more focus group members found this to be a problem weed.
Table 4. Emerging weeds, algae and liverworts of concern in the southeast U.S
Common name Scientific name Algae1 Nostoc spp. American Burnweed Erechtites hieraciifolia Asiatic Hawksbeard Youngia japonica Benghal Dayflower Commelina benghalensis Cogongrass Imperata cynlindrica Dogfennel Eupatorium capillifolium Doveweed Murdannia nudiflora Liverwort Marchantia polymorpha Mulberryweed Fatoua villosa Longstalked phyllanthus, Phyllanthus tenellus (longstalked phyllanthus chamberbitter, P. urinaria, (chamberbitter, gripeweed) gripeweed Ragweed Parthenium Parthenium hysterophorus 1Species are listed alphabetically, not in order of priority or importance.
Entomology 79
SNA Research Conference Vol. 56 2011
Table 5. Entomology Extension priorities (unranked)
Priorities • Monitor the presence and populations of insects and establish action thresholds • Group scale insects and develop management guidelines for each group • Emphasize scouting and early detection to be able to act on thresholds • Use oils early when thresholds are reached to avoid using products that might be more expensive, more toxic or both • Emphasize the importance of decreasing stress on plants and using appropriate production practices to do so
Table 6. Entomology research priorities (unranked)
Priorities • Improve mite management • Develop thresholds and what products to use to avoid secondary pest outbreaks i.e., potato leafhopper applications increasing mite populations • Use of water conditioner for pH • Develop understanding of production practices relationship with pest outbreaks—focus on insect complexes, not on an individual but rather focus on a plant to allow the consolidation of sprays • Determine if improved nutrition in the fall will reduce attacks by the flatheaded apple tree borer in field and container-grown plants. (Some growers use 25 ppm K or Mg nitrate late in summer to gradually slow the plants down • Timing in pruning • Increase chemical efficacy by determining correct surfactants and their rate • Improve borer identification technique, distinguish between various borers • Determine insect biology, host preference and overwintering host preference and how production practices might affect both • Products that control pests with minimal negative effects on natural enemies and pollinators • Determine possibilities for management of granulate ambrosia beetle after they enter trees • Investigate pesticide efficacy, life history, timing of sprays, trials to show using life history and timing of sprays for Japanese maple scale, white peach scale. • Develop thresholds for Japanese beetles
Entomology 80
SNA Research Conference Vol. 56 2011
Table 7. Plant pathology Extension priorities (unranked)
Priority • Develop resources that provide information regarding cultural practices as well as chemical controls with efficacy tables that also include other details such as curative/preventative activity and certain state label restrictions
Table 8. Plant pathology research priorities (unranked) Priority • Evaluate the efficacy of products applied via chemigation
Table 9. Weed Extension priorities (unranked)
Priorities • Improved management guidelines for “hard to control” weeds such as; seasonal timing for postemergent (POST) weed control to manage perennial weed pests in nursery borders, field rows and new (e.g., container and pot- in-pot) production areas • Improved monitoring tools, protocols, and educational programs (e.g., improved guides for identifying “emerging weeds of concern”) • Improved decision-aids for selecting the most appropriate weed management options – (e.g., economic thresholds, efficacy tables, resistance management protocols) • Training leading to development of an overall integrated weed management plan, tailored to each specific production operation, for controlling weeds • Education on avoiding crop damage from herbicides
Entomology 81
SNA Research Conference Vol. 56 2011
Table 10. Weed research priorities (unranked).
Priorities • Biology and ecology of weeds in these unique nursery ecosystems (e.g., environmental and climatic modeling for predicting certain weed seed germination; development and reproduction of common and newly introduced species) • A systematic survey of the current state of weeds in nursery production systems across the southeastern United States • Greater understanding of herbicide persistence and longevity of control relative to the need for re-applications or other supplemental management (e.g., pairing environmental/climatic models with knowledge of herbicide persistence and efficacy to better time both deployment and re-application of preemergent (PRE) herbicides) • Effectiveness and utility of cultural, physical and mechanical controls such as cover crops and living mulches, physical barriers (e.g., landscape fabric, geotextile, woolpack, hair and coir disks and large bark chip topdressings) • Accurate cost accounting of weed management systems including labor for hand-weeding and strategies for efficient resource utilization through use of IPM to decrease weed management costs • Opportunities to achieve efficient weed control with reduced PRE and POST emergence herbicide use, particularly in crops nearing sale date • Understanding and avoiding crop injury from herbicide use in nurseries (e.g.: long-term consequences of POST emergence herbicide use such as glyphosate applications via “Enviromist” sprayer technology, or environmental persistence such as herbicide residue effects on seedling germination and liner growth • Phytotoxicity of both PRE- and POST emergence chemistries on the diverse ornamental crops, with emphasis on new and expanding crop categories (e.g., perennials, ornamental grasses, tropical plants) being grown in the southeastern United States • Development of new weed control technologies and herbicide formulations
Entomology 82
SNA Research Conference Vol. 56 2011
Table 11. Overall Extension priorities (unranked) of nursery producers and Extension professionals in the southeast U.S.
Priorities • Encourage the support and use of county Extension personnel (serving the green industry) in the dissemination of information • Utilize multi state collaboration of university/industry personnel to develop a regional web site/clearing house for compiling and disseminating pest/pest management information • Emphasize use of digital diagnosis through county offices • Develop training and certification for scouting (expand to on-line and through distance education) • Develop and make available efficacy tables to include re-entry intervals and mode of action group • Create awareness regarding timing of pesticide application to increase worker protection and effectiveness of chemicals
Table 12. Overall research priorities identified by nursery producers and Extension professionals in the southeast U.S.
Priorities • Make IPM profitable and viable for nursery crop production • Identify effective treatments for foliar nematodes • Identify plant phenological indicators of arthropod pest activity • Investigate how to manage arthropod pest complexes rather than individual species • Whole systems approaches to pest management • Determine cause and treatment of Cryptomeria tip disorder • Develop more cost effective management of fire ants • Understand glyphosate damage in nursery crops, symptoms, application technology • Determine physiological differences between container and field grown plants with regard to pest susceptibility and pesticide treatments • Develop systemic controls of borer and scale insects • Identify surfactant and penetrate use for insect control in trees • Conduct efficacy and cost analysis of generic pesticides • Develop a controlled release preemergence herbicide • Determine appropriate timing of pest monitoring, scouting, and pesticide applications for weeds, arthropods, and diseases • Test efficacy of chemigation techniques- test efficacy of chemicals • Investigate biology of black root rot
Entomology 83
SNA Research Conference Vol. 56 2011
Table 13. Overall regulatory priorities identified by nursery producers and Extension professionals in the southeast U.S.
Priorities • Evaluate the sustainability of oak production regarding Sudden Oak Death • Resolve questions on required quarantined treatments for fire ants and Japanese beetles • Address use of hydrogen peroxide for water filters • Address chlorine concerns (Homeland Security) • Numerous water issues (availability, quality, runoff, regulations, etc.) • Identification of ornamental production as an agriculture industry
Entomology 84
SNA Research Conference Vol. 56 2011
Approaches in the Southern Region to Research and Extension for Sustainable
Landscape Plant Production, Use and Pest Management
Gary W. Knox* and Russell F. Mizell, III
North Florida Research and Education Center, University of Florida/IFAS, 155 Research Road, Quincy, FL 32351; 850.875.7162
Index Words: green industry, nursery, IPM.
Significance to Industry: Attempts to develop sustainable production, maintenance and integrated pest management (IPM) strategies for the Green Industry have been challenged by the number of plant species, growing methods, climatic zones and site conditions across the U.S. Nevertheless, current market and governmental emphases on sustainability necessitate innovation in developing integrated approaches to make landscape plant production and consumption more environmentally compatible. More than 45 stakeholders from eight states convened at two meetings and developed a series of strategies for southern U.S. regional approaches to create sustainable landscape plant production, use and pest management.
Nature of Work: The Green Industry consists of various component industries linking landscape plant production and consumer use in the landscape. Current pest management efforts that operate independently of plant culture and management practices are ineffective, inefficient and unsustainable. Previous approaches for Green Industry sustainability by research and extension have been piecemeal and have not effectively exploited the interactions between the ecological components of the production systems from a holistic perspective. Changes in research and extension are necessary to provide new breakthroughs to enable growers to progress toward higher sustainability. The time is ripe for innovation in the Green Industry in all sectors to make production more sustainable and consumption more environmentally efficient.
A Planning Grant from the USDA Specialty Crops Research Initiative allowed us to convene two regional planning meetings to develop transdisciplinary, multistate extension/research grant proposals and other activities. We used the regional pest management centers as a model for this effort, with the objective of changing the way landscape plant research, extension and ultimately production and consumption of landscape plants are conducted in the southern United States.
Results and Discussion: Meetings were held 4-5 November 2009 at the University of Florida/IFAS North Florida Research and Education Center in Quincy, FL, and 13-14 May 2010 at the University of Florida/IFAS Mid-Florida Research and Education Center in Apopka, FL, both regional centers of nursery production. Each meeting convened more than 45 scientists, producers, and others from associated industries connected
Entomology 85
SNA Research Conference Vol. 56 2011
with landscape plant production and use in the Southern region. In addition, participants included members of regulatory organizations as well as representatives of the chemical and other allied industries. Attendees represented the states of AL, FL, GA, LA, MS, SC, TN, and TX and the academic disciplines of entomology, plant pathology, weed science and horticulture. The first meeting was organized with the objective of developing a document that builds on available industry data contained in a crop timeline and two pest management strategic plans (Knight 2005; Knox et al. 2003; Mizell et al. 2009) to conceptualize methods to achieve a regional systems approach to sustainable landscape plant production, use and pest management.
In facilitated sessions, the participants determined research, extension and regulatory priorities for the Green Industry. Group participants found commonalities in strategies and tactics that delineate interactions between disciplines to facilitate future transactional outreach and other activities. Common themes and unifying concepts were explored in areas such as: • Plant and pest phenology • Water use as an ongoing factor in production and use of landscape plants • Plant stress as it interacts with pest management • Emerging pests • Key pests and production barriers to their management • Lack of management tools for certain pests, especially "soft" pesticides • Need for pest prediction tools integrating weather, biological and chemical information • Extension: o Output that can be taught, i.e. BMPs. o Linking research more directly to outreach.
Participants then outlined a schedule of attack to move the Green Industry toward more rapid change. The second, follow-up meeting further refined the themes explored.
Final research and extension themes for future projects include: • Regional phenology projects for predictive purposes o Regional research on key pests Study phenology, ecology, biocontrol, detection and monitoring, degree day models, biology, host plant resistance and chemical control of selected model pests such as scale, mites, borers and selected weeds Perform research on a latitudinal basis in-depth to determine requisite understanding of population dynamics and the driving variables to implement habitat management strategies for suppression o Regional phenology gardens as predictive tools Sentinel plots of key plant species across the region for predicting pathogen and pest population phenology based on plant phenology (budding, bloom, etc.; Orton and Green 1989) ipmPIPE (Integrated Pest Management Pest Information Platform for Extension and Education) to deliver pest information
Entomology 86
SNA Research Conference Vol. 56 2011
May not be applicable to the lower South due to lack of distinct seasons • Nursery diversity: defining and exploiting the systems ecology of the nursery to enhance IPM and integrated crop management: o Landscape level structure and function, biological control augmentation, banker plants, multifunctional ecological services (augmentation of beneficials, pollinators, wildlife, nutrient capture, water filtration, erosion control), pathogen epidemiology o Landscape level with geospatial components (varying levels of resolution) o Weeds (contribution to pest problems negative or positive), scales, mites, pathogens Mite IPM – biological control (mycopathogens, predatory mites), habitat manipulations to augment, production practices to suppress outbreaks, determine key habitat factors (moisture, host plant, leaf density, leaf characteristics (hairs, wax, etc.), host plant resistance and environmental interactions. o Ecosystem services – systems structure and function, emergent properties, habitat manipulation, landscape level processes (pollination, salt tolerance, biological control), market groups (colors, pest free, sustainably grown, native, wildlife friendly, drought tolerant, low input landscape plant (little or no irrigation, fertilizer, pesticide, pruning, etc.) o Host plant resistance and its uses in plant production, landscape design, installation and maintenance • Plant stress as it relates to pest susceptibility using borers as model organisms: o Ambrosia beetles: plant stress-insect interactions, regional phenology and monitoring using degree day models; stress factors as they relate to host susceptibility and semiochemistry, host plant resistance, insect behavior o Other wood borers: host quality relationships, monitoring methods, biological controls using nematodes and mycopathogens • Marketing, landscape use, culture and management: o Specialty plants: developing and marketing plants for specific uses or purposes, i.e.: Augmentation of pollinators, natural enemies or wildlife Nutrient capture, water filtration, erosion control o Interactions of cultural factors with pest management: irrigation methods and frequencies, fertilizer, species, cultivars, spacing, arrangement of plant species according to function (ex. nectar through blooms for parasitoids) or practices (similar production requirements), input use and pest occurrence (water, fertilizer, stress), regulatory issues • Extension outreach: o IPM PIPE as a delivery platform for: Regional pest phenology to predict pest occurrence Real-time delivery of pest occurrences in regional sentinel plots Presence and distribution of invasive species o Landscape architect training on designs for pest suppressive landscapes
Entomology 87
SNA Research Conference Vol. 56 2011
o Software updating and integration (e.g., WoodyBug, http://entnemdept.ifas.ufl.edu/fasulo/woodypest/) o Economics: determining cost:benefit ratios of IPM strategies and tactics, pest impacts, measurement o Other topic areas: regulatory issues as related to pests.
Literature Cited: 1. Knight, P., ed. 2005. Pest management strategic plan for container grown ornamental trees in USDA hardiness zones 6-8. Southern Region IPM Program. 61 pp. 2. Knox, G.W., T. Momol, R. F. Mizell, III, and H. Dankers. 2003. Crop timeline for nursery-grown evergreens and shade trees. Quincy, FL: prepared for U.S. Environmental Protection Agency, Office of Pesticide Programs. 32 pp. http://entnemdept.ifas.ufl.edu/fasulo/woodypest/flevergreen_shadetrees.pdf. 3. Mizell, R., G. Knox, P. Knight, C. Gilliam, eds. 2009. Woody Ornamental and Landscape Plant Production and Pest Management Innovation Strategic Plan; http://www.sripmc.org/pmsp/. Nov. 6, 2009. 64pp. 4. Orton, D.A. and T.L. Green. 1989. COINCIDE: The Orton System of Pest Management. Plantsman’s Publications, Flossmoor, Ill. 190 pp.
Acknowledgement: We gratefully acknowledge financial support through the USDA National Institute of Food and Agriculture 2008 Specialty Crop Research Initiative (SCRI) Research and Extension Planning Grant.
Entomology 88
SNA Research Conference Vol. 56 2011
Chemical Control of Armored Scales
Scott W. Ludwig
Texas AgriLife Extension Service, P.O. Box 38, Overton, TX 75684
Key Words: Euonymus, Euonymus scale, Laurus nobilis, California red scale
Significance to Industry: Armored scales can be one of hardest to control pests on nursery grown plants. In two trials, systemic insecticides, contract insecticides, and insect growth regulators provided excellent control of California red scale and euonymus scale. In these trials each plant was individually sprayed. This resulted in thorough spray coverage. Growers often have plants spaced pot tight. As a result it can be difficult to get contact insecticide to all the scales on a plant. When using non- systemic insecticides it is essential to completely cover the plant when applying the insecticide.
Nature of Work: Armored scales are one of the hardest to manage nursery pests. This is due to, plant being placed pot tight, scales located under leaves, and the cryptic nature of many species makes them difficult to detect at low levels. Results are presented from trials conducted evaluating the efficacy of commercially available insecticides against euonymus scales and California red scales on container grown plants.
Euonymus Scales: The efficacy of Aloft SC, Distance, Flagship 25WG, Safari 20SG, Talus 40SC, Safari 2G, TriStar 30SG and Triact 70 was evaluated against euonymus scale (Unaspis euonymi) on euonymus plants (Euonymus japonica, 'Microphylla') grown in one-gallon pots. The trial was conducted on plants obtained from a commercial nursery with a natural infestation of euonymus scale. The trial was conducted on an overhead irrigated nursery pad at the Texas AgriLife Research and Extension Center at Overton, TX. Plants were set up in a randomized complete block design with six replicates. Foliar treatments (Table 1) were applied on 23 Aug and 21 Sep 2009 using an R & D® CO2 backpack sprayer with an 8002VS tee-jet flat spray nozzle at 60 psi. Capsil (6 oz / 100 g) was included in all foliar treatments. The Safari applications were only applied on 23 Aug. To monitor the scale population, branch terminals were collected and 25 scales per plant were evaluated under a microscope to determine if they were dead. Samples were collected on 23 Aug, 21 Sep, and 19 Oct. Percent mortality for each treatment was calculated by dividing the number of dead scales by the total number of scales evaluated. Data were transformed (arcsine√x) prior to analysis. Data were analyzed with ANOVA and means separation was accomplished using the Tukey’s HSD test at P ≤ 0.05.
Entomology 89
SNA Research Conference Vol. 56 2011
California Red Scale: The efficacy of Distance, Flagship 25WG, Marathon II, Safari 20SG, Safari 2G, SuffOil-X, Talstar Flowable, Talus 40SC, and Triact 70 was evaluated against California red scale (Aonidiella aurantii) on bay laurel (Laurus nobilis) plants grown in three-gallon pots in an unheated hoop house. The trial was conducted at a commercial nursery in Wills Point, TX. Plants were set up in a RCB block design with six replicates. Foliar treatments (Table 2) were applied on 5 Feb and 4 Mar 2010. The foliar treatment was applied using an R & D® CO2 backpack sprayer with an 8002VS tee-jet flat spray nozzle at 35psi. Capsil (6 oz / 100 gal) was included in all foliar treatments. The Safari applications were only applied on 5 Feb. To monitor the scale population, five leaves were randomly collected from each pot on 5 Feb and 21 April. Twenty-five adult scales per replicated treatment were randomly selected, flipped over, and recorded as dead or alive by microscopic inspection. Percent mortality for each treatment was calculated by dividing the number of dead scales by the total number of scales evaluated. Data were transformed (arcsine√x) prior to analysis. Data were analyzed with ANOVA and means separation was accomplished using the Tukey’s HSD test at the P ≤ 0.05 level.
Results and Discussion: Euonymus Scales: Fifty-seven days after the first treatment all the insecticide treatments results in significantly higher euonymus scale mortality rates compared to scales on the untreated plants. Both Safari treatments resulted in a mortality rate of over 99%. This is significantly higher than the scale mortality on the TriStar treated plants. This research was supported by the Texas IPM Program and IR-4 Project.
California Red Scale: At the initiation of the trial the plants were infested with all scale life stages. Although the plants were covered with scales, many of them were dead and had not fallen off the plants. This is typical with many scale species. Mortality ranged in the treatments from 47.3% to 68.7%. The scale mortality rate on the untreated plants was 66.7% at the start of the trial and 75 days after the first treatment. The mortality rate increased on the plants that received an insecticide treatment. The Triact 70 treatment was the only treatment that was not significantly different than the untreated control. However, the Triact 70 treatment was statistically similar to the Safari 20SC, Marathon II, Distance IGR, and Talus treatment. The mortality rates were over 93% for the SuffOil-X, Safari 2G, Safari 20SC, Flagship 25WG, Marathon II, Talstar Flowable, Distance, and Talus 40SC treatments. This research was supported by the Texas IPM Program.
These results indicate that with proper application techniques armored scales can be managed with a number of different insecticides. It is important to note that in these trials each plant was individually sprayed. This resulted the pesticides making contact with the scales. Growers often have these plants spaced pot tight. As a result it is difficult for them to get the insecticide to all the leaves and stems.
Entomology 90
SNA Research Conference Vol. 56 2011
Table 1. Mean euonymus scale mortality after insecticide applications. Application Days after treatment Product Rate / 100 gal method 0 29 57 4 oz drech / Safari 20SG 24 fl oz pot 18.7a 66.4abcd 99.3a Safari 2G 2.6 g / pot Top Dress 34.7a 96.0a 99.2a Aloft SC 10 fl oz Foliar 32.7a 82.7abc 97.3ab Distance 12 fl oz Foliar 38.7a 46.7cde 92.8ab Triact 70 2 gallons Foliar 29.6a 91.3ab 90.0ab Talus 40SC 21. 5 fl oz Foliar 21.3a 29.3de 82.7ab Flagship 25 WG 8 oz Foliar 26.7a 68.0abcd 80.1ab Aloft SC 5 fl oz Foliar 23.3a 94.0a 77.3ab TriStar 30SG 8 oz Foliar 30.0a 57.3bcde 62.0b UTC 6 oz 25.3a 17.3e 12.0c Means within a column followed by the same letter are not significantly different (Tukey’s HSD; P> 0.05).
Table 2. Mean California red scale mortality after insecticide applications. Application Days after treatment Product Rate /100 gal method 0 75 SuffOil-X 2 gal Foliar spray 62.0 100 c Safari 2G 2.6 g / pot Top dress 68.7 99.3c Flagship 25WG 8 oz Foliar spray 56.7 99.3c Talstar Flowable 28.5 fl oz Foliar spray 52.0 98.7c Safari 20SG 18 oz Foliar spray 52.0 98.0bc Marathon II 50 ml Foliar spray 47.3 98.0bc Distance 12 oz Foliar spray 61.3 96.7bc Talus 40SC 21.5 fl oz Foliar spray 58.0 94.0bc Triact 70 2 gal Foliar spray 51.3 83.3ab Untreated Check 66.7 66.7a Means within a column followed by different letters are not significantly different (Tukey’s HSD; P< 0.05).
Entomology 91
SNA Research Conference Vol. 56 2011
A New Method for Monitoring Strawberry Rootworm Populations in Nurseries
C. T. Werle and B. J. Sampson
USDA-ARS, Southern Horticultural Laboratory, 810 Highway 26 West, Poplarville, MS 39470
Index words: leaf beetle, Paria fragariae, IPM, scouting
Significance to Industry: The strawberry rootworm, Paria fragariae Wilcox (Coleoptera: Chrysomelidae), is a primary pest of azaleas and other containerized ornamental crops at production nurseries throughout the southeast. The cryptic nature of all life stages of this pest can make detection and subsequently control a challenge. The intent of this project was to improve strawberry rootworm monitoring in nurseries. Proper timing of insecticide applications, when aided by a monitoring program, can be critical to reducing potentially devastating late-season pest outbreaks. This can have the added benefit of increased savings in pest control expenses. Here we discuss a new and effective method for monitoring cryptic pest insect populations in areas of intense overhead irrigation.
Nature of Work: The standard method of sampling for P. fragariae is to manually shake or beat a plant until insects drop onto a beat sheet or into a shallow sweep net (2). This is an effective method when practiced by an experienced scout, but due to the nocturnal and cryptic nature of our target pest, it can prove challenging and time-consuming, and may even be damaging to plants over time. In addition, manual sweeps only represent a snapshot of the insect community while the scout is actively surveying. The nocturnal P. fragariae can take cover under leaf litter during the day, and even when it is collected in a sweep net, it will stubbornly adhere to the underside of bits of debris, playing dead when exposed. These tiny, dark-brown beetles can be easily overlooked by less experienced scouts, or even mistaken for mulch debris.
Sticky cards are commonly used by pest control professionals for monitoring insect populations in greenhouses, where cards are not exposed to adverse weather conditions. In 2009, we conducted an area-wide survey for P. fragariae at 26 azalea production nurseries using sticky cards. It was our hope that this could save time and effort during our monthly tri-state (LA, MS, AL) survey, and that it would permit quick on- site diagnosis of insect pest species. We quickly discovered that sticky cards are rendered useless by the constant barrage of sunlight and water from overhead irrigation risers. Insects that were collected in melting glue would often drift to the bottom of the card where they would be washed away, while the cardboard became waterlogged and the trap either molded or was torn from its twist-tie anchor. Only 68 specimens of P. fragariae were identified from over 900 sticky cards placed at the 26 nurseries, as opposed to 174 specimens collected from manual sweeps.
Entomology 92
SNA Research Conference Vol. 56 2011
For our 2010 P. fragariae survey, we have designed a trap station that incorporates a sticky card with a protective roof. Painted pine boards (1x6) were cut to lengths of 12” for the trap station backing and 10” for the roof, which were screwed together and fitted with U-bolts so that trap stations could be affixed to irrigation risers. Sticky cards were easily stapled and removed from the trap stations. In addition, we incorporated a light trap design for half of the stations using solar-charged garden lanterns (Hampton Bay) with the anticipation of attracting the nocturnally active P. fragariae. Round holes 5” in diameter were cut into roof sections for lanterns to rest in, and sealed with all-weather silicone caulk (Fig. 4). The solar lights charge during the day and power a small LED for 8-9 hours at night.
Two large production nurseries were surveyed with three blocks at each nursery, and an additional block was located at the Southern Horticultural Laboratory for a total of seven research blocks. Each block had one light and one non-light trap installed on separate irrigation risers, with the sticky card roughly level with plant canopy height. Beginning in March, sticky cards were changed out every two weeks. In addition, two plants proximal to each trap station were manually sweep-sampled (ten sweeps per plant) for comparison. Sticky cards were enclosed in protective plastic kitchen wrap and returned to the lab for microscopic analysis. Data from the three collection methods (light traps, non-light traps and sweeps) were analyzed using Tukey’s Test for Multiple Comparisons.
Results and Discussion: Light trap stations collected significantly more P. fragariae compared with non-light trap stations or sweep samples (Fig. 1). Differences between light and non-light trap captures were astonishing at times, with a maximum disparity of 63 P. fragariae collected from a light trap to only 3 at the non-light trap from the same block in early September. The only exception was at site 1, where the non-light traps outperformed the light traps, but this was probably due to one of the light traps malfunctioning for several weeks. Trap captures, with or without a light, were higher at two of our three sites when compared with sweep captures (Fig. 2). The exception was at site three, where non-light captures were slightly lower than sweep captures.
Site differences were observed, with site two largely responsible for the significance (Fig. 2). P. fragariae populations were higher at site two throughout the collection period, as evidenced by higher captures from all three methods.
While light trap captures were significantly higher than sweep captures, using four sweep samples from each block may not be an accurate comparison for these monitoring methods. When considering time, a sweep sample of four plants may take as little as four minutes. Each light trap station operated for 8-9 hours each night for two weeks, and an additional 15-16 hours each day as a non-light trap when the LED was not powered. This comes out to 112-126 hours of light trapping and 210-224 hours of non-light trapping, or 336 hours total for each two-week sample period.
Seasonal effects were apparent from our data (Fig. 3). As P. fragariae became increasingly active in warmer weather, they were more likely to be captured by our trap
Entomology 93
SNA Research Conference Vol. 56 2011 stations. In contrast, as the weather cooled, they may have ceased flying, preferring to crawl up plant stems instead. Overwintering populations of P. fragariae take refuge in leaf litter, but will venture out to feed on foliage. This behavior may make sweep sampling more effective in cooler months, and trap stations more effective in warmer months. This hypothesis is corroborated by the increased effectiveness of sweeps that we found during the cooler months of 2010, and also by comparing our data to that presented by Boyd and Hesselein (1). In examining P. fragariae biology, they found four distinct population peaks in April, June, July and the zenith in August/September, suggesting four separate generations. Interestingly, our research corresponds very similarly to that of Boyd and Hesselein in terms of the timing and severity of outbreaks, though we encountered only three population peaks in April, July and August/September.
In addition to this success with P. fragariae captures, light traps easily outperformed other monitoring methods with more than double the total insect capture. This would suggest that our light trap station may prove useful as a monitoring tool for a range of insect pests at container nurseries. Midges and flower thrips in particular were captured in large numbers from our trap stations.
We recommend monitoring for emerging overwintering populations and early season sprays to disrupt the lifecycle of P. fragariae, and monitoring throughout the summer for subsequent population spikes. Also, practicing good sanitation can greatly reduce refuge for overwintering populations and may significantly reduce pest control costs.
Acknowledgments: We would like to thank Chazz Hesselein of the Alabama Cooperative Extension Service for his invaluable advice and assistance, and Grant Kirker of the USFS Forest Products Lab for initiating this research.
Literature Cited: 1. Boyd, D. W., Jr. and C. P. Hesselein. 2004. Biology of the strawberry rootworm, Paria fragariae (Coleoptera: Chrysomelidae) in containerized azaleas. Proc. South. Nursery Assn. Res. Conf. 49: 200-202. 2. Hesselein, C. P. and D. W. Boyd, Jr. 2003. Strawberry Rootworm Biology and Control. Proc. South. Nursery Assn. Res. Conf. 48: 174-176.
Entomology 94
SNA Research Conference Vol. 56 2011
Figure 1. Mean number of P. fragariae Figure 2. Total number of P. fragariae collected from seven research blocks in collected in 2010 from three sites using 2010, using three different collection three different collection methods: methods. Bars with the same letter are sweeps (blue), non-light traps (red) and not significantly different, according to light traps (green). Tukey’s Test for Multiple Comparisons.
Figure 3. Mean P. fragariae captured bi-weekly with light and non-light traps in 2010 compared with mean bi-weekly sweep collections in 2003 (Boyd and Hesselein 2004).
Entomology 95
SNA Research Conference Vol. 56 2011
Figure 4. Insect monitoring station with solar lantern fixture.
Entomology 96
SNA Research Conference Vol. 56 2011
The black pearl pepper banker plant for biological control of thrips in greenhouses
Sarah Wong and Steven D. Frank
North Carolina State University, Department of Entomology, Campus Box 7613, Raleigh, NC 27695
Index words: banker plant, biological control, minute pirate bug, Orius insidiosus, Western Flower Thrips, Frankliniella occidentalis
Significance to Industry: Sustainable pest management methods are becoming increasingly popular among growers around the world. In the United States, ornamental plants are the second most valuable crop worth $14.7 billion (4). Due to the value of ornamental crops, effective and sustainable thrips management is a priority for ornamental growers (2). Biological control is a form of sustainable pest management that most often involves the release of natural enemies of a targeted pest to either consume or parasitize the pest and decrease its abundance and damage to a crop. Biological control can reduce pest abundance and damage to acceptable levels (5). However, efficacy is unpredictable because natural enemies starve, emigrate from greenhouses, or cannot suppress rapidly increasing pest populations. Growers are hesitant to implement biological control because current implementation practices, in which growers have to repeatedly purchase and release natural enemies, make efficacy inconsistent and often expensive.
This study sheds light on a possible solution to the current problems in biological control by using a banker plant system for sustainable thrips management. A ‘banker plant’ is defined as, “A plant that directly or indirectly provides resources, such as food, prey, or hosts, to natural enemies that are deliberately released within a cropping system” (1). In this study’s particular banker plant system, the ‘Black Pearl’ pepper plant, an ornamental pepper that flowers continuously throughout the year, is placed among crop plants to provide pollen for Orius insidiosus, an omnivorous predator of thrips. Banker plant systems are also compatible with popular pesticide tactics required to manage thrips. The banker plant can be removed from the greenhouse if an insecticide application becomes necessary and replaced after a safe interval to resume thrips suppression by O. insidiosus. The Black Pearl pepper banker plant has the potential to increase and sustain O. insidiosus populations and in doing so would provide preventative and long-term thrips suppression. The following experiment investigates the ability of the Black Pearl pepper to serve as a banker plant by sustaining populations of O. insidiosus.
Entomology 97
SNA Research Conference Vol. 56 2011
Nature of Work: Western Flower Thrips (Frankliniella occidentalis) are one of the most economically important greenhouse pest of ornamental and vegetable crops. Thrips feeding and oviposition cause aesthetic damage to leaves and fruit tissue in the form of deformed leaves and buds. Thrips also transmit tospoviruses such as Tomato Spotted Wilt Virus and Impatiens Necrotic Spot virus which are lethal to many crops and result in significant economic loss. To prevent economic loss, growers rely on frequent insecticide applications to reduce thrips abundance and damage. However, thrips are especially hard to control using insecticides because eggs are protected in leaf tissue, pupae are protected in soil, and larvae and adults feed in curled leaves and buds. In addition, rapid development of resistance has made many insecticides less effective (3).
O. insidiosus is often purchased for the biological control of thrips and is most often used in augmentative biological control. In augmentative biological control, natural enemies are released and pest suppression is expected to occur only from the released individuals, not successive generations. By providing pollen to sustain and retain populations of O. insidiosus throughout a growing season, banker plant systems could make biological control of thrips more effective and affordable. For example, sustaining O. insidiosus in greenhouses before thrips colonize will make biological control more reliable since O. insidiosus will be present when the initial thrips infestation occurs rather than trying to cure an outbreak. Banker plants will also save time and money by decreasing the number of augmentative releases necessary to suppress pests.
The objective of our research was to determine if ‘Black Pearl’ pepper flowers increase O. insidiosus abundance compared to plants with no flowers. We evaluated the ability of flowering and non flowering pepper plants to sustain O. insidiosus populations for three weeks. In January 2010, individual pepper plants were placed in organdy bags in a hoop house that was completely enclosed by plastic covering. The first treatment, hereafter referred to as “flower,” consisted of pepper plants that were allowed and encouraged to flower continuously by picking off the peppers every week. The second treatment, hereafter referred to as “no flower,” consisted of pepper plants that were not allowed to flower and had buds and any opening flowers picked off weekly. The treatments were replicated ten times. The O. insidiosus used in this experiment were purchased from Koppert Biological. At the beginning of the trial, 30 O. insidiosus were placed on each plant with a 2:1 male to female ratio. After 3 weeks plants were beaten over a large white tray and any O. insidiosus adults and nymphs were counted. Alcohol was poured over the remaining contents in the tray, placed into glass jars, and returned to the laboratory. The number of thrips and other prey items was counted under a dissecting scope. Given that the black pearl pepper plant readily and quickly flowers, occasionally a bud would successfully open before the inspection day. To avoid this, plants were inspected daily by looking through the organdy material at the plants and if a mature bud or opening flower was spotted, the bags were opened briefly to remove them. T-tests were used to compare the effect of flower removal on the abundance of O. insidiosus adults and nymphs, flowers, and thrips.
Entomology 98
SNA Research Conference Vol. 56 2011
Results and Discussion: There were 85% fewer flowers on plants in the no flower treatment than in the flower treatment (Figure 1). The presence of flowers on the Black Pearl pepper plants had a positive effect on the abundance of O. insidiosus adults and nymphs. Initially, 30 O. insidiosus were released on each plant. As of week three, the total number of adults decreased in both treatments, however, the number of adults in the flowers treatment was 10 times higher than in the no flowers treatment (Figure 2). The initial number of nymphs for either treatment was zero. As of week three there were significantly more O. insidiosus nymphs in the flowers treatment than the no flowers treatment (Figure 3). The results support our hypothesis that pollen from the Black Pearl pepper can sustain populations of O. insidiosus.
Due to the development time of O. insidiosus, the adults that were present in either treatment as of the third week may have been either the same adults from the initial inoculation or second generation adults that had been initially laid as eggs on the Black Pearl pepper plant. Surviving adults were likely feeding on pollen and other plant resources as well as thrips (Figure 4) and pests such as aphids and white flies (data not shown). Since the abundance of these prey was equal in both treatments, the importance of pollen from the Black Pearl pepper plant in the development and survival of O. insidiosus becomes apparent. In many commercial greenhouses, pollen for natural enemies is scarce and unable to sustain natural enemy populations when pests are not abundant. As a result, natural enemies either die for lack of food or leave the greenhouse in search of food and suitable mates or oviposition sites. This study shows the Black Pearl pepper’s ability to provide adequate amounts of pollen to sustain O. insidiosus abundance and reproduction. Proposed future studies with the Black Pearl pepper banker plant system include full greenhouse experiments to determine the optimum frequency of and distance between banker plants for effective thrips suppression.
Literature Cited
1. Frank, S. D. (2010). "Biological control of arthropod pests using banker plant systems: Past progress and future directions." Biological Control 52(1): 8-16. 2. IR-4. 2007. Ornamental Horticulture Survey. http://ir4.rutgers.edu/ornamental/SummaryReports/2007OrnamentalHorticultureSurv ey.pdf 3. Jensen, S. E. (2000). Insecticide resistance in the western flower thrips, Frankliniella occidentalis. Integrated Pest Management Reviews, 5, 131-146. 4. USDA. (2002). 2002 Census of Agriculture. http://www.agcensus.usda.gov/Publications/2002/index.asp 5. Vasquez, G.M., Orr, D.B., & Baker, J.R. (2006) Efficacy assessment of Aphidius colemani (Hymenoptera: Braconidae) for suppression of Aphis gossypii (Homoptera: Aphididae) in greenhouse-grown chrysanthemum. Journal of Economic Entomology, 99, 1104-1111.
Entomology 99
SNA Research Conference Vol. 56 2011
Figure 1. The average number of open flowers on ‘Black Pearl’ pepper plants after three weeks of flower removal.
Entomology 100
SNA Research Conference Vol. 56 2011
Figure 2. The average number of adult O. insidiosus on ‘Black Pearl’ pepper plants with and without flowers three weeks after releasing 30 adult O. insidiosus.
Entomology 101
SNA Research Conference Vol. 56 2011
Figure 3. The average number of nymphal O. insidiosus on ‘Black Pearl’ pepper plants with and without flowers three weeks after releasing 30 adult O. insidiosus.
Entomology 102
SNA Research Conference Vol. 56 2011
Figure 4. The average number of thrips on ‘Black Pearl’ pepper plants with and without flowers three weeks after releasing 30 adult O. insidiosus.
Entomology 103
SNA Research Conference Vol. 56 2011
Usefulness of fire ant genetics in insecticide efficacy trials
Tim Rinehart1 and Jason Oliver2
1USDA-ARS Southern Horticultural Laboratory, 810 Highway 26 West, Poplarville, MS 39470 2Tennessee State University, School of Agriculture and Consumer Sciences, Otis L. Floyd Nursery Research Center, 472 Cadillac Ln., McMinnville, TN 37110
Index Words: SSR, microsatellite, genetic diversity.
Significance to Industry: Red (Solenopsis invicta Buren) and black (Solenopsis richteri Forel) imported fire ant and their hybrids have spread throughout the southeastern United States after being introduced in Mobile, Alabama in the late 1930’s. New infestations can be caused by infested sod and nursery stock that are shipped outside the ant’s current range. Nursery items, such as balled nursery stock, that are shipped to areas outside of the quarantine zone must be certified and compliant with USDA-APHIS regulations. Control measures generally include insecticide treatments, which are updated and revised as new research and products are available to improve the management of imported fire ants. Our objective here is to better understand the results of pesticide efficacy trials by analyzing the genetic background of fire ants in colonies being treated.
Nature of Work: Mature fire ant colonies contain an average of 80,000 worker ants. For this study, eight fire ant workers were randomly sampled from each colony. DNA fingerprints for each individual ant were generated using 21 simple sequence repeats (SSR) markers that were developed from fire ant DNA by other laboratories (1, 3, 4). Workers from eight different colonies were tested for a total of 64 individual ants. Samples were labeled with numbers corresponding to the colony and letters for each individual ant (Table 1 and Fig. 1). All colonies were then treated with Onyx Pro Insecticide or Scimitar GC as part of pesticide efficacy trials. Among the eight colonies sampled, colonies that survived from 3 – 8 weeks post treatment included colony numbers 30, 32, 87, 130, and 181 (Table 1). Colonies eliminated during the 1 week after treatment included 7, 160, and 190 (Table 1). Our objective was to look for evidence of a genetic basis for survival following pesticide treatment by comparing genetic diversity between colonies that survived and those that were eliminated within the first week. DNA fingerprints were compiled for all samples and analyzed for similarities (5). The genetic relationships among ants and colonies were visualized using an unrooted neighbor-joining tree that shows clustering of more closely related ants (Fig. 1).
Results and Discussion: Individual ants from the same colony were closely related to each other (Fig. 1). The only exception was 7A, which did not cluster with the other ants from colony 7. Statistical analysis of the genetic information among ants within a
Entomology 104
SNA Research Conference Vol. 56 2011 colony was consistent with a single queen mated to a single male for all colonies (data not shown). Further testing is available using additional genetic markers (e.g. Gp-9 locus) that would confirm that all ants tested came from single queen colonies (2). Single or multi-queen colony organization has an important role in reproductive and dispersal behavior of fire ants, which may impact eradication efforts. Statistical analyses of the DNA fingerprints also suggest that all ants tested are diploid, or have two copies of each chromosome, which is typical for red and black imported fire ants. Colonies did not show genetic relationships (i.e., clustering) based on location. For example, colonies located adjacent to each other such as 30 and 32 were no more closely related to each other than to colonies that were more distant (Figs. 1 and 2). Each colony likely represents an independent infestation regardless of location. In terms of pesticide efficacy trials, each colony within a site is as likely as any other to contain a genetic background for pesticide resistance. The potential for resistance at one colony is not likely to influence the occurrence of resistance at another colony unless there is movement of fire ants between colonies.
Genetic testing supports the following conclusions: 1. There is no genetic association between the five colonies that initially survived insecticide treatment. 2. There is no genetic association between colonies that were rapidly eliminated. 3. There are no genetic associations between colonies that are located near each other. 4. Differences in pesticide response are likely due to environmental factors and not genetic background. In the future, we will test ants collected from colonies before treatment and, if they survive, after treatment. Genetic testing of survivors may uncover evidence of ants moving between colonies or queen replacement. This research is part of a larger program looking at pesticide efficacy in the Tennessee imported fire any quarantine zone.
Literature Cited: 1. Garlapati, R.B., Cross, D.C., Perera, O.P. and Caprio, M.A. Characteristics of 11 polymorphic microsatellite markers in the red imported fire ant, Solenopsis invicta Buren. Molecular Ecology Resources 9:822-824. 2009. 2. Gotzek, D., and Ross, K.G. Genetic regulation of colony social organization in fire ants: An integrative overview. Q. Rev. Biol. 82:201-226. 2007. 3. Krieger, M.J.B. and Keller, L. Genetic plolymorphism in the fire ant. Molecular Ecology 6:997-999. 1997. 4. Qian. Z, Crozier, Y.C., Schlick-Steiner, B.C., Steiner, F.M., and Crozier, R.H. Characterization of expressed sequence tag (EST)-derived microsatellite loci in the fire ant Solenopsis invicta (Hymenoptera: Formicidae). Conserv. Genet. 10:1373–1376. 2009.
Entomology 105
SNA Research Conference Vol. 56 2011
5. Stephens, J. C., Gilbert, D.A., Yuhki, N., and O'Brien, S.J. Estimation of heterozygosity for single-probe multilocus DNA fingerprints. Molecular Biology and Evolution 9: 729-743. 1992.
Table 1. Post-treatment colony survival for eight mounds sampled in this study. Colony Field Colony Activity (Weeks After Treatment)a Code Site 0 1 2 3 4 6 8 13 20 22 25 27 29 31 34 No. 30 H12 X X X X X X X 130 H47 X X X X X X 87 H47 X X X X X 181 H47 X X X X 32 H12 X X 160 H6 X 7 SKY X 190 SKY X a X = Colony was active during sampling week.
Entomology 106
SNA Research Conference Vol. 56 2011
Fig. 1. Tree based on DNA fingerprints for 64 individual fire ants. Individuals that cluster together are genetically similar. Red branches indicate colonies that survived after initial insecticide treatment.
Entomology 107
SNA Research Conference Vol. 56 2011
87
181 130
7 190
30 32 160
Fig. 2. Map created in ArcGIS showing locations of imported fire ant colonies sampled in this study relative to each other.
Entomology 108
SNA Research Conference Vol. 56 2011
Phenology gardens in Alabama: Application of plant phenology to pest management
Raymond Young and David Held
Department of Entomology & Plant Pathology,Auburn University,301 Funchess Hall, Auburn University, AL 36849
Index words: phenology, degree-days, forecasting model, urban integrated pest management
Significance to Industry: The U.S. Green Industry is diverse with an estimated annual economic impact of $148 billion in sales and employs roughly two million people [1]. Urbanization increases demand for municipal, commercial, and residential green spaces including lawns and landscapes. As plant diversity increases in the landscape, so do numbers of arthropod pests [2]. As a result, significant amounts of pesticides are used for pest control in landscapes. Sparks et al. [3] attributed over $229 million worth of damages and costs of control to pests attacking ornamentals in landscapes and nurseries in Georgia.
Monitoring, a practice adapted to landscapes from row crop IPM programs, enables the landscape manager or grounds maintenance professional time to control the pests before significant damage occurs. Use of degree-days or phenological indicators can be useful tools for pest managers [4,5]. When made readily available, integration of degree-day information has been shown to decrease pesticide usage and reliance on cover sprays [5, 6].
In these studies, pesticide usage was reduced by ≥85% in landscapes that were actively monitored. These pilot programs relied upon university personnel for scouting, which lacks sustainability once the project is completed. Relating growing degree-days or phenological indicators to vulnerable pest life stages would further focus scouting [6] and perhaps make pest managers more apt to monitor for early detection. The objectives of this project were to develop a training program on phenology and its application to landscape pest management and to establish living laboratories where trained personnel could develop these skills under university supervision.
Nature of Work: Dogwood borer (Synanthedon scitula): Dogwood borer (DWB), Synathedon scitula (Lepidoptera: Sessidae), is a multi-voltine pest of dogwoods but also develops in callus or gall tissue on other plant species including oaks and apples [7,8], affecting plantings in homes and parks. Dogwood borer has a wide host range that includes beech, willow, chestnut, blueberry, hickory, pecan, pine, ash, oak, and elm [9].
Entomology 109
SNA Research Conference Vol. 56 2011
Dogwood borer, with a wasp-like body approximately 1.25 cm long, emerges in the spring to lay eggs on the bark. Within 8-9 d, the eggs hatch and first instar larvae enter the plant and form large feeding galleries. It takes approximately a year for larvae to pass through seven instars [8]. The following spring, larvae create exit holes close to the exterior of the plant before pupation.
Phenology Gardens Training Program: Five gardens were established throughout the state containing the same suite of 13 landscape plants (Table 1) selected to provide a continuum of blooms from February to November and have easily recognizable phenological phases (phenophases). Each plot, replicated four times, was approximately 0.16 ha each and mulched. Volunteers began monitoring phenology in the garden and collecting trap data in March 2010. Traps were mailed bi-weekly. Site visits are made monthly to collect data sheets and garden maintenance.
Monitored variables: To test the first hypothesis, we monitor temperature at each of the five gardens using an on-site weather station (HOBO, model # U23-003, Onset Computer Corporation, Bourne, MA). Temperature is a valid tool in predicting insect development rate. Degree days accounts for the accumulation of heat units in a 24- hour period. Ambient temperature will be recorded at each site. Garden sites include Huntsville Botanical Garden, Oak Mountain Middle School (Birmingham), Auburn University Campus, Wiregrass Extension Center (Headland), and Mobile Botanical Garden. In order to test the second hypotheses, we used the flowers as phenological indicators.
Plants were monitored three times per week for phenophases. Data on all four plants in each garden were used to calculate an average date for each phenological event. We recorded first bloom, 50% bloom, and full bloom for plants like camellia and forsythia, similar to [3]. On these plants, we will randomly select and flag 4-10 branches (Figure 1) each species in order to count percent of opened flowers. For plants like sunflower and loropetalum, we recorded first bloom and full bloom. For herbaceous perennials such as daylily and daffodil, we have four phenophases 1) bud tight & upright, 2) shepherd’s crook, 3) first petal open, and 4) fully open. Plants at other garden sites throughout the state are being monitored by area Master Gardeners, who will be trained via spring training workshops.
Plants established in the landscape may have different phenophases than the newly planted species in the Auburn garden due to acclimatization factors. In order to compare phenophases, I will monitor similar plants on the surrounding campus. I will record phenophases for the spring flowering species (forsythia, daffodil, cherry, and loropetalum) in the first year to compare flower phenology. We will use pheromones and sticky traps to monitor pest emergence, activity, and peak of two sentinel insect species. At each site, cooperators are provided with sex pheronome lures and wing-type traps for monitoring male dogwood borer flight. Traps will be inspected weekly coincident with monitoring of the plant phenophases and lures replaced monthly. Every 2 weeks, traps will be mailed to Auburn for processing.
Entomology 110
SNA Research Conference Vol. 56 2011
At the Auburn site, eight additional pests will be monitored. These additional species represent significant pests of ornamental plants across AL. All traps, pests, and their host plants (e.g., lace bugs) are incorporated into a ‘pest block’ in the garden (Figure 2). Data compiled for the sentinel species across the state tests whether local PPI and pest data can be reliably extrapolated to different areas of the state. This extrapolation has been made in other states without data for verification. If verified, we can then apply PPI for these additional pests to other areas of the state. Each site will collect data for sentinel pest species, PPI, and degree days during both years of the project. For each sentinel species, the following response variables will be determined: first and cumulative moth capture of DWB. We also have phenology data for some of the pests in the Auburn garden pest block, including Eastern tent caterpillar, Lesser canna leafroller, and Azalea lacebug.
Results and Discussion: Our training sessions were completed in February and volunteers recorded data in the garden three times per week throughout the growing season. We posted the training manual and some additional training videos on the phenology garden website www.auburn.edu/phenology. Data collected will be posted to the website and published. We have just begun year two of a two year study.
Literature Cited: 1. Hall, C.R., A. Hodges, and J. Haydu. 2005. Economic impacts of the Green Industry in the United States. Final report to the National Urban and Community Forestry Advisory Comm. 81 pg. (www.utextension.utk.edu/hbin.greenimpact.html). 2. Raupp, M.J., P.M. Shrewsbury, J.J. Holmes, and J.A. Davidson. 2001. Plant species diversity and abundance affects the number of arthropod pests in residential landscapes. J. Arboric. 27: 221–229. 3. Sparks, B.L., W.G. Hudson, S.K. Braman, R.D.Oetting, and D.L. Horton. 1997.v Summary of losses from insect damage and costs of control in Georgia. XII. Ornamental, Lawn, and Turf Insects. (www.bugwood.org/sl97/ornam.htm). 4. Mussey, G.J. and D.A. Potter. 1997. Phenological correlations between flowering plants and activity of urban landscape pests in Kentucky. J. Econ. Entomol. 90: 1615–1627. 5. Hoover, G. 2002. Collaborative for integrated pest management. Tree Care Ind. 13: 19–24. 6. Stewart, C.D., S.K. Braman, B.L. Sparks, J.L. Willams-Woodward, G. Wade, and J.G. Latimer. 2002. Comparing an IPM pilot program to a traditional cover spray program in commercial landscapes. J. Econ. Entomol. 95: 789–796. 7. Bergh, J.C. and T.C. Leskey, 2003. Biology, ecology, and management of dogwood borer in eastern apple orchards. Can. Entomol. 135: 615–635. 8. Eliason, E.A. and D.A. Potter, 2000. Dogwood borer (Lepidoptera: Sesiidae) infestation of horned oak galls. J. Econ. Entomol. 93:757–762. 9. Johnson W. and H. Lyon 1991. Insects that Feed on Trees and Shrubs. Comstock Publishing Associates, Cornell University Press, Ithaca and London.
Entomology 111
SNA Research Conference Vol. 56 2011
Figure 2.
Figure 1.
Entomology 112
SNA Research Conference Vol. 56 2011
Table 1. Thirteen plant species and cultivars to be established in the phenology gardens Common Name Scientific Name Flowered in 2010 Lynwood Gold Border Forsythia x intermedia 'Lynwood Mid-March Forsythia Gold' Ice Follies Daffodil Narcissus 'Ice Follies' Late-March
Yoshino Cherry Prunus xyedoensis Late-March
Ruby Loropetalum Loropetalum chinense 'Ruby' Mid-March
Eleanor Tabor Indian Rhaphiolepis indica Eleanor Mid-April Hawthorn Tabor tm
Ellen Huff Oakleaf Hydrangea quercifolia 'Ellen Early-Mid May Hydrangea Huff'
Natchez Crapemyrtle Lagerstroemia indica xfourieri May-June 'Natchez'
Happy Returns Daylily Hemerocallis 'Happy Returns' Mid-May
Hummingbird Clethra Clethra alnifolia 'Hummingbird' Late-June to early- July Majestic Liriope Liriope muscari 'Majestic' Late-June
Crown of Rays Goldenrod Solidago canadensis 'Crown of June Rays'
Little Lemon Swamp Helianthus 'Lemon Queen' Late-June to Mid- Sunflower July Daydream Sasanqua Camellia sasanqua 'Daydream' Early-October Camellia
Entomology 113
SNA Research Conference Vol. 56 2011
Economics and Marketing
Marco Palma Section Editor and Moderator
Economics and Marketing 114
SNA Research Conference Vol. 56 2011
An Analysis of Consumer Preference for Sustainably Produced Bedding and
Potted Flowering Plants
Joyia T. Smith, Jennifer H. Dennis, and Roberto G. Lopez
Purdue University, Department of Agricultural Economics, 403 W. State Street, West Lafayette, IN 47907 Department of Horticulture and Landscape Architecture, 625 Agricultural Mall Drive, West Lafayette, IN 47907
Index words: consumer study, floriculture, sustainability
Significance to the Industry Retailers, wholesalers, and consumer demand have begun to pressure the United States (U.S.) Green industry to become more sustainable. It is also believed that the demand for organic and sustainable flower products is increasing in the U.S. as a result of an emerging market segment focused on health and fitness, the environment, personal development, sustainable living, and social justice, known as Lifestyles of Health and Sustainability (LOHAS). The LOHAS market represents 30% of all U.S. households and is spending $230 billion annually on socially and environmentally responsible products. In 2005, the $16 million organic flower market was the fastest growing sector of the nonfood organic market in the U.S.
Nature of Work The objective of this research was to examine whether differences exist in consumer preferences for sustainably produced bedding and potted flowering plants and to identify factors influencing consumer’s willingness to pay a premium for sustainably produced floriculture crops. Experiment 1. On 12 and 13 May 2008, sustainably and conventionally produced geranium (Pelargonium ×hortorum), marigold (Tagetes erecta), vinca (Catharanthus roseus), petunia (Petunia ×hybrida hort. Vilm.- Andr.) and New Guinea impatiens (Impatiens hawkeri Bull.) were delivered to retail garden centers and greenhouses located in Lafayette, Fort Wayne, Jeffersonville, Hope, and Zionsville, IN. At each location, the conventional and sustainable plants were displayed adjacently with signage placed near the sustainable plants. Signage included a poster explaining sustainable floriculture and its production practices. Each plant had a survey attached to the pot and consumers were provided with a 10% coupon to the garden center for filling out the survey. In total, 1000 surveys were available for consumers to fill out. Sixty-four surveys were returned. Experiment 2. On 07 Dec. 2008 the National Poinsettia Cultivar Trials consumer open house was held at Purdue University (West Lafayette, IN). Attendees were asked to participate in an anonymous survey to determine consumer interest in purchasing sustainably produced poinsettias. Individuals were asked hypothetical questions about their willingness to purchase or pay for the different plant types as well as sustainable or environmentally friendly products. One-hundred twelve surveys were returned. Both surveys included questions that asked about consumer’s attitudes towards sustainability, environmentally friendly practices, consumer’s willingness to pay, and demographics. Using SPSS 17.0, an independent sample t-test was conducted to
Economics and Marketing 115
SNA Research Conference Vol. 56 2011
analyze the difference in means for all of the plant types, including conventionally, sustainably, organically, and locally produced, plants grown with organic fertilizer, in energy efficient greenhouses, and in biodegradable pots.
All demographic characteristics were statistically significant showing differences in age, gender, race, education, ethnicity, and income. At least one-third of bedding plant consumers (31.3%) were between 31 to 40 where as just under half of the potted plant consumers (48.2%) were 30 years old and younger (Table 1). There were differences in gender and education based on potted and bedding plant customers. Potted plant consumers were almost equally split between male (40.7%) and female (59.3%) consumers, which were different from bedding plant consumers whose respondents were almost all (93.8%) female. Under half (40.6%) of bedding plant consumers had attended some college and the rest of respondents were either college graduates (25%), had a master’s degree (23.4%), or had a doctoral degree (11%). Over a third (39.3%) of potted plant consumers were high school graduates and one quarter (25%) of potted plant consumers attended some college. Just under half (45.3%) of bedding plant consumers had an income range of $75,000 to $99,999 and over a third (32.7%) of potted plant consumer were in the income range of $0 to $19,999 (Table 1).
Attitudes about sustainability and environmentally friendly practices. Each plant consumer group had different perceptions about sustainability. Most (89%) of the bedding plant consumers had not heard of the term “sustainability” where as the majority (81%) of the potted plant consumers had heard of the term. The small percentage (11%) of bedding plant consumers that heard of the term stated it meant “chemical free”, “earth friendly” and “harmless to the environment.” Potted plant consumers also had various definitions of the term “sustainability” including: “environmentally friendly practices using the least amount of energy,” “survival”, and “the ability to produce a high quality product with environmental practices and remain profitable.” Both consumer groups agreed the best reason to purchase a sustainably produced plant was the reduction of chemical exposure to their homes. However, bedding plant consumers also thought it would make them feel better about reducing their environmental footprint whereas potted plant consumers thought plant material produced sustainably would infer higher quality.
Mean ratings were used to determine consumer’s attitudes about environmentally friendly practices between bedding and potted plant consumers. Based on a scale of 1 to 7 (1= strongly disagree, 7 = strongly agree), bedding plant consumers showed more interest (μ=5.72) in paying more for a plant grown using environmentally friendly practices than potted plant consumers (μ=4.83) (Table 2). Bedding plant consumers (μ=5.84) were also willing to pay more for a plant packaged using environmentally friendly materials than potted plant consumers (μ=4.81). Potted plant consumers (μ=5.07) had a moderate interest for other environmentally friendly lawn and garden products than bedding plant consumers (μ=4.20) (Table 2). Neither bedding plant nor potted plant consumers thought that the current green movement was a fad (2.88; 2.23) Table 2).
Economics and Marketing 116
SNA Research Conference Vol. 56 2011
We asked both consumer groups questions about their willingness to pay for sustainable, conventional, local, and organic plant material based on a seven point likert scale (1=lowest interest, 7=highest interest). Bedding plant consumers had a higher interest in purchasing a conventionally produced plant (μ=6.33) but had a moderate interest in purchasing a sustainably produced bedding plant (μ=5.11) (Table 3). Potted plant consumers had a moderate interest in purchasing locally produced plants (μ=5.83) but a neutral interest in purchasing conventionally produced plant (μ=3.69) (Table 3). Bedding plant consumers showed a higher interest (μ=6.33) than potted plant consumers (μ=3.69) for conventionally produced plants (Table 3). Bedding plant consumers also displayed a slightly higher interest (μ=5.81) than potted plant consumers (μ=5.13) for plants grown with organic fertilizers (Table 3). Potted plant consumers showed they were slightly more interested (μ=5.63) in purchasing plants grown in energy efficient greenhouses than bedding plant consumers (μ=5.17) (Table 3). Just under half (42%) of all consumers were interested in purchasing a conventional plant and just over half (54%) were willing to purchase a plant grown with organic fertilizer. Neither the bedding plant nor the potted plant consumers were willing to pay an increase of more than 15% for any of the plant types (data not shown).
Discussion and Conclusions In this study, consumers stated that sustainability is important to them. Although there were positive attitudes about sustainability and environmentally friendly practices, more information is needed to accurately analyze consumer behavior. Although bedding plant consumers did not know much about sustainability, they had a higher interest in purchasing conventionally produced plants, plants grown in organic fertilizer, organically produced and sustainably produced plants. Potted plant consumers were more interested in purchasing locally produced plants. This may be due to where the survey was administered for each plant type customer (store verse university setting). Therefore, the bedding plant consumers may be more characteristic of the national lawn and garden consumer population. Another factor that played a role in these results is positioning. To properly compare bedding plant and potted plant consumers, both surveys should be done in a retail environment. It may also be beneficial if the sample sizes were larger. While none of the consumers were willing to pay more than a 15% increase for any plant, bedding plant consumers were more interested than potted plant consumers in paying an increase for each of the plant types.
Overall, most of the differences shown in this study may be traced to the amount of consumer knowledge on sustainability. Consumers may have not seen promotional material and information for these types of plants. Consumers also may not understand the terminology used by the Green industry. Based on these findings, consumers need more information via educational assistance and support to help guide their decisions about sustainable plants.
Literature Cited Lohas Online-Lifestyles of Health and Sustainability. (n.d.). Accessed on April 6, 2009 at http://www.lohas.com/
Economics and Marketing 117
SNA Research Conference Vol. 56 2011
Table 1. Potted and Bedding Plant Respondent Demographics Potted Plant Bedding Plant Chi Square Gender Male 40.7% 6.3% 23.7615* Female 59.3% 93.8% Age 20 or under 19.1% 0% 20-30 29.1% 12.5% 31-40 4.5% 31.3% 41-50 10.9% 15.6% 42.229* 51-60 16.4% 28.1% 61-70 13.6% 9.4% 71-80 5.5% 3.1% 81 and over 0.9% 0% Education Some HS 8.9% 0% HS Grad 39.3% 0% Some College 25% 40.6% College Grad 16.1% 25% Masters 8% 23.4% 54.687* Degree Doctoral 0% 11% Degree Did Not 2.7% 0% Respond Income $0-$19,999 32.7% 0% $20,000- 7.9% 0% $34,999 $35,000- 9.9% 0% $49,999 67.89* $50,000- 15.8% 17.2% $74,999 $75,000- 13.9% 45.3% $99,999 $100,000 or 19.8% 37.5% more African Ethnicity 1.9% 0% American Asian 2.8% 0% 4.191** Caucasian 93.5% 100% Other 1.9% 0% *indicates significant at p=0.01, ** indicates significant at p=0.05
Economics and Marketing 118
SNA Research Conference Vol. 56 2011
Table 2. Respondent’s attitudes towards consumer friendly practices based on a 1 (1= strongly disagree) to 7 (7=strongly agree) likert scale. Variable Plant Type Mean Standard T Sig. (2- Deviation tailed) Are you willing Potted 4.83 1.632 to pay more for Bedding 5.72 .951 plants grown using -4.548 .000 environmentally friendly practices*
Are you willing Potted 4.81 1.627 to pay more for Bedding 5.84 1.417 plants
packaged -4.237 .000 using environmentally friendly materials*
Are you willing Potted 5.07 1.501 to pay more for Bedding 4.20 1.605 other 3.572 .000 environmentally friendly materials*
I think the Potted 2.23 1.602
green Bedding 2.88 1.453 -2.647 .009 movement is a fad.* *significant at the .01 level, ** significant at the .05 level
Economics and Marketing 119
SNA Research Conference Vol. 56 2011
Table 3. Respondent’s attitudes towards willingness to pay for sustainable, conventional, local, and organic plant material based on a seven point likert scale (1=lowest interest, 7=highest interest “based on a likert scale. Variable Plant Type Mean Standard T Sig. (2- Deviation tailed) Conventional Potted 3.69 1.621 -15.304 .000 plants Bedding 6.33 .592
Sustainable Potted 5.07 1.607 -.151 .880 plants Bedding 5.11 1.438
Organic Potted 5.15 1.786 -1.053 .294 plants Bedding 5.42 1.445
Local plants Potted 5.83 1.496 .127 .899 Bedding 5.80 1.347
Plants grown Potted 5.13 1.603 with organic Bedding 5.81 1.271 -2.925 .004 fertilizers*
Plants grown Potted 5.63 1.489 in energy Bedding 5.17 1.254 2.058 .041 efficient greenhouses
Plants grown Potted 5.73 1.465 in Bedding 5.41 1.400 1.417 .158 biodegradable pots *significant at the .01 level, ** significant at the .05 level
Economics and Marketing 120
SNA Research Conference Vol. 56 2011
The State of the Green Industry: National Nursery Survey Results
Alan Hodges1, Charlie Hall2, and Marco Palma3
1University of Florida, Food and Resource Economics Department, Gainesville, FL 2 Texas A&M University Horticultural Sciences Department, College Station, TX 3 Texas A&M University, Department of Agricultural Economics, College Station, TX
Significance to Industry: Over the past two decades, there have been shifts in the structure, conduct, and performance of the U.S. nursery and greenhouse industry. Surveys have examined the present business climate, but little has been done to understand what types of changes are taking place and whether or not these changes are regional in nature. Understanding the types of structural changes taking place allows nursery and greenhouse managers to better evaluate their business decisions as compared to industry trends.
Nature of Work: The 2009 National Nursery Survey, which gathered information for calendar year 2008, represented the fifth such effort by the Green Industry Research Consortium. Basic descriptive results of the previous surveys were reported by Brooker (1990, 1995, 2000, 2003). The objective of these surveys was to document changes in production and management practices of the U.S. nursery and greenhouse industry over time in individual states and regions, and to provide information useful to growers, allied industry professionals, extension personnel and researchers. Information collected in this survey included annual sales, fulltime and part-time employment, plant types produced, native plants, product forms, market distribution channels, interstate and international trade flows of finished products and propagation materials, selling methods, advertising forms, irrigation water sources and application methods, integrated pest management practices, year of business establishment, computerized business functions, and factors affecting business growth and pricing.
Results and Discussion: A total of 17,019 nursery firms were surveyed by both mail and internet methods. The survey sampled 44.8 percent of the U.S. nursery population overall, but this percentage ranged widely among individual states, from 100 percent for Arizona to 26 percent in Maine. Valid responses were received from 3,044 firms, including 2,732 from the mail survey and 312 from the email survey, representing an overall response rate of 17.9 percent. These tabulations do not include questionnaires that were returned blank, or duplicate responses received from the same firms. States with the highest number of respondents were Florida (556), California (296), Pennsylvania (275), North Carolina (151), New York (147), Ohio (141), Texas (114), and Tennessee (101). A few states had less than 10 respondents (AZ, MT, ND, NW, UT, and WV). Response rates were greater than 25 percent for the states of Wisconsin (35.8%), Montana (29.6%), Delaware (28.0%), Minnesota (26.2%), and Ohio (25.2%), but were less than 10 percent for New Hampshire, Oklahoma and West Virginia. Response rates for the mail survey (19.3%) were higher than for the internet
Economics and Marketing 121
SNA Research Conference Vol. 56 2011
(email) survey (10.8%). Overall, 85 percent of respondents reported the key information on annual sales. Total National expanded sales were estimated at $27.1 billion dollars for 2008. The top 10 producing states were California ($6,681.8 million), Florida ($3,520.9 million), Texas ($1,350.4 million), Pennsylvania ($1,235.0 million), Georgia ($1,013.5 million), New York ($927.7 million), New Jersey ($916.7 million), Louisiana ($ 872.0 million), Ohio ($859.7 million), and Illinois ($830.6 million). A copy of the full report can be obtained at http://www.greenindustryresearch.org
Literature Cited
1. Brooker, John R. and Steven C. Turner. Trade Flows and Marketing Practices within the United States Nursery Industry. Southern Cooperative Series Bulletin 358, University of Tennessee Agricultural Experiment Station, October 1990. 2. Brooker, John R., Steven C. Turner, and Roger A. Hinson. Trade Flows and Marketing Practices within the United States Nursery Industry: 1993. Southern Cooperative Series Bulletin 384, University of Tennessee Agricultural Experiment Station, 1995. 3. Brooker, John R., Roger A. Hinson, and Steven C. Turner. Trade Flows and Marketing Practices within the United States Nursery Industry: 1998. Southern Cooperative Series Bulletin 397, University of Tennessee Agricultural Experiment Station, 2000. 4. Brooker, John R., David Eastwood, Charles Hall, Kirk Morris, Alan Hodges and John Haydu. Trade Flows and Marketing Practices within the United States Nursery Industry: 2003. Southern Cooperative Series Bulletin 404, University of Tennessee Agricultural Experiment Station, 2005. Available at: http://economics.ag.utk.edu/pub/crops/SCB404.pdf.
Economics and Marketing 122
SNA Research Conference Vol. 56 2011
Color and Taste: Consumer Perceptions of Flavor
Christine E. H. Coker1, Wes Schilling2, and Mike Ely3
1Mississippi State University, Coastal Research and Extension Center, 1815 Popps Ferry Road, Biloxi, MS 39532 2 Mississippi State University Department of Food Science, Nutrition, and Health Promotion, Mississippi State, MS 39762 3 Beaumont Horticultural Unit 478 Hwy. 15N, Beaumont, MS 39423
Significance to Industry: Recent concerns about food safety as well as decreasing food budgets have spawned a revival in home gardening. Consumers who might have been attracted to ornamental bedding plants are now taking an interest in edible plants, especially herbs and vegetables. It is important that the nursery industry recognize this trend and capitalize on the benefits of introducing edible bedding plants to existing product lines.
Nature of Work: Several studies have been conducted on consumer preferences, especially in regards to color and flavor perceptions (1, 5). These studies include sensory evaluation of relating specifically to colored bell peppers (Capsicum annuum L.) (2, 4). Colored bell peppers are usually more expensive in the market than green bell peppers, although they are produced identically. Growing colored bell pepper cultivars in the home garden may enhance the consumer’s gardening experience, as well as providing additional savings in the household food budget. The objective of this study was to evaluate the visual acceptability, perceived flavor acceptability, as well as actual flavor preference of colored bell peppers. Seven cultivars of bell peppers were grown in a high tunnel at the Beaumont Horticultural Unit in Perry County, Mississippi. The high tunnel was 30’ x 96’ and contained only bell peppers. Commercial production standards were utilized including drip irrigation and plastic mulch. Six cultivars were used in the sensory evaluation portion of the project (Table 1.): ‘Colossal’, ‘Aladdin XR3’, ‘Valencia’, ‘Tequila’, ‘Super Heavy Weight’, and ‘Sirius’.
Two consumer based sensory panels (n=120, n=60 per panel) were conducted to evaluate the acceptability of different varieties and colors of bell peppers. Participants were recruited by e-mails sent with information regarding panel details, and by asking people passing by the vicinity of the test (word of mouth) if they were interested in participating in the test. Bell peppers were washed thoroughly, dried and sorted for both visual appearance and consumer acceptability testing. Random three digit numbers were assigned to identify the samples. Sample order was randomized to account for sampling order bias. Water and unsalted crackers were provided, and panelists were asked to expectorate and rinse their mouths between each sample. For the visual appearance test, each panelist was presented with a tray containing 6 labeled whole peppers. Panelists were asked to evaluate each whole pepper based on appearance,
Economics and Marketing 123
SNA Research Conference Vol. 56 2011
and how acceptable that they thought the flavor of the sample would be based on appearance of the whole bell pepper. Each panelist was then asked to evaluate 6 coded samples of bell pepper strips (approximately ½ x 1 in) for appearance, aroma, texture, flavor, and overall acceptability. A nine point hedonic scale, where 1 = dislike extremely, 5 =neither like nor dislike, and 9 =like extremely (3), was used to score the response for both visual appearance and consumer acceptance test.
A randomized complete block design with 3 replications was used to determine if differences existed (P<0.05) among the sensory acceptability of bell peppers. Fisher’s Protected Least Significant Difference (LSD) test was utilized to separate main effect treatment means (P<0.05) when significant differences occurred among treatments (SAS Version 9.2, Cary, NC).
Results and Discussion: The cultivar ‘Colossal’ was the most preferred pepper based on visual appearance alone. ‘Colossal’ is a standard commercial cultivar which sets green fruit which eventually turns to red. This color combination is the most familiar to many consumers. However, ‘Valencia’, a green to orange cultivar was also liked by the panelists. Panelists’ perceived flavor acceptability, based on visual appearance alone, closely correlated to appearance acceptability (Table 2.).
Before tasting the pepper samples, panelists were presented with bell pepper strips independently of seeing the whole peppers. Interestingly, ratings given for visual appearance of the strips did not follow the same order as ratings for the whole peppers (Table 3.). ‘Valencia’ was found to be significantly more visually acceptable than the other cultivars rated at 7.7 (p>0.05). In terms of aroma, ‘Tequila’ ranked significantly higher (6.8) than the other cultivars. ‘Tequila’ did not rank highly in terms of appearance and perceived flavor acceptability. This could be a result of its unusual fruit color, ranging from lilac to a mottled multicolored appearance. Flavor acceptability among cultivars ranged from 6.0 to 6.7 with no significant standouts. The texture of ‘Valencia’ (7.4) was most preferred, however, not statistically different from ‘Colossal’ (7.3). ‘Valencia’ and ‘Colossal’ also received high rankings for overall acceptability when all traits were combined. The least preferred cultivar was ‘Sirius’ followed closely by ‘Super Heavy Weight’. Both of these cultivars have yellow fruit near maturity. As consumers become increasingly aware of the variety of cultivars of bell peppers available and the benefits of home gardening, colored bell peppers could become a mainstay in the product lines of bedding plant producers.
Literature Cited: 1.Barrett, D. M., R. Shewfelt, and J.C.Beaulieu. 2010. Color, flavor, texture, and nutritional quality of fresh-cut fruits and vegetables: desirable levels, instrumental and sensory measurement, and the effects of processing. Crit. Rev. in Food Sci. and Nutr. 50(5): 369-389. 2. Frank, C.A., B.K. Behe, A.H. Simonne, R.G. Nelson, and E.H. Simonne. 2001. Consumer preferences for color, price, and vitamin C content of bell peppers. HortSci. 36 (4), p. 795-800.
Economics and Marketing 124
SNA Research Conference Vol. 56 2011
3. Meilgaard, M., G. V. Civille, and B. T. Carr. 2007. Sensory Evaluation Techniques, 4th ed. Descriptive Analysis Techniques. 173-188. CRC Press, Boca Raton, Florida. 4. Simonne, E., J. Owen, M. Ruf, J. Kemble, J. Eason, J. Little, and J. Pitts. 1996. Subjective and objective evaluation of color in bell peppers. Research report series (Alabama Agricultural Experiment Station) research report series, Apr 1996 (11), p. 18- 19. 5. Zampini, M., C. Spence, N. Phillips, and D. Sanabria. 2007. The multisensory perception of flavor: Assessing the influence of color cues on flavor discrimination responses. Food quality and preference 18(7): 975-984.
Table 1. Color descriptors for 6 bell pepper cultivars grown at the Beaumont Horticultural Unit in 2010.
Cultivar Color Descriptors Colossal green to red Aladdin XR3 green to yellow Valencia green to orange Tequila lilac to multicolored Super Heavy Weight green to yellow Sirius yellow
Table 2. Mean hedonic scores1 for appearance and perceived flavor acceptability of whole bell peppers (N=120)1. Visual Acceptability Perceived Acceptability of Cultivar Flavor Based on Appearance Colossal 7.2a 7.2a Aladdin XR3 6.1c 6.1c Valencia 6.8ab 6.7b Tequila 6.3c 6.1c Super Heavy Weight 6.4bc 6.3c Sirius 6.4bc 6.4bc SEM 0.15 0.15 1Consumer acceptability was based on a 9-point scale (1=dislike extremely, 5=neither like nor dislike, and 9=like extremely). abc Means with the same letter within each row are not significantly different (p>0.05).
Economics and Marketing 125
SNA Research Conference Vol. 56 2011
1 Table 3. Mean hedonic scores for the consumer acceptability of appearance, aroma, flavor, texture, and overall acceptability of colored bell peppers (n=120).1 Overall Cultivar Appearance Aroma Flavor Texture Acceptability Colossal 7.4b 6.0c 6.7ab 7.3ab 6.9ab Aladdin XR3 7.2bc 6.2bc 6.5abc 6.6cd 6.5bc Valencia 7.7a 6.4b 6.8a 7.4a 7.0a Tequila 6.4e 6.8a 6.2cd 7.0bc 6.4cd Super Heavy Weight 7.0cd 6.0c 6.3bcd 6.6cd 6.3cd Sirius 6.8d 5.9c 6.0d 6.3d 6.1d SEM 0.12 0.12 0.16 0.14 0.14 1Consumer acceptability was based on a 9-point scale (1=dislike extremely, 5=neither like nor dislike, and 9=like extremely). a-b-c-d-e Means with the same letter within each row are not significantly different (p>0.05).
Economics and Marketing 126
SNA Research Conference Vol. 56 2011
Rural Retail Lawn & Garden Market Benchmarks
Forrest Stegelin
312 Conner Hall; Dept. of Ag. & Applied Economics University of Georgia; Athens, GA 30602-7509
Index Words:benchmarks, retail, garden center, structure, performance, activities
Significance to Industry: Identification of key statistics and benchmarks of current rural retail lawn and garden markets can be used to develop guidelines for those interested in starting, maintaining, or growing a retail lawn and garden market in a rural economic environment. The data points or benchmarks collected included type and number of retail markets operated, physical size of retail market facilities, variety of equipment in the market, use of technology in the sales area, the number of laborers/employees, promotional activities employed, days and hours of operation, items sold, and activities or events included in marketing.
Nature of Work: The recession of 2007 – 2009 had many casualties among rural businesses, notwithstanding the retail lawn and garden markets or garden centers. However, there is now an interest gaining momentum for re-opening some of the closed and/or sold markets as well as starting new lawn and garden markets in previously untested locations. There are guidelines available for consideration from sources such as Barton (2002) and Stanley (2002), but these publications focus on more urban or suburban markets. Requests for information with a more rural focus and appeal suggested a survey or questionnaire of the recession survivors as to the structure- conduct-performance of their individual businesses, to get an average (or range of) benchmark values that could be shared with those entrepreneurs considering entering the retail marketing for lawn and garden supplies and plant materials (NAICS 44522).
Results and Discussion: Using the USDA definition of “rural” as the guide for collecting survey results, 97 lawn and garden owner/managers in 76 Georgia counties were questioned as to their own operations; of these 89 individuals provided complete details. Following are the observations compiled from the face-to-face surveys: Structures and Facilities 64% have a permanent retail structure (barn, shed, garage, etc.) 30% utilize a temporary structure (hoop house, high tunnel) at a retail market 5% utilized permanent structures (greenhouse, shade/lathe house) at a retail market 2% utilized a semi-trailer or container-truck as a retail market
Economics and Marketing 127
SNA Research Conference Vol. 56 2011
o 11% had no inside or enclosed sales area o 28% had less than 200 square feet of inside sales area o 22% had between 200 and 1,000 square feet of sales area o 13% had between 1,000 and 2,000 square feet of enclosed sales area
• 33% used an outside sales area of less than 200 square feet • 26% had between 200 and 1,000 square feet of outside sales area • 12% utilized between 1,000 and 2,000 square feet of outside sales area
9 28% of the businesses had 10 or fewer parking spaces 9 37% had between 10 and 20 parking spaces 9 35% had parking spaces for more than 20 vehicles
Retail Horticulture Experience 22% of the operators had 10 years or less lawn and garden retailing experience 26% had between 11 and 20 years of retailing experience 22% had between 21 and 30 years of marketing experience 10% had between 30 and 50 years of retail experience 20% are working with at least 50 years of experience with retail lawn and garden retailing experience
Employees or Workforce • 13% of the markets did not have any salaried, full-time employees • 23% had one full-time employee • 22% had two full-time employees • 17% had three or more full-time employees
o 25% utilized only seasonal/part-time/temporary workers o 75% had no (zero) part-time employees o 3% had only one part-time employee o 3% used two part-time employees o 9% had three part-time employees o 6% had four part-time employees o 3% used five or more part-time employees
Days and Hours of Operation 9 86% of the markets are open year-round 9 When open, 88% are open at least some of the time on Sundays and holidays 9 75% had posted hours of 10-6; 20% had no posted hours of operation; and 5% had 7-7 during daylight savings time, and 9-5 during the winter months
Economics and Marketing 128
SNA Research Conference Vol. 56 2011
Services or Activities Available
Paper or Plastic?
Economics and Marketing 129
SNA Research Conference Vol. 56 2011
Products Available
Green Goods and/or Hard Goods All of the businesses offered green goods (plant materials) Only 15% offered hard goods (statuary, bird baths/feeders, stepping stones, etc.) 38% offered landscape design services, including DIY ideas 25% offered delivery and landscape installation services, including irrigation.
Literature Cited: Barton, Susan (editor). 2002. Establishing and Operating a Garden Center: Requirements and Costs. Natural Resource, Agriculture, and Engineering Service NRAES-161, Ithaca, NY.
Negen, Bob & Susan. 2007. Marketing Your Retail Store in the Internet Age. John Wiley & Sons, Inc, Hoboken, NJ.
Patterson, Laura. 2009. Marketing Metrics in Action. Racom Books/Racom Communications, Chicago, IL.
Stanley, John. 2003. Just About Everything a Retail Manager Needs to Know. lizardpublishing.biz, Kalamunda, Western Australia.
Stanley, John. 2002. The Complete Guide to Garden Center Management. Ball Publishing, Batavia, IL.
Economics and Marketing 130
SNA Research Conference Vol. 56 2011
Economic Challenges Facing Nursery Growers in Warren County, Tennessee
F. Tegegne, S. P. Singh, E. Ekanem, and P. Dharma
Department of Agricultural Sciences, Tennessee State University 3500 John A. Merritt Blvd. Nashville, TN 37209-1561
Index Words: field nursery growers, economic downturn, profitability and future plans
Significance to Industry: The green industry is an important sub-sector of agriculture with grower cash receipt of $16.9 billion in 2006 (Jerardo, 2007). A study by Hall et al. (2006) shows that the industry contributes approximately 2 million jobs. Growers, landscaping design and maintenance and retail generate about $148 billion in economic impacts for the U.S. economy. There are about 700 certified nurseries in Tennessee with approximately 53,000 acres in production of which 70% is in Warren and surrounding counties (Tennessee Landscape and Nursery Association).
Nature of Work: The goal of this paper is to identify and assess some of the key challenges facing nursery growers in Warren County. The data was collected in October 2010 at a training workshop for twenty two field nursery growers in Warren County, Tennessee using a short survey. Questions asked in the survey covered ranking the importance of various challenges they face; type of marketing channels used; share of sales within and outside the state; profitability trend; number of years in business; size of their operations and the extent to which they use internet in their business.
Results and Discussion: Producers are asked to rank challenges they face. About 64% put economic downturn as a number one challenge followed by marketing and lack of skilled personnel. Fifty-five percent of producers had farm size of less than 50 acres while the balance (45%) operated greater than 50 acres. In terms of internet use in their business a very high proportion (82%) responded that they use it substantially. Products are sold to whole sellers and retailers with about 50% being sold to whole sellers. On profitability, 68.2% reported decline; 18.2% are enjoying continued profitability and 13.6% experienced no change in profitability. The very high decline in profitability reflects the impact of the economic downturn which is characterized by high unemployment and lack of income resulting in declining consumer purchases. It is also found that about 74% of sales are done with businesses outside the state and only 36% within the state. The prevalence of a significant proportion of the producers experiencing declining profitability is not surprising since the economic downturn is both local and national in scope. Suffice it to note that decline in housing starts also has negative impact on demand for nursery products. In terms of future plans, once the economic downturn passes, 45% responded that they will produce new products and 32% stated they will expand their operations. Only 10% indicated that they will improve
Economics and Marketing 131
SNA Research Conference Vol. 56 2011
existing operations. The above findings can provide input for undertaking a larger study covering other counties and more growers.
Literature Cited
1. Hall, C.R., A.W. Hodges and J.J. Haydu. 2006. “The Economic Impacts of the Green Industry in the U.S. Hort Technology 16:345-353. 2. Jerardo, A. 2007. “Floriculture and Nursery Crops Yearbook.” ERS, USDA, September, Washington D.C. 3. Tennessee Nursery and Landscape Association.
Economics and Marketing 132
SNA Research Conference Vol. 56 2011
Water Management
Donna Fare Section Editor and Moderator
Water Management 133
SNA Research Conference Vol. 56 2011
Growth of ‘Panama Red’ Hibiscus in Response to Substrate Water Content
Amanda Bayer1, Imran Mahbub1, Matthew Chappell1, John Ruter2, and Marc van Iersel1
1Dept of Horticulture, University of Georgia, Athens, GA 30602 2Dept of Horticulture, University of Georgia, Tifton, GA 31793
Index Words: Hibiscus acetosella, irrigation, water use
Significance to Industry: Competition for world water resources continues to increase due to population growth and increased agricultural and industrial water demand. In contrast, the per capita availability of water worldwide will likely continue to decrease due to a growing global population as well as future climate change (Jury and Vaux, 2005). Many horticultural operations have adopted best management practices to more efficiently utilize existing water resources. These practices are beneficial for growers, since they reduce water use, leaching of nutrients, pesticide use and energy use. However, more sophisticated systems, such as real-time soil moisture monitoring systems, have the potential to drastically reduce the amount of water needed for irrigation by using more precise irrigation control. Soil moisture sensors monitor substrate water content, and when used in conjunction with a data logger-controlled irrigation system, can be used to initiate irrigation when substrate water content drops below a user-specified set point. Our objective was to understand how plant growth responds to various substrate water contents (0.10, 0.15, 0.20, 0.25, 0.30, 0.35, 0.40, and 0.45 L·L-1) and to determine how much water is needed to produce Hibiscus acetosella ‘Panama Red’. Shoot dry weight increased with increasing substrate water content and there was an asymptotic response of shoot dry weight to the total amount of water applied. Plant growth increased sharply as irrigation volume increased from 2 to 14 L/plant, but there was little or no additional growth as the irrigation volume increased above 22.5 L/plant. Our results can help growers to get a better understanding of the water needs of this crop. This knowledge can be used to irrigate more efficiently, which will conserve water, promote uniform plant growth, and reduce profit losses due to disease, as well as water and nutrient leaching and runoff.
Nature of Work: It is inevitable that the demand for more efficient water usage by the green industry will continue to increase due to environmental regulations and future demands on water supplies. Soil moisture sensor-controlled automated irrigation systems give growers the potential to precisely control irrigation, reducing water use and still producing high quality plants (van Iersel et al, 2009). Before such technology can be implemented, plant responses to substrate moisture need to be understood. The objective of our study was to determine the effect of substrate water content on the growth of Hibiscus acetosella ‘Panama Red’ and to quantify the water requirements of this plant.
Water Management 134
SNA Research Conference Vol. 56 2011
On June 17, 2010 rooted cuttings of Hibiscus acetosella ‘Panama Red’ (PP20121), pruned to the third node above substrate level, were planted in one gallon containers filled with soilless substrate (Fafard Nursery Mix; Conrad Fafard Inc., Agawam, MA). Pots were topdressed with 24 grams of 16 month, slow release fertilizer (Graco 14-8-14 with minors; Graco Fertilizer Co., Cairo, GA) and watered in. Plants were grown in a glass-covered greenhouse throughout the study. The irrigation system used in the experiment was based on the design described by Nemali and van Iersel (2), with substrate water content set points of 0.10, 0.15, 0.20, 0.25, 0.30, 0.35, 0.40, and 0.45 L·L-1. Treatments were started on June 24. The experiment was designed as a randomized complete block with eight treatments and four replications (32 total plots). Each plot contained two pots which were monitored with soil moisture sensors (EC-5, Decagon, Pullman, WA). A data logger (CR10, Campbell Scientific, Logan, UT) stored readings from the two sensors and initiated irrigation when the average of the two sensor readings dropped below the assigned substrate water content set point, providing 44.5 mL of water per irrigation event. The number of irrigation events was recorded by the datalogger, allowing for the calculation of the amount of irrigation water applied to each plant. On August 2, the experiment was ended and plant growth measurements were taken. Substrate water content was measured using a ThetaProbe soil moisture sensor (Delta- T Devices, Cambridge, UK). Shoots were cut off at the substrate surface and dry weight was determined. Data were analyzed with linear and non-linear regression using SigmaPlot (v. 11, Systat Software, San Jose, CA).
Results and Discussion: The soil moisture sensor-controlled irrigation system was able to maintain soil moisture levels close to the specified set points, with set points being reached before the tenth day (Fig. 1). A strong correlation (r = 0.81, p < 0.0001) between ThetaProbe measurements and substrate water content set points confirmed differences in substrate water content among the treatments (Fig. 2) and validated the probes’ accuracy. Plant growth, represented by shoot dry weight, was affected by water availability. This is demonstrated by the correlations between dry weight and substrate water content (Fig. 3) (r = 0.83, p < 0.001) as well as dry weight and total irrigation volume (Fig. 4) (R2 = 0.84, p = 0.001). Total irrigation volume increased with increases in substrate water content set points (r = 0.82, p < 0.001) (Fig. 5). Analysis of shoot dry weight as a function of total volume of irrigation water applied shows volume distinct non-linear response (Fig. 4). A sharp increase in growth can be observed as the irrigation volume increases from 2 to 14 L/plant, but additional growth is minimal on plants receiving 22.5 L of water or more. These observations suggest that plant growth is dependent on the amount of water applied up to a threshold, after which additional irrigation no longer significantly increases growth. This indicates that plants of similar size can be obtained with differing substrate water contents, and therefore reduced irrigation volume. Our results suggest that growers using an automated irrigation system would be able to reduce total irrigation volume by approximately 20 L/plant by using a set point of 0.35 L·L-1 instead of 0.45 L·L-1, while still obtaining similar size plants. Although our results are from plants grown in a controlled greenhouse setting, they suggest it is possible to achieve similar results in a nursery setting in which
Water Management 135
SNA Research Conference Vol. 56 2011
plants are exposed to varying environmental conditions. Preliminary results from subsequent trials in outdoor nurseries confirm this (unpublished results).
Acknowledgements: We thank Sue Dove for her help with this research. Funding for this research was provided by USDA-NIFA-SCRI award no. 2009-51181-05768.
Literature Cited: 1. Jury, W.A., and J. Vaux. 2005. The role of science in solving the world’s emerging water problems. Proc. Natl. Acad. Sci. USA. 102:15715-15720. 2. Nemali, K.S., and M.W. van Iersel. 2006. An automated system for controlling drought stress and irrigation in potted plants. Scientia Hort. 110:292-297. 3. van Iersel, M.W., R.M. Seymour, M. Chappell, F. Watson, and S. Dove. 2009. Soil moisture sensor-based irrigation reduces water use and nutrient leaching in a commercial nursery. Proc. SNA Res. Conf. 54: 17-21.
0.5 ) -1 L . 0.4
0.3
0.2
0.1
Substrate water content (L 0.0 0 10203040 Time (days)
Figure 1. Substrate water content over the length of the experiment. Dashed lines indicate set points for irrigation (0.10, 0.15, 0.20, 0.25, 0.30, 0.35, 0.40, and 0.45 L·L-1).
Water Management 136
SNA Research Conference Vol. 56 2011 )
-1 0.5 L . 0.4
0.3
0.2
0.1 y = 0.0687 + 0.780 X r = 0.81
0.0 Theta probe reading (L 0.0 0.1 0.2 0.3 0.4 0.5 . -1 Substrate VWC (L L ) Figure 2. Theta Probe readings of substrate moisture content versus substrate water content set points (ranging from 0.10 to 0.45 L·L-1) of the automated irrigation system. Symbols represent means with standard errors for each treatment (n=4).
60
40
20
y = -13.5 + 167 X r = 0.83 Shoot dry weight (g/plant) dry weight Shoot 0 0.0 0.1 0.2 0.3 0.4 0.5 Substrate VWC (L.L-1)
Figure 3. Shoot dry weight of hibiscus ‘Panama Red’ as affected by substrate water content set point (ranging from 0.10 to 0.45 L·L-1) at which the plants were irrigated. Symbols represent means with standard errors for each treatment (n=4).
Water Management 137
SNA Research Conference Vol. 56 2011
80
60
40
20 y= -4.9 + 95.0 X / (16.1 + X) Dry weight (g/plant) weight Dry R2 = 0.85 0 0 10203040 Total irrigation volume (L/plant)
Figure 4. Shoot dry weight of hibiscus ‘Panama Red’ as a function of the total amount of water plants received during the experiment. Symbols represent means with standard errors for each treatment (n=4).
50
40
30
20
10
0 y = -14.202 + 117.071 X R 2 = 0.67
Total Irrigation Volume (L/plant) Volume Irrigation Total -10 0.00.10.20.30.40.5 Substrate VWC (L.L-1)
Figure 5. Total irrigation volume as affected by substrate water content set point (ranging from 0.10 to 0.45 L·L-1) at which the plants were irrigated. Symbols represent means with standard errors for each treatment (n=4).
Water Management 138
SNA Research Conference Vol. 56 2011
Phosphorus acquisition and remediation of simulated nursery runoff using Golden Canna (Canna flaccida) in a floating wetland mesocosm study
J. Brad Glenn1, Elizabeth T. Nyberg2, Jonathan J. Smith2, and Sarah A. White2
1Environmental Toxicology, Clemson University, Pendleton, SC 29670 2Department of Environmental Horticulture, Clemson University Clemson, SC 29634-0319
Index Words: Phosphorus, Water quality, Canna flaccida, Golden Canna, Floating wetland, Mesocosm, Remediation, Constructed wetland
Significance to Industry: Phosphorus (P) is classified as a macronutrient and is involved in many cellular and biochemical processes within the plant, such as energy transfer and activation of cellular processes. Because P is utilized in many cell processes it often becomes a limiting nutrient. Nurseries apply supplemental P during fertilization to promote plant growth and health. Phosphorus is readily taken up by plants, however it is often over applied. Irrigation and rain events mobilize and leach P from container substrates before it can all be absorbed and metabolized by ornamental crops. Reducing P levels in runoff is of importance because P is the primary contributor (besides nitrogen) to accelerated fresh water eutrophication; excess P promotes algal growth and blooms, ultimately leading to deteriorating water quality as defined by reduced clarity and extremely low dissolved oxygen levels. We investigated the P remediation potential of floating wetlands established with Golden Canna and determined that Golden Canna is efficient at aiding P removal from simulated nursery runoff.
Nature of Work: Constructed wetlands mimic natural wetlands and filter out excessive amounts of nutrients, reduce suspended solids, and enhance water quality, but are often quite large and take many years to fully establish and attain their remediation potential. Floating wetlands can be used as an alternative to large-scale constructed wetlands, and they can be established with one or two plant species in a short time period. Plant choice can also be catered to optimize uptake of excess nutrients. These smaller scale wetlands serve the same function as their permanent predecessors but are much more adaptable. Floating wetlands place large root surface areas directly in the water column; this root area provides habitat for nutrient metabolizing micro- bacteria, aids in filtration of particulates and suspended solids, and enhances sites for nutrient uptake by the plant species. Floating wetlands can also be placed in smaller and low-use areas, such as drainage areas as long as adequate water depth is maintained. Floating wetlands are cost efficient, do not take away land space valuable to the nursery, are not permanent and are easy to install and harvest. The presence of floating wetlands can even add aesthetic quality in the forms of water gardens and waterscapes.
Water Management 139
SNA Research Conference Vol. 56 2011
Previous research by Polomski et al. 2008 (1) suggested that aquatic ornamental plants can be used to remove excess P and Nitrogen (N) at concentrations similar to nursery runoff. This study was designed to examine one common aquatic species, Canna flaccida (Golden Canna), to determine its ability to remove P, to determine how aeration influences P uptake, and to determine if planting densities affect nutrient removal. Golden Canna liners were purchased from Charleston Aquatic Nurseries (Johns Island, SC). Bare root Golden Canna transplants were placed in aerator cups, seated in floating mats, and allowed to grow to maturity. The experiment was carried out over a 5 month time period. The test period encompassed active growth by the juvenile plant to reach mature flowering and was terminated when senescence began due to seasonal and environmental cues.
The experimental setup for the floating wetland mesocosms utilized twenty-four 380-liter (100 gal.) Rubbermaid® tanks. Simulated nursery runoff was supplied using a 20-2-20 commercial-grade soluble fertilizer (Southern Agricultural Insecticides, Inc., Hendersonville, NC) with 34.6 ± 6.4 mg/L (ppm) N and 3.8 ± 0.5 mg/L (ppm) P supplied to each tank at a 2-day hydraulic retention time. Treatments consisted of 50% and 100% floating mat surface coverage with plant densities of either 10 plants (50% or 100% coverage) or 20 plants (100% coverage). Water quality parameters monitored - - included NO3 , NO2 , NH3, PO4, SO4, and pH. Anion concentrations were determined using a Dionex AS50 ion chromatograph (Dionex Corp., Sunnyvale, CA), and total P, K, Ca, Mg, Zn, Cu, Mn, Fe, S, Na, B, and Al were analyzed via inductively coupled plasma emission spectrophotometer (ICP-ES, 61E Thermo Jarrell Ash, Franklin, MA). Golden Canna roots and shoots were measured on a monthly basis to monitor growth and establishment of the floating wetlands. Floating wetlands were planted March 23, 2010 and harvested August 31, 2010. Three representative plants from each mesocosm were selected during harvest weighed, dried, reweighed and submitted to the Clemson Agriculture Service laboratory for tissue analyses (data not reported). Data were analyzed using SAS PROC GLM (SAS Institute Inc. Cary, NC).
Results and Discussion: Aeration did not appear to influence mesocosm dissolved oxygen levels until after 1 month (Figure 1), when plant shoots and root systems were more mature. Differences detected in dissolved oxygen (D.O.) levels between the aerated and non-aerated treatments resulted in P dynamics that conflict with results from our previous research (2). Although we found little correlation between D.O. levels and N reduction (2) in 2009, we posit that low D.O. and higher pH levels enhanced P remediation in non-aerated treatments (Figures 1,3). Although declining D.O. concentrations correlated with a drop in pH of treated effluent, non-aerated treatments maintained a higher pH (on average) than aerated treatments pH of 4.95 ± 1.2 and pH 4.42 ± 0.8, respectively. This shift in pH was relevant because rhizosphere pH has been shown to influence P availability to plants (5). At pH vales < 6.0, P may have become less available to plants due to its chemical state; typically P forms a complex with aluminum or iron in acidic environments. However, even at the pH values maintained in our treatment mesocosms, P removal still occurred. This P removal could be driven by chemical complexation, active absorption by Golden Canna, or through breakdown via microbial communities (3). Between May and June, when the lowest pH
Water Management 140
SNA Research Conference Vol. 56 2011
value was detected, we also measured the lowest P concentrations in treatment mesocosm effluent (Figure 2). Phosphorus removal may be driven by complexing metals at lower pH values, mineralization and settling, or possible conversion to organic P and absorption by the plants (4). As pH began to increase later in the season (July), P concentrations in mesocosm effluent began to increase (Figure 2). This was most likely because P was still biologically unavailable to Canna (pH < 6.0), but complexation and mineralization processes prevalent at low pH were unfavorable. Overall P removal efficiency (Figure 4) fluctuated dramatically over the experiment (aerated 43% ± 19% and non-aerated 51% ± 16%), but P removal efficiency increased in July (aerated 58% ± 7% and non-aerated 76% ± 4%), especially in the non-aerated treatments, which maintained a higher pH (aerated 4.21 ± 0.13 and non-aerated 4.43 ± 0.22, average, Figure 3). These findings are important because it may be more critical to choose plant species that maintain higher average pH in their rhizosphere, thus enhancing P remediation in constructed wetlands.
When comparing coverage in terms of P removal ability, we found that mesocosms established with either 50 or 100 percent coverage had similar P removal efficiencies. Although it seems that higher density plantings improve nutrient remediation (especially later in the season, Figure 4), the relationship between D.O and pH is equally important and may drive P remediation efficiency mesocosms when plant uptake capacity is not the limiting factor.
Overall Golden Canna is effective at reducing P levels in simulated nursery runoff. Dense Golden Canna plantings maintained an extended P remediation capacity when compared with low-density plantings later in the growing season after plants had reached maturity. pH changes in effluent may be more important than planting density for maintaining optimal P remediation. For optimal P remediation, our study results indicate that floating wetlands should be established using a mixture of planting densities with plants that do not strongly acidify their rhizosphere.
References: (1) Polomski, R.F., Bielenberg, D.G., Whitwell, T., Taylor, M.D., Bridges, W.C., Klaine, S.J., 2008. Differential nitrogen and phosphorus recovery by five aquatic garden species in laboratory-scale subsurface-constructed wetlands. HortScience 43, 868-874. (2) White, S.A., Cousins, M., Seda, B., Glenn, J.B., 2009. Does oxygen status influence floating wetland nutrient uptake? SNA Research Conference Proceedings. 55, 182-188 (3) Mulkerrins, D., Jordan, C., McMahon, S., Colleran, E., 2000. Evaluation of the parameters affecting nitrogen and phosphorus removal in anaerobic/anoxic/ oxic (A/A/O) biological nutrient removal systems. Journal of Chemical Technology and Biotechnology. 75: 261-268. (4) Achat, D.L., Bakker, M.R., Zeller, B., Pellerin, S., Bienaime, S., Morel, C., 2010. Long-term Organic Phosphorus Mineralization in Spodosols Under Forests and its Relation to Carbon and Nitrogen Mineralization. Soil Biology & Biochemistry. 42(9): 1479-1490. (5) Marschner, H. 1995. Mineral Nutrition of Higher Plants 2nd edition. San Diego; Academic Press, pp 549-580.
Water Management 141
SNA Research Conference Vol. 56 2011
Figure 1: Dissolved oxygen concentrations measured in aerated and non-aerated experimental scale floating wetland mesocosms† established with Canna flaccida and receiving simulated nursery effluent for five months in 2010. †Treatments consisted of aerated (A) and non-aerated (NA) treatments established with 100 percent coverage with 10 plants, 100 percent coverage with 20 plants, and 50 percent coverage with 10 plants.
Water Management 142
SNA Research Conference Vol. 56 2011
Figure 2: Phosphorus (Inorganic and organic) concentration detected in the influent and effluent of aerated (A) and non-aerated (NA) floating wetland treatment† mesocosms established with Canna flaccida and receiving simulated nursery effluent for five months in 2010. †Treatments included 100 percent coverage with 10 plants, 100 percent coverage with 20 plants, and 50 percent coverage with 10 plants.
Water Management 143
SNA Research Conference Vol. 56 2011
Figure 3: pH values measured in aerated and non-aerated experimental scale floating wetland mesocosms† established with Canna flaccida and treating simulated nursery effluent for five months in 2010. †Treatments consisted of aerated (A) and non-aerated (NA) treatments established with 100 percent coverage with 10 plants, 100 percent coverage with 20 plants, and 50 percent coverage with 10 plants.
Water Management 144
SNA Research Conference Vol. 56 2011
Figure 4: Phosphorus removal efficiency in aerated (A) and non-aerated (NA) floating wetland treatment† mesocosms established with Canna flaccida and receiving simulated nursery effluent for five months in 2010. †Treatments included 100 percent coverage with 10 plants, 100 percent coverage with 20 plants, and 50 percent coverage with 10 plants.
Water Management 145
SNA Research Conference Vol. 56 2011
Salt Tolerance of Selected Bedding Plants
Genhua Niu and Denise S. Rodriguez
Texas AgriLife Research Center at El Paso, Texas A&M System, 1380 A&M Circle El Paso, TX 79927
Index Words: landscape irrigation, salinity tolerance, water reuse
Significance to Industry: Water shortage and poor water quality are critical issues in the Southwest and many other regions of the world. With a rapidly increasing population and diminishing water supplies, the competition for fresh water among agriculture, industry, urban and recreational users has become intense. Using alternative water sources to irrigate agricultural crops and landscapes may be inevitable in the future. Therefore, information on salt tolerance of bedding plants is of increasing importance. Previous studies have shown that a wide range of salt tolerance exists among floricultural crops and other ornamentals (1,3,4). This study continued to screen the salt tolerance of selected bedding plants. The results indicated that marigold and gazania were sensitive to salinity while angelonia, gomphrena, and petunias were moderately tolerant to salinity and could be irrigated with saline water at moderate salinity levels, although growth may be reduced.
Nature of Work. Seeds of seven bedding plants provided by Ball Horticultural Company (Table 1) were sown in 72-cell trays filled with a germination mix (Sunshine Mix No. 5, SunGro Hort., Bellevue, WA) and placed in a greenhouse on a mist bench with reverse osmosis (RO) water. After germination, seedlings were grown in the greenhouse in 500-mL pots (one plant per pot) filled with similar potting mix with additional coarse perlite to improve drainage (Sunshine Mix No. 4, SunGro Hort.). Plants were subirrigated with nutrient solution until Mar 12 when saline solution treatments were initiated.
Saline solutions at electrical conductivity (EC) of 1.5 (nutrient solution, control), 2.8, 4.5, 6.5, and 8.2 dS·m-1 (symbols: Control, EC 2.5, EC 4, EC 6, and EC 8) were created by adding appropriate amounts of sodium chloride (NaCl), magnesium sulfate (MgSO4·7H2O), and calcium chloride (CaCl2) at 87:8:5 (weight ratio) to the nutrient solution. The nutrient solution with EC of 1.5 was prepared by adding 0.5 g·L-1 of 20N- 8.6P-16.7K (Peters 20-20-20; Scotts) to tap water. The major ions in the tap water were + 2+ 2+ - 2- –1 Na , Ca , Mg , Cl , and SO4 at 184, 52.0, 7.5, 223.6, and 105.6 mg·L , respectively. The composition of the treatment saline solutions was similar to that of the reclaimed municipal effluent of the local water utilities. Flat-bottom tubs with a dimension of 128 x 71 x 18 cm (4.2 x 2.3 x 0.6 ft) were used for subirrigation. Nine plants in 4-in pots were fit in one flat (25.4 x 50.8 cm or 10 x 20 in) along with another nine empty pots spacing and supporting the experimental plants. Whenever the substrate surface started to dry, plants
Water Management 146
SNA Research Conference Vol. 56 2011
were subirrigated by placing the whole flat into the flat-bottom tub filled with one of the treatment solutions. After subirrigation, flats were randomly placed back on to the growing benches. For the three petunia cultivars, 18 days after treatments (March 30), plants were transplanted from 4-in pots to 2.6 L containers (1 gal) due to rapid growth and were top irrigated (through substrate surface) with tap water right after transplanting. Petunia plants were then switched to top irrigation with 1 L treatment solutions from 6 April until the end of the experiment, which was 30 April, while all other species were subirrigated throughout the experiment and were terminated a week earlier (April 22). The temperatures in the greenhouse during the experimental period were at 29.3 ± 1.6 C (mean ± SD) during the day and 23.0 ± 2.4 C at night. The daily light integral (photosynthetically active radiation) was measured at 10.4 ± 3.1 mol·m-2·d-1.
Leaf osmotic potential was analyzed by taking leaf samples 2 weeks after the initiation of the treatment, when all plants were alive while visual differences among treatments already exhibited. The procedure for leaf osmotic potential analysis was described in previous studies (2,4). Upon termination of the experiment, shoots were severed at the substrate surface. Shoot dry weight (DW) was determined after oven-dried at 70 C for 72 h. In order to quantify the salt accumulation and vertical distribution in the root zone, substrate was separated by cutting the top 2-cm layer (top) apart from the rest of the substrate (bottom). The two separated substrates were then extracted according to US Salinity Lab Staff (6). Three pots were selected randomly among the different species per treatment for the above salinity analysis. For the one-gal petunia pots, substrate salinity was analyzed for control, EC 4 and EC 8 using the same methodology. The experiment was a completely randomized design with 6 to 9 replications, depending on species. ANOVA analysis was conducted using PROC GLM. To distinguish the differences among treatments, Student-Newman-Keuls multiple comparisons were performed. All data were analyzed using SAS software (Version 9.1.3, SAS Institute Inc., Cary, NC).
Results and Discussion. The salinity of the top 2-cm layer for the 4-in pots ranged from 17.8 dS·m-1 in the control to 39.0 dS·m-1 in the EC 8 treatments (Table 2). The bottom salinity ranged from 2.3 dS·m-1 in the control to 12.9 dS·m-1 in the EC 8 treatment. These results indicated that the higher the salinity of irrigation water, the higher the salinity in the root zone both at the top and bottom, while the salinity at the top were 2 to 8 times higher than that at the bottom. Our previous study indicated that salinity in mineral soils at the top soil layer increased linearly over time when irrigated with saline water at EC of 1.5 dS·m-1 (5). Petunia plants, in one gallon pots, that were irrigated through the substrate surface from 6 April to 30 April, had higher salinity in the top substrate layer than at the bottom (Table 2), indicating that salts moved toward the top through water extraction by the plants. As long as salts exist in the irrigation water, salts accumulate in the root zone.
Among the seven species, marigold was the most sensitive to elevated salinity. By day 24, all plants in the EC 8 and about 50% in the EC 6 treatments were dead. By day 40, at the end of the experiment, all marigold plants were dead except for those in the control treatment. Plants in the control also had visible foliar salt damage caused by
Water Management 147
SNA Research Conference Vol. 56 2011
high salinity at the top of the substrate (17.9 dS·m-1) and 2.3 dS·m-1 for the rest of the substrate. Therefore, care must be taken when subirrigating salt sensitive plants for extended period because salinity increases over time when mineral salts exist in the irrigation water. For gazania, open flowers wilted sooner at higher salinity levels (data not shown), although all plants survived regardless of salinity treatment. Plants were smaller when irrigated with higher salinities. By the end of the experiment, flowers of the control plants also exhibited wilting. For gomphrena, plants in the EC 4 treatment performed best. Plants in the control and EC 2.5 exhibited leaf wilting even though substrate was moist, possibly due to low light intensity in the greenhouse. The greenhouse roof was covered by a shade cloth with 55% light exclusion during the experiment. All petunia and angelonia plants looked healthy throughout the experimental period, although angelonia plants became smaller as EC of irrigation water increased.
Shoot DW decreased linearly as salinity of irrigation solution increased in all species except for gomphrena (Fig. 1). As salinity increased, shoot DW of gomphrena changed in a quadratic fashion with highest shoot DW occurred at EC of 4.5 dS·m-1. Compared to the control, shoot DW of angelonia at EC of 4.5, 6.5, and 8.2 dS·m-1 was reduced by 39, 45, and 57%, respectively. In our previous study, the impact of salinity on shoot growth reduction in angelonia was smaller. The differences may be due to the subirrigation, causing salt accumulation in the root zone, and seedling age at the time of initiating salinity, although the salinities of the irrigation solutions were similar. In the present study, seedlings were younger than those in (4) at the initiation of treatment. For petunias, plants grow rapidly without salt injury. Since no visual damage exhibited at all, moderate salinity may produce more compact plants compared to the control and may eliminate or reduce the use of plant growth regulators.
Leaf osmotic potentials decreased linearly as salinity increased in angelonia, gazania, marigold, petunia ‘Baby Duck Yellow’ and ‘Spreading’, while those in gomphrena and petunia ‘Mirage Rose’ changed in a quadratic fashion (Fig. 2). In summary, angelonia, petunia and gomphrena plants are moderately salt tolerant and can be irrigated with saline water up to moderate salinity levels, although shoot growth would be reduced.
Literature cited 1. Carter, C.T. and C.M. Grieve. 2006. Salt tolerance of floriculture crops, p. 279- 287. In: M.A. Khan and D.J. Weber (eds.). Ecophysiology of high salinity tolerant plants. Springer, Dordrecht, Netherlands. 2. Niu, G. and D.S. Rodriguez. 2006. Relative salt tolerance of five herbaceous perennials. HortScience 41:1493–1497. 3. Niu, G., D.S. Rodriguez, and L. Aguiniga. 2008. Effect of saline water irrigation on growth and physiological responses of three rose rootstocks. HortScience 43:1479–1484. 4. Niu, G., D.S. Rodriguez, and T. Starman. 2010a. Response of bedding plants to saline water irrigation. HortScience 45:628-636.
Water Management 148
SNA Research Conference Vol. 56 2011
5. Niu, G., D.S. Rodriguez, R. Cabrera, J. Jifon, D. Leskovar, and K. Crosby. 2010b. Salinity and soil type effects on emergence and growth of pepper seedlings. HortScience 45:1265–1269. 6. USDA Staff. 1954. Diagnosis and improvement of saline and alkaline soils. In: Richards, L.A. (Ed.), USDA Agriculture Handbook No. 60. U.S. Government Printing Office, Washington, DC.
Table 1. List of plant species used in the experiment.
Scientific name Common cultivar Angelonia angustifolia Angelonia Purple Gazania rigen Gazania Pink Shade Gomphrena sp. Gomphrena Fireworks Petunia x hybrida Petunia Baby Duck Yellow Petunia x hybrida Petunia Mirage Rose Petunia x hybrida Petunia Spreading Tagetes erecta Marigold Gold
Table 2. Salinity of the substrate at the top 2-cm layer and below (bottom) analyzed through saturated extraction at the end of the experiment (Mean ± SD).
Treatment Top Bottom Top Bottom 4-in pots (dS m-1) one gallon pots (dS m-1)
Control 17.9 ± 1.2 2.3 ± 0.2 6.7 ± 0.2 1.7 ± 0.3 EC 2.5 26.7 ± 3.9 6.3 ± 0.8 -- z -- EC 4 34.3 ± 0.7 8.3 ± 0.8 15.7 ± 2.2 4.8 ± 0.3 EC 6 34.0 ± 2.5 14.2 ± 1.3 -- -- EC 8 39.0 ± 0.8 12.9 ± 1.1 32.7 ± 1.7 7.6 ± 0.6 z not measured
Water Management 149
SNA Research Conference Vol. 56 2011
Shoot dry weight (g/plant)
3.5 3.5 Angelonia a Gazania 3.0 3.0 b 2.5 a 2.5 b a b 2.0 2.0 b 1.5 1.5 b bc 1.0 c 1.0 Y=3.26-0.25X (P<0.0001) Y=2.73-0.13X (P<0.0001) 0.5 0.5 0.0 0.0 6 30 Gomphrena Petunia 'Baby Duck Yellow' 5 25 4 a ab a 3 ab ab 20 b 2 b b 15 Y=1.21+1.37X-0.13X^2 (P=0.02) c c 1 Y=25.7-1.37X (P<0.0001) 0 10 25 25 Petunia 'Mirage Rose' Petunia 'Spreading' 20 a 20 a b 15 b 15 b bc c c c c 10 10 Y=17.7-0.95X (P<0.0001) Y=20.8-0.87X (P<0.0001) 5 5 123456789 123456789 -1 -1 Electrical conductivity (dS·m ) Electrical conductivity (dS·m )
Fig. 1. Shoot dry weight (DW) of seven bedding plants irrigated with saline solution at electrical conductivity of 1.5, 2.8, 4.5, 6.5, or 8.2 dS·m-1. Vertical bars represent standard errors. Means with same letters are not significantly different tested by Student-Newman-Keuls multiple comparisons.
Water Management 150
SNA Research Conference Vol. 56 2011
Leaf osmotic potential (MPa) -0.6 -0.6 Angelonia a Gazania -0.8 a -0.8 ab ab b -1.0 ab -1.0 b -1.2 b -1.2 c b -1.4 -1.4 Y=0.79-0.07X (P<0.0001) -1.6 -1.6 Y=-0.90-0.08X (P=0.0039) -1.8 -1.8 -0.6 -0.6 a Gomphrena Marigold -0.8 -0.8 ab a -1.0 a -1.0 ab a b -1.2 -1.2 bb c -1.4 -1.4 -1.6 -1.6 Y=-1.0+0.06X (P=0.0017) Y=-0.71-0.09X (P<0.0001) -1.8 -1.8 -0.6 -0.6 Petunia 'Baby Duck Yellow' Petunia 'Mirage Rose' -0.8 -0.8 a -1.0 a -1.0 ab -1.2 ab bc -1.2 bc -1.4 c -1.4 bc Y=-0.75-0.07X (P<0.0001) c c -1.6 -1.6 Y=-0.31-0.35X+0.03X^2 (P=0.0007) -1.8 -1.8 -0.6 123456789 Petunia 'Spreading' -0.8 Electrical conductivity (dS·m-1) a -1.0 ab -1.2 b -1.4 c c -1.6 Y=-0.69-0.09X (P<0.0001) -1.8 123456789
-1 Electrical conductivity (dS·m ) Fig. 2. Leaf osmotic potential of seven bedding plants irrigated with saline solution at electrical conductivity of 1.5, 2.8, 4.5, 6.5, or 8.2 dS·m-1. Vertical bars represent standard errors. Means with same letters are not significantly different tested by Student-Newman-Keuls multiple comparisons.
Water Management 151
SNA Research Conference Vol. 56 2011
Salt Tolerance of Five Wildflower Species
Genhua Niu1, Denise S. Rodriguez1, Cynthia McKenney2
1Texas AgriLife Research Center at El Paso, Texas A&M System, 1380 A&M Circle El Paso, TX 79927 2Department of Plant and Soil Science, Texas Tech University, Lubbock, TX 79409
Index Words: landscape irrigation, salt tolerance, water reuse, water-wise landscape
Significance to Industry: Due to intense competition for fresh water among agriculture, industry, and domestic water users, an alternative water source such as municipal reclaimed water is being used for irrigating landscapes in some areas in the Southwest. Herbaceous wildflowers dominate arid regions of Australia and the western United States, and are important plant materials for water-wise landscapes (1,2,5). However, the responses of herbaceous perennial wildflowers to irrigation water with elevated salts are unknown. This study quantified the responses of five native wildflowers to elevated salinity. Our results indicated that Mexican Hat was the most tolerant, followed by evening primrose and mealy cup sage and they could be irrigated with saline solution at low to moderate salinity. Lemon horsemint was most sensitive to salinity, followed by chocolate daisy, which was moderately sensitive.
Nature of Work. Seeds of Salvia farinacea (mealy cup sage), Berlandiera lyrata (chocolate daisy), Ratibida columnaris (Mexican hat), Oenothera elata (evening primrose), and Monarda citriodora (lemon horsemint) were sown Feb 2 into 406-cell flats filled with sunshine mix 5 (SunGro Hort., Bellevue, WA). Flats were covered with aluminum foil and placed into cold storage at 5 C for 3 to 6 weeks depending on species, and were placed back in greenhouse benches whenever seedlings emergence occurred. Germinated seedlings were transplanted to larger cells (vol. 26 mL) on March 26 and April 9, depending on species, and grown in the greenhouse. On April 29, seedlings were transplanted to 2.6 L (1 gal) containers filled with Sunshine Mix No. 4 (SunGro Hort). The temperatures in the greenhouse during the experimental period were at 29.3 ± 1.6 C (mean ± SD) during the day and 23.0 ± 2.4 C at night. The daily light integral (photosynthetically active radiation) was measured at 10.4 ± 3.1 mol·m-2·d- 1. On May 6, Osmocote 14-14-14 (13 grams/pot) (The Scotts Co., Maryville, OH) and Marathon (1 teaspoon/pot) (OHP, Inc., Mainland, PA) were applied to all plants. On May 7, plants were moved to a shade house with 25% light exclusion and were well irrigated with tap water until saline solutions treatments were initiated on May 20.
Saline solutions at electrical conductivity (EC) of 2.8, 3.9, 5.5, and 7.3 dS·m-1 were created by adding appropriate amounts of sodium chloride (NaCl), magnesium sulfate (MgSO4·7H2O), and calcium chloride (CaCl2) at 87:8:5 (weight ratio) to tap water. The EC of tap water was 0.8 dS·m-1 and the major ions in the tap water were Na+, Ca2+,
Water Management 152
SNA Research Conference Vol. 56 2011
2+ - 2- –1 Mg , Cl , and SO4 at 184, 52.0, 7.5, 223.6, and 105.6 mg·L , respectively. The composition of the treatment saline solutions was similar to that of the reclaimed municipal effluent of the local water utilities. Plants were irrigated with tap water (control) or one of the saline solutions at 1 L per pot whenever the substrate surface started to dry, which depended on species (biomass) and climatic conditions. The outdoor climatic conditions during the experimental period were average daily air temperatures at 28.5 ± 2.0 C, relative humidity at 19.8 ± 7.3 %, solar radiation at 29.5 ± 2.6 MJ·m-2·d-1, and four times of rainfall with a total of 68 mm, recorded by an on-site weather station.
Leaf osmotic potential was analyzed by taking leaf samples in the fourth weeks after the treatments were initiated. The procedure for leaf osmotic potential analysis was described in previous studies (3,4). In order to quantify the salt accumulation, leachate was measured according to pour-through method (6). Upon termination of the experiment, shoots were severed at the substrate surface. Shoot dry weight (DW) was determined after oven-dried at 70 C for 72 h. Foliar salt damage was rated by giving a score to every plant from 0 to 5, where 0 = dead, 1 = over 90% foliar damage (salt damage: burning, necrosis, and discoloration); 2 = moderate (50-90%) foliar damage; 3 = slight (<50%) foliar damage; 4 = good quality with minimal foliar damage; and 5 = excellent with no foliar damage. The experiment was a split-plot design with salinity of irrigation water as the main plot and species subplot with 10 replications. All data were analyzed by a two-way ANOVA using PROC GLM. When the main effect was significant, linear regression was performed using PROC REG. To determine the differences among salinity level on plant growth, Student-Newman-Keuls multiple comparisons were performed. All statistical analyses were performed using SAS software (Version 9.1.3, SAS Institute Inc., Cary, NC).
Results and Discussion. Among the five species, lemon horsemint was the most sensitive to elevated salinity, followed by chocolate daisy. Eighteen days after the treatments, the survival percentages were 60%, 30%, 20%, 20% for plants irrigated at EC of 2.8, 3.9, 5.5, and 7.3 dS·m-1, respectively. For chocolate daisy, the survival percentages were 30% at EC of 5.5 and 7.3 dS·m-1 on day 18. By the end of the experiment (five week treatment), all plants of lemon horsemint in the elevated salinity treatments were dead (Table 1). Visual quality was lowest for lemon horsemint. Chocolate daisy plants had low visual scores at EC of 5.5 and 7.3 dS·m-1. For the other three species, survival percentages were 80% and 90% at the highest salinity level (Table 1). Evening primrose and mealy cup sage had similar low visual quality scores at EC of 7.3 dS·m-1, while Mexican hat plants had high scores regardless of salinity treatment (Table 2).
Shoot dry weight (DW) of all survived species decreased linearly as salinity of irrigation water increased, except for chocolate daisy, which was not affected by salinity (Fig. 1). Chocolate daisy grew slowly during the experimental period with large variations among individual plants and therefore, no significant differences were observed among the treatments. For mealy cup sage, shoot DW was not different among control, EC of 2.8,
Water Management 153
SNA Research Conference Vol. 56 2011
3.9, and 5.5 dS·m-1. For Mexican Hat and evening primrose, no differences were found -1 in shoot DW between the control and EC 2.8 dS·m . The r reduction of shoot DW was 25%, 27%, and 53% for Mexican Hat and 17%, 19%, and 39% for evening primrose at EC of 3.8, 5.5, and 7.3 dS·m-1, respectively, compared to the control.
Leaf osmotic potential in the control was highest in lemon horsemint, indicating that this species has lowest ability in osmotic adjustment (Table 3). Since no plants of lemon horsemint survived, no data of osmotic potential was able to compare with other species. Generally, leaf osmotic potential decreased with increasing salinity in Mexican hat, mealy cup sage, and evening primrose. In the survived plants of chocolate daisy in control, EC of 2.8 and 3.9 dS·m-1, no differences were found. Leachate salinities were pooled from species. The EC of leachate measured in the middle of the experiments were 3.8, 7.1, 11.8, 14.6, and 16.2 dS·m-1 for treatments of EC 0.8 (control), 2.8, 3.9, 5.5, and 7.3 dS·m-1, respectively. These results indicated salt accumulation in the root zone.
In summary, lemon horsemint was most sensitive to salinity stress and could not tolerate any elevated salinity in irrigation water. Chocolate daisy was moderately sensitive and may be irrigated with low salinity less than 3.9 dS·m-1. Based on the current study, the order of salt tolerance among the five was Mexican hat > evening primrose and mealy cup sage > chocolate daisy > lemon horsemint.
Literature Cited 1. Beran, D.D., R.E. Gaussoin, and R.A. Masters. 1999. Native wildflower establishment with imidazolinone herbicides. HortScience 34:283-286. 2. Kjelgren, R., L. Wang, and D. Joyce. 2009. Water deficit stress responses of three native Australian ornamental herbaceous wildflower species for water-wise landscapes. HortScience 44:1358-1365. 3. Niu, G. and D.S. Rodriguez. 2006. Relative salt tolerance of five herbaceous perennials. HortScience 41:1493–1497. 4. Niu, G., D.S. Rodriguez, and T. Starman. 2010a. Response of bedding plants to saline water irrigation. HortScience 45:628-636. 5. Pérez, H.E., C.R. Adams, M.E. Kane, J.G. Norcini, G. Acomb, and C. Larsen. 2010. Awareness and interest in native wildflowers among college students in plant-related disciplines: a case study from Florida. HortTechnology 20:368-376. 6. Wright, R.D. 1986. The pour-through nutrient extraction procedure. HortScience 21:227-229.
Water Management 154
SNA Research Conference Vol. 56 2011
Table 1. Survival percentage (%) of five wildflower species irrigated with saline solution - at electrical conductivity (EC) of 0.85 (control, tap water), 2.79, 3.89, 5.50, or 7.26 dS·m 1 for five weeks. Survival percent (%) Species EC = 0.8 EC = 2.8 EC = 3.9 EC = 5.5 EC = 7.3 Chocolate daisy 90 90 100 20 30 Lemon horsemint 100 0 0 0 0 Evening primrose 100 100 100 100 80 Mexican Hat 90 100 100 90 90 Mealy cup sage 100 100 90 100 80
Table 2. Visual quality (score) of five wildflower species irrigated with saline solution at electrical conductivity (EC) of 0.85 (control, tap water), 2.79, 3.89, 5.50, or 7.26 dS·m-1 for five weeks. Score of 0 = dead, 5 = excellent. Visual score Species EC = 0.8 EC = 2.8 EC = 3.9 EC = 5.5 EC = 7.3 Chocolate daisy 4.8 4.4 4.8 0.6 1.5 Lemon horsemint 3.5 0 0 0 0 Evening primrose 4.6 4.6 4.4 4.5 3.1 Mexican Hat 4.9 5.0 4.5 4.7 4.9 Mealy cup sage 5.0 4.9 4.4 4.5 3.3
Table 3. Leaf osmotic potential measured at the end of the experiment of five wildflower species irrigated with saline solution at electrical conductivity (EC) of 0.85 (control, tap water), 2.79, 3.89, 5.50, or 7.26 dS·m-1 for five weeks. Leaf osmotic potential (MPa) Species EC = 0.8 EC = 2.8 EC = 3.9 EC = 5.5 EC = 7.3 Chocolate daisy -1.59 A b z -1.71 A -1.43 A - y - Lemon horsemint -1.29 a - - - - Evening primrose -1.81 AB bc -2.25 DC -1.76 A -2.15 BC -2.56 D Mexican Hat -1.66 A bc -1.76 A -1.95 AB -2.17 B -2.51 C Mealy cup sage -1.92 A c -2.12 AB -2.21 ABC -2.33 BC -2.53 C
z means with same capitalized letters in the same row (among treatments) were not different; means with the same small letters in the same column (among species) were not different tested by Student-Newman-Keuls multiple comparisons at P = 0.05 y not measured (dead or not enough replicates).
Water Management 155
SNA Research Conference Vol. 56 2011
Shoot dry weight (g/plant)
10 20 Chocolate daisy Mexican Hat 8 15 NS 6 10 4 5 2 Y=14.1-0.96X (P=0.0007) 0 0 30 20 Evening primrose Mealy cup sage 25 15 20 15 10 10 Y=24.7-1.34X (P<0.0001) 5 5 Y=14.3-1.0X (P=0.0008) 0 0 012345678 012345678
-1 -1 Electrical conductivity (dS·m ) Electrical conductivity (dS·m )
Fig. 1. Shoot dry weight (DW) of five wildflower species irrigated with saline solution at electrical conductivity of 0.8 (control, tap water), 2.8, 3.9, 5.5, or 7.3 dS·m-1. Vertical bars represent standard errors.
Water Management 156
SNA Research Conference Vol. 56 2011
Ecological Disinfestation: Evaluation of Substrates for Removal of Zoospores of Phytophthora nicotianae From Water
Elizabeth T. Nyberg1, Inga M. Meadows2, Steven N. Jeffers2, Sarah A. White3
1Environmental Toxicology, Clemson University, Pendleton, SC 29670 2Department of Entomology, Soils,and Plant Sciences, Clemson University Clemson, SC 29634 3Department of Environmental Horticulture, Clemson University, Clemson, SC 29634
Index Words: Phytophthora nicotianae, slow sand filtration, physical filtration
Significance to Industry: This research is an initial investigation to evaluate the efficiency of various filter substrates to remove propagules of oomycete plant pathogens from recycled irrigation water at ornamental plant nurseries. Eventually, our results can be used to develop an ecological pathogen remediation system for recycled irrigation water, which should increase the use of alternative water sources in the nursery industry.
Nature of Work: As demands for fresh water increase due to population growth, there is a growing need to reduce water usage and reuse wastewater. Almost 60% of the world’s fresh water resources is used for irrigation and approximately half of this is available for reuse after irrigation (1). The ornamental plant nursery industry has made a significant effort to increase water use efficiency by capturing, treating, and recycling irrigation runoff. Ecologically based, low maintenance water remediation systems have been developed to remove fertilizers and pesticides from irrigation runoff (2). However, developing a strategy to mitigate plant pathogens in runoff water is essential to improve the utility of these water remediation systems, so they will be useful for all types of nurseries. The removal or elimination of propagules of plant pathogens, species of Phytophthora and Pythium in particular, is critical if irrigation water is to be recycled and reused. These pathogens are present in many nurseries and greenhouses, and irrigation water can be a primary dispersal mechanism (3). If infested water is applied to crops, there is an elevated threat of wide-spread epidemics, crop damage, and lost profits (3,4). The traditional methods for treating water—e. g., chlorination, ozonation, and ultraviolet radiation—are expensive to install and maintain, which deters many nursery owners from initiating a water-recycling program (3).
Species of Phytophthora produce motile, swimming zoospores that are disseminated in water (5). Phytophthora nicotianae was used in this study because it attacks over 200 plant species worldwide and is one of the most common species attacking nursery plants and infesting irrigation water in the southeastern USA (3,4,5; Jeffers, personal observation). It would be a significant improvement to modify ecologically based, low maintenance water remediation systems to remove propagules of these destructive plant pathogens. Therefore, the overall goal of this project is to evaluate the effectiveness of five substrates—sand, crushed brick, calcined clay, Kaldnes® medium,
Water Management 157
SNA Research Conference Vol. 56 2011
and polyethylene beads—to remove zoospores of P. nicotianae from water. Wohanka et al. (6) optimized the removal of several plant pathogens using slow sand filtration; however, investigating substrates that have the potential for higher flow rates is critical for practical application at the relatively large nurseries in the southeastern USA, which use large volumes of water on a daily basis. Slow sand filtration efficiency is based on physical, chemical, and microbial parameters of the substrate and water system (7). For this research, we will analyze the physical and microbial parameters for the selected substrates, but we report here only the physical attributes of these substrates.
A series of transparent poly-vinyl chloride (PVC) columns (5 cm in diameter, 121 cm tall) were constructed to evaluate the five substrates (Figure 1). The bottom of each column was sealed with a PVC cap fitted with a mesh lining and a valve to keep substrates in the column and to regulate flow, respectively. A 13-gal sump tank and pump evenly supplied water to each column. Before use, substrates were washed and dried to remove fine dust and to maximize flow. The physical filtration capacity of each substrate was evaluated at six depths: 0, 5, 10, 20, 40, and 60 cm.
Zoospores of P. nicotianae were produced and quantified in the laboratory. Zoospores were added to distilled water to prepare a standard suspension of 1×104 zoospores/L, and a fixed volume of this suspension was added to the top of each column as a single injection at a consistent flow rate. Samples of water entering and exiting each column were collected and assayed for zoospores by passing 200-ml aliquots through polycarbonate membrane filters with 3-µm pores. Filters were inverted onto plates of PARPH-V8, a medium selective for species of Phytophthora (8,9), and isolation plates were placed at 20°C for 24 hr. Filters then were removed and colony-forming units (CFU) were counted to determine the densities of zoospores in the water entering and passing through each column of substrate.
All six depths of each of the five substrates were evaluated six times, and the means of each substrate × depth combination were calculated. Densities were adjusted so that each trial of the experiment had the same initial zoospore density. This adjustment resulted in reporting the changes in zoospore densities among water samples passing through the columns compared to the control for each substrate (depth = 0), which had the maximum zoospore density. By standardizing densities, comparisons among all substrates and depths could be made. Data were analyzed statistically using JMP v.8.0.2 statistical software (SAS Institute, Cary, NC). Means were separated based on Fishers protected least significant difference (LSD, P = 0.05).
Results and Discussion: Filtration efficiency varied significantly among the substrates and depths (Figure 2). In a two-way analysis of variance, the substrate × depth interaction was significant (P < 0.05), indicating that filtration efficiency was affected differentially by depth for each substrate. Sand was the most efficient physical filtration substrate at all depths. Zoospore densities in effluents from sand columns were significantly different from the other substrates at each depth except 5 cm. Zoospores were not recovered in effluent passing through sand depths of 40 and 60 cm, unlike the other substrates where zoospores were recovered in effluents from all depths. This
Water Management 158
SNA Research Conference Vol. 56 2011
difference maybe a consequence of the varying physical properties associated with each substrate (Table 1). Wohanka et al. (6) proposed that a substrate with a uniformity coefficient maximum of 5 and small pore spaces will have an optimum physical filtration ability. Sand had the most uniform grain sizes and the smallest effective grain size, both characteristics of an effective physical filter medium (Table 1). The filtration efficiency of brick and calcined clay were similar across all depths (Figure 2), but their effective grain sizes differed considerably (Table 1). Brick and calcined clay filtered zoospores better than the other two substrates (Kaldnes® medium and polyethylene beads). Kaldnes® medium and polyethylene beads were least effective at removing zoospores from water (Figure 2). Although the filtration efficiencies of these two substrates were similar at most depths, their particle diameters differed by three-fold (Table 1).
The physical features of a substrate like sand can be directly responsible for effectively removing zoospores of P. nicotianae from water—as we have demonstrated; however, the microbial component also has been shown to be an important component in the slow sand filtration system (6,7). Therefore, in our next experiments, we will evaluate the additive effect of biofilms produced by bacteria on zoospore removal by all the substrates used here to determine if filtration efficiency can be enhanced. Eventually, we plan to incorporate a subsurface filtration module into a constructed wetlands system (2), so nurseries in the southeastern USA have an ecologically based, low maintenance water treatment system to cleanse recycled irrigation water.
Literature Cited
1. U.S. Geological Survey. March 2010. Irrigation Water Use. http://ga.water.usgs.gov/edu/wuir.html. [Accessed: October 27, 2010]. 2. Garcia, J., Rousseau, D. P. L., Morato, J., Lesage, E., Matamoros, V. and Bayona, J. M. 2010. Contaminant Removal Processes in Subsurface-Flow Constructed Wetlands: A Review. Critical Reviews in Environmental Science and Technology 40: 561-661. 3. Hong, C.X., and Moorman, G.W. 2005. Plant pathogens in irrigation water: Challenges and opportunities. Critical Reviews in Plant Sciences 24:189-208. 4. Benson, D. M., and von Broembsen, S. 2001. Phytophthora root rot and dieback. pp 52-56 in: Diseases of Woody Ornamentals and Trees in Nurseries. R. K. Jones and D. M. Benson (eds.). The American Phytopathological Society, St. Paul, MN. 5. Erwin, D.C., and Riberio, O.K. 1996. Phytophthora Diseases Worldwide. The American Phytopathological Society, St. Paul, MN. 6. Wohanka, W., Luedtke, H., Ahlers, H., and Luebke, M. 1999. Optimization of slow filtration as a means for disinfecting nutrient solutions. Acta. Hort 481:539-544. 7. Husiman, L., and Wood, W.E. 1974. Slow Sand Filtration. World Health Organization. Geneva, Switzerland. 8. Ferguson, A. J., and Jeffers, S. N. 1999. Detecting multiple species of Phytophthora in container mixes from ornamental crop nurseries. Plant Disease 83:1129-1136. 9. Jeffers, S. N., and Martin,S.B. 1986. Comparison of two media selective for Phytophthora and Pythium species. Plant Disease 70:1038-1043.
Water Management 159
SNA Research Conference Vol. 56 2011
Figure 1.PVC columns used to evaluate physical filtration by substrates at different depths. These columns are filled with two replicates of polyethylene beads at six depths: 0, 5, 10, 20, 40, and 60 cm.
Figure 2. Efficiency of six depths of each of five substrates to filter zoospores of Phytophthora nicotianae from an aqueous suspension.The y-axis represents the change in the number of zoospores (reported as colony-forming units [CFU] in 600 ml) passing through a substrate compared to the control (no substrate, depth = 0). Error bars are the least significant difference (LSD, ±15); therefore, at each depth, substrates with overlapping error bars are not significantly different.
Water Management 160
SNA Research Conference Vol. 56 2011
Table 1. Physical characteristics of five substrates evaluated as filters for zoospores of Phytophthora nicotianae.
Uniformity Effective grain size Particle diameter Substrate coefficient (mm) (mm) Sand 1.89 0.28 n/a Crushed brick 2.60 2.60 n/a Calcined clay 2.07 0.95 n/a Kaldnes® medium n/a* n/a 10.0 Polyethylene n/a n/a 3.0 beads * n/a = Data not applicable to substrate.
Water Management 161
SNA Research Conference Vol. 56 2011
Water Consumption of Hydrangea macrophylla as Affected by Environmental Factors
Lucas O'Meara, Matthew Chappell, and Marc W. van Iersel
The University of Georgia, Department of Horticulture, Athens, GA 30602
Index Words: daily light integral, evapotranspiration, irrigation, load cell, predictive modeling, transpiration
Significance to Industry: With global climate change, commercial and residential expansion, and population growth on the rise, water availability and usage is becoming an increasingly important issue. Large nurseries may use up to 3,000,000 gallons of water per day to irrigate their inventory and can spend hundreds of thousands of dollars per year just to power irrigation equipment. Growers often encounter pathological problems (both foliar and root-related) due to improper irrigation practices, which can result in decreased product salability and increased crop losses. One hurdle that makes more efficient irrigation difficult is the lack of quantitative information regarding the water requirements of plants. The goal of this study was to determine the effect of plant size and environmental conditions on water use of hydrangea ‘Pia’ and ‘Fasan’. Daily water use ranged from 50 to 300 ml/plant per day. Taken together, plant age, final leaf area, daily light integral(DLI), temperature, and vapor pressure deficit (VPD) explained 90 and 95% of the day-to-day fluctuations in daily water use of ‘Fasan’ and ‘Pia’, respectively, with plant size and DLI being by far the most important factors. Temperature and VPD had a much smaller, but significant effect on plant water use. Our results suggest that taking plant size and DLI into account can help growers determine the daily water needs of hydrangeas, and thus help to make irrigation more efficient.
Nature of Work: Excessive irrigation can result in a wide array of economical and physiological problems in ornamental plant nurseries and with the cost of plant production increasing faster than the cost per unit of plant material (2), the need for more efficient irrigation practices is paramount. It has been shown that over-watering can increase plant susceptibility to root diseases, such as phytophthora (1), and can lead to eutrophication of surface water bodies due to high levels of nitrogen and phosphorus contained in irrigation runoff (3). Our objective was to investigate the relationship between plant size, environmental factors, and water consumption of Hydrangea macrophylla. Data obtained in this study may be used at a later date to develop predictive modeling software that would control irrigation frequency and duration in accordance with the exact needs of the plants.
Our study took place at the Center for Applied Nursery Research (Dearing, GA). Thirty two rooted cuttings of each Hydrangea macrophylla cultivar, 'Fasan' and 'Pia'
Water Management 162
SNA Research Conference Vol. 56 2011
(James Greenhouses, Colbert, GA), were transplanted into #2 containers filled with a composted pine bark medium (bark amended with, 4 lbs. lime, 1.5 lbs. micromax, 1.5 lbs gypsum, 2 lbs. talstar, 4 lbs. Osmocote Pro 18-6-12/ cu. yd.). The plants were arranged on a custom drip irrigation system with four plants from each cultivar mounted on load cells (LSP-10, Transducer Techniques, Temecula, CA). The system was controlled using a datalogger (CR10, Campbell Scientific, Logan, UT) and multiplexer (AM25T, Campbell Scientific) and the datalogger controlled water applications and stored environmental and water use data. Light levels were monitored using a quantum sensor (QSO-sun, Apogee instruments, Logan, UT), while temperature and humidity data were collected with a temperature/humidity probe (HMP50, Vaisala, Helsinki, Finland).
The plants were watered daily at 10 pm for 30 minutes to bring the substrate moisture level to container capacity, ensuring that water would not limit evapotranspiration. Leachate was allowed to drain for an hour and a half before the plants were weighed at midnight, establishing a base weight for the start of each day. At 10:00 pm every night, the datalogger recorded the weights of the eight plants mounted on the load cells as the final weight for each day, before the plants were irrigated again. The datalogger then calculated the decrease in weight that occurred during that day and stored that value as the daily water use (DWU). Light levels, temperature, and relative humidity were measured every 5 minutes and compiled at 11:55 pm, at which time the datalogger calculated the daily light integral. The datalogger also calculated the vapor pressure deficit from temperature and humidity measurements. Maximum, minimum and daily average values were stored for photosynthetic photon flux, temperature, and vapor pressure deficit.
After 83 days, the plants mounted on the load cells were harvested. Total plant leaf area measurements were taken (LI 3100, Li-Cor, Lincoln, NE). The containers, still filled with substrate and roots, were brought to container capacity, weighed, dried, and weighed again to calculate the total water holding capacity of the pine bark medium. Due to poor growth of one ‘Pia’ and one ‘Fasan’ plant, only three plants of each cultivar were used in the data analysis. The effects of environmental and plant parameters on daily water use of the plants were tested using linear and multiple regression. Stepwise selection was used to eliminate non-significant factors from the model (proc REG, SAS 9.2, The SAS Institute, Cary, NC).
Results and Discussion: Average DWU rates of both cultivars showed a gradual increase over time from 50 to 300 mL/day (Fig. 1), likely as the result of increasing plant size. There was a 12% difference in average DWU between 'Fasan' (231 mL/day) and 'Pia' (207 mL/day). Overall, the plants only used 2.5-15% of the approximately 2 L present in the substrate at container capacity, indicating that water use was never limited by water availability in the substrate. On the 48th day of the study, shade cloth was pulled over the hoophouse, which resulted in an immediate and sustained decrease in DWU of both cultivars (Fig. 1). DLI was the only environmental factor significantly decreased by the application of the shade cloth, while temperature and VPD remained similar (Fig. 2). There was a clear effect of DLI on DWU; on days with
Water Management 163
SNA Research Conference Vol. 56 2011
low light levels DWU was low as well (e.g,, day 3, 61, and 73). Surprisingly, there was no correlation between DLI and DWU (Table 1), but there were strong correlations between DWU and the interaction of DLI and plant age, as well as the three-way interaction among DLI, plant age, and leaf area. Other factors correlated with DWU include temperature, VPD and the interaction between leaf area and plant age (Table 1). For a more in depth analysis of which factors were important in determining DWU, multiple regression was used with stepwise selection. Partial R2 values were used to quantify the effect of various factors on DWU. This regression indicated that 83.2% of day-to-day changes in DWU of 'Fasan' could be explained by the plant age, final leaf area, and DLI combined. Although VPD and temperature were statistically significant, they only explained another 6.5% of fluctuations in DWU and were not as biologically important as plant age, leaf area, and DLI. 90.8% of fluctuations in DWU of 'Pia' could be explained by the combination of plant age, final leaf area, and DLI, while VPD and temperature only explained an additional 4.03%. Our finding that DLI is by far the most important environmental variable affecting plant water use is consistent with earlier findings that showed that 79% of fluctuations in daily water use of petunia could be explained based on plant age and DLI (4). Our results suggest that by monitoring plant size and DLI, growers can more accurately determine the daily water requirements of hydrangea and irrigate their stock more efficiently, improving both economical and environmental aspects of ornamental plant production. Although other environmental factors, such as temperature and vapor pressure deficit also affect water use, they are much less important than light levels.
Acknowledgements: We thank Sue Dove and Mike McCorkle for their help with this research. Funding for this research was provided by USDA-NIFA-SCRI award no. 2009-51181-05768 and the Center for Applied Nursery Research.
Literature Cited: 1. Blaker N.S. And J.D. MacDonald. 1981. Predisposing effects of soil moisture extremes on the susceptibility of Rhododendron to Phytophthora root and crown rot. Phytopathology 71: 831-834. 2. Jerardo, A. 2006. Floriculture and nursery crops outlook. U.S. Dept. Agr. FLO-05. 3. Majsztrik, J.C., A.G. Ristvey and J.D. Lea-Cox. 2010. Water and nutrient management in the production of container-grown ornamentals. Horticultural Reviews (in press). 4. van Iersel, M.W., S. Dove, J.G. Kang, and S.E. Burnett. 2010. Growth and water use of petunia as affected by substrate water content and daily light integral. HortScience 45:277-282.
Water Management 164
SNA Research Conference Vol. 56 2011
Table 1. The relationship between daily water use and various parameters used to explain day to day changes in water use of two hydrangea cultivars as indicated by Pearson’s correlation coefficients (r) and significance (P). DLI = daily light integral, VPD = vapor pressure deficit. Cultivar ----- ‘Fasan’ ------‘Pia’ ------r P r P Day 0.646 <.0001 0.581 <.0001 DLI 0.064 0.3186 0.077 0.2338 Temperature 0.806 <.0001 0.719 <.0001 VPD 0.750 <.0001 0.690 <.0001 Leaf area -0.169 0.0085 0.413 <.0001 Day * DLI 0.885 <.0001 0.804 <.0001 Day *leaf area 0.582 <.0001 0.721 <.0001 DLI * leaf area 0.012 0.8526 0.234 0.0002 DLI * leaf area * day 0.812 <.0001 0.923 <.0001
Water Management 165
SNA Research Conference Vol. 56 2011
400
Fasan Pia
300
200
Daily water use(mL/day) 100
0 0 20406080 Time (days) Fig. 1. Daily water use of Hydrangea macrophylla 'Fasan' and 'Pia'.
35 DLI 2.4 Temperature VPD 2.2 30 2.0
25 1.8
1.6 20 1.4 15
1.2 VPD (kPa)
10 1.0
0.8
Temperature (C) or DLI (mol/m2/d) Temperatureor (C) DLI 5 0.6
0 0.4 0 20406080 Time (days) Fig. 2. Daily light integral (DLI), temperature, and vapor pressure deficit (VPD) over the 85 day experiment.
Water Management 166
SNA Research Conference Vol. 56 2011
Growth of Petunia as Affected by Substrate Moisture Content and Fertilizer Rate
Alem Peter, Paul A. Thomas, and Marc W. van Iersel
Department of Horticulture, The University of Georgia, Athens, GA 30602
Index Words: irrigation, leaching, Petunia × hybrida, water use
Significance to Industry: A large percentage of fertilizer applied to plants can be lost through leaching if irrigation is excessive. Soil moisture sensor-controlled irrigation can significantly reduce or even eliminate leaching. If leaching is reduced, growers might be able to use lower fertilizer rates to grow their crops, which can result in significant financial savings. The objective of our study was to quantify the optimal fertilizer rates for petunia, when the plants are grown at different substrate volumetric water contents (VWC). Petunias (Petunia × hybrida ‘Dreams White’) were grown at four substrate VWC levels (0.1, 0.2, and 0.4 m3·m-3) and with 8 fertilizer rates (0, 5, 10, 15, 20, 30, 40, and 60 g/container; 0 - 2.5 g/plant). Fertilizer rate had a quadratic effect (P = 0.001) on shoot dry weight, while there also was a linear effect of VWC (P = 0.0189), and an interactive effect of VWC and fertilizer rate (P = 0.0001) on shoot dry weight. The optimal fertilizer rate for growth was 1.3 to 1.7 g/plant. VWC and fertilizer rate also affected leaf size; the size of leaves doubled as the VWC set point increased from 0.10 to 0.40 m3·m-3 and increased by 16 – 34% as the fertilizer rate increased from 0 to 2.5 g/plant. Water use was affected by the VWC set point. With no leaching, approximately 0.4 L/plant of water was needed to grow petunia from plug seedling to full bloom in 23 days at a VWC of 0.4 m3·m-3. Growers should be able to reduce fertilizer rates with efficient irrigation methods that minimize leaching.
Nature of work: The cost of producing commercial plants has increased in recent years due to increased cost of labor and fertilizers (1). Increasing water scarcity and increasingly strict regulations regarding runoff pose additional challenges to greenhouse and nursery growers. Excessive irrigation causes most of the leaching and runoff of fertilizers and pesticides. Leaching of fertilizers is more prevalent when fertigation is used, but can also happen with controlled slow release fertilizers. The resulting runoff poses a threat to ground and surface water quality, and many states regulate this runoff (3). Efficient irrigation techniques reduce leaching and thus the amount of fertilizer needed to grow plants. Reduced irrigation runoffs also ensure environmental conservation and produces savings on the general cost of production. Crop water use refers to the total amount of water lost through evaporation from the substrate and plants transpiration (6). Substrate water content influences substrate water potential and consequently water availability and use by plants. Fertilizer rates also affect plant growth with low rates potentially cause nutrient deficiencies, while high
Water Management 167
SNA Research Conference Vol. 56 2011
fertilizer rates can cause toxicities and/or osmotic stress. High fertilizer rates often specifically enhance shoot growth (increased size and number of leaves), which in turn increases water loss through transpiration (2) and thus increases the water requirements of the crop. However, these interactions between fertilizer rate, substrate water content, and crop water use are poorly understood.
Automation of water application has been a challenge in the past due to a lack of precise and accurate methods to measure substrate water content. With advances in sensor and data logging technology, accurate monitoring and control of substrate volumetric water content has become possible, and this can reduce or eliminate leaching. Such technologies provide exciting opportunities for growers, but fertilizer management may need to be improved, since excess fertilizer salts might no longer be leached from the substrate.
The objective of this experiment was to quantify the interactive effects of different fertilizer rates and substrate water contents on growth of petunia under zero-leaching conditions. As part of this research we aimed to develop guidelines for fertilizer rates and substrate water contents that can be used to grow high quality bedding plants. Plant material. Petunia (Petunia × hybrida ‘Dreams White’) seedlings were obtained from a commercial greenhouse (Tagawa Greenhouses, Brighton, CO). Twenty-four seedlings were transplanted into rectangular containers (36 cm × 24.4 cm × 10 cm), which were filled with a peat: perlite (80:20) substrate (Fafard 1P; Fafard, Agawam, MA). The substrate was kept well-watered during the first week after transplanting to allow establishment of the seedlings.
Treatments. Prior to transplanting, different amounts of controlled release fertilizer (Osmocote 14-14-14, The Scotts Co., Marysville Ohio) were incorporated into the substrate (0, 5, 10, 15, 20, 30, 40 and 60 g/container; 0 to 2.5 g/plant). Starting one week after transplanting, irrigation was controlled using an automated, sensor-controlled system (4). Two capacitance sensors (EC-5; Decagon, Pullman, WA) were inserted diagonally into the substrate in each container. The sensors were connected to a datalogger (CR10, Campbell Scientific) using multiplexers (AM416; Campbell Scientific, Logan, UT). Sensors were measured every 10 minutes and the VWC readings of the two sensors in one container were averaged. If the average VWC was below the set point, the datalogger used a relay driver (SDM16AC/DC controller; Campbell Scientific) to open a solenoid valve for 20 s to irrigate the container. Irrigation set points were 0.10, 0.20, 0.30, and 0.40 m3·m-3. The water volume applied per irrigation event was 88.9 ml (3.7 mL/plant).
Data collection. The data logger stored the average substrate VWC every 2 hours and the number of times each container was irrigated daily. Since the water volume per application was known, we were able to calculate the irrigation volume. Pore water EC was measured multiple times during the study (SigmaProbe, Delta T Devices, Cambridge, UK). At the end (23 days) of the experiment, leaf area was measured from 10 fully expanded leaves from the plants in each container (LI3100, Li-Cor, Lincoln,
Water Management 168
SNA Research Conference Vol. 56 2011
NE). The shoots were then cut off at the substrate surface and dried for 1 week at 80 °C, after which their dry weight was determined.
Experimental design and data analysis. The experimental design was a completely randomized, factorial design with four VWC treatments and eight fertilizer rates. The experimental unit was a container with 24 plants. Data were analyzed with multiple regression (SAS 9.2, SAS Institute, Cary, NC).
Results and discussion: Shoot dry weight. There was a quadratic effect of fertilizer rate (P = 0.0001), a linear effect of VWC (P = 0.0189), and an interactive effect of VWC and fertilizer rate (P = 0.001) on shoot dry weight (Fig. 1). Shoot dry weight reached a maximum at fertilizer rates of 1.3 to 1.7 g/plant and decreased at higher fertilizer rates. The decrease in shoot dry weight at high fertilizer concentration may have been caused by osmotic stress. Pore water EC increased from 1.2 to 3.6 mS/cm as fertilizer rates increased from 0 to 2.5 g/plant. Pore water EC was approximately 3.1 to 3.4 mS/cm in treatments with the highest shoot dry weight. The optimal fertilizer concentration was lower in treatments with lower VWC. An interaction between fertilizer rates and volumetric water content is consistent with previous findings (5). There was approximately 66% increase in shoot dry weight as the VWC set point increased from 0.1 to 0.4 m3·m-3.
Leaf size. The area of the uppermost fully expanded leaf increased both with increasing VWC set point and with increasing fertilizer concentrations (Fig. 2). Substrate water content had the most impact on leaf size, which doubled as the VWC set point increased from 0.10 to 0.40 m3·m-3. Leaf area increased by 16 – 34% as the fertilizer rate increased from 0 to 2.5 g/plant. Water use. Plant water use was greatly affected by the VWC set point, and increased from 120 to 375 ml/plant as the set point increased from 0.10 to 0.40 m3·m-3. This corresponds to an average irrigation volume of 5.2 to 16.3 ml/plant/day. Daily water use was also influenced by weather conditions. Warmer, brighter days resulted in higher water use (results not shown).
Flowering. Flowering of plants generally decreased with increasing fertilizer rates (Fig. 4). Since flowering is an important quality characteristic for petunias, growers need to balance flowering and shoot growth, since shoot growth is maximized at fertilizer rates that reduce flowering of petunia.
Important plant characteristics in commercial production, like height, leaf area and flowering, are affected both by water and nutrition and maintaining a balance is critical for the production of high-quality plants. Balancing fertilization and irrigation is a challenge faced by many commercial greenhouse and nursery growers. Growers often use higher fertilizer rates and more water than plants require. The result may be tall, overgrown, delicate plants that require growth regulators, adding to the cost of production. Growers can grow plants with lower fertilizer rates if leaching is minimized, and soil moisture sensor can help to achieve this. With no leaching, we grew high quality petunias with the fertilizer as low as 0.8 g/plant (7.1 lbs/yd3 of substrate).
Water Management 169
SNA Research Conference Vol. 56 2011
Acknowledgement: Funding for this research was provided by the American Floral Endowment and USDA- NIFA-SCRI award no. 2009-51181-05768.
Literature cited:
1. Huang, W.Y. 2009. Factors contributing to the recent increase in U.S fertilizer prices, 2002-08. U.S. Dept. Agr. Economic Res. Serv. AR-33. 2. Linder, S., M.L. Benson, B.J. Myers, and R.J. Raison. 1987. Canopy dynamics and growth of Pinus radiata. I. Effects of irrigation and fertilization during a drought. Can. J. For. Res. 17:1157–1165. 3. Majsztrik, J.C., A.G. Ristvey, and J.D. Lea-Cox. 2010. Water and nutrient management in the production of container-grown ornamentals. Hort. Reviews (in press).Nemali, K.S. and M.W. van Iersel. 2006. An automated system for controlling drought stress and irrigation in potted plants. Sci. Hort. 110: 292-297. 4. Oren, R. and D.W. Sheriff. 1995. Water and nutrient acquisition by roots and canopies. In Resource Physiology of Conifers. Eds. W.K. Smith and T.M. Hinckley. Academic Press, San Diego, p 39–74. 5. Siebert, S. and P. Döll. 2010. Quantifying blue and green virtual water contents in global crop production as well as potential production losses without irrigation, J. Hydrol. 384:198–217.
1.6 Substrate water content (m3/m3) 1.4 0.10 0.20 1.2 0.30 0.40
1.0
0.8
0.6
0.4 Shoot dry weight (g/plant) weight Shoot dry
0.2
0.0 0.0 0.5 1.0 1.5 2.0 2.5 3.0 Fertilizer rate (g/plant) Fig. 1. Shoot dry weight of petunias grown with different rates of controlled release fertilizer at four different substrate water contents. Colored lines indicate the result of the regression analysis.
Water Management 170
SNA Research Conference Vol. 56 2011 )
2 26 Substrate water content (m3/m3) 24 0.10 22 0.20 0.30 20 0.40
18
16
14
12
10
8
6
Area of upper-most expanded leaf (cmArea of upper-most expanded 0.0 0.5 1.0 1.5 2.0 2.5 3.0 Fertilizer rate (g/plant) Fig. 2. Area of the upper-most expanded leaf of petunia grown with different rates of controlled release fertilizer at four different substrate water contents. Colored lines indicate the result of the regression analysis. 450
400
350
300
250
200
Water applied (ml/plant) 150
100 0.0 0.1 0.2 0.3 0.4 0.5 Substrate volumetric water content (m3.m-3)
Fig. 3. Mean irrigation volume, from treatment initiation to termination of the experiment after 23 days as a function of the substrate volumetric water content threshold.
Water Management 171
SNA Research Conference Vol. 56 2011
Fig. 4. Appearance of petunias grown with different rates of controlled release fertilizer and at four different substrate water contents. Plant growth increased with increasing substrate water content, but flowering was reduced with high fertilizer rates.
Water Management 172
SNA Research Conference Vol. 56 2011
Substrate Water Content Dynamics in Nurseries: Real-Time Monitoring Can Improve Irrigation Practices
Marc van Iersel 1, Will Ross 2, Sue Dove 1, Matthew Chappell 1, Paul Thomas 1, John Ruter 3, and Sherryl Wells 4
1 Department of Horticulture, The University of Georgia, Athens, GA 30602 2 Evergreen Nursery, Statham, GA 30666 3 Department of Horticulture, The University of Georgia, Tifton, GA 31793 4 Dept of Biological and Agricultural Engineering, University of Georgia, Griffin, GA 30223
Index words: automation, runoff, soil moisture sensor
Significance to the industry. More efficient irrigation practices can have many benefits for both nurseries and society-at-large. Benefits for nurseries include better control over plant quality, reduced water and fertilizer use, less power consumption (related to running pumps for irrigation), fewer problems with root pathogens, and less runoff, while benefits for society-at-large include a reduction in potential pollution from nurseries (e.g. runoff of fertilizer and pesticides), a decrease in competition for water resources, and decreases in CO2 emissions. Perhaps the most significant barrier to implementation of more efficient irrigation practices is the lack of knowledge regarding when plants need to be watered and how much water needs to be applied. Here we describe the use of a wireless network to monitor environmental conditions, substrate water content of selected crops, and irrigation water applications. Such networks can provide growers with real-time information regarding the water status of their crops and provide valuable information regarding the efficiency of water applications.
Nature of work. Irrigation is necessary during the production of containerized nursery crops, due to the relatively small volume of substrate that is used to produce the plants. To assure rapid growth, it is crucial to supply the plants with water and nutrients as needed. Nutrients generally are incorporated into the substrate, applied by topdressing, or added to the irrigation water in a water-soluble form. Irrespective of how the fertilizer is applied, irrigation and fertilization are closely linked, since movement of nutrients through the substrate depends on water (see Majsztrik et al. (1) for an in-depth review). Excessive irrigation leads to leaching of nutrients. This leaching constitutes an economic loss to the grower, since these nutrients are no longer available to the crop and pose a potential environmental risk, since fertilizer runoff can contribute to eutrophication of water bodies. Excessive irrigation can also produce conditions amenable to root pathogens, and thus lead to significant crop losses. Finally, excessive irrigation carries a direct cost for nursery growers, since the expenses for the power to run irrigation pumps can be significant. Thus, more efficient irrigation practices can have many benefits for nurseries.
Water Management 173
SNA Research Conference Vol. 56 2011
At the same time, there are benefits to society-at-large when irrigation practices are improved. A reduction in runoff, and less risk of environmental pollution, can help safeguard environmental quality and reduce the need for water treatment. Reductions in power consumption will result in a decrease in CO2 emissions, and may thus contribute to slowing down global climate change.
The objective of this project was to test a wireless sensor network in a commercial nursery, and to determine whether real-time sensor data can be used to improve irrigation practices. This work was done in collaboration with Evergreen Nurseries in Statham, GA. At this nursery, a wireless network, consisting of four dataloggers (EM50R, Decagon Devices, Pullman, WA) was installed. These dataloggers can be used to measure a wide variety of sensors. In this case, one of the dataloggers was configured as a weather station by connecting a photosynthetic photon flux sensor (Apogee Instruments, Logan UT), a relative humidity and temperature sensor (Decagon Devices), and a rain gauge (Decagon Devices). The other three dataloggers were used to monitor substrate water content in various crops, by connecting four soil moisture sensors (EC-5, Decagon Devices) to the datalogger. Later on, a rain gauge was connected to these loggers as well, with the purpose of monitoring rainfall and irrigation of each crop. The dataloggers measured each sensor once every 20 minutes. All crops were irrigated using overhead sprinklers and grown in hoop houses covered with shade cloth. All four dataloggers communicated wirelessly with the basestation connected to a computer running DataTrac software (Decagon Devices). This software provides a simple interface to allow users to graph the data from multiple dataloggers. This allowed the grower to have easy access to all data as they were being collected. Researchers had remote access to the computer at the nursery using remote access software (TeamViewer 5.0, TeamViewer GmbH, Göppingen, Germany).
Results and Discussion. Figure 1 is a screenshot from the DataTrac software showing the environmental conditions in the nursery during a one week period. Relative humidity was generally close to 95% pre-dawn and decreased to 20-30% in the afternoon. There was a clear, inverse relationship between relative humidity and temperature, which ranged from 40 to 55 °F pre-dawn to 75 to 85 °F in the early afternoon. There was only one small rain event during this period, in the morning of October 20.
The substrate water content as measured in one hoop house with both lantanas and gaillardias is shown in Fig. 2. Irrigation practices were changed during the two-week period shown here: during the first week, the crops were irrigated for 15 minutes on most days, while the crops were not irrigated on October 8 and 11. During the second week shown in this graph, the crops were irrigated twice daily, 8 minutes each time. The goal of using cyclic irrigation was to reduce leaching. The gradual increase in substrate water content following the switch to cyclic irrigation does indeed suggest that more of the applied irrigation water was retained by the substrate.
Water Management 174
SNA Research Conference Vol. 56 2011
The data in Fig. 3 are from a hellebores crop during the period August 14 – September 4, 2010. These data show the average of the readings from four different sensors. As can be seen in the top graph, there was regular rain from August 13-23, and, as expected, each significant rainfall event resulted in a rapid increase in substrate water content. The rain largely stopped after August 22 and the substrate starts to dry out gradually from that time on. The substrate dries out much faster during the day than at night, presumably related to the greater vapor pressure deficit and opening of the stomates during the daylight hours. In early September, the crop was irrigated twice (as indicated by the red arrows).
The data obtained from the wireless sensor network clearly show the dynamic changes in substrate water content. However, looking at the change in substrate water content from one measurement to the next can add valuable information. To do so, we simply subtracted the current substrate water content from that measured 20 minutes earlier (Fig.4, red line). Note that only decreases in substrate water content (leaching and/or evapotranspiration) are shown. Irrigation and rainfall would appear as large negative values and are excluded for clarity.
When looking at the change in substrate water content, it is clear that each significant rain event is followed immediately by a rapid decrease in substrate water content (i.e., the spikes in the red curve). This indicates that very shortly after a rainfall event, the water drains to below where the sensor is in the container. Given the size of the pots, that likely means that, this water leached out of the pots. Such leaching events are much easier to see when looking at the change in substrate water content, rather than the substrate water content itself. This also can be seen in the data from the two irrigation events near the end of this period: the first irrigation, on September 1, apparently resulted in very light leaching, while there was a fair amount of leaching after the irrigation on September 2, as indicated by the rapid decrease in substrate water content following that irrigation.
The information that can be obtained using these wireless networks can be used to make irrigation practices more efficient. Substrate water content readings can be used to determine when irrigation is needed. By adjusting the irrigation time, and determining how much the substrate water content increases after irrigation will allow for the determination of how much water needs to be applied during an irrigation event. A rapid decrease in substrate water content is indicative of leaching. The currently available hardware is able to monitor substrate water content and can help growers make decisions regarding irrigation. Planned improvements in the hardware include the incorporation of a relay, which would allow these dataloggers to open and close irrigation valves, based on grower-defined conditions. We also expect that sensors that can measure both substrate water content and electrical conductivity will soon be available. Such sensors will help to further integrate irrigation and fertilization. Measurements of electrical conductivity could be used to determine whether leaching is needed or whether additional fertilizer applications may need to be made.
Water Management 175
SNA Research Conference Vol. 56 2011
Acknowledgments. Funding for this research was provided by the American Floral Endowment and USDA-NIFA-SCRI award no. 2009-51181-05768.
Literature cited 1. Majsztrik, J.C., A.G. Ristvey, and J.D. Lea-Cox. 2010. Water and nutrient management in the production of container-grown ornamentals. Hort. Reviews (in press).
Figure 1. Screenshot of the DataTrac graphic user interface showing environmental conditions in a nursery during a one week period. Data include temperature (red), light intensity (green), relative humidity (orange), and rainfall (blue).
Water Management 176
SNA Research Conference Vol. 56 2011
Figure 2. Screenshot showing the DataTrac graphic user interface. The four lines show substrate water content of two containerized lantana (green and black, plants in #2 containers) and two gaillardia plants (purple and blue, #1 containers). Pink bars indicate rainfall or irrigation events. Irrigation was changed from once daily to twice daily on October 14.
Water Management 177
SNA Research Conference Vol. 56 2011
0.55 5 Irrigation 0.50 Rain 4
0.45 3 0.40 2
0.35 Rain (inches)
1 0.30
Substrate water content (%) water content Substrate 0.25 0
100 2000
80 1500 Temp (F) Temp 60 1000 PPF (umol/m2/s) RH (%)
40 500
RH Temperature PPF 20 0 12/08 16/08 20/08 24/08 28/08 01/09 Date (day/month)
Figure 3. Substrate water content of a Hellebores crop (top, average of four sensors) and environmental conditions (rain, top and RH, temperature and photosynthetic photon flux (PPF), bottom) in a commercial nursery. Plants were grown in #1 containers.
Water Management 178
SNA Research Conference Vol. 56 2011
) 3 0.6 0.04
/m 3 Irrigation
/20 min) 0.5 3 /m
0.03 3 0.4
0.3 0.02
0.2
0.01
0.1
0.0 0.00 Decrease in water content (m content in water Decrease Substrate water content (m
2.0
1.5
1.0
Rain (inches) 0.5
0.0
8/12 8/16 8/20 8/24 8/28 9/1
Date (month/day)
Figure 4. Substrate water content of a hellebores crop (top, black line) and the change in substarte water content in a 20 minute period (top (red line). Note that there is a rapid decrease in substrate water content following each significant rainfall event (blue bars, bottom). This is indicative of leaching. Plants were grown in #1 containers.
Water Management 179
SNA Research Conference Vol. 56 2011
Time-Course Nutrient Uptake by Three-Plant Species Established in Floating Wetlands
Sarah A. White1, Jonathan J. Smith1, Elizabeth T. Nyberg2, J. Brad Glenn2
1Department of Environmental Horticulture, Clemson University Clemson, SC 29634-0319 2Environmental Toxicology Graduate Program, Clemson University Pendleton, SC 29670
Index Words: Nitrogen, Phosphorus, Juncus effusus, Canna flaccida, Agrostis sp.
Significance to Industry: Floating wetlands are new tools that along with modified production practices can help growers reduce nitrogen and phosphorus runoff from production areas into surface waters. Plants installed in the floating treatment systems can be harvested, composted, and biomass mixed with container substrate or applied as a soil amendment, facilitating nutrient recycling. This research documented nutrient uptake by golden canna, Red top bentgrass, and Soft rush. Each plant was harvested on a biweekly basis from floating mats installed in a series of ponds. Red top bentgrass and golden canna fixed similar mass quantities of N and P on a per unit area treatment basis and are good plant selections for use in floating wetlands during the summer season.
Nature of Work: Water quality degradation is a concern throughout the U.S. and regulators are beginning to impose limits on nutrient release into watersheds and basins by imposing numeric nutrient criteria and by mandating capture and treatment of runoff. In the future, nurseries and other green industry producers in states that have not been heavily regulated in the past will have to implement treatment technologies to comply with water quality regulations. Constructed wetlands are used to cleanse wastewater and runoff of various contaminants including pesticides, metals, and nutrients. Constructed wetlands are ideal treatment tools that can cleanse water of a variety of contaminants. Floating wetlands are a modification of constructed wetlands and can be used in existing retention ponds to provide similar treatment capacity but without loss of land or initial capital investment. Floating wetlands are effective treatment systems because of the large root surface areas in contact with the water column (1, 2). They have been examined for their utility in treating swine lagoon wastewater (2), urban sewage and stormwater treatment (3), and agricultural and municipal wastes (1,4). The high root surface area in the water column provides habitat for microbial communities that aid in contaminant uptake and transformation. Previous research by White et al. (1) suggested that aeration enhanced nutrient uptake and remediation by plants established in floating wetlands. This study was designed to examine the nutrient uptake of three plant species Canna flaccida (Golden canna), Juncus effusus
Water Management 180
SNA Research Conference Vol. 56 2011
(Softrush), and Agrostis alba (Red top bentgrass) over time in an aerated pond and to determine the biomass accumulation rate and N and P removal rate of each species on a plant and per unit area basis.
The experiment was performed in a two-stage small-scale flow-through pond system. The upper pond where nutrient injection occurred was 500 ft2 and effluent from this pond flowed into the lower treatment pond that was 918 ft2. Plants from each species examined were seated in floating mats and placed in the lower pond on May 10, 2010 the same date that nutrient additions were initiated in the upper pond. The lower pond was the treatment pond and floating mats were planted with C. flaccida, J. effusus, and A. alba. Each pond was sampled for water quality on a bi-weekly basis and three plants from each species were harvested when water samples were collected through August 30, 2010. Water samples were analyzed for 1) anions [Nitrite (NO2), Nitrate (NO3), and phosphate (PO4) via ion chromatography with a Dionex AS10 IC ion chromatograph (Dionex Corp., Sunnyvale, CA], 2) total organic carbon (dissolved carbon from organic sources that is available for microbial metabolic functions) via NPOC/TN analysis using a Shimadzu TOC-V CPH total organic carbon analyzer with TNM-1 total nitrogen measuring unit (Shimadzu Scientific Instruments, Kyoto, Japan), and 3) total phosphorus (P), potassium, calcium, magnesium, zinc, copper, manganese, iron, sulfur, sodium, boron and aluminum via inductively coupled plasma emission spectrophotometer (ICP-ES, 61E Thermo Jarrell Ash, Franklin, MA). Average N [ammonia (NH3) + NO2 + NO3] and P loading rates into the ponds were 3.10 ± 0.94 and 0.27 ± 0.05 mg/L, respectively. These influent concentrations of N and P are consistent with our first study conducted in 2008 (1).
Plant root and shoot tissue samples were weighed (fresh weight, g) and dried at 80 ºC, re-weighed (dry weight, g), and then ground in a Wiley mill (Swedesboro, NJ) to pass through a 40-mesh (0.425-mm) screen. Nitrogen concentration was determined using 100 mg of tissue and assayed using an Elementar Vario Macro Nitrogen combustion analyzer (Mt. Laurel, NJ), and P was assayed by wet acid digestion procedure using the nitric acid and hydrogen peroxide method (5). Phosphorus, K, Ca, Mg, Zn, Cu, Mn, Fe, S, Na, B, and Al concentrations in plant tissues were determined by ICP-ES. Only data concerning whole plant fresh weight and N and P tissue concentrations will be presented. Data were analyzed, when appropriate, using SAS PROC GLM procedure with a MEANS statement (SAS Institute Inc. Cary, NC).
Results and Discussion: Initial (month 0) percentage of N in plant tissue were similar among plant species, but P percentage in tissue varied, and golden canna had significantly (P < 0.05) greater initial tissue P than the other species examined (Fig. 2). During the first month of growth during the experiment all species gained an average of 136 ± 17 g of fresh weight (Fig. 3), and N and P accumulated in plant tissues were similar among species (Fig. 1 and 2). However, golden canna accumulated more mass than the other species examined during the first month, accumulating an additional 167 g of tissue, perhaps contributing to a dilution-based decline of % P in tissue.
Water Management 181
SNA Research Conference Vol. 56 2011
Plant growth rates, correlated with measured mass increases and were similar among the plant species screened. Nitrogen accumulation in plant tissues were similar with a slight increase in N fixed in soft rush tissues over time, while golden canna and red top bentgrass percent N in tissue were relatively static at each harvest date (Fig. 1 and 3). Phosphorus accumulation in tissues exhibited a slight downward trend for all species screened (Fig. 2). This downward trend may be attributed to a dilution-based effect where plant uptake of P occurred at a slower rate than plant growth, so % P in plant tissue declined. An alternative theory is that P uptake was reduced by limited N availability. Each of the plant species screened, especially golden canna, perform better in nutrient rich environments (6); because nutrient loading rates were relatively low, low N availability may have limited plant P uptake.
During the fourth month and at final harvest, we found increased growth rates (Fig. 3) and N and P fixation rates (Fig. 1 and 2) on a per unit area basis in golden canna and red top bentgrass, in comparison with soft rush; we also detected higher inflow concentrations during this period (Figure 4). This increased nutrient loading dramatically increased golden canna growth and N and P uptake on a per unit area basis (Figures 1-4). Thus, we hypothesize that if nutrient loading rates had been higher throughout the experiment, N and P uptake into plant tissues may have increased. However, even though the nutrient loading rates of this experiment were low, all plant species grew and contributed to highly efficient nitrogen and phosphorus removal.
Red top bent grass accumulated the greatest N and P on a percent tissue basis. Golden canna accumulated lower tissue percentages of N and P but had a greater growth rate and thus accumulated similar concentrations of N and P on g per m2 basis. Soft rush accumulated the lowest concentrations of N and P and was the least efficient nutrient scavenger of the three species screened in treatment floating wetlands. Golden canna and red top bentgrass are ideal plants to establish in floating wetlands to remediate nutrient rich effluent during the summer months in the southeastern USA.
Acknowledgement: Beeman’s Nursery and Clemson University Startup Funds provided financial support for this project.
Literature Cited: 1. White, SA, B. Seda, M.M. Cousins, S.J. Klaine, T. Whitwell. 2009. Nutrient remediation using vegetative floating mats. SNA Research Conference Proceedings 54: 39-43. 2. Hubbard, R.K. 2010. Floating vegetated mats for improving surface water quality. In Emerging Environmental Technologies Vol. II. Springer, London. pp 211-244. 3. Boutwell, J.E. 2002. Water quality and plant growth evaluations of the floating islands in Las Vegas Bay, Lake Mead, Nevada. U.S. Department of the Interior Bureau of Reclamation. Technical Memorandum No. 8220-03-09. 4. Stewart, F.M., T. Mulholland, A.B. Cunningham, B.G. Kania, and M.T. Osterlund. 2008. Floating islands as alternatives to constructed wetlands for treatment of excess nutrients from agricultural and municipal wastes – results of laboratory-scale
Water Management 182
SNA Research Conference Vol. 56 2011
tests. Land Contamination & Reclamation 16(1): 25-33. 5. Mills, H.A., J.B. Jones, Jr. 1996. Plant analysis handbook II. MicroMacro Publishing, Inc., Athens, GA. 6. Polomski, R.F., D.G. Bielenberg. T. Whitwell, M.D. Taylor, W.C. Bridges, S.J. Klaine. 2008. Differential nitrogen and phosphorus recovery by five aquatic garden species in laboratory-scale subsurface-constructed wetlands. HortScience 43: 868-874.
Figure 1. Nitrogen† fixed by plant species established in floating wetland treatment systems over four months from May 2010 through August 2010. † % N in plant tissue and N fixed on a per unit area (g/m2) basis.
Water Management 183
SNA Research Conference Vol. 56 2011
Figure 2. Phosphorus† fixed by plant species established in floating wetland treatment systems over four months from May 2010 through August 2010. † % P in plant tissue, and P fixed on a per unit area (g/m2) basis.
Water Management 184
SNA Research Conference Vol. 56 2011
Figure 3. Fresh mass† of plant tissues harvested from a floating wetland treatment system over four months from May 2010 through August 2010 (n = 6 for each species, each month).
Water Management 185
SNA Research Conference Vol. 56 2011
Figure 4. Nitrogen (NH3 + NO2 + NO3 –N) and phosphorus (inorganic and organic-P) influent and effluent concentrations detected from samples collected at a floating wetland treatment system over four months from May 2010 through August 2010.
Water Management 186
SNA Research Conference Vol. 56 2011
Monitoring And Controlling Subirrigation With Soil Moisture Sensors: A Case Study With Hibiscus
Rhuanito Soranz Ferrarezi 1 and Marc W. van Iersel 2 1 College of Agricultural Engineering/FEAGRI, Campinas State University/UNICAMP, Campinas, SP, Brazil 2 Department of Horticulture, The University of Georgia, Athens, GA 30602
Index Words: automation, ebb-and-flow, Hibiscus acetosella, irrigation, soil moisture sensor, substrate water content
Significance to Industry: Subirrigation can be used to reduce water loss and nutrient leaching in nurseries and greenhouses, because it is a closed system in which the nutrient solution is recirculated. However, the irrigation normally is controlled by timers, without monitoring and controlling substrate moisture content. Thus, irrigation is not based on the actual plant water requirements or the substrate water content required for optimal plant growth. Alternatively, capacitance sensors can be used to monitor substrate water content and to control irrigation, thus applying water as needed and optimizing plant production in subirrigation systems. Our results show that sensor- controlled subirrigation is indeed feasible. We subirrigated hibiscus ‘Panama Red’ when the substrate water content dropped below 0.10, 0.18, 0.26, 0.34 or 0.42 m3·m-3. Lower thresholds for irrigation resulted in less frequent irrigation and reduced both plant height and shoot dry weight. This indicates that soil moisture sensors cannot only be used to control irrigation, but to manipulate plant growth as well.
Nature of Work: Nurseries and greenhouses normally use overhead and drip irrigation systems to apply water. These irrigation methods tend to be excessive and have low application efficiency, causing water losses, as well as nutrient and pesticide leaching into the soil, with a high potential for groundwater and/or surface water pollution (1). As the population increases, the demand for water is increasing and water is becoming scarce, including in the Southeastern United States. Reducing water use and runoff is needed to address these challenges. Water-saving irrigation technologies are important to assure that irrigation water is used efficiently.
Subirrigation may be one way to reduce water use and fertilizer runoff from nurseries and greenhouses. Using a closed system, consisting of ebb-and-flow benches or flood floors, a nutrient solution reservoir, and pumps, water is applied directly to the bottom of pots, where capillary rise allows water and nutrients to move upward in the growing medium. When the irrigation is complete, unused water drains back to the reservoir for later recirculation through the system.
Subirrigation has several benefits compared to other irrigation systems used in nurseries and greenhouses: increased production per unit area, better plant uniformity, reduction in growth period, elimination of water loss and nutrient leaching into the soil
Water Management 187
SNA Research Conference Vol. 56 2011
(1), possibility of application of pesticides and plant growth stimulators, reduction in the amount of water applied (2), reduction in labor costs, and the possibility of automation (3). On the other hand, subirrigation can have drawbacks such as: a high concentration of salts in the upper layers of the substrate, high cost for initial deployment and maintenance, and increased risk of spread of pathogens.
Control of irrigation in subirrigation systems is commonly achieved using timers. Thus, irrigation is not based on the actual plant water requirement or the minimum substrate water content required for optimal plant growth. Subirrigation systems can be automated using soil moisture sensors to monitor substrate volumetric water content (VWC), and irrigation can then be controlled based on actual substrate VWC measurements (4).
The objective of this work was to automate a subirrigation system using soil moisture sensors to monitor and control substrate VWC and to quantify the effect of substrate VWC on the growth of hibiscus plants.
Ten 3’ × 5’ ebb-and-flow benches (MidWest GroMaster, St. Charles, IL) were used. Irrigation was automated using 3 dielectric soil moisture sensors (EC-5; Decagon, Pullman, WA) per bench, inserted into pots diagonally. The sensors were connected to a multiplexer (AM416; Campbell Sci., Logan, UT, USA), which was connected to a datalogger (CR10; Campbell Sci., Logan, UT). Every 30 minutes, the datalogger measured all sensors and averaged the readings of the three sensors on the same bench. This average substrate VWC was compared to a bench-specific VWC threshold (0.10, 0.18, 0.26, 0.34 or 0.42 m3·m-3) and the bench was flooded for about 3 minutes if the measured VWC was below the threshold. Complete drainage back into the reservoir occurred 3 minutes after flooding, resulting in a 6 minute period that the benches were flooded. The datalogger controlled the irrigation pumps using a relay driver (SDM- CD16AC; Campbell Sci., Logan, UT).
Rooted hibiscus (Hibiscus acetosella ’Panama Red’) cuttings were transplanted into 6”, round pots filled with a peat-perlite substrate (Fafard 1P Mix; Fafard, Agawam, MA) on September 13, 2010. The hibiscus were hand-watered with nutrient solution until the beginning of the experiment on September 16. At that time, the automated irrigation was started and plants were irrigated with a 100 ppm N water-soluble fertilizer solution (20-10-20 Peat-Lite Special, Scotts Co., Marysville, OH), with an EC of 0.59 mS/cm. Shoot height and dry weight were measured at the end of experiment.
The experimental design was completely randomized, with five treatments (VWC thresholds) and two replications. An experimental unit consisted of one bench with 28 plants. Statistical analyses were performed using regression analysis.
Results and Discussion: The automation of the subirrigation system worked well. The substrate gradually dried out until the threshold for a specific treatment was reached, at which time that bench was irrigated (Fig. 1). Each subirrigation resulted in a rapid
Water Management 188
SNA Research Conference Vol. 56 2011
increase in substrate water content. The number of irrigations depended on the VWC threshold, ranging from 5 to 27 irrigation events at VWC thresholds from 0.10 to 0.42 m3·m-3. The increase in VWC following a subirrigation was much greater in treatments with a low VWC threshold: irrigation increased the VWC by approximately 0.20 m3·m-3 (from 0.10 to 0.30 m3·m-3) with the 0.10 m3·m-3 irrigation threshold versus 0.05 m3·m-3 (from 0.42 to 0.47 m3·m-3) with the 0.42 m3·m-3 irrigation threshold. Even immediately after irrigation, substrate VWC was much lower in treatments with a low VWC threshold than in those with a high threshold (Fig. 1), indicating that the substrate did not reach container capacity following irrigation. Longer periods of flooding the ebb-and-flow benches during irrigations likely would result in higher VWC following irrigation.
For a more detailed look at the dynamics of substrate water content, 10 days of data from the 0.10 m3·m-3 treatment are shown in Fig. 2. This figure shows both the measured VWC over time, as well as the change in VWC from one measurement to the next. This change in VWC is an indicator of the evapotranspiration rate (water use by the plant plus water evaporating from the substrate). There is a clear diurnal pattern in evapotranspiration, with the highest rate occurring during the middle of the day, and little to no evapotranspiration at night. Evapotranspiration rates were low on day 11, which was caused by overcast conditions. Evapotranspiration remained high, even as the VWC approached 0.10 m3·m-3, suggesting that such low VWC did not greatly affect plant water use. However, these data need to be interpreted with care, since an increase in plant size during this same 10 day period makes day to day comparisons difficult.
Shoot height and dry weight after 29 days increased significantly with increasing irrigation thresholds (P < 0.003, Fig. 3). Compared to plants grown at a VWC threshold of 0.42 m3·m-3, plants grown with a threshold of 0.10 m3·m-3 had 62% lower shoot dry weight and were 40% shorter. The strong effect of VWC threshold on plant growth will allow growers to manipulate growth by adjusting the VWC threshold for irrigation. The ability to control plant growth is not present in conventional subirrigation systems that are irrigated using timers. Soil moisture sensors can therefore provide a valuable tool for growers who want to get better control of plant growth and quality. Our results suggest that soil moisture sensors can be used to both monitor and control substrate VWC, and thus allow for better control of irrigation in subirrigation systems. Specifically, sensors can be used to irrigate based on plant water use, rather than on a rigid schedule. Control of substrate water content will allow growers to have better control of plant growth and may thus be used to improve plant quality.
Acknowledgements. We thank the Capes Foundation (Ministry of Education, Brazil) for a grant to the first author for an internship at the University of Georgia (Proc. BEX 1390/10-4). Funding for this research was provided by the American Floral Endowment and USDA-NIFA-SCRI award no. 2009-51181-05768
Water Management 189
SNA Research Conference Vol. 56 2011
Literature Cited 1. Dumroese, R.K., J.R. Pinto, D.F. Jacobs, A.S. Davis, and B. Horiuchi. 2006. Subirrigation reduces water use, nitrogen loss, and moss growth in a container nursery. Native Plants Journal 7: 253-261. 2. James, E. and M.W. van Iersel. 2001. Ebb and flow production of petunias and begonias as affected by fertilizers with different phosphorus content. HortScience 36: 282-285. 3. Cayanan, D.F., M. Dixon, and Y. Zheng. 2008. Development of an automated irrigation system using wireless technology and root zone environment sensors. Acta Hort. 797: 167-172. 4. Nemali, K.S. and M.W. van Iersel. 2006. An automated system for controlling drought stress and irrigation in potted plants. Sci. Hort. 110: 292-297.
0.50 ) -3
m 0.42 3
Set point 0.34 (m3.m-3) 0.42 0.34 0.26 0.26 0.18 0.10 0.18 Substrate Water Content (m Water Content Substrate
0.10 0 5 10 15 20 25 30
Time since starts of treatments (days) Figure 1. Substrate volumetric water content (VWC) as maintained by a soil moisture sensor- controlled automated subirrigation system. Irrigation was triggered when substrate water content dropped below a particular VWC set point.
Water Management 190
SNA Research Conference Vol. 56 2011
0.34 0.015 )
) -3 m 3 /2 hours -3
0.010 m
0.26 3
0.005 0.18
0.000
Substrate Water Content (m 0.10 Change in water content (m 8 9 10 11 12 13 14 15 16 17 18 Time since starts of treatments (days)
Figure 2. Substrate volumetric water content in the treatment with a 0.10 m3·m-3 threshold (left axis) and the change in substrate water content (difference between current VWC and that measured two hours earlier). 5.0 48
Shoot dry weight 46 4.5 Shoot height 44 4.0 Shoot dry weight: 42 y = 8.8x + 0.69 3.5 r = 0.83 40 Shoot height: 38 3.0 y = 48x + 22 r = 0.84 36
2.5 34
32 (cm) Shoot height
Shoot dry weight (g) weight dry Shoot 2.0 30 1.5 28
1.0 26 0.10 0.18 0.26 0.34 0.42 3. -3 Substrate water content set point (m m ) Figure 3. Shoot height and dry weight of hibiscus ‘Panama Red’ at 29 days after the start of sensor-controlled subirrigation. Plants were irrigated when the substrate water content dropped below a specific threshold.
Water Management 191
SNA Research Conference Vol. 56 2011
Pathology and Nematology
Pathology Section 192
SNA Research Conference Vol. 56 2011
Determine the Efficacy of Biological Fungicides for Control of Pythium Stem and Root Rot in Poinsettia
Mengmeng Gu, Ph.D, Plant and Soil Sciences Maria Tomaso-Peterson, Ph.D, Entomology and Plant Pathology Yan Zhao, Plant and Soil Sciences Mississippi State University, MS 39762
Index words: P. aphanidermatum, poinsettia stem and root rot, biological fungicides, conventional fungicides.
Significance to Industry: Pythium stem and root rot is considered the most consistent and serious soil-borne disease problem in poinsettia production. Production greenhouse management practices typically include a fungicide drench when cuttings are transplanted. The standard conventional fungicide in the industry is mefenoxam (metalaxyl) (Subdue Maxx) a high risk fungicide for resistance, which targets RNA polymerase I in nucleic acid synthesis. Fungicide insensitivity metalaxyl exists in P. aphanidermatum isolated from turfgrass as well as poinsettia roots. Resistance management is a vital component of greenhouse production of floriculture crops when pathogens such as Pythium spp. are the target fungi. A key component of resistance management is integrating biofungicides into a disease management program.
Nature of Work: Pythium stem and root rot is favored by cool, saturated, poorly drained soils. Moderately low soil temperatures reduces water usage by plants, which favors Pythium stem and root rot in greenhouse production systems. Other factors that favor disease development in poinsettias include excessive fertilizer levels and high pH.
The pathogen typically attacks below the soil surface and may extend up into the base of the stem. Pythium spp. cause the lower stems and roots to become brown or black, soft, water-soaked and rotted, and the outer layers of root tissue easily strip off leaving a bare strand of inner vascular tissue exposed. Symptoms often become apparent when poinsettia plants wilt and die suddenly. In plants that survive, the growth is often stunted, and wilting may occur when the temperature is relatively high. Other symptoms may include premature flowering and defoliation. Pythium irregulare and P. ultimum are common species found in poinsettia, but P. aphanidermatum may account for most of the Pythium stem and root rot cases.
This early stage research program was designed to evaluate biological fungicides alone and in rotation with conventional fungicides to optimize the efficacy of biological fungicides for controlling Pythium stem and root rot in poinsettia. The objectives were to define fungicide programs using BW 240 (undergoing EPA registration) and other bio- and conventional fungicides that are beneficial to production greenhouse growers for controlling Pythium stem and root rot.
Pathology Section 193
SNA Research Conference Vol. 56 2011
'Prestige Red' poinsettia rooted cuttings were transplanted to 6-inch azalea pots and placed on benches in the greenhouse in June 2010. The biofungicide study was initiated with the application of biofungicide treatments (Table 1) four days prior to introduction of the pathogen. Pythium-infested rice served as the inoculum. Inoculum was prepared by sterilizing white rice in the autoclave for three successive days at 1 hour per 2.2 pounds rice. A pure colony four-day-old P. aphanidermatum growing on potato dextrose agar was macerated in 8.45 fluid ounces sterile distilled water and poured over 2.2 pounds sterile rice. The infested rice inoculum incubated three days in the dark at 82oF. Non-infested sterile rice served as the control. Each poinsettia plant was inoculated with 0.02 ounces of Pythium-infested rice; 1.0-inch from the stem at a 1.0-inch depth and immediately watered and allowed to drain. The common horticultural practices were adopted and the poinsettias were watered to maintain adequate soil moisture. Shade cloth was used to reduce greenhouse temperatures and prevent scalding of poinsettias from 10:00 through 15:00. Greenhouse temperatures ranged from 78o to 110oF throughout the study.
Shoot vigor was rated on a visual scale of 1 to 7 where 1 = dead plant and 7 = very healthy. Six shoot vigor ratings were conducted on 27- and 30-Jul, 5-, 13-, 20-Aug, and 9-Sept (4, 7, 13, 21, 28 and 48 days after Pythium inoculation (DAI)). Plant growth (shoot height, width and perpendicular width) were measured on 5- and 19-Aug and 3- Sept (13, 27 and 42 DAI). On 9 Sept (48 DAI), poinsettias were removed from the pots to complete a visual root rating (1 to 7; 1 = dead, 7 = very healthy). Poinsettia shoots were harvested to measure fresh and dry weights. Table 1 outlines the biofungicide treatments, treatment numbers corresponding to figures 1 through 3, active ingredient, application rates, and timing and application method.
The greenhouse study was arranged in a randomized complete block design with 10 replicates per treatment. Treatment means were analyzed using ANOVA. All the treatments were compared to the Pythium-infested control (#13) using the Dunnett test.
Results and Discussion: Wilting was observed in some treatments 4 DAI. At 48 DAI, poinsettias treated with Subdue Maxx (#5), Magellan (#6) and Aliette (#8) had significantly higher visual ratings compared to the Pythium-infested control (#13) and all the other treatments were similar (Fig. 1). Similar results were observed for area under the disease progress curve (AUDPC) and root rating (Fig. 2). The biofungicide treatment #9, BW240 followed by RootMate, was numerically greater for the shoot vigor and AUDPC compared to the Pythium-infested control (#13) (Figs. 1 and 2).
Poinsettias treated with Subdue Maxx had greater fresh weight compared to the non- infested control (#14); however the dry weight was reduced by more than 50%. Treatments BW240 (#10) and BW240 (#9) both followed by RootMate were numerically greater for fresh weight than the Pythium-infested control (#13). The treatment responses for growth index at 13-, 27-, and 42 DAI were similar to results of the visual rating data (Fig. 3). Although not significantly different, the growth index of BW 240 followed by RootMate (#9) was 59% greater than the Pythium-infested control (#13) at 42 DAI (Fig. 3).
Pathology Section 194
SNA Research Conference Vol. 56 2011
Based on the results of this study, the experimental biofungicide, BW 240 followed by RootMate (#9), exhibited a level of numerically improved shoot vigor at all rating dates, fresh weight, and overall AUDPC compared to the Pythium-infested treatment. Additional studies are warranted to further evaluate BW 240 application rates, intervals, rotations and tank-mixes with other biofungicides and conventional products that control Pythium stem and root rot. In a separate study, BW 240 tank-mixed with Subdue Maxx (0.5 fl oz/100 gallon water) provided very good control (Fig. 4) 42 DAI (data not shown). While the standard conventional fungicide, Subdue Maxx, reduced Pythium stem and root rot symptoms in poinsettias, the phosphonates Magellan and Alliete, also provided significant Pythium control resulting in acceptable plant vigor and reduced AUDPC. The phosphonate products may also be considered as an alternative control product in poinsettia production disease management program for controlling Pythium stem and root rot.
The technology developed from this and future evaluations will be transferred to poinsettia production growers for use in their Pythium disease management programs through Mississippi State University Extension Service outreach programs. The addition of biofungicides and non-conventionals such as phosphonates will reduce the number of applications and quantity of conventional fungicides that in turn will be environmentally beneficial and simultaneously reduce the risk of fungicide resistance to important fungicides such as Subdue Maxx.
Literature Cited: 1. Moorman, G.W., and Kim, S.H. 2004. Species of Pythium from greenhouses in Pennsylvania exhibit resistance to propamocarb and mefenoxam. Plant Dis. 88:630- 632. 2. Moorman, G.W., Kang, S., Geiser, D.M., and Kim, S.H. 2002. Identification and characterization of Pythium species associated with greenhouse floral crops in Pennsylvania. Plant Dis. 86:1227-1231. 3. Nelson, P.V. 2003. Greenhouse operation & management. 6th ed. Prentice Hall, Upper Saddle River, NJ. 4. Sanders, P.L. 1984. Failure of metalaxyl to control Pythium blight on turfgrass in Pennsylvania. Plant Dis. 68:776-777
Pathology Section 195
SNA Research Conference Vol. 56 2011
Table 1. Biological fungicide protocol for control of Pythium stem and root rot in poinsettia, IR-4 – 2010.
Treatment Active ingredient(s) Rate Timing/method Trichoderma harzianum 12 oz/100 gal 1 app @ trial 1. BW 240 T. virens water initiation/drench Trichoderma harzianum 8 oz/100 gal 1 app @ trial 2. BW 240 T. virens water initiation/drench 4 oz/100 gal 1 app @ trial 3. RootShield T. harzianum water initiation/drench 4 oz/100 gal 1 app @ trial 4. RootMate T. virens water initiation/drench 1 oz/100 gal 1 app @ trial 5. Subdue Maxx mefenoxam water initiation/drench 12 oz/100 gal 6. Magellan phosphorous acid water 14-d interval/drench 4 pt/100 gal 7. Magellan phosphorous acid water 14-d interval/ foliar 9.6 oz/100 gal 8. Aliette fosetyl-Al water 30-d interval BW 240 fb 8.0 oz fb 4.0 1 app fb 1 9. RootMate oz/100 gal water (WAT)/drench BW 240 fb 12.0 oz/ fb 4.0 1 app fb 1 10. RootMate oz/100 gal water WAT/drench BW 240 fb 8.0 oz/ fb 6.0 1 app fb 6 11. Magellan oz/100 gal water WAT/drench BW 240 + 8.0 oz/ + 0.5 1 app @ trial 12. Subdue Maxx oz/100 gal water initiation/drench Inoculated Pythium 96 hours post 13. control aphanidermatum 0.5 gram/pot treatment app. Non-inoculated 14. control
Pathology Section 196
SNA Research Conference Vol. 56 2011
8 1 2 3 4 5 6 7 8 9 10 11 12 13 14
7 ** * * * * * * * * * * 6 * * * * * 5 *
4
3 rating Shoot visual 2
1
0 4 DAI 7 DAI 13 DAI 21 DAI 28 DAI 48 DAI
Fig. 1. Shoot vigor visual rating of at 4, 7, 13, 21, 28 and 48 days after inoculation with Pythiumaphanidermatum (DAI). * indicates significant difference compared to the Pythium-infested control, treatment 13 based on Dunnett’s test at P = 0.05.
Pathology Section 197
SNA Research Conference Vol. 56 2011
45 1 2 3 4 5 6 7 8 9 10 11 12 13 14 40 *
35 * * 30 * * * 25 20 * 15 *
10 * 5 * * * 0 * AUDPC FW (g) DW (g) Root rating
Fig. 2. Area under the disease progress curve (AUDPC), shoot fresh weight (FW), shoot dry weight (DW) and root rating at 48 days after inoculation with Pythium aphanidermatum (DAI). * indicates significant difference compared to the Pythium-infested control, treatment 13 based on Dunnett’s test at P = 0.05.
Pathology Section 198
SNA Research Conference Vol. 56 2011
40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 * *
* 30 *
* * * 20 * * * *
(cm) index Growth 10
0 13 DAI 27 DAI 42 DAI
Fig. 3. Growth index at 13, 27 and 42 days after inoculation with Pythium aphanidermatum (DAI). * indicates significant difference compared to the Pythium- infested control, treatment 13 based on Dunnett’s test at P = 0.05.
BW 240 + Subdue Non-inoculated BW 240 Pythium-infested
Fig. 4. Poinsettia shoot vigor 42 days after inoculation with Pythium aphanidermatum. Shoot vigor in poinsettia treated with BW 240 (8.0 oz) + Subdue Maxx (0.5 fl oz) was similar to Subdue Maxx (1.0 fl oz) and the non-inoculated control.
Pathology Section 199
SNA Research Conference Vol. 56 2011
Survey for Bacterial Pathogens in Creeks at the Collins River Subwatershed
C. Korsi Dumenyo, Caleb Kersey, Sam Dennis and Debbie Eskandarnia
Department of Agricultural Sciences, Tennessee State University, 3500 John A. Merritt Blvd., Nashville, TN 37209
Significance to Industry: The Collins River Watershed is heavily impacted by agricultural activities and also by point source industrial pollution facilities. Recently, questioned have been raised on the safety of the water obtained from this watershed. In response, state authorities have described the microbial counts in these waters as normal for areas with agricultural and urban run-off. The goal of this project was to test the levels of common human bacterial pathogens in the waters within the Collins River Watershed. This project will create baseline knowledge to detect changes in the pathogens levels and therefore the need for watershed protection strategies. Out of 24 samples collected, half of which were associated with rain, only three tested positive for one pathogen and we failed to detect two other pathogens from any of the samples.
Nature of Work: Watersheds are highly impacted by activities that take place within them and those that are located within or near rural areas are especially impacted by agricultural activities. These waters are at high risk of many negative effects such as bank erosion, siltation, eutrophication, polluted runoff, and decreased dissolved oxygen. Most nonpoint source pollution in these waters arises from agricultural and other commercial activities. Most of these pollutants make their way into the water through polluted surface run-off following rainfall events. Common bacterial pathogens in water include Salmonella spp, Shigella sp, E. coli O157:H7, Pseudomonas aeruginosa, Aeromonas hydrophila, and Helicobacter pylori.
The Collins River Watershed is approximately 811 square miles and includes parts of 6 Middle Tennessee counties. A part of the Cumberland River drainage basin, the watershed has 1,003 stream miles and 69 lake acres. The main objective of this project was to sample the waters of two creeks, Charles Creek and Hills Creek within the Collins River watershed for common bacterial pathogens associated with agricultural activities.
Three sampling sites were located in each of the creeks where water samples were collected. Most of the treatment of the water sample followed modified methods of (Fincher et al. 2009). About a liter of water was collected from each site in 1-L sterile polypropylene bottles. The bottles were submerged approximately 1 m from the shore and 10 cm under water. Water samples were kept on ice until brought to the laboratory where they were refrigerated and analyzed.
Pathology Section 200
SNA Research Conference Vol. 56 2011
About 100 ml of each sample was centrifuged at 5,200 rpm. The pelletted material was resuspeded in about 5 ml of the remaining water. About 1 ml of this resupension was inoculated into Terrific Broth and cultured at 37 °C overnight. Genomic DNA was extracted from these cultures using Promega Wizzard Genomic DNA kit. The DNA samples were tested for E. coli O157:H7, Listeria monocytogenes and for Salmonella enterica. PCR products were resolved on agarose gels and compared to results using known pathogen DNA. The specificity of the primers used for the detection has been described by Mustapha and Li (2006) and Ortege (2006).
Results and Discussion: Water samples were tested for three pathogens, E. coli O157:H7, Salmonella enterica and Listeria monocytogenes. Listeria and Salmonella were not detected in any samples. These data suggest that these two pathogens may not be a problem in these waters. Although the samples were taken at one time, it is unlikely that samples taken at other times will contain significant levels of this pathogen. For a more dependable results, sampling has to be done over a period of time. For this study, we took two samples from each location. One of these samples is associated with rainfall. Therefore, our failure to obtain any positive test for these pathogens strongly suggest the run off from the impacted activity areas is fairly free of these pathogens.
Three samples, samples 16, 19 and 24 tested positive for E. coli (Table 2, Figure 1). Two of the positive samples came from the Collins River itself and one from Charles Creek. That two of the river samples tested positive for E. coli could probably be explained by the fact that the river contains water from all the creeks that feed into it. It therefore has a higher chance of containing any of the pathogens that may be present in the creeks that empty into the river.
Literature Cited 1. Campbell C. 30 May 2008. Resident says Warren County River polluted - State says levels are normal where there is urban, agricultural runoff. In WSMV Channel 4 TV. USA 2. Fincher LM, Parker CD, Charuret CP. 2009. Occurrence and antibiotic resistance of Escherichia coli O157:H7 in a watershed in North-Central Indiana. J. Environ. Qual. 38: 997-1004 3. Mustapha A, Li Y. 2006. Molecular detection of foodborne bacterial pathogens. In PCR methods in Foods, ed. J Maurer, pp. 69-90. New York: Springer 4. Ortege Y. 2006. Molecular tools for the identification of foodborne parasites. In PCR methods in Foods, ed. J Maurer, pp. 119-45. New York: Springer
Pathology Section 201
SNA Research Conference Vol. 56 2011
Table 1. Primers for specific detection of pathogens in water samples.
Primer Name Species Primer Sequence EHEC 0157 stx1-F E. coli CAGTTAATGTGGTGGCGAAGG EHEC 0157 stx1-R CACCAGACAATGTAACCGCTG L-monocyt iap-F L. monocytogenes CAAACTGCTAACACAGCTACT L-monocyt iap-R GCACTTGAATTGCTGTTATTG Salmonella-F Salmonella AGCCAACCATTGTAAATTGGCGCA Salmonella-R GGTAGAAATTCCCAGCGGGTACTG
Table 2. Samples used in the test Date Rain Sample # Location Collected Event 7 HC1 5/1 1-May-09 Y 9 HC2 5/1 1-May-09 Y 11 HC3 5/1 1-May-09 Y 19 CR1 5/4 4-May-09 Y 21 CR2 5/4 4-May-09 Y 23 CR3 5/4 4-May-09 Y 1 MC1 5/1 1-May-09 Y 3 MC2 5/1 1-May-09 Y 5 MC3 5/1 1-May-09 Y 13 CC1 5/4 4-May-09 Y 15 CC2 5/6 6-May-09 Y 17 CC3 5/6 6-May-09 Y 8 HC1 5/20 20-May-09 N 10 HC2 5/20 20-May-09 N 12 HC3 5/20 20-May-09 N 20 CR1 5/19 19-May-09 N 22 CR2 5/19 19-May-09 N 24 CR3 5/19 19-May-09 N 2 MC1 5/20 20-May-09 N 4 MC2 5/20 20-May-09 N 6 MC3 5/20 20-May-09 N 14 CC1 5/19 19-May-09 N 16 CC2 5/19 19-May-09 N 18 CC3 5/19 19-May-09 N
CC = Charles Creek HC = Hills Creek CR = Collins River MC = Mountain Creek
Pathology Section 202
SNA Research Conference Vol. 56 2011
Figure 1. Agarose gel of PCR-amplified DNA from water samples. The test is testing for the presence of Salmonella in the water samples. Lanes 1, DNA ladder; 2, CC2 5/19; 3, CR1 5/4; 4, control (no DNA); 5, Positive control (Salmonella DNA); 6, CR3 5/19.
Pathology Section 203
SNA Research Conference Vol. 56 2011
Organic Fungicides Compared for Foliar Disease Control on Crape Myrtle and Hydrangea
A. K. Hagan1, J. R. Akridge2, J. W. Olive3 and J. Stephenson3
1Department of Entomology and Plant Pathology, Auburn University, Auburn, AL 36849 2Brewton Agricultural Research Unit, Brewton, AL 36427 3Mobile Ornamental Research Unit, Mobile, AL 36608
Index Words: Bonide Liquid Copper Fungicide, Bonide All Seasons Horticultural Spray and Dormant Oil Concentrate, MilStop 85W, Garden Disease Control RTU, Serenade Disease Control RTU, Green Leaf Neem Concentrate, Bonide Bonide Citrus, Fruit, and Nut Orchard Spray Concentrate, Southern Ag Liquid Copper Fungicide, EcoSense Garden Disease RTU, Daconil Ultrex, Immunox, Cercospora leaf spot, powdery mildew, Corynespora leaf spot, biorational fungicide.
Significance to Nursery Industry: Consumers are interested in organic alternatives to synthetic fungicides for controlling diseases on herbaceous and woody ornamentals. Unfortunately, efficacy of retail or commercial OMRI-certified organic fungicides against diseases is not well documented. In this series of trials, the organic fungicide Bonide All Seasons Horticultural and Dormant Spray Oil Concentrate gave superior control of Cercospora leaf spot on field grown crape myrtle when compared with selected synthetic and organic fungicides. Previously, the active ingredient (paraffinic oil) in this product has been highly effective in controlling powdery mildew on hydrangea (4). With the exception of Green Light Neem Concentrate, all organic fungicides along with the synthetic fungicide standards gave a very high level of powdery mildew control. With Corynespora leaf spot, organic fungicides except for Bonide Liquid Copper Fungicide were usually less efficacious than the synthetic commercial and retail fungicide standards Heritage 50WDG and Immunox, respectively. Southern Ag Liquid Copper Fungicide, which is not an OMRI-certified organic product, gave superb control of Corynespora leaf spot but proved highly phytotoxic to hydrangea. Some rugosity and leaf distortion similar to that noted on the Southern Ag Liquid Copper Fungicide –treated plants was also noted on the juvenile leaves on the Bonide Liquid Copper Fungicide- treated hydrangea. No copper fungicide induced phytotoxicity was noted on the crapemyrtle.
Nature of Work: Organic or biorational fungicides, which purportedly have few negative impacts on the environment, are being heavily promoted as replacements for synthetic fungicides for the control of diseases of ornamentals as well as vegetables and tree fruits in residential landscapes. The number of studies conducted to evaluate the performance of retail organic fungicides for the control of ornamentals diseases is limited. Mmbaga and Sauve (6) noted that weekly applications of Armicarb® 100, which contains potassium bicarbonate, controlled powdery mildew on flowering dogwood as effectively as the synthetic fungicides Heritage 50WDG (azoxystrobin) and Banner MAXX (propiconazole). Control of powdery mildew on deciduous azalea (8),
Pathology Section 204
SNA Research Conference Vol. 56 2011
hydrangea (4), and monarda [bee balm] (7) as well as black spot on rose (5) has also been obtained with several formulated potassium bicarbonate products. On field grown flowering dogwood, Hagan and Akridge (1) noted that the organic fungicides SunSpray Ultra Fine Oil (paraffinic oil), Neem Concentrate (neem extract), and Rhapsody (Serenade biofungicide) had to be applied twice as often as a synthetic fungicide to obtain a similar level of powdery mildew control. In contrast, SunSpray Ultra Fine Oil and to a lesser extent MilStop 85W proved nearly as effective as the synthetic fungicides Heritage 50WDG and Eagle 40W in controlling powdery mildew on hydrangea (4). In contrast to powdery mildew, efficacy of organic fungicides for the control of aggressive leaf spot and blight diseases on woody ornamentals is not well known. Hagan and Akridge (1) found that SunSpray Ultra Fine Oil, Neem Concentrate, and Rhapsody failed to give the level of spot anthracnose and Cercospora leaf spot control needed to produce quality field or container-grown flowering dogwood.
Cercospora leaf spot, which is characterized by tan to dark brown spots randomly scattered on yellow to red discolored leaves, can ruin the fall color display of crape myrtle but has little impact on tree growth (3). While the ideal control of Cercospora leaf spot is the establishment of disease resistant cultivars, relatively few crape myrtle cultivars in the trade have a high level of resistance to this disease. As a result, fungicides may be periodically needed to control this disease on specimen crape myrtle. Preliminary trials (2) suggest that only a few synthetic fungicides appreciably slow disease development on field grown crape myrtle.
Bigleaf hydrangea (Hydrangea macrophylla) is not only widely used in landscape plantings across Alabama but also is a staple crop for the florist industry. While powdery mildew is often cited as the dominant disease on bigleaf hydrangea (9), leaf spots and blights incited by fungi such as Cercospora arborescentis, Myrothecium roridum, Phoma exigua and Corynespora cassicola may have a detrimental impact on plant aesthetics in the landscape or on the salability of container-grown plants (6). While selected organic and synthetic fungicides effectively control powdery mildew on bigleaf hydrangea (4); however, their performance against any of the above leaf spot and blight diseases on bigleaf hydrangea is unknown.
This report compares the efficacy of selected organic and synthetic fungicides for the control of Cercospora leaf spot on field-grown crapemyrtle as well as powdery mildew and Conyespora leaf spot on container-grown bigleaf hydrangea.
Crape myrtle - ‘Wonderful White’ crape myrtle were transplanted in February 2004, into a Benndale sandy loam soil (≤ 1% organic material) at the Brewton Agricultural Research Unit (USDA Hardiness Zone 8a). Prior to planting, soil fertility and pH were adjusted according to the results of a soil fertility assay. A drip irrigation system was installed at planting and the trees were watered as needed. An application of 16-4-8 analysis fertilizer at 60 lb/A of actual N was made annually in April. A randomized complete block design with four single-plant replications was used. With the exception of Heritage 50WDG (azoxystrobin) which was applied only on a 2-week schedule,
Pathology Section 205
SNA Research Conference Vol. 56 2011
Daconil Ultrex (chlorothalonil), Bonide Liquid Copper Fungicide (copper octanoate), Bonide All Seasons Horticultural Spray and Dormant Oil Concentrate (paraffinic oil), and MilStop 85W (potassium bicarbonate) were applied at 1- and 2-week intervals to drip with a tractor mounted sprayer using a hand wand with a single flood-type nozzle tip at the above intervals beginning on 10 July until 23 September 2009 and 8 July until 9 September 2010. Cercospora leaf spot (CLS) intensity was visually rated on 29 September 2009 and 19 September 2010 using a modified Florida 1 to 10 peanut leaf spot rating scale where 1 = no disease, 2 = very few lesions in canopy, 3 = few lesions noticed in lower and upper canopy, 4 = some lesions in lower and upper canopy with < 10% defoliation, 5 = lesions noticeable and < 25% defoliation, 6 = lesions numerous and < 50% defoliation, 7 = lesions very numerous and < 75% defoliation, 8 = numerous lesions on few remaining leaves and <90% defoliation, 9 = very few remaining leaves covered with lesions and < 95% defoliation, and 10 = plants defoliated. Significance of treatment effects was tested by analysis of variance and Fisher’s protected least significant difference (LSD) test (P<0.05).
Hydrangea - In 2009 and 2010, rooted cuttings of the bigleaf hydrangea ‘Dooley’ were transplanted into #1 (C-650) containers filled with a pine bark:peat moss medium (3:1 by vol) amended with 14 lb of Osmocote 17-7-12, 6 lb of dolomitic limestone, 2 lb of gypsum, and 1.5 lb of Micromax per yd3 of potting mixture. Plants were maintained outdoors on a clam shell-covered bed under 47% shade cloth and watered daily with overhead impact sprinklers. The experimental design was a randomized complete block with six single plant replications. Serenade Disease Control RTU and EcoSense Garden Disease RTU (ready to use) were applied with a hand pump spray bottle, whereas the remaining fungicide treatments were applied to drip with a CO2-pressurized sprayer. Fungicide treatments were scheduled at the intervals listed below from 10 August and 12 October 2009 and 8 July to 20 October 2010. Heritage 50WDG and Immunox (myclobutanil) applications were made on a 2-week compared with a 1-week schedule for Bug Oil (unknown a.i.) and Garden Disease Control RTU (copper octanoate) in 2009, as well as Serenade Disease Control RTU (Bacillus subtilis QST713), Green Leaf Neem Concentrate (neen oil extract), and Bonide Citrus, Fruit, and Nut Orchard Spray Concentrate (sulfur + pyrethrins) in both years, along with Bonide Liquid Copper Fungicide (copper octanoate), Southern Ag Liquid Copper Fungicide, and MilStop 85W in 2010. Powdery mildew incidence was visually rated on 14 and 28 October in 2009 and 2010, respectively, using a 0 to 11 Horsfall and Barratt rating scale where 0 = no disease, 1 = 0 to 3%, 2 = 3 to 6%, 3 = 6 to 12%, 4 = 12 to 25%, 5 = 25 to 50%, 6 = 50 to 75%, 7 = 75 to 87%, 8 = 87 to 94%, 9 = 94 to 97%, 10 = 97 to 100 %, and 11 = 100% of leaves colonized by E. polygoni. Corynespora leaf spot intensity was visually rated on 14 October 2009 and 28 October 2010 using a modified 1 to 10 Florida peanut leaf spot scoring system as previously described. Significance of treatment effects was tested by analysis of variance and Fisher’s protected least significant difference (LSD) test (P<0.05).
Weather Patterns - While rainfall in July, August, September and October 2009 were average to above average 30 year total for those months, rainfall totals for 2010 at both
Pathology Section 206
SNA Research Conference Vol. 56 2011
study locations were below to well below and temperatures higher compared with the historical average for the Brewton Agricultural Research Unit in Brewton, AL and Ornamental Horticulture Research Unit in Mobile, AL.
Results and Discussion
Crape myrtle - When compared with the non-treated control in 2009, Cercospora leaf spot intensity was not reduced with Daconil Ultrex applied at 1- or 2-week intervals, MilStop 85W applied at 2-wk intervals or with Heritage 50WDG. In contrast, significant reductions in disease intensity were obtained with Bonide Liquid Copper Fungicide and MilStop 85W applied at 1-week intervals along with the All Seasons Horticultural and Dormant Spray Oil applied at 1- and 2-week intervals, which gave equally effective Cercospora leaf spot control. Bonide Liquid Copper Fungicide controlled Cercospora leaf spot better when applied at 1- compared with 2-week intervals. Regardless of application interval, All Seasons Horticultural and Dormant Spray Oil gave better Cercospora leaf spot control than Daconil Ultrex, MilStop 85WP, and Bonide Liquid Copper Fungicide applied on a 2- but not 1-week schedule.
In 2010, Cercospora leaf spot intensity was not reduced with Heritage 50WDG, Daconil Ultrex, Bonide Liquid Copper Fungicide, or the 2-week MilStop 85W program when compared with the non-treated control. Significant reductions in disease intensity were obtained with the 1-week MilStop 85W program as well as the 1- and 2-week All Seasons Horticultural Spray and Dormant Oil Concentrate and Bonide Liquid Copper Fungicide programs. The latter two fungicide programs proved equally effective in controlling Cercospora leaf spot when applied at 1- and 2-week intervals. At both application intervals, All Seasons Horticultural Spray and Dormant Oil Concentrate gave superior Cercospora leaf spot control than either the 1- or 2-week Daconil Ultrex program, as well as the 2-week MilStop 85WP and Bonide Liquid Copper Fungicide programs.
Over the two year study period, the organic fungicide All Seasons Horticultural Spray Oil Concentrate gave better control of Cercospora leaf spot not only the organic fungicides Bonide Liquid Copper Fungicide and MilStop 85W but also the synthetic fungicides Heritage 50WDG and Daconil Ultrex, which had ratings similar to the non-treated control (2). In addition, Hagan and Akridge (2) also showed that the All Seasons Horticultural Spray and Dormant Oil Concentrate when applied at 1 and 2-week intervals proved similarly effective in controlling this disease. While Heritage 50WDG reduced the level of leaf spotting and premature leaf loss on crapemyrtle in a previous trial, Daconil Ultrex did not (2). When applied weekly, Bonide Liquid Copper Fungicide and MilStop 85W also gave some modest protection from Cercospora leaf spot.
Hydrangea - With the exception of Garden Safe Fungicide 3, no signs or symptoms of powdery mildew were seen on the fungicide-treated hydrangea in 2009. Powdery mildew incidence was significantly higher on the non-treated controls compared with the Garden Safe Fungicide 3-treated hydrangea, which did not give effective disease
Pathology Section 207
SNA Research Conference Vol. 56 2011
control when compared with the other organic and synthetic fungicides. Significant reductions in Corynespora leaf spot intensity were obtained with all fungicides except for Bug Oil and Garden Safe Fungicide 3. Weekly applications of Serenade Disease Control RTU and EcoSense Garden Disease Control RTU were as effective in controlling Corynespora leaf spot as Heritage 50WDG applied at 2-wk intervals. Immunox gave significantly better Corynespora leaf spot control than Serenade Disease Control RTU, EcoSense Garden Disease Control RTU, and Citrus, Fruit, and Nut Orchard Spray Concentrate, which gave similar control of this disease. A slight distortion of the tip of newly emerging leaves was noted on the EcoSense Garden Disease Control RTU-treated hydrangea.
When compared with the non-fungicide treated control, all fungicide treatments provided a high level of powdery mildew control in 2010. While the Heritage 50WDG- and MilStop 85W-treated hydrangea had highest powdery mildew ratings, disease incidence was very low. Bonide Liquid Copper Fungicide, Immunox, Southern Ag Liquid Copper Fungicide, and Heritage 50WDG proved equally effective in protecting hydrangea from Corynespora leaf spot. When compared with the non-treated control, a reduction in disease was also obtained with MilStop 85W and Green Light Neem Concentrate. Serenade Disease Control RTU and Citrus, Fruit, and Nut Orchard Spray Concentrate failed to reduce Corynespora leaf spot intensity below levels noted on the non-treated control. Southern Ag Liquid Copper Fungicide and to a lesser extent Bonide Liquid Copper Fungicide were phytotoxic to the leaves of hydrangea.
Due to the vulnerability of the fungal mycelia on the upper leaf surfaces, powdery mildew was almost completely controlled in both years with the synthetic fungicides and nearly all of the organic fungicides except Green Light Neem Concentrate in 2009. In contrast, Green Light Neem Concentrate was equally effective in controlling powdery mildew as the other organic fungicides in 2010. Previously, Hagan and Akridge (1) obtained similar powdery mildew control on flowering dogwood with weekly Neem Concentrate as well as SunSpray Ultra Fine Oil treatments under light but not heavy disease pressure. Effectiveness of the organic and synthetic fungicides for the control of Corynespora leaf spot significantly differed. In both years, the synthetic fungicides Heritage 50WDG and Immunox greatly reduced the level of leaf spotting and premature defoliation associated with this disease. While also effective against Corynespora leaf spot, the leaves on the Bonide Liquid Copper Fungicide and Southern Ag Liquid Copper Fungicide-treated hydrangea were slightly too severely deformed.
In summary, All Seasons Horticultural Spray and Dormant Oil Concentrate proved to be the treatment of choice for controlling Cercospora leaf spot on crape myrtle. Activity of this organic fungicide was often superior to that obtained with not only the other organic fungicides but also the synthetic fungicides, particularly when applied at 2-week intervals. Generally, the organic and synthetic fungicides both gave superior control of powdery mildew on hydrangea. However, the organic fungicides were applied at 1- compared with 2-week intervals, so some decline in the efficacy of organic fungicides, as has been shown in previous trials (1), probably would occur when application interval
Pathology Section 208
SNA Research Conference Vol. 56 2011
were extended to 2 weeks. In contrast to powdery mildew, organic fungicides, except for Bonide Liquid Copper Fungicide, displayed little activity against Corynespora leaf spot. Unfortunately, Bonide Liquid Copper Fungicide and particularly the Southern Ag Liquid Copper Fungicide were phytotoxic to hydrangea. Phytotoxicity issues such as those encountered would greatly limit the use of these two and other copper-based fungicides on hydrangea and possibly other copper sensitive woody ornamentals.
Literature Cited
1. Hagan, A. K. and J. R. Akridge. 2007. Synthetic and biorational fungicides compared for the control of three foliar diseases of flowering dogwood. J. Environ. Hort 25:157-165. 2. Hagan, A. K. and J. R. Akridge. 2009. Instrata 3.61SE evaluated for the control of Cercospora leaf spot on crapemyrtle, 2007. Plant Disease Management Reports 3:OT027. 3. Hagan, A. K., Akridge, J. R., and Bowen, K. L. 2009. Influence of nitrogen rate on Cercospora leaf spot and growth of crapemyrtle. Online. Plant Health Progress doi:10.1094/PHP-2009-1214-01-RS. 4. Hagan, A. K., J. W. Olive, J. Stephenson, and M. E. Rivas-Davila. 2005. Control of powdery mildew and Cercospora leaf spot on bigleaf hydrangea with Heritage and MilStop fungicides. Alabama Agri. Exp. Sta. Bul. 658. 13 pp. 5. Horst, R. K., S. O. Kawamoto, and L. L. Porter. 1992. Effect of sodium bicarbonate and oils on the control of powdery mildew and black spot on rose. Plant Dis. 76:247-251. 6. Mmbaga, M. T., M. T. Windham, Y. Li, and R. J. Sauve. 2009. Fungi associated with naturally occurring leaf spots and leaf blights in Hydrangea macrophylla. Proc. Southern Nur. Assoc. Res. Conf. 54:49-53. 7. Perry, L. 2002. Comparison of powdery mildew controls on Snow White bee balm, 2001. Fungicide and Nematicide Tests 57:OT04. 8. Pscheidt, J. W. 2001. Comparison of fungicides for control of powdery mildew on deciduous azalea. Fungicide and Nematicide Tests 56:OT2. 9. Williams-Woodward, J. L. and M. L. Daughtrey. 2001. Hydrangea Diseases. Pages 191-194 in Compendium of Nursery Crop Diseases. R. Jones and M. Benson, eds. APS Press, St. Paul, MN.
Pathology Section 209
SNA Research Conference Vol. 56 2011
Table 1. Organic and synthetic fungicides compared for the control of Cercospora leaf spot on field-grown ‘Wonderful White’ crape myrtle at the Brewton Agricultural Research Unit in Brewton, AL.
Spray Cercospora interval leaf spotz Fungicide and rate/100 gal (week) 2009 2010 Untreated Control --- 7.0 ay 7.0 a Bonide Liquid Copper Fungicidex 0.8 gal 1 5.0 de 5.5 cd Bonide Liquid Copper Fungicide 0.8 gal 2 5.8 cd 6.5 ab All Seasons Horticultural Spray and Dormant Oil 1 4.5 e 4.8 d Concentratex 1.2 gal All Seasons Horticultural Spray and Dormant Oil 2 4.5 e 5.3 d Concentrate 1.2 gal MilStop 85Wx 2.5 lb 1 6.0 bc 5.8 bcd MilStop 85W 2.5 lb 2 6.8 ab 6.3 abc Heritage 50W 4 oz 2 6.5 abc 6.5 ab Daconil Ultrex 82.5 WDG 1.4 lb 1 6.5 abc 6.0 bcd Daconil Ultrex 82.5 WDG 1.4 lb 2 7.0 a 6.5 ab zCercospora leaf spot (CLS) intensity was assessed using a modified 1 to 10 Florida leaf spot rating scale. yMeans followed by the same letter are not significantly different according to Fisher’s protected least significant difference test (P<0.05). xOMRI certified organic fungicide.
Pathology Section 210
SNA Research Conference Vol. 56 2011
Table 2. Organic and synthetic fungicides compared for powdery mildew and Corynespora leaf spot control on container-grown ‘Dooley’ hydrangea at the Ornamental Horticulture Research Unit in Mobile, AL.
Spray Powdery Corynespora interval mildewz leaf spoty Treatment and rate/100 gal (week) 2009 2010 2009 2010 Bug Oil 2 gal 1 0 cx -- 4.7 aby -- Bonide Liquid Copper Fungicidew 1.5 gal 1 -- 0 c -- 2.2 cd Serenade Disease Control RTUwv 1 0 c 0 c 2.8 cd 3.8 ab Green Light Neem Concentratew 0.8 gal 1 48 b 0 c 4.7 ab 3.3 b Citrus, Fruit, and Nut Orchard Spray 1 0 c 0 c 3.8 bc 3.5 ab Concentrate 2 gal EcoSense Garden Disease Control RTUwv 1 0 c -- 3.0 cd -- Southern Ag Liquid Copper Fungicide 1.1 qt 1 -- 0 c -- 1.5 d MilStop 85Ww 1.5 lb 1 -- 1 b -- 3.2 b Heritage 50WDG 4 oz 3 0 c 1 b 2.2 de 1.8 d Immunox 1.55% 0.8 gal 2 0 c 0 c 1.8 e 2.5 c Non-treated Control -- 62 a 76 a 5.3 a 4.3 a zPowdery mildew was visually rated using the 0 to 11 Horsfall and Barratt rating scale and disease ratings were back transformed to percent values for presentation. yCorynespora leaf spot was rated using a modified Florida 1 to 10 peanut leaf spot rating scale. xMeans separation within columns was according to Fisher’s protected least significant difference test (P<0.05). wOMRI certified organic fungicide. vRTU (ready to use) formulations were applied with a hand pump spray bottle.
Pathology Section 211
SNA Research Conference Vol. 56 2011
Reaction of Ornamental Switchgrass (Panicum virgatum) Selections to Rust and Anthracnose
A. K. Hagan, J. R. Akridge, and K. L. Bowen
1Department of Entomology and Plant Pathology, Auburn University, Auburn, AL 36849 2Brewton Agricultural Research Unit, Brewton, AL 36427
Index Words: Disease resistance, resistant varieties, Puccinia emaculata, Colletotrichium navitas.
Significance to Nursery Industry: Rust and anthracnose are emerging threats to the health and beauty of ornamental switchgrass. Of the two diseases, rust, which was noted on all selections, is most likely to degrade the aesthetics of switchgrass in commercial and landscape plantings. Switchgrass selections that suffered the least rust damage and had the highest aesthetic value throughout the growing season were Shenandoah, Rotstralbush, Haense Herms, and Northwind. Unacceptably high levels of rust-related leaf death were noted on Dewey Blue, Dallas Blue, Panicum virgatum, and Badlands. Anthracnose noticeably damaged only Prairie Sky, a selection that in contrast suffered little rust damage.
Nature of Work: While well known as a potential high energy feed stock for biofuel production (7), a number of switchgrass (Panicum virgatum) selections have been released for use as accents, screens, or specimen plants in residential and commercial landscapes and are considered both pest and drought resistant (5,7). Rust caused by the fungus Puccinia emaculata, which is recognized as a potentially damaging disease (7), has been recently reported in feed stock switchgrass plantings at multiple locations in Arkansas (3), Iowa (2), and Tennessee (8). Existence of multiple races of P. emaculata as noted by Li et al. (5) could minimize the value of rust-resistant selections as a tool for managing this disease in field or landscape plantings of switchgrass. Previously, ornamental switchgrass cultivars Shenandoah, Northwind, and wild type Panicum virgatum had the lowest rust ratings in an Illinois field trial (4), while Prairie Sky, Dallas Blues, Haense Herms, and Cloud 9 were among the most rust-susceptible. Other potentially damaging fungal diseases on switchgrass include spot blotch incited by Bipolaris sorokiniana (7) and anthracnose incited by Colletotrichium navitas (1). Recently, severe anthracnose incited leaf spotting on the ornamental switchgrass Prairie Sky was reported by Li et al. (6). In Alabama, anthracnose was also diagnosed in 2010 on switchgrass feed stock breeding material (Hagan, personal observation).
Switchgrass selections were transplanted from trade gallon containers in 23 February 2010 into a Benndale sandy loam soil (≤ 1% organic material) at the Brewton Agricultural Research Unit (USDA Hardiness Zone 8a). Prior to planting, soil fertility and pH were adjusted according to the results of a soil fertility assay. A drip irrigation system was installed at planting and the plants were watered as needed. An
Pathology Section 212
SNA Research Conference Vol. 56 2011
application of 400 lb/A of 5-10-15 analysis fertilizer was made on 30 March. Pre- emergent weed control was obtained with an application of Surflan AS at 2 qt/A + Gallery at 1 lb/A was applied on 30 March. A randomized complete block design with six single-plant replications was used. Rust and anthracnose intensity was visually rated on 16 August and 16 September 2010, respectively using a modified Florida 1 to 10 peanut leaf spot rating scale where 1 = no disease, 2 = very few lesions/pustules in canopy, 3 = few lesions/pustules noticed in canopy, 4 = some lesions/pustules in canopy and < 10% leaf death, 5 = lesions/pustules noticeable and < 25% leaf death, 6 = lesions/pustules numerous and < 50% leaf death, 7 = lesions/pustules very numerous and < 75% leaf death, 8 = numerous lesions/pustules on remaining green leaves and <90% leaf death, 9 = very few remaining green leaves covered with lesions/pustules and < 95% leaf death, and 10 = all leaves dead. Significance of treatment effects was tested by analysis of variance and Fisher’s protected least significant difference (LSD) test (P<0.05).
Results and Discussion: Despite extended periods of hot and dry summer weather, severe rust and anthracnose damage was noted on some switchgrass selections, which differed in their reaction to these two diseases. Symptoms of anthracnose and rust were noted in mid-June and disease development continued into early fall. Of 13 switchgrass selections, considerable anthracnose-related leaf spotting and blighting was noted only on Prairie Sky, which in contrast suffered the least rust damage. Light to moderate rust development, which was not noticeable until September, was seen on Shenandoah, Rotstralbush, Haense Herms, and Northwind. Heaviest rust damage with 50% to 75% leaf mortality was recorded on Dewey Blue, Dallas Blue, wild type Panicum virgatum, and Badlands.
As previously noted by Jacobs and Terrell (4), the switchgrass selections Shenandoah and Northwind displayed good resistance to rust in this study, while Cloud 9, Heavy Metal, and Dallas Blue suffered heavy damage. Although Panicum virgatum was rust resistant in Illinois (4), this selection proved as susceptible to rust as the latter two switchgrass selections. In contrast, Prairie Sky and Haense Herms switchgrass, which had among the lowest rust ratings in the Alabama study, suffered severe rust damage in Illinois (4). Presence of different strains of the rust fungus as reported by Li et al. (5) could account for the regional differences in the reaction of ornamental switchgrass selections to rust. As noted by Li et al. (6), Prairie Sky is highly susceptible to anthracnose.
Literature Cited
1. Crouch. J. A., L. A. Beirn, L. M. Cortese, S. A. Bonos, and B. Clarke. 2009. Anthracnose disease of switchgrass caused by novel fungal species Colletotrichium navitas. Mycological Res. 113:1411-1421. 2. ravert, C. E. and G. P. Munkvold. 2002. Fungi and diseases associated with cultivated switchgrass in Iowa. J. Iowa Acad. Sci. 109:30-34.
Pathology Section 213
SNA Research Conference Vol. 56 2011
3. Hirsch, R. L., D. O. TeBeest, B. H. Bluhm, and C. P. West. 2010. First report of rust caused by Puccinia emaculata on switchgrass in Arkansas. Plant Dis. 94:381. 4. Jacobs, K. A. and C. I. Terrell. 2004. Evaluation of ornamental switch grass susceptibility to rust, 2003. Biological and Cultural Tests for the Control of Plant Diseases 19:O008. 5. Li, Y., M. Windham, R. Trigiano, A. Windham, B. Ownley, G. Gwinn, J. Zale, and J. Spiers. 2009. Rust diseases in ornamental grasses. Proc. Southern Nur. Assoc. Res, Conf. 54:81-82. 6. Li., Y., M. Windham, R. Trigiano, P. Wadi, K. Moulton, A. Windham, and J. Spiers. 2010. Anthracnose: a new disease in ornamental grasses. Proc. Southern Nur. Assoc. Res, Conf. 55:425-426. 7. Parrish, D. J. and J. H. Fike. 2005. The biology and agronomy of switchgrass for biofuels. Critical Rev. in Plant Sci. 24:423-459. 8. Zale, J., L. Freshour, S. Agarwal, J. Sorochan, B. H. Ownley, K. D. Gwinn, and L. A. Castelbury. 2008. First report of rust on switchgrass (Panicum virgatum) caused by Puccinia emaculata in Tennessee. Plant Dis. 92:1710.
Table 1. Reaction of ornamental switchgrass selections to anthracnose and rust at the Brewton Agricultural Research Unit in 2010.
Switchgrass selection Anthracnose Rustz z Prairie Sky 5.3 ay 1.6 f Shenandoah 1.0 b 4.0 e Rotstralbush 1.0 b 4.2 e Haense Herms 1.0 b 4.8 de Northwind 1.0 b 4.8 de Thundercloud. 1.0 b 5.7 cd Cheyenne Sky 1.0 b 5.7 cd Heavy Metal 1.0 b 6.0 bc Badlands 1.0 b 6.4 abc Panicum virgatumx 1.0 b 6.8 ab Dallas Blue 1.0 b 7.0 a Dewey Blue 1.0 b 7.0 a Cloud 9 1.0 b 7.3 a zAnthracnose and rust intensity were rated on 16 August and 16 September, respectively, using a modified Florida 1 to 10 peanut leaf spot rating scale. yMeans in each column that are followed by the same letter are not significantly different according to Fisher’s least significant difference (P<0.05) test. xWild type.
Pathology Section 214
SNA Research Conference Vol. 56 2011
Control of Rust on Panicum (switchgrass) with Fungicides
A. K. Hagan1 and J. R. Akridge2
1Department of Entomology and Plant Pathology, Auburn University, Auburn, AL 36849 2Brewton Agricultural Research Unit, Brewton, AL 36427
Index Words: Chemical control, Puccinia emaculata, Daconil Ultrex, Heritage 50WDG, Banner MAXX. Eagle 40W, 3336 4.5F, Medallion 50W, Palladium 62.5WG.
Significance to Nursery Industry: Rust is a significant threat to container and landscape plantings of ornamental switchgrass selections. The fungicides Eagle 40W and Heritage 50WDG when applied at 2-week intervals effectively controlled rust on the susceptible switchgrass selection ‘Dallas Blue’. In contrast, 3336 4.5F, Banner MAXX, Medallion 50W and Palladium 62.5WG failed to provide any protection from switchgrass rust.
Nature of Work: A damaging rust disease on switchgrass (5), which caused by the fungus Puccinia emaculata, has been recently reported in feed stock plantings at multiple locations in Arkansas (2), Iowa (1), and Tennessee (6). Outbreaks of this disease in ornamental switchgrass plantings have also been reported in Illinois (3) as well as North Carolina and Tennessee (4). Jacobs and Terrell (3) also noted the detrimental impact of rust on the aesthetics of ornamental switchgrass selections. In 2010, extensive rust damage was noted in container-grown Cloud 9 ornamental switchgrass in southwest Alabama (Hagan, personal observation). Significant differences in the rust severity among ornamental switchgrass selections have been noted in recent trials in Illinois (3) and Tennessee (4). While the production and establishment of resistant selections is the preferred method of avoiding damaging rust outbreaks, fungicides may be required, particularly in a production nursery, to protect as well as maintain the quality of finished container stock. However, no information is available concerning the efficacy of fungicides for the control of rust on ornamental switchgrass. The report summarizes a project designed to assess the efficacy of a range of commercial fungicides for the control of rust on ornamental switchgrass.
The switchgrass cv ‘Dallas Blues’ was transplanted from #1 containers on 23 February 2010 into a Benndale sandy loam soil (≤ 1% organic material) at the Brewton Agricultural Research Unit (USDA Hardiness Zone 8a). Prior to planting, soil fertility and pH were adjusted according to the results of a soil fertility assay. A drip irrigation system was installed at planting and the plants were watered as needed. An application of 400 lb/A of 5-10-15 analysis fertilizer was made on 30 March. A randomized complete block design with six single-plant replications was used. Fungicide treatments were applied beginning on 2 June until 20 September at 2-week intervals to drip with a tractor mounted sprayer using a hand wand with a single flood- type nozzle. Rust intensity was visually rated on 16 September using a modified Florida 1 to 10 peanut leaf spot rating scale where 1 = no disease, 2 = very few lesions/pustules in canopy, 3 = few lesions/pustules noticed in canopy, 4 = some
Pathology Section 215
SNA Research Conference Vol. 56 2011
lesions/pustules in canopy and < 10% leaf death, 5 = lesions/pustules noticeable and < 25% leaf death, 6 = lesions/pustules numerous and < 50% leaf death, 7 = lesions/pustules very numerous and < 75% leaf death, 8 = numerous lesions/pustules on remaining green leaves and <90% leaf death, 9 = very few remaining green leaves covered with lesions/pustules and < 95% leaf death, and 10 = all leaves dead. Significance of treatment effects was tested by analysis of variance and Fisher’s protected least significant difference (LSD) test (P<0.05).
Results and Discussion: While monthly rainfall totals from June through October were often below to well below the historical average at the study location, temperatures during this same period were above average. Rust intensity was significantly lower on the Heritage 50WDG and Eagle 40W-treated plants where approximately 10% of the leaves succumbed to rust (Table 1). In contrast, disease ratings ranging from 6.3 to 7.0 for the other fungicide treatments and non-treated control indicate that 50% to 75% leaf mortality occurred. Daconil Ultrex-treated plants had higher rust ratings than those receiving 3336 4.5F and Medallion 50W but not Banner MAXX and Palladium 62.5WG. Finally, the non-treated control and all of the latter fungicide treatments had similarly high rust ratings.
In summary, Eagle 40W and Heritage 50WDG gave effective control of rust on switchgrass while Daconil Ultrex, 3336 4.5F, Medallion, Banner MAXX, and Palladium 62.5WG did not.
Literature Cited:
1. Gravert, C. E. and G. P. Munkvold. 2002. Fungi and diseases associated with cultivated switchgrass in Iowa. J. Iowa Acad. Sci. 109:30-34. 2. Hirsch, R. L., D. O. TeBeest, B. H. Bluhm, and C. P. West. 2010. First report of rust caused by Puccinia emaculata on switchgrass in Arkansas. Plant Dis. 94:381. 3. Jacobs, K. A. and C. I. Terrell. 2004. Evaluation of ornamental switch grass susceptibility to rust, 2003. Biological and Cultural Tests for the Control of Plant Diseases 19:O008. 4. Li, Y., M. Windham, R. Trigiano, A. Windham, B. Ownley, G. Gwinn, J. Zale, and J. Spiers. 2009. Rust diseases in ornamental grasses. Proc. Southern Nur. Assoc. Res, Conf. 54:81-82. 5. Parrish, D. J. and J. H. Fike. 2005. The biology and agronomy of switchgrass for biofuels. Critical Rev. in Plant Sci. 24:423-459. 6. Zale, J., L. Freshour, S. Agarwal, J. Sorochan, B. H. Ownley, K. D. Gwinn, and L. A. Castelbury. 2008. First report of rust on switchgrass (Panicum virgatum) caused by Puccinia emaculata in Tennessee. Plant Dis. 92:1710.
Pathology Section 216
SNA Research Conference Vol. 56 2011
Table 1. Rust intensity on ‘Dallas Blues’ switchgrass as impacted by fungicide treatments at the Brewton Agricultural Research Unit in 2010. Rust Fungicide and rate/100 gal Intensityz Non-treated Control 6.6 aby Daconil Ultrex 1.4 lb 7.0 a Heritage 50WDG 4 oz 4.0 c Banner MAXX 8 fl oz 6.5 ab Eagle 40W 8 oz 3.8 c 3336 4.5F 20 fl oz 6.3 b Medallion 50W 4 oz 6.3 b Palladium 62.5WG 6 oz 6.5 ab zRust intensity was rated on 16 September using a modified Florida 1 to 10 peanut leaf spot ratings scale. yMeans in each column that are followed by the same letter are not significantly different according to Fisher’s least significant difference (P<0.05) test.
Pathology Section 217
SNA Research Conference Vol. 56 2011
Perpetuation of Cherry Leaf spot Disease in Flowering Cherry
Jacqueline Joshua, Margaret T. Mmbaga and Lucas A. Mackasmiel
Tennessee State University Nursery Research Center, 472 Cadillac Lane, McMinnville, TN 37110
Significance to Industry Cherry leaf spot caused by the fungus Blumeriella jaapii is an important disease of sweet and sour cherries, it also affects other Prunus species and has been reported as a constraint in nursery production of flowering cherry trees. The pathogen has been reported to overwinter in leaf debris in the northern Great Lakes and the northwest regions of the US and other areas of the world where fruit cherry trees are grown. While fruit cherry are grown largely in cooler northern and northwest regions of the US, flowering cherry are widely grown in warmer southeastern region of the country. There are no previous studies to show the source of primary inoculum in spring for the southeastern region of US, so as to time fungicide sprays appropriately. This study was conducted to evaluate winter survival of the pathogen and assess the timing of infection establishment in relation to weather conditions in mid-Tennessee. Information from the study will be used to guide growers on the timing of fungicide sprays for effective control of the disease
Nature of Work Cherry leaf spot is caused by a fungus, Blumeriella jaapii L. (6). The disease causes premature defoliation, reduced shoot growth, increased susceptibility of trees to winter injury, and death in fruit trees (1,3). In flowering cherry, increased winter injury resulting in split bark, significantly reduced flowering and plant vigor, and reduced aesthetic value and marketability of infected trees have been associated with cherry leaf spot disease(7). Lower sales of infected trees and increased costs for disease management have recently become a constraint in nursery production system. Research studies on cherry leaf spot have focused on fruit cherries and spray programs have been developed to control this disease. However, these studies are based on cooler regions where sweet and sour cherries are important crops (6). The pathogen has been reported to overwinter in leaf debris (2,3,5); the fungus overwintering structures (ascocarps) formed in leaf debris release ascospores in spring as primary inoculum and infection gets established in early spring (1,5). The release of ascospores for primary inoculum depends on weather conditions particularly temperature and moisture. Due to the influence of weather conditions on spore release and infection establishment, fungicide spray programs based on weather conditions have been developed for controlling this disease on fruit cherries in the Northern Great Lakes regions United States. Favorable temperature of 17.2 to 22°C and rainfall allow the discharge of ascospores that initiate infection in early spring. Splash rain and wind spread the spores to other leaf surfaces where subsequent infections occur with a peak of spore dispersal in mid-May (5). The source of primary inoculum, availability of susceptible leaves and the timing of infection establishment in flowering cherry in warmer climates of the southeastern region have not been studied. Such information is needed to guide growers on the timing of fungicide applications for effective control of this disease.
Pathology Section 218
SNA Research Conference Vol. 56 2011
(a) Assessment of leaf debris as a source of primary inoculum. Airborne ascospores released from leaf debris of previously infected trees were assessed in a nursery field and at a landscape location where flowering cherry trees were severely infected with cherry leaf spot disease in the previous year. Sticky slides were prepared using water agar and Vaseline™ petroleum jelly and used as spore traps for airborne spores. These sticky slides were hung on flowering cherry tree branches using clothespins starting in March through May. A replication of six slides per field and three per landscape location with random selection of trees and location within tree canopy; two trees of wild flowering cherry at the border of the nursery were included. The slides were left for 7 days and replaced with new ones every 7 days. When spore trap slides were collected from the field, they were placed in a plastic container and covered for transportation to the laboratory where they were observed under a compound microscope. The presence of ascospores and conidiospores on the slides was noted and spores B. jaapii were identified using morphological features (8). Conidiospores were hyaline and filiform in shape, single-celled and some were septate ; ascospores were hyaline,1-2 celled ellipsoid to elongate in shape and narrower in the middle (7). Spores trapped and identified as B. jaapii were counted and recorded at 7 days intervals as spores per 21.6cm2 slide.
Weather conditions that prevailed in McMinnville, TN during this study were noted. Some leaf debris were collected from the field, and incubated in moist chamber for 48- 72 hours and spores that oozed out from the leaves were collected and observed under a compound microscope. Spores identified as B. jaapii on spore traps were compared with those harvested from leaf debris. Representative spores from the spore traps and from leaf debris were grown in Potato dextrose agar (PDA) and identified using morphological features.
(b) Assessment of dormant buds as a source of primary inoculum. Six cultivars of flowering cherry ‘Kwanzan’, ‘Yoshina’, ‘Okami’, ‘Snowgoose’, ‘Autumnalis’ and ‘Akebono’ that were previously infected with leaf spot disease in a nursery field were used in this study. Bare root plants were planted in Morton’s nursery mix in one gallon (3.75L) containers; in February 2010 and placed in a greenhouse controlled environment maintained at 28/20°C and 70 percent relative humidity. Plants were arranged in a randomized complete block design with a replication of four individual plants per cultivar. Plants were irrigated by sprinkler irrigation and fertilized using Nutricote Total™ 18-6-8 (N-P-K) at the rate of 12 g per plant. Development of disease symptom was monitored by the appearance of leaf spot and shot holes on leaf lamina. Two branches were randomly selected from each tree and used in counting the number of holes and brown spots. Progress of disease symptoms was recorded on a weekly basis starting early May when first symptoms were observed to end of August.
Results and Discussion Assessment of leaf debris as a source of primary inoculum. A large number of spores were trapped on trap slides starting March through June. Spores that matched those of B. jaapii ascospores and conidiospores were identified (Fig 1). The number of trapped spores of B.jaapii increased gradually starting March through April and declined at the end of April before it increased sharply in May to reach
Pathology Section 219
SNA Research Conference Vol. 56 2011
a peak in mid-May (Fig 2). Results from this study are in agreement with previous reports that Blumeriella jaapii overwinters in leaf debris and acts as the source of infection in early spring (8,4,5,and 3). By the time bud break occurred and trees were in full bloom in late March, ascospores were already in the air in field nursery. The number of airborne spores peaked in May when trees had abundant leaves for infection (Fig. 2). Weather in McMinnville had low rainfall in April and frequent rain showers in May (Fig 3) that coincided with low ascospore numbers in April and highest number of ascospores re in May (Fig 2). A large number of conidiospores were also trapped in mid-May coinciding with frequent May showers indicating that spores released in April had already caused infection and released secondary inoculum . First disease symptoms observed in early April were characterized by small circular purplish lesions that became red-brown in color with definite borders and later the necrotic centers dropped out and produced shot holes. The release of a large numbers of conidiospores in May indicated that infection that started sin April had released abundant secondary inoculum that was significantly more in numbers than ascospores (Figs 2-3).
Availability of both ascospores and conidiospores in May indicated that infection rate was high due to high inoculum efficiency. Reports from literature show that infection on fruit trees, starts in early spring and fungal fruiting bodies (apothecia and acervuli) are produced in overwintered leaves (5). The primary cycle of infection is initiated by ascospores discharged in the air during rainy periods, followed by production of conidiospores that causes secondary infection (3). Rainfall discharges ascospore for primary inoculum and spread them to healthy leaf surface where they establish infection. Optimal temperature for infection establishment is 17.2 to 22°C along with 100 percent humidity for approximately six to eight weeks normally beginning at petal fall (2). Lesions on the leaf surface occurs in 1-2 weeks of latent periods followed by production of abundant conidiospores that are spread to other leaves by splashing rain initiating secondary infections (3,5). In our studies, disease symptoms observed in early April must have been initiated in mid- to late March and this is in agreement with availability of primary inoculum in early March. A study in Hungary, also found the peak of spore production occurred in mid-May (5). Effective fungicides require timely applications. Results from this study showed that airborne spores were trapped before bud break, and first disease symptoms were observed in early April. Thus, for effective and economic control of cherry leaf spot in flowering cherry, spray program should start when petals start falling and new leaves start forming in early April.
Assessment of dormant buds as a source of primary inoculum. All the plants that were maintained under greenhouse conditions, free from leaf debris and airborne inoculums developed symptoms of cherry leaf spot i.e. brown spots, shot holes and some had yellowing of leaves. The first symptoms were observed on some plants in the first week of May (Fig. 4). There were significantly more brown spots than shot holes on the leaves with the highest being in August. This demonstrates the progression of the disease as brown spots dry and drop out, giving a “shot hole” appearance (3). However both brown spots and shot holes had their peak in August indicating the highest disease severity. Availability of moisture from the overhead irrigation administered twice a day could have facilitated the spread of the inoculums to other foliage. The leaves with
Pathology Section 220
SNA Research Conference Vol. 56 2011 more of either brown spots or shot holes tended to yellow out and abscise from the plant. The occurrence of symptoms on all the plants clearly shows that, dormant buds were the source of infection because the environment was free from leaf debris and airborne spores. Therefore, dormant buds constitute as a significant source of initial infection for Cherry leaf spot in mid-Tennessee and probably in the southeast where the disease occurs. It was also observed that the leaves attached directly to the bud on the main stem of the plant showed the first symptoms, followed by those further on the branch. This could mean that these may have been the previously infected buds where the fungus overwintered on the stem and spread. Some cultivars seemed to have more disease severity showing more susceptibility than others indicating that they were probably more severely infected and harbored more primary inoculum. ‘Snowgoose’ had highest infection while Kwanzan had the least infection. In conclusion, this study showed that leaf debris from previously infected plants and dormant buds were the main sources of initial infection for flowering cherry leaf spot in McMinnville, TN. Eliminating the source of primary inoculums that starts initial infection is important in controlling this disease. This can be achieved by eradicating or decreasing overwintered leaf debris and ensuring that all cuttings used are clean and free from infection. Efficacy of fungicides depends on the correct timing of spray program, thus fungicide application should commence early in the season during petal drop when leaf tissue start to appear. This will eliminate infection establishment. Strategic measures that are both preventative and curative are the most effective in controlling cherry leaf spot
Literature Cited 1 Babadoost, Mohammad.1995. Cherry leaf spot. Report on Plant Disease No.800 September 1999.University of Illinois Extension. 2 Eisensmith S.P and Jones A.L.1981.A Model for Detecting Infection Periods of Coccomyces hiemalis on Sour Cherry. Phytopathology 71: 728-732. 3 Ellis, A.M. 2008. Cherry leaf spot. Fact sheet agriculture and natural resources. Retrieved October 19, 2010. Ohio State University Extension. 4 Green, H., Bengtsson, M., Duval, X., Pedersen, L.H., Hockenhull, J., Larsen, J., 2006. Influence of urea on the cherry leaf spot pathogen, Blumeriella jaapii, and on microorganisms in decompositing cherry leaves. Soil Biology & Biochemistry.38:2731-2742.Holb, I.J (2009) Some Biological Features of Cherry Leaf Spot (Blumeriella jaapii) with special reference to cultivar susceptibility: International Journal of Horticulture Science, 15 Issue (1-2):91-93. 5 Holb, I.J (2009) Some Biological Features of Cherry Leaf Spot (Blumeriella jaapii) with special reference to cultivar susceptibility: International Journal of Horticulture Science, 15 Issue (1-2):91-93. 6 McManus P.S, Proffer T.J, Berardi R, Gruber, B.R, Nugent, J. E, Ehret, G.R, Ma, Z Sundin, G.W. (2007) : Integration of Copper-Based and Reduced-Risk Fungicides for Control of Blumeriella jaapii on Sour Cherry. Plant Dis.91:294-300 7 Mmbaga, M.T and Suave, R. 2010. Leaf spot disease on ornamental flowering cherry. Proceed. Southern Nursery Association Research Conference.55:29-33.
Pathology Section 221
SNA Research Conference Vol. 56 2011
8 Williamson, A.M and Bernard C.E. 1988. Life cycle of new species of Blumeriella (ascomycotina: dermateaceae), a leaf-spot pathogen of spirea.Can.J.Bot.66:2048- 2054
Fig.1. Conidiospores of the cherry leaf spot pathogen and characteristic leaf spot and shot hole symptoms on flowering cherry trees.
50.00
slide Conidiospores 45.00
per 40.00
35.00 Ascospores 30.00 spores 25.00 of
20.00 15.00 number
10.00 5.00
Mean 0.00
1 5 2 2 2 / 1 / ‐4/7 / ‐5 / ‐6 ‐4/17 ‐4 ‐4/28 ‐5 ‐5/19 ‐5/26 6 4 1 /2 3/30 4/7 /1 /2 4/28 5/5 5 4 4 5/12 5/19
Fig.2: Mean number of ascospores and conidiospores trapped from air by date.(Arrow shows date of infection).
Pathology Section 222
SNA Research Conference Vol. 56 2011
35
30
25
20
15
Temperature (C) 10 Max (c ) 5 Min (c )
0
30
25 Rainfall (cm) Rain Frequency 20
15
10 Rainfall (cm) Rainfall
5
0
l t. ri ne p u July A May J Sep March August 2010
Fig. 3: Average temperature and rainfall in McMinnville from March-September.
Pathology Section 223
SNA Research Conference Vol. 56 2011
Fig.4. Mean number of brown spots and shot holes in greenhouse plants by dates.
Pathology Section 224
SNA Research Conference Vol. 56 2011
Efficacy and Methods of Application of Biological Control Agents Against Powdery Mildew in Dogwood
L. A Mackasmiel and M. T.Mmbaga Tennessee State University, School of Agriculture and Consumer Science Otis Floyd Nursery Research Center, McMinnville, TN 37110
Index words: Powdery mildew, Cornus florida, Fungicides, Biological Control Agents, Dogwood, Resistance, Erysiphe pulchra
Significance to Industry: Powdery mildew caused by Oidium spp., [Erysiphe (Sect. Microsphaera) pulchra] cause stunted growth, defoliation, reduces the esthetic value of flowering dogwood (Cornus florida L.) and in some cases, a serious decline of infected plants (Chartfield and Rose, 1996; Smith, 1999; Mmbaga, 2000). Although fungicides are commonly used to control the disease (Windham, 1994), they are expensive, cause environmental hazards, pose health problems to human applicators, and may kill other non-target organisms. The use of biological control (biocontrol) agents (BCA) provides a safer, environmentally-friendly, and presumably less expensive method of controlling powdery mildew. By combining the use of BCA with user-friendly methods like resistant cultivars and cultural practices, it is possible that fungicide application may become unnecessary in controlling powdery mildew in dogwood. The success of using BCA will translate directly to growers’ profits by reducing costs associated with fungicides to control powdery mildew in dogwood nurseries.
Nature of Work: Flowering dogwood is native to southern region of the United States of America (USA), and common in most other parts of the nation, often used as an ornamental plant in residential and public areas. It is an important under-story species in forest areas where its nutritious seeds provide valuable food for birds and wildlife. This study utilizes microorganisms previously isolated from native plants in natural environment where fungicides have never been used. These microorganisms have high potential against powdery mildew (Mrema and Mmbaga, 2006; Mmbaga et al., 2007; Mmbaga and Sauvé, 2009). The study evaluates the effects of the individual microorganisms consisting of two bacteria (B17A and B17B); two fungi (F13 and F16); and two yeasts (Y4 and Y14), as BCAs of powdery mildew on dogwood. It compares BCA with a conventional fungicide, thiophanate methyl (Cleary’s 3336®) and the non- treated control, or water. Finally, the study tries to integrate utilization of BCA as a method of controlling powdery mildew in dogwood, along with other user-friendly methods, in order to increase the potential to reduce or eliminate reliance on conventional fungicides.
Materials and Methods: Seedlings of C. florida were grown in Morton’s Grow Mix™ #2, placed in one gallon containers and maintained in two environments, shadehouse under 65% shade cloth, and in the greenhouse. The plants were fertilized using fast acting Miracle-Gro™ water-soluble 18-24-16, at the rate of 18 g per 3780 mL (w/v) of
Pathology Section 225
SNA Research Conference Vol. 56 2011
fertilizer:distilled water, in early May followed by application of dry granules of controlled-release Nutricote Total™ 18-6-8 fertilizer at the rate of 12 g per pot.
Application of microbial BCA in the shadehouse was by spraying the foliage using two bacteria, two fungi and two yeast i.e. B17A, B17B, F13, F16, Y4, Y14 and water as control treatment. Inoculum concentration of 2 x 104 spores/propagules per ml was used for fungi and Yeast BCA, and 1 x 106 CFU per ml for bacteria and Yeast BCA. The fungicide was sprayed at the rate of 1 mL per 1280 mL (v/v) of fungicide:water. A spray interval of approx.12 days was followed starting in mid-May when first disease symptoms were observed, and continued throughout the growing season. Plants in the greenhouse were root-dipped in suspensions of fungi and bacteria BCA on newly germinated seeds before being planted. Two months after planting, they were root- drenched using 2 mL of inoculum or water control per plant. Previously, yeast did not appear to have endophytic potential hence they were not administered on roots and were excluded in the greenhouse experiment. Inoculation with powdery mildew was administered from air-borne spores of previously infected plants, placed randomly in the experiment area.
Disease severity readings (rating) to assess the relative effectiveness of each treatment on powdery mildew was based on a scale of 0-5 (0 = No infection; 1 = 1-10%; 2 = 11- 25%; 3 = 26-50%; 4 = 51-75% and 5 = 76-100%), and were used to score the foliage area showing disease symptoms. The readings were recorded from May to through early September.
Results and Discussion: From May to end of June, there were no noticeable disease symptoms. Disease intensity and severity increased rapidly starting mid-July, but high temperatures and humidity particularly for plants in the shadehouse affected disease progression, however, when the temperature declined to moderate levels, disease intensity increased correspondingly (Figures 1 and 2). Results from the shadehouse showed significant differences (p<0.0001) in symptom severity and intensity between treated plants and the control groups (Figures 1 and 2). Disease pressure was very high in greenhouse environment compared to shadehouse and increased to severe levels throughout the growing season. BCA-treated plants were less infected by powdery mildew compared to the water-treated (control), but were relatively inferior to the conventional fungicide (Figure 3). However, BCA-treated and fungicide-treated were not significantly different, but there was significant differences (p<0.0001) between fungicide-treated seedlings, BCA and the control group as the disease progressed in both sites.
Results from both the shadehouse and greenhouse experiments indicate that the Bacteria-based inocula were more effective than fungal BCA in the shadehouse foliar application, but the reverse was true in the greenhouse where BCA was applied on the roots (Figs 1-3). From these results, there is evidence that BCA were effective and that both methods of application (foliar sprays or root-treatment) were effective in reducing the severity of powdery mildew in dogwood, but more work is needed using genetically uniform plant material. Although the effects of genetic variations in plant material were
Pathology Section 226
SNA Research Conference Vol. 56 2011
not quantitated in this study, evidence of variability was observed when non-treated seedlings from R12, a previously selected powdery mildew resistant plant was compared with seedlings from R11, no.400, and no. 327 powdery susceptible mother plants (Fig. 4). These observations indicate a need to determine the combined effect of resistance and BCA as biological-based IPM for powdery mildew. There is also a need to determine the effectiveness of both BCA treatment methods in a similar environment.
Acknowledgements: The authors thank Terry Kirby, Terri Simmons Jackie Omega and Candace Stubblefield for their technical support during the season, and USDA for funding the project.
Literature Cited: 1. Chartfield, J.A., Rose, MA., 1996. Ornamental Plants Annual Report and Research Summaries. Ohio State University Special Circular No. 152. 2. Mmbaga, M.T., 2000. Winter survival and source of primary inoculum for powdery mildew of dogwood in Tennessee. Plant Dis. 84:574-579. 3. Mrema, F.A., Mmbaga, M.T., 2006. Biological control of powdery mildew of dogwood. Southern Nursery Association (SNA) 50: 256-259. 4. Mmbaga, M.T., Sauvé, R.J., Mrema, F.A., 2007. Identification of microorganisms for biological control of powdery mildew in Cornus florida. Biological Control 44: 67- 72. 5. Mmbaga, M.T., Sauvé, R.J., 2009. Epiphytic microbial communities on foliage of fungicide treated and non-treated flowering dogwoods. Biological control 49 (2): 97-104. 6. Smith, V.L., 1999. First report of powdery mildew on Cornus florida in Connecticut caused by Microshaera pulchra. Plant Disease 83, 782. 7. Windham, A. S., 1994. Disease management of woody ornamentals in nurseries and commercial landscapes. Univ. Tenn. Agric. Ext. Serv. PB 1234.
Pathology Section 227
SNA Research Conference Vol. 56 2011
Figure 1: Disease rating of dogwood cultivar 295 sprayed with biological control agents (F13, F16, B17A, B17B, Y4 and Y14), and the non-treated control (CTRL) in shadehouse environment in 2010.
Figure 2: Disease rating of dogwood cultivar R12 spray-treated with biological control agents (F13, F16, B17A, B17B, Y4 and Y14), and the non-treated control (CTRL) in shadehouse environment 2010.
Pathology Section 228
SNA Research Conference Vol. 56 2011
Figure 3: Trends in disease rating of dogwood seedlings root-treated with biological control agents (F13, F16, B17A, and B17B), non-treated and fungicide-treated controls. in the greenhouse environment.
Figure 4: Dogwood seedlings from different maternal parents (R11, R12, 327, and 400) that that differ in their inherent susceptibility to powdery mildew show differences in disease progress in the greenhouse environment.
Pathology Section 229
SNA Research Conference Vol. 56 2011
Spatial Analysis of Phytophthora Diseases in Nursery Production System in Warren County, TN
Katherine Kilbourne, Margaret Mmbaga and Robert Harrison Tennessee State University, School of Agriculture and Consumer Sciences Department of Agricultural Sciences, Nashville, TN
Key Words: Phytophthora, Risk, Nurseries, GIS
Significance to the Industry There are 108 species of Phytophthora (1), many causing a variety of devastating disease epidemics worldwide. Unfortunately, many of the high value ornamental trees, shrubs and native plants grown in Tennessee are highly susceptible to a variety of Phytophthora species. Within nurseries, the best method of disease management and prevention is early detection. However, continually monitoring by sampling is impractical. Technologies such as remote sensing, global positioning system (GPS), and Geospatial Information Systems (GIS) provide a practical and precise approach to determining areas of disease occurrence and prevalence. These technologies have given researchers an easier method of tracking and monitoring the spread of plant diseases. Such tools, like GIS, allow researchers to create models that identify areas of disease risk based on environmental variables unique to a pathogen’s reproduction requirements, and availability of susceptible host species. Creating a small scale, more detailed map for nurseries most at risk will allow growers to be aware of a Phytophthora risk in their area. The significance of this project is to provide information that will facilitate the management of Phytophthora diseases.
Nature of work Phytophthora epidemics are ecologically and economically disastrous, especially to the nursery and timber industry. Surviving economic losses as were experienced from P. ramorum in Oregon and California (2) or P. cinnamomi in the Jarrah forest of Australia (3) requires a strong economic base and financial capabilities. Ornamentals constitute an important component of rural economies such as Warren County, Tennessee, but most growers would not survive quarantine restrictions from Phytophthora outbreaks as experienced from P. ramorum. Many of the high value ornamental trees, shrubs and native plants grown in Tennessee are highly susceptible to a variety of Phytophthora species causing leaf blights, root rots, and cankers. In order to better predict where these Phytophthora diseases may occur, a Phytophthora risk map for Warren County has been created. A GIS allows a computer to easily store, manipulate, and display geographically reference data (4). This tool allows researchers to create models that portray areas of disease risk based on environmental variables unique to a pathogen’s reproduction requirements, which constitute a favorable environment and availability of susceptible host species. Models use the determined parameters to extrapolate the areas of suitable environment (5). This may allow for better management practices which may ultimately increase revenue for growers.
The model was based on present environmental conditions including host vegetation, soil texture, elevation, and proximity to roads. Climate conditions, including monthly average temperatures, precipitation, and relative humidity, were the non-spatial
Pathology Section 230
SNA Research Conference Vol. 56 2011
parameters that play an important role in a Phytophthora’s reproductive capabilities. These parameters were determined by their known influence on Phytophthora dispersal and occurrence and have been used in similar models. To create the disease model, climate data for Warren County was accessed from the National Climate Data Center (6). Land cover vegetation was accessed from the Southeast Gap Analysis Project (7). Elevation, roads, and soil data sets were from the Tennessee Spatial Data Server (8). Environmental variables are ranked by their influence on Phytophthora distribution and weighted by their importance. Each variable combination at a particular locale receives a score based on its weighted rank. To determine the accuracy of the model, samples of soil, plant roots and leaves and irrigation water were collected from nurseries and analyzed for Phytophthora in the lab using standard techniques for Phytophthora isolation and identification (7,9).
Results and Discussion The analysis of the climate data determined suitable months for Phytophthora reproduction and infection establishment in Warren County, TN. These are May, June, September, and October. During November through April temperature average to low for Phytophthora spores to germinate, however the spore may survive dormant in the soil. In January and February temperatures reach lows that kill the dormant pathogen in the soil. In July and August, the dry and high temperature conditions are unfavorable for Phytophthora reproduction and dispersal.
Risk was rated from no risk, low risk, to very high risk based on each individual parameter presented in Figs. 1- 4. A combination of all parameters and weighted ranks provided a final score presented in Table 1 and Fig. 5. Analysis of the accuracy of the model is characterized in Table 1. This model is a strong indicator of the potential for disease epidemics caused by Phytophthora species. Most nurseries fall in the moderate risk areas, but surrounding fields around production areas may be in the higher risk areas and potential spread of Phytophthora via water flow may increase the risk. Phytophthora data included for this article is from a three year survey of Southern Middle Tennessee; however, this study only includes data from Warren County in which 41 Phytophthora isolates of 9 different species were recovered from 9 nurseries. The inclusion of all areas in Mid Tennessee will provide a more complete picture of Phytophthora risk in nursery production systems.
References 1. Phytophthora Database. 2010. Available at http://www.phytophthoradb.org/species.php. (Verified 6 Oct. 2010). Phytophthora Database. Penn State, University Park, PA. 2. Meentemeyer, R., D. Rizzo, W. Mark, and E. Lotz. 2004. Mapping the risk of establishment and spread of sudden oak death in California. Forest Ecology and Management. 200:195-214. 3. Hansen, E. M. 2008. Alien forest pathogens: Phytophthora species are changing world forests. Boreal Env. Res. 13:33-41. 4. Nelson, M. R., T. V. Orum, and R. Jaime-Garcia. 1999. Applications of geographic information systems and geostatistics in plant disease epidemiology and management. Plant Disease 83:308-319.
Pathology Section 231
SNA Research Conference Vol. 56 2011
5. Guo, Q., M. Kelly, and C. Graham. 2005. Support vector machines for predicting distribution of Sudden Oak Death in California. Ecological Modeling 182:75-90. 6. NOAA Satellite and Information Service. (2010) Available at http://www1.ncdc.noaa.gov/pub/orders/BE3CB5E7-7C41-429C-8102- A6F527315E04-wxc3.pdf. (Verified 2 Nov 2010). NCDC. Asheville, NC 7. SEGAP GEO Data Server. (2009) Available at http://www.basic.ncsu.edu/segap/. (verified 2 Nov 2010) Southeast Gap Analysis Project. NC State University. Raleigh, NC 8. Tennessee Spatial Data Server. Available at http://www.tngis.org/data.html. Tennessee Federal GIS Users Group. (2 Nov 2010) Nashville, TN 9. Donahoo, R., and K. Lamour. 2008. Characterization of Phytophthora species from leaves of nursery woody ornamentals in Tennessee. HortScience 43:1833-1837.
Table 1. Phytophthora risk levels in nursery production systems in Warren County. Very High Moderate Low Very None High (25- (20-16) (15- Low ( < 5) ( > 26) 21) 11) (10-6) Final Score of Overlaid 30-26 25-21 20-16 15-11 10-6 5-4 Parameters Percent of Nurseries in each 1.3% 1.3% 94.8% 0% 0% 2.6% risk area Nurseries with a Phytophthora 0 1 8 0 0 0 Occurrence in each risk area
Pathology Section 232
SNA Research Conference Vol. 56 2011
Pathology Section 233
SNA Research Conference Vol. 56 2011
Figs 1-5. Risk analysis rating for Phytophthora disease occurrence based on individual risk parameters: proximity to roads(1), soil (2), vegetation (3), elevation (4) and a combination of all parameters overlaid and weighted ranks (5) with risk levels color coded starting with no risk (white) low risk (green color) to very high risk (red).
Pathology Section 234
SNA Research Conference Vol. 56 2011
Container Grown Plant Production
Derald Harp Section Editor and Moderator
Container Grown Plants 235
SNA Research Conference Vol. 56 2011
Cedar Substrate Particle Size Affects Growth of Container-Grown Rudbekia
Zachariah Starr, Cheryl Boyer, Jason Griffin Kansas State University, Department of Horticulture, Forestry and Recreation Resources, Manhattan, KS 66506
Index Words: alternative substrates, container media, eastern redcedar, nursery crops, pine bark, Rudbeckia fulgida
Significance to Industry: This study evaluated the growth of a perennial crop, Rudbeckia fulgida var. fulgida (L.) (black-eyed susan), in five substrates consisting of either pine bark (PB) or cedar (Juniperus virginiana L.) chips ground to pass a 3/16-, 3/8-, 1/2-, or 3/4-inch screen. As substrate particle size increased shoot dry weight decreased though plant growth indices was generally similar and most plants were marketable. Substrate EC did not vary between treatments at any rating date while pH varied at each rating date until termination at which time pH of all treatments pHs had reached a similar level. These results indicate that J. virginiana chips can be used as a substrate for container-grown Rubeckia when processed at all 4 screen sizes, but performed best at 3/16-inch screen size.
Nature of Work: Pine bark is the typical material used for nursery production of container-grown plants throughout the much of U.S. (11). With the closing and relocation of timber mills and use of PB as an alternative energy source for those mills, PB is becoming less available and more costly to purchase (4, 6). Regions without large pine forests, such as the Great Plains, experience a compounded price increase due to transportation costs for nursery substrates. This has lead to a demand for alternative substrates to supplement or replace PB supplies. Eastern redcedar (J. virginiana) is endemic to the Great Plains and has spread rapidly due to reduced natural controls (community development resulting in less natural fires). In addition, its use in windbreaks and for wildlife cover has resulted in an increased seed population which has lead to an eastern redcedar population boom (2, 8). This large eastern redcedar population has negative affects on the native grasslands of the Great Plains by altering species composition (species richness, forb cover, and grass cover), soil moisture, blocking incoming solar radiation, decreasing soil temperature and alterations to litter dynamics (5, 3). As loss of native grasslands increases, less forage area for livestock is available which increases handling costs for the livestock industry (7). Utilization of eastern redcedar whole tree chips as a substrate component could alleviate PB demand in the Great Plains with a sustainable, local resource that improves the grassland ecosystem by reducing unwanted eastern redcedar populations. Previous work showed that eastern redcedar chips milled to pass a 3/4-inch screen can function as a substrate for Taxodium distichum (L.) Rich. (baldcypress) but worked best as an amendment to a PB mix (9). Plants grown in substrates that contained 80% eastern redcedar chips and 20% sand had reduced container capacity due to elevated air-space when compared to other mixes containing both PB, cedar, and sand or PB and sand (9). The purpose of
Container Grown Plants 236
SNA Research Conference Vol. 56 2011 this investigation was to determine at what particle size, if any, cedar can be used to produce a container-grown perennial crop, Rudbeckia fulgida var. fulgida (L.), comparable to plants grown in PB.
Juniperus virginiana chips (cedar) (Queal Enterprises. Pratt, KS) from whole trees harvested in Barber County, KS (aged for six months) were ground in a hammer mill (C.S. Bell Co., Tiffin, OH, Model 30HMBL) to pass a 3/16-, 3/8-, 1/2-,or 3/4-inch (4.76 mm, 9.53 mm, 12.70 mm, 19.05 mm) screen on April 28th 2010. The cedar and a PB (SunGro, Bellevue, WA) control were then blended with sand to make a series of five 80% wood : 20% sand (by vol.) substrate mixes. Substrates were pre-plant incorporated with 2 lbs/yd3 (1.17 kg/m2) micronutrient package (Scotts, Micromax, Marysville, OH) and controlled release fertilizer at a medium rate of 14.5 lbs/yd3 (8.60 kg/m2) (Scott’s, Osmocote Classic , 18-6-12, 8 to 9 month release, Marysville, OH). Two-gallon (8.7 L) containers were then filled and planted with liners (one per container from a 72 cell pack) of Rudbeckia fulgida var. fulgida L (Creek Hill Nursery, Leola, PA.). Containers were placed on an outdoor gravel container pad and irrigated daily via overhead sprinklers supplying approx. 1-in. of precipitation daily. Data collection began on May 13th, 16 days after planting (DAP), and continued once every 4 weeks (43 DAP, 71 DAP) until termination on August 11 (106 DAP). Data collected included pH and electrical conductivity (EC) using the PourThru technique (10), leaf greenness as measured with a SPAD meter, and growth indices [(widest width + perpendicular width + height) ÷ 3] at 16, 43, 71, and 106 DAP. Shoot dry weight was recorded at the conclusion of the study (106 DAP) by drying in a forced air oven (The Grieve Co. Model SC-400, Round Lake, IL) at 160oF (71.11 °C) for 7 days. Substrate physical properties were determined using North Carolina State University porometers (Raleigh, NC) which measured substrate air space, water holding capacity, substrate bulk density, and total porosity (1). Data were analyzed using SAS (Version 9.1 SAS Institute Inc. Cary, NC) The experimental design was a randomized complete block with a factorial arrangement of treatments and eight single plant replications.
Results: All cedar-based substrate pH were similar to each other at 16 and 43 DAP, and higher than the PB substrate (Table 1). Greater variation occurred at 71 DAP with pH of PB remaining low compared to cedar substrates, while 3/4-inch cedar had the highest pH. There were no significant differences in pH between treatments at the conclusion of the study106 DAP. Irrigation water pH averaged 7.52. There were no significant differences between substrate EC in any treatment at all measurement dates (Table 1).
Growth indices of Rudbeckia fulgida var. fulgida at 106 DAP varied by substrate with plants growing in PB and 3/16-inch cedar producing the largest plants and 1/2-inch cedar producing the smallest plants (Table 2). Growth of plants in substrates containing 3/4-and 3/8-inch cedar were similar to all other treatments. Dry weight of the shoot tissues varied greatly between treatments. Plants grown in PB had the greatest shoot dry weight with 3/16 and 3/8-inch cedar producing similar mass to PB. Substrates containing 1/2- and 3/4-inch cedar produced less mass but were statistically similar to
Container Grown Plants 237
SNA Research Conference Vol. 56 2011
3/16 and 3/8-inch cedar (Table 2). Leaf greenness, measured with a SPAD meter on four recently matured leaves, initially varied at 16 DAP but there were no significant differences between substrates thereafter (data not shown).
Generally, as cedar particle size increased container capacity decreased with increasing air space as shown in the previous study (11). Correspondingly, shoot dry weight and growth indices decreased in a similar manner. Pine bark, which had the greatest container capacity and least air space produced plants with the greatest shoot dry weight and growth indices. Container capacity of both 1/2- and 3/4- inch cedar was outside the recommended range of 45% to 65%. Similarly, airspace of 1/2- and 3/4- inch cedar was also outside the recommended range of 10 – 30%. However, container capacity and air space of 3/8-inch cedar was close to the recommended ranges. Interestingly, PB also fell outside of the recommended ranges for container capacity and air space. However, 3/16-inch cedar substrate was within recommended ranges for both container capacity and air space and had the second greatest growth and shoot dry weight after plants grown in PB. Pine bark had greater bulk density and total porosity than all cedar treatments, which were similar regardless of processed screen size (11) (Table 3).
Despite not performing quite as well as PB, 3/16 and 3/8-cedar could be a viable substrate for Rudbeckia fulgida var. fulgida. The savings on substrate materials could make up for slightly less plant growth. Additionally, the decreased bulk density of cedar could decrease the cost of shipping finished products while smaller plant size might also allow for more plants to be shipped per load. Despite less growth, most plants were in marketable condition at the conclusion of the study (3 months). All cedar treatment plants were root bound to the container and plants grown in PB had the upper half of the container densely populated with roots (data not shown). Future studies could involve evaluating root growth of perennial crops grown in cedar-based substrates, alterations to cedar substrate pH, and mixing substrate particle sizes. This is encouraging for Plains states growers as they look for new sources of nursery substrate materials. Additionally property owners with large cedar populations could earn income from harvest and sale of eastern redcedar trees to horticultural industries.
Literature cited: 1. Fonteno, W.C. and T.E. Bilderback. 1993. Impact of hydrogel on physical properties of coarse-structured horticultural substrates. J. Amer. Soc. Hort Sci. 118: 217-222. 2. Ganguli, A.C., D.M. Engle, P.M. Mayer, and E.C. Hellgren. 2008. Plant community diversity and composition provide little resistance to Juniperus encroachment. Botany 86: 1416-1426. 3. Gehring, J.L. and Bragg, T.B. 1992. Changes in prairie vegetation under eastern red cedar (Juniperus virginiana L.) in an eastern Nebraska Bluestem prairie. The American Midland Naturalist. 128(2): 209-217. 4. Griffin, J.J. 2009. Eastern red-cedar (Juniperus virginiana) as a substrate component for container production of woody plants. HortSci. 44:1131.
Container Grown Plants 238
SNA Research Conference Vol. 56 2011
5. Linneman J.S. and M.W. Palmer. 2006. The effect of Juniperus virginiana on plant species composition in an Oklahoma grassland. Community Ecology 7(2): 235-244. 6. Lu, W., J.L. Sibley, G.H. Gilliam, J.S. Bannon, and Y. Zhang. 2006. Estimation of U.S. bark generation and implications for horticulture industries. J. Environ. Hort. 24: 29-34. 7. Ortmann, J., J. Stubbendieck, R.A. Masters, G.H. Pfeiffer, and T.B. Bragg. 1998. Efficacy and costs of controlling eastern redcedar. J. of Range Mgmt. 51: 158- 162. 8. Owensby C.E., K.R. Blan, B.J. Eaton, and O.G. Russ. 1973. Evaluation of Eastern redcedar infestations in the Northern Kansas Flint Hills. J. of Range Mgmt. 26: 256-259. 9. Starr, Z., C. Boyer, and J. Griffin. 2010. Growth of containerized Taxodium distichum in a cedar-amended substrate. Proc. Southern Nurs. Assoc. Res. Conf. (In Press) 10. Wright, R.D. 1986. The pour-thru nutrient extraction procedure. HortSci. 21: 227- 229. 11. Yeager T. (editor). 2007. Best management practices: Guide for producing nursery crops. 2nd ed. The Southern Nursery Association, Atlanta, GA.
Table 1. pH and EC of cedar- and PB-based substrates. 16 DAPz 43 DAP 71 DAP 106 DAP
EC Substrates pH (µS/cm) pH EC pH EC pH EC 6.02 0.96 6.80 1.09 Pine Bark 1.16 a 6.06 b 0.64 a 6.28 c by a a a 3/16- inch 0.73 6.84 1.26 6.88 a 1.10 a 7.28 a 0.83 a 6.80 b cedar a a a 7.21 1.00 7.03 1.31 3/8-inch cedar 6.94 a 1.02 a 7.18 a 0.67 a ab a a a 0.96 6.95 1.37 1/2-inch cedar 6.92 a 1.02 a 7.24 a 0.75 a 7.04 ab a a a 0.94 7.22 1.30 3/4-inch cedar 7.05 a 1.01 a 7.39 a 0.64 a 7.34 a a a a zDays after planting yMeans within column followed by the same letter are not significantly different based on Waller-Duncan k ratio t tests (α = 0.05, n = 4).
Container Grown Plants 239
SNA Research Conference Vol. 56 2011
Table 2. Growth and shoot dry weight of Rudbeckia fulgida in cedar- and PB- based substrates. Growth index Shoot dry weight Substrate (cm)z (g)y Pine Bark 49.42 ax 70.70a 3/16- inch 49.67 a 65.18ab cedar 3/8-inch cedar 44.71 ab 60.16ab 1/2-inch cedar 41.00 b 52.31b 3/4-inch cedar 46.75 ab 54.94b z Growth Index = (Height + width + perpendicular width)÷ 3 (1cm = 0.397 inch) yShoots were harvested at the container surface and oven dried at 160oF (71.11 °C) for 7 days (1 g = 0.0035 oz.). xMeans within column followed by the same letter are not significantly different based on Waller-Duncan k ratio t tests (α = 0.05, n = 8).
Table 3. Physical properties of cedar- and PB-based substratesz. Contain Total er Air porosity capacity space Bulk y x w density (g.cm- Substrates (% Vol) 3)v 4.70 Pine Bark 73.5 au 68.83 a 0.52 a e 3/16- inch 20.17 70.23 b 50.07 b 0.45 b cedar d 29.93 3/8-inch cedar 70.07 b 40.10 c 0.46 b c 33.87 1/2-inch cedar 69.97 b 35.17 d 0.45 b b 40.10 3/4-inch cedar 69.00 b 29.90 e 0.47 b a zAnalysis performed using the North Carolina State University porometer. yTotal porosity is container capacity + air space. xContainer capacity is (wet wt - oven dry wt) / volume of the sample. wAir space is volume of water drained from the sample / volume of the sample. vBulk density after forced-air drying at 105°C (221.0 °F) for 48 h (1 g · cm-3 = 62.4274 lb/ft3). uMeans within column followed by the same letter are not significantly different based on Waller-Duncan k ratio t tests (α = 0.05, n = 3).
Container Grown Plants 240
SNA Research Conference Vol. 56 2011
Cotton Amended Substrates: Wrinkle Free?
Elizabeth D. Bridges, Helen T. Kraus, Brian E. Jackson, and Ted E. Bilderback Department of Horticultural Science North Carolina State University, Raleigh, NC 27695-7609
Index Words: substrate, cotton stalks, cotton gin, azalea, juniper
Significance to Industry: Alternative substrates that replace pine bark (PB) completely or partially are needed as (PB) supplies are running short in some areas of the country and prices are increasing. Cotton stalks (CS) and cotton gin trash (CGT) are plentiful waste products of the cotton industry and have shown promise as substrate amendments. Substrates constructed from whole pine trees (PTS) have also shown promise as substrates. However, these cotton wastes have not been evaluated when mixed with pine tree based substrates. Shoot and root growth of azalea and juniper were greatest with PB amended with CGT and smallest with PTS amended with CGT. Substrate bases of PB and PTS blended with composted CS either with or without an additional Nitrogen (N) source produced similar shoot and root growth in both azalea and juniper.
Nature of Work: The nursery industry in the southeast relies very heavily on PB as a substrate. PB is desirable because it is light in weight, well-drained, pathogen-free and disease suppressive. PB has been available as a waste product of the lumber industry; however, current forestry harvesting practices now recommend shredding the bark and small branches of pine trees after harvest and spreading these organic resources on the soil of the land where the trees were harvested. The 2008 Farm Bill included a component known as Biomass Crop Assistance Program (BCAP). This bill assists agricultural and forest land owners and operators in beginning an establishment and producing eligible crops that can be utilized as alternative fuel sources (1). The changes in the forestry industry and BCAP have led to a reduction in the availability of PB and an increase in price and now threaten the availability of the southeastern nursery industry’s growing substrate. The need for alternative substrates is becoming critical.
Composted CS and composted CGT mixed with PB have shown promise as alternative substrates (2, 3). Cotton is very abundant in the southeast, comprising 2% of NC’s 9.7 billion dollar farm cash receipts and could be easily accessible to containerized plant growers (5). The objective of this experiment was to evaluate the growth of two woody plant species that have susceptibility to Phytophthora in six compost amended, PB based or PT based substrates grown under drip irrigation. This project is part of a larger goal to provide the nursery industry in the southeast with regionally available alternative potting substrates that will keep the industry competitive and continue demand for their products in the competitive nursery industry.
Container Grown Plants 241
SNA Research Conference Vol. 56 2011
Rhododendron obtusum ‘Sunglow’ and Juniperus conferta ‘Blue Pacific’ were potted on May 7th, 2010 into 3 quart (2.8 L) black plastic containers filled with either PB or PT based substrates that had been amended (v/v) with cotton stalks composted without a N source (CS), cotton stalks composted with a N source (Daddy Pete’s Plant Pleaser, 0.5-0.5-0.5, Stony Point, NC) (CS+N), or cotton gin trash (CGT). The pine tree substrate base was produced from freshly harvested loblolly pine trees (Pinus taeda) that were delimbed, chipped, and ground in a hammer mill through a ¾ inch screen. A factorial treatment arrangement of these substrate bases (PB and PT) and amendments (CS, CS+N, and CGT) resulted in six substrates: 4:1 PB : CS (PBCS), 4:1 PB : CS+N (PBCS+N), 9:1PB : CGT (PBCGT), 1:1 PT : CS (PTCS), 1:1 PT : CS+N (PTCS+N), and 1:1 PT : CGT (PTCGT) arranged in a RCBD. Additions of CS, CS+N, and CGT were made to PB or PT to achieve similar water holding capacities. Total porosity (TP) (93- 86%), airspace (AS) (39-26%), container capacity (CC) (61-54%), available water (AW) (25-21%), unavailable water (UW) (39-27%) and bulk density (BD) (0.26-0.12 g/cc3) of all six substrates were all within acceptable ranges for nursery crop production (10). An industry control of 100 % PB substrate (TP = 88%, AS = 32%, CC = 56%, AW = 16%, UW = 39%, BD = 0.23 g/cc3) was included in the experimental design for comparisons. All substrates were amended with 3.0 lbs/yd3 (1.4 kg.m3) dolomitic lime at mixing. On May 17th, PB-based substrates and the 100% PB control were topdressed with 2.6 g N [15 g (0.52 oz) fertilizer] and PT-based substrates were topdressed with 3.4 g N [20 g ( 0.71 oz) fertilizer] supplied by a polymer-coated, slow release fertilizer, 17-5-10 (17N- 2.2P-0.83K) (Harrell’s, Sylacauga, AL). Higher fertilizer rates were used in the PT treatments based on previously published work indicating the fertilizer rates needed to be increased for PT-grown plants (1). Irrigation was applied by a low volume spray stake (PC Spray Stake, Netafim, Ltd., Tel Aviv, Israel) that delivered 3.2 GPH. Irrigation volume was managed to maintain a 0.2 leaching fraction (volume of leached / volume of applied) for each of the six substrates and the 100% PB control. Leaching fractions were measured from each substrate every two weeks and irrigation volume was adjusted accordingly. Additionally, substrate solution was collected every two weeks using the pour-through nutrient extraction method (9) and used to determine electrical conductivity (EC) and pH using a Hanna pH/EC meter (HI 8424, Hannah Instruments, Ann Arbor, MI). On August 26, plants were separated into shoots and roots. Roots of juniper only were washed to remove substrate. All plant parts were dried to a constant weight at 62°C. All variables were tested for differences using analysis of variance procedures and lsd means separation procedures (p >0.05) where appropriate (SAS, 2001).
Results and Discussion: The species by substrate interaction was insignificant for shoot growth so the main effects of substrate and species will be discussed (data not presented). Shoot growth was not different between species (data not presented) while substrate did affect shoot growth (Fig. 1). Shoot growth was greatest with PBCGT (Fig. 1). Jackson (2) also reported similar or greater growth indices for ‘Winter Gem’ boxwood, ‘Firepower’ dwarf nandina, ‘Midnight Flare’ azalea, and ‘Renee Mitchell’ azalea grown in CGT amended substrates. There were no differences between shoot growth with PBCS+N, PB, PTCS, and PTCS+N (Fig. 1).
Container Grown Plants 242
SNA Research Conference Vol. 56 2011
Warren et al., (8) reported increased growth of ‘Skogholm’ cotoneaster as composted CS additions to a PB based substrate increased from 0 to 45%. In our study, we amended a PT based substrate with 50% composted CS and a PB based substrate with 20% composted CS and found no differences in shoot growth of azalea or juniper (Fig. 1). PTCGT produced the smallest shoot growth. Composted cotton burrs resulted in smaller poinsettia plants (shorter, more narrow, smaller inflorescence, and less dry weight) than poinsettia grown with a 1:1 (v/v) peat moss : PB substrate (7).
Substrate affected root growth of juniper (Fig. 2). Root growth was also greatest with PBCGT and least with PTCGT and PBCS+N. Several researchers have reported similar or enhanced root growth of ‘Blitz tomato, weeping fig, ‘Hot Country’ lantana, and croton when grown in substrates amended with cotton gin compost (4, 5) Root growth with PB, PBCS, PTCS, and PTCS+N was not different (Fig. 2).
Since physical properties of all six substrates in this study were within acceptable ranges (see materials and methods), growth reductions in the PTCGT substrate were most likely due to elevated EC levels due to the nutrients in CGT (4) and higher fertilizer additions to the PT-based substrates. Statistical analysis for EC, pH and substrate solution nutrient levels have not been completed as of submission of this paper; however, the 20% addition of CGT to PT in the PTCGT substrate averaged a 2x EC level (0.8 dS.m-1) compared to the 10% addition of CG to PB in the PBCG substrate (EC averaged 0.4 dS.m-1). Several other researchers have reported higher EC levels in substrates amended with cotton stalks (8) cotton gin (2, 3, 4) and cotton burrs (7).
Literature Cited: (1) Department of Agriculture: Biomass Crop Assistance Program. http://www.fsa.usda.gov/Internet/FSA_Federal_Notices/bcap_prm_2_8_2010.pdf Accessed October, 2010. (2) Jackson, Brian E., Amy N. Wright, David M. Cole, and Jeff L. Sibley. 2005a. Cotton Gin Compost as a Substrate Component in Container Production of Nursery Crops. J. Environ. Hort. 23(3):118 -122. (3) Jackson, Brian E., Amy N. Wright, Jeff L. Sibley, and Joseph M. Kemble. 2005b Root Growth of Three Horticultural Crops Grown in Pine Bark Amended Cotton Gin Compost. J. Environ. Hort. 23(3):133-137. (4) Papafotiou, Maria, Barbara Avajianneli, Costas Michos, and Iordanis Chatzipavlidis. 2007. Coloration, Anthocyanin Concentration, and Growth of Croton (Codiaeum variegatum L.) as Affected by Cotton Gin Trash Compost Use in the Potting Medium. HortScience 42(1):83-87. (5) NC Department of Agriculture & Consumer Services. Agricultural Statistics – 2009 Annual Statistics Book. http://www.ncagr.gov/stats/2009AgStat/index.htm Accessed October, 2010. (6) SAS Institute, Inc. 2001. SAS/STAT User’s Guide: Release 8.2 Edition, SAS Inst., Inc,.Cary, NC. (7) Wang, Yin-Tung and Thomas M. Blessington. 1990. Growth and Interior Performance of Poinsettia in Media Containing Composted Cotton Burrs. HortScience 25(4):407-408.
Container Grown Plants 243
SNA Research Conference Vol. 56 2011
(8) Warren, S.L., T.E. Bilderback and J.S. Owen, Jr. 2007. Growing media for the nursery industry:Use of amendments in traditional bark-based media. Acta.Hort. 819: 143-155. (9) Wright, R.D. 1986. The Pour-through Nutrient Extraction Procedure. HortScience 40:1513-1515. (10) Yeager, Tom, Ted Bilderback, Donna Fare, Charles Gilliam, John Lea-Cox, Alex Niemiera, John Ruter, Ken Tilt, Stuart Warren, Ted Whitwell, and Robert Wright. 2007. Best Management Practices: Guide for Producing Container-Grown Crops Version 2. Southern Nursery Association, Atlanta, GA.
Figure 1. Effect of substrate on juniper and azalea shoot growth. The substrate x species interaction was nonsignificant. Means between substrates with different letters are significantly different from each other based on lsd mean separation procedures (p>0.05). The substrates consisted of; 4:1 PB : CS (PBCS), 4:1 PB : CS+N (PBCS+N), 9:1PB : CGT (PBCGT), 1:1 PT : CS (PTCS), 1:1 PT : CS+N (PTCS+N), and 1:1 PT : CGT (PTCGT). CS = composted cotton stalks, CS+N = composted cotton stalks with an nitrogen source added during composting, and CGT = aged cotton gin trash.
Container Grown Plants 244
SNA Research Conference Vol. 56 2011
Figure 2. Effect of substrate on juniper root growth. Root dry weight was not determined for azalea. Means between substrates with different letters are significantly different from each other based on lsd mean separation procedures (p>0.05). The substrates consisted of: 4:1 PB : CS (PBCS), 4:1 PB : CS+N (PBCS+N), 9:1PB : CGT (PBCGT), 1:1 PT : CS (PTCS), 1:1 PT : CS+N (PTCS+N), and 1:1 PT : CGT (PTCGT). CS = composted cotton stalks, CS+N = composted cotton stalks with an nitrogen source added during composting, and CGT = aged cotton gin trash.
Container Grown Plants 245
SNA Research Conference Vol. 56 2011
Differences in Pour-through Results from Two Plant Species and a No-plant Control
Winston Dunwell, Carey Grable, Dwight Wolfe, and Dewayne Ingram1
University of Kentucky Research and Education Center, 1205 Hopkinsville St, Princeton, KY 42445 1University of Kentucky, N-308F Agri. Science Center, Lexington KY 40546-0091
Index Words: PourThru, Pour-through, Pterostyrax hispida, Indigofera heterantha, Fertilization, Nursery
Significance to Industry: This research was performed to determine if mid-season low pour-through (PT) soluble salt readings are an indication that plant growth is a factor or that the fertilizer has all been released. The plant root system may expand to fill the pot and lead to higher fertilizer utilization efficiency. The data show that the soluble salt level of the leachate from the No-plant container followed the same pattern as the leachate from containers with plants. The 5-6 month controlled release fertilizer (CRT) no longer provided adequate levels of fertilizer after 13 weeks in western Kentucky. If additional growth is desirable additional fertilizer would need to be applied.
Indigofera heterantha is in a genus recognized for drought tolerance (2,4) but observations indicate that in a container production system it is a heavy water user.
Nature of Work: In western Kentucky, regardless of the longevity stated for a slow release fertilizer, we find that there is little or no soluble salt readings from PT taken in mid-summer following spring application. Dan Struve (5) stated that the plant root system would be filling the pot by that time and would be more efficient at removing fertilizer from the soil solution. Previous work attempting to retrieve all fertilizer prills to test for fertilizer remaining in mid-summer when the low soluble salts PT results occurred has not been successful. Including a container with no plant might give us an indication of whether there was still fertilizer being released to the soil solution.
April 23, 2010, fifteen plants each of Pterostyrax hispida and Indigofera heterantha were transplanted from 3-gallon containers (Nursery Supplies, C300) to 7 gallon containers (WhiteRidge, LLC, 2358 l). The media was aged pine bark with no amendments. Fifteen 7-gallon containers filled with media without a plant were used as the No-plant control. Containers were set in TopHat™ Container Stabilizers to avoid blow over and fertilizer loss. Irrigation was provided via a single Agridor 4463 sprayer per container. Water was applied at 0900 and 1400 for 20 minutes each. Osmocote Plus 15-9-12 5-6 month was applied at 3.5 ounces per pot on June 9, 2010. The three treatments were allocated to the 45 containers in a generalized randomized block design with three treatments per row and three rows (blocks).
Container Grown Plants 246
SNA Research Conference Vol. 56 2011
PT soluble salt reading and pH was recorded every two weeks from June 14, 2010 to October 4, 2010 by the Pour-Through-Extraction method (3). An additional irrigation emitter was added to the Indigofera heterantha, July 2, 2010, to ensure the amount of water leaching from a 500 ml application 30 minutes following an irrigation event was the equivalent to that of the No-plant and Pterostyrax hispida (1).
Results and Discussion: Leachate salts averaged 441 µS/m for the no-plant control, 294 µS/m for the Pterostyrax hispida and 202 µS/m for Indigofera heterantha over the duration of the experiment and were significantly different from each other (Table 1). The peak level of soluble salts in the leachate for all treatments was one month after application, July 12, 2010. At that time the salt levels averaged 1099 µS/m for the No- plant control, 610 µS/m for the Pterostyrax hispida and 204 µS/m for the Indigofera heterantha. At the September 21, 2010 extraction the readings indicated that the fertilizer was less than the range, 200 to 500 µS/m (7), considered adequate for growth.
Over the course of the study the pH of the leachate initially declined before leveling out in the range of 6.5 – 6.9 (Figure 2.). The pH levels inversely reflected the level of soluble salts in the leachate. The No-plant treatment pH was significantly lower that the Pterostyrax hispida and Indigofera heterantha for the duration. Measuring leachate pH was discontinued following the September 3 readings.
Literature Cited
1. Ariana P. Torres, Michael V. Mickelbart, and Roberto G. Lopez. 2010. Leachate Volume Effects on pH and Electrical Conductivity Measurements in Containers Obtained Using the Pour- through Method. 2. Cecil, Ben. 2010. Personal Communication. 3. Dunwell, Win and Amy Fulcher. 2005. PourThru Extraction. 18 Nov. 2010 http://www.ca.uky.edu/HLA/Dunwell/PourThruExtract.html 4. Evans, Erv. 2010. Drought Tolerant Shrubs. 18 Nov. 2010. http://www.ces.ncsu.edu/depts/hort/consumer/quickref/shrubs/shrubs- drought.html 5. Struve, Dan. 2010. Personal communication. 6. Wright, Robert D. 1986. The Pour-through nutrient Extraction Procedure. HortScience 21(2):227-229. 7. Yeager, Tom, et.al. 2007. Best Management Practices: Guide for Producing Nursery Crops, 2nd ed. Southern Nursery Assoc., Atlanta, GA.
Container Grown Plants 247
SNA Research Conference Vol. 56 2011
Table 1. Average soluble salt reading over the experiment
Treatment Soluble Salt Number of Readings No-plant 441 a1 135 Pterostyrax hispida 294 b 134 Indigofera heterantha 202 c 133 Lsd (0.05) 51 na 1 Means with the same letter are not significantly different.
Figure 1. Soluble salts in PT leachate from Pterostyrax hispida, Indigofera heterantha and No-plant containers for two week sampling dates. Mean intervals are + or – ½ the least significant difference at the 0.05 probability level.
Container Grown Plants 248
SNA Research Conference Vol. 56 2011
Figure 2. pH of the PT leachate from Pterostyrax hispida, Indigofera heterantha and No- plant containers for two week sampling dates. Mean intervals are + or – ½ the least significant difference at the 0.05 probability level.
Container Grown Plants 249
SNA Research Conference Vol. 56 2011
Allelopathic Influences of Fresh and Aged Pine Needle Leachate on
Germination of Lactuca sativa
Whitney G. Gaches, Glenn B. Fain, Donald J. Eakes, Charles H. Gilliam, and Jeff L. Sibley
Department of Horticulture, Auburn University, 101 Funchess Hall, Auburn University, Alabama 36849
Significance to Industry: Previous work by the authors demonstrates increased plant growth response in aged WholeTree (WT) substrate as compared to fresh WT. The differences in the previous studies may be attributed to differences in substrate physical or chemical properties, day length, or temperature; however, another explanation could be a plant produced chemical present in the fresh WT, resulting in an allelopathic relationship between the substrate solution and the plant. Knowing the cause of the differences in plant growth in aged and fresh WT could provide insight to superior storage and handling requirements of the material. This study indicates that the plant- substrate interaction may be the result of pine-related chemicals still present in fresh WT.
Nature of Work: The discoveries of plant – plant interactions are becoming more frequent as scientific technology improves. Scientists currently acknowledge inhibitory relationships between black walnut (Juglans nigra) and turf species (17); crabgrass (Digitaria sanguinalis) and agronomic crops such as cotton and peanuts (14); and apple (Malus spp.) and turf species (11), to name a few. Reduced plant growth in fresh WT substrate may be due to some type of chemical interaction between the milled pine tissues and young plants grown in such materials.
Hans Molisch is considered the modern Father of Allelopathy, having coined the term in 1937 to refer to biochemical interactions between all types of plants including microorganisms (9). A more modern definition defines allelopathy as any direct or indirect harmful effect by one plant on another through production of chemical compounds that escape into the environment (12); however, in the more recent edition of his book, Rice refers back to Molisch’s original definition to allow the term allelopathy to include both harmful and beneficial interactions between plants and microorganisms (13).
Several investigators have reported allelopathic effects of Pinus spp. on other plants. Nektarios et al. (10) reported the allelopathic potential of Pinus halepensis Mill. needles is greatest with fresh needles, moderate in senesced needles, and low in decaying needles in a bioassay using fresh, senesced, and decaying pine needle leachate with Avena sativa as the biosensor plant.
Container Grown Plants 250
SNA Research Conference Vol. 56 2011
The dynamics of ponderosa pine stands in North Dakota were studied to determine the influence of plant-produced chemicals on nitrification (8). Low levels of nitrate-nitrogen relative to ammonium-nitrogen and low numbers of Nitrosomas and Nitrobacter in the soils suggested that nitrification rates were low. This could not have been pH related as the soils were alkaline. Evidence in the study suggested that the reduction in nitrate synthesis was due to the production and subsequent transfer of allelochemicals to the soil. Several compounds inhibitory to nitrification were found in extracts from ponderosa pine needles, bark, and A-horizon soils (8).
Work at the USDA Bureau of Soil demonstrated that various leachates of oak, pine, chestnut, tuliptree, dogwood, maple, and cherry were inhibitory to wheat seedling transpiration or growth (7, 16), but this work was never followed up.
Whittaker and Feeny (19) identified five major categories of plant-produced chemical inhibitors: phenylpropanes, acetogenins, terpenoids, steroids, and alkaloids. Terpenoids, or terpenes, consist of five-carbon isoprene units linked together in various ways and with different types of ring closures, functional groups, and degrees of saturation (15). Monoterpenes consist of C10 hydrocarbons and are the major constituents of many pine resin oils (21). Potential sources of monoterpenes include leaf litter, canopy, and roots exudates. Leachate from pine leaf litter is thought to be the largest source of monoterpenes. As allelopathic agents, they are thought to inhibit plant growth and germination in several plant communities (21).
In 1986, research was initiated on monoterpene inhibition of the nitrogen cycle (18). It was hypothesized that vegetation in ponderosa pine forests inhibited nitrification by releasing volatile terpenes that retarded the oxidation of ammonium. White used ‘trapped vapor’ experiments to assay the effects of vapors on nitrification in soils from burned plots. Soil from non-burned plots placed in sealed jars containing soil from burned plots reduced nitrification by 87%. A single water extraction of non-burned forest floor reduced nitrification by 17%. Vapors from a mixture of five major monoterpenes found in the pine resin completely inhibited nitrification (18).
With new pine wood fiber alternative substrates (3, 4, 20, 22) becoming more available to growers, concern for potential growth inhibition due to phytotoxins and nitrogen tie-up is rising. A study by Gaches et al. (5) comparing two different wood fiber substrates demonstrated increased plant growth after substrates were stored for a period of time. A resulting study later reported increased plant growth response with greater growth indices, more blooms, and greater dry weights for greenhouse grown annuals when grown in aged WT as compared to fresh WT (6). Because WT composition is approximately 80% wood, 15% bark, and 5% needles (3), needles in the fresh WT could be releasing terpenes or other chemical compounds into the substrate solution, potentially inhibiting the nitrogen cycle and negatively affecting plant growth. A research proposal for a bioassay of fresh and aged pine needles was developed.
Container Grown Plants 251
SNA Research Conference Vol. 56 2011
A study was initiated on March 18, 2010. Fresh pine needles were collected directly from 12 year old loblolly pine trees (Pinus taeda L.) at the Mary Olive Thomas Forestry Research Plot in Auburn, Alabama. Aged pine needles were collected from the ground under the same pine trees. Procedures used in this bioassay followed the procedures outlined by Al Hamdi, et al. (1) and Nektarios et al. (10). Needles were immediately rinsed with distilled water. Two hundred needles each of fresh and aged were crushed with mortar and pestle and soaked in 600 mL of distilled water for 24 hours. On March 19, 2010 the samples were drained to obtain full-strength aged and fresh leachate, respectively. One germination sheet (Anchor Paper Company St. Paul, Minnesota) was placed in the bottom of a glass Petri dish. Five Lectuca sativa L. seeds were placed on each germination sheet, and another sheet placed on top of the seeds. Five mL of the appropriate solution was poured into each Petri dish. Each dish counted as one experimental unit. With two treatments and thirteen replications per treatment, there were a total of 26 experimental units. The Petri dishes were completely randomized, and placed in plastic zip bags and sealed to retain moisture, then placed in an incubator in the dark at 26°C for five days. After the incubation period, average germination percentage and average radicle length for seedlings in each Petri dish were calculated. All data were analyzed as a binomial in SAS 9.1 (SAS Institute Cary, North Carolina).
Results and Discussion: There was no difference (P=1.00) in germination percentage for lettuce (Lactuca sativa L.) seeds between treatments; however, the radicle length of seeds germinated in aged needle leachate was greater (P=0.0062) than the radicle length of seeds germinated in fresh needle leachate. While seed germination was not inhibited by fresh pine needle leachate, post-germination growth of the seedlings was negatively affected in the presence of the fresh needle leachate. Results indicate that some chemical present in fresh pine needles may negatively affect radicle growth in fresh WT substrate. A comprehensive chemical analysis of fresh and aged pine needles should be executed in order to identify the types and concentrations of compounds present in pine needles. Once specific compounds (such as terpenes, alkaloids, etc.) are confirmed to be present in fresh loblolly pine needles, protocol can be developed to manipulate WT in order to obtain the best possible plant growth, possibly by storing fresh WT in order to allow the substrate to go through an initial heat, as described by Gaches et al. (6). For example, terpenes are volatile and heat has been shown to affect the loss of monoterpenes from pine leaf litter (21). Further investigation is necessary to understand plant – plant interactions associated with wood fiber substrates and develop protocol accordingly.
Literature Cited 1. Al Hamdi, B., J., Inderjit, M. Olofsdotter J.C. Streibig. 2001. Laboratory bioassay for phytotoxicity: an example from wheat straw. Agron. J. 93:43-48. 2. Boyer, C.R. 2008. Evaluation of clean chip residual as an alternative substrate for container grown plants. Auburn University Dissertation. 204 Pages. 3. Boyer, C.R., G.B. Fain, C.H. Gilliam, T.V. Gallagher, H.A. Torbert, and J.L. Sibley. 2008. Clean chip residual: a substrate component for growing annuals. HortTechnology 18:423-43.
Container Grown Plants 252
SNA Research Conference Vol. 56 2011
4. Fain, G.B., C.H. Gilliam, and J.L. Sibley. 2006. Processed whole pine trees as a substrate for container-grown plants. SNA Res. Conf. Proc. 51:59-61. 5. Gaches, W.G., G.B. Fain, D.J. Eakes, C.H. Gilliam, and J.L. Sibley. 2010. A comparison of WholeTree and Chipped Pine Log substrate components in the production of greenhouse grown annuals. J. of Environ. Hort. 28:173-178. 6. Gaches, W.G., G.B. Fain, D.J. Eakes, C.H. Gilliam, and J.L. Sibley. 2010b. Comparison of aged and fresh WholeTree as a substrate component for production of greenhouse-grown annuals. J. of Environ. Hort. 29:39-44. 7. Livingston, B.C., C.A. Jensen, J.F. Breazeale, F.R. Pember, and J.J. Skinner. 1907. Further studies on the properties of unproductive soils. U.S. Department of Agriculture, Bureau of Soils Bulletin 36:1-71. 8. Lodhi, M.A.K. and K.T. Killingbeck. 1980. Allelopathic inhibition of nitrification and nitrifying bacteria in a ponderosa pine (Pinus ponderosa Dougl.) community. Amer. J. Bot. 67:1423-1429. 9. Molisch, H. 1937. “Der Einfluss einer Pflanze auf die andere-Allelopathie.” Fischer, Jena. 10. Nektarios, P.A., G. Economou, and C. Avgoulas. 2005. Allelopathic effects of Pinus halepensis needles on turfgrasses and biosensor plants. HortScience 40:246-250. 11. Pickering, S.V. 1919. The action of one crop on another. J. R. Hort. Soc. 43:372- 380. 12. Rice, E.L. 1974. Allelopathy. Academic Press, New York. 13. Rice, E.L. 1984. Allelopathy: 2nd ed. Academic Press, New York. 14. Robinson, E.L. 1976. Effect of weed species and placement on seed cotton yields. Weed Sci. 24:353-355. 15. Robinson, T. 1983. The organic constituents of higher plants. 5th Ed. Cordus - ress, North Amherst, Massachusetts. 16. Schreiner, O. and J.J. Skinner. 1911. Lawn soils. U.S. Department of Agriculture, Bureau of Soils Bulletin 75:1-55. 17. Stickney, J.S., and P.R. Hoy. 1881. Toxic action of black walnut. Trans. Wis. State Hort. Soc. 11:166-167. 18. White, C.S. 1986. Volatile and water-soluble inhibitors of nitrogen mineralization and nitrification in a ponderosa pine ecosystem. Biology and Fertility of Soils. 2:97-104. 19. Whittaker, R.H. and P.P. Feeney. 1971. Allelochemics: chemical interactions between species. Science 171:757-770. 20. Witcher, A.L., G.B. Fain, E.K. Blythe, and J.M. Spiers. 2009. The effect of nitrogen form on pH and petunia growth in a WholeTree substrate. Proc. Southern Nursery Assn. Res. Conf. 54:428-233. 21. Wood, S.E. 1996. Loss of foliar monoterpenes from Umbellularia californica leaf litter and their influence on nitrification potential in soil beneath the trees. University of California, Davis. 151 pages. 22. Wright, R.D. and J.F. Browder. 2005. Chipped pine logs: a potential substrate for greenhouse and nursery crops. HortScience 40:1513-1515.
Container Grown Plants 253
SNA Research Conference Vol. 56 2011
Parboiled Rice Hulls Effect on Physical Properties of Amended Pine Bark Substrates During Long-term Nursery Crop Production
Celina Gómez and James Robbins University of Arkansas, Department of Horticulture, Fayetteville, AR 72701
Additional Index words: Container substrates, soilless medium, spirea
Significance to the Industry: Parboiled rice hulls (PBH), which have not previously been investigated as an amendment for bark-based container media in long-term nursery crop production, appear to be an amendment for pine bark (PB). Based on our results, bark-based substrates in which up to 60% of the PB was replaced with PBH had physical properties that were generally within current guidelines for nursery container substrates after two growing seasons (67 weeks).
Nature of work: The decline in the availability of PB supplies and increasing prices has caused concerns in the nursery industry. A greater shortage and inferior quality of PB are expected due to the increasing demand for wood-based materials to be used as biofuel (2). Research was conducted to evaluate the changes in physical properties of PB-based container substrates amended with PBH during long-term production cycles under outdoor nursery conditions. Six media substrates were formulated by blending PBH with pH-adjusted PB. Individual blends with 0%, 20%, 40%, 60%, 80%, or 100% PBH (by volume) were mixed in a Mitchell Ellis 1-cubic yard soil mixer (Mitchell Ellis, Semmes, AL) on 14 April 2009. Osmocote Plus (15N-3.9P-10K; 8-9 month, O.M. Scotts Horticulture Products, Marysville, OH) was pre-plant incorporated at rate of 12 lbs·yd-3 and added towards the end of the blending process.
On 14 April, spirea (Spiraea × bumalda L. ‘Anthony Waterer’) liners (average 16-cm tall) were potted in # 5 plastic containers [(Classic 2000, Nursery Supplies Inc., Chambersburg, PA; 28.2-cm (h) × 29.2-cm (TD) × 24.5-cm (BD)]. Additional containers were filled with similar substrates but were left unplanted (fallow containers) to compare changes in physical properties with and without plants. Fallow containers were managed similarly as the containers with plants for the duration of the study. Containers were placed in two locations: gravel container beds at University of Arkansas Horticulture Research Farm in Fayetteville, AR (36°06'N,94°10'W) and Southwest Research and Extension Center at Hope, AR (33°42'N, 93°33'W). One week after planting all containers were treated with Pendulum® 2G herbicide (pendimethalin; BASF Corp., Research Triangle Park, NC) at a rate of 200 lbs·acre-1. During the growing season, containers were moved as needed so that the canopies did not overlap. Containers were placed pot-to-pot during the winter. On 13 April 2010, plants were re-fertilized (top-dressed) at a rate of 8.9 lbs·yd-3 with the same fertilizers as initially applied. Containers were overhead irrigated as needed depending on the
Container Grown Plants 254
SNA Research Conference Vol. 56 2011 weather conditions for the length of the experiment. Sufficient water was applied for each substrate to return containers to CC providing a 20% LF.
Physical Properties: initial. Immediately following the blending process, three random samples of each substrate were collected for further analysis. Air-filled pore space (AS; v/v), water-holding capacity (WHC; v/v), total porosity (TP; v/v), and dry bulk density (DBD; w/v), were determined by using air-dried substrate samples. Samples were rewetted to a moisture level of 50% (w/w) and allowed to equilibrate to attain moisture uniformity. Physical properties were determined on three replicate samples following the NCSU Porometer methods (4). Initial physical properties were subject to mean separation among substrates. Results were subjected to ANOVA and means were separated using Tukey’s HSD.
Physical Properties: final. Root medium samples were collected from each container by manually separating the roots from the substrate. Three replicate samples of each substrate were obtained by mixing two containers together. Each replicate sample was used for physical properties analyses following the same procedures used for initial measurements. It is important to note that the final physical properties presented in this study are not representative of the physical conditions in the containers after 67 weeks under production conditions. Final physical properties were analyzed as a 6 × 2 × 2 factorial with six substrates, two planting methods (with plants or from fallow containers), and two locations (Fayetteville and Hope) arranged in a completely randomized design. Data were subjected to ANOVA and means were separated by Tukey’s HSD.
Because initial data was not specific for a given location and/or planting method, significance for the change in physical properties over time was based on a 95% confidence interval (CI). The change over time was obtained by subtracting the final value from its respective initial value. If a CI did not overlap with zero, then a significant change over time (67 weeks) was considered. All data were analyzed with JMP 8 (SAS Institute, Inc., Cary, NC). Although final plant data were collected, only physical property data will be presented in this paper.
Results and Discussion: Initial TP was highest in substrates with 40% to 100% PBH and all of these blends were above the recommended range (50-85%; 6) (Table 1). In most cases, TP significantly decreased during the experiment at both locations and regardless of the planting method. For each substrate, final TP over the 67 week of the experiment was not affected by location. In general, the presence of plants did not alter the TP of the substrates. At 67 WAP substrates with up to 60% PBH fell within the suggested range for container production (6). Initial AS increased as the percentage of PBH increased in the blends (Table 1). Overall, results suggested a significant decrease in AS over time. The suggested range for AS in container substrates is 10-30% (6). Initially, all substrates that contained PBH in the blend had AS percentages above the acceptable range. However, at 67 WAP substrates that contained up to 60% PBH fell within recommendations regardless of location and planting method.
Container Grown Plants 255
SNA Research Conference Vol. 56 2011
In the initial blends, WHC decreased as the percentage of PBH increased (Table 2); that trend was generally not affected over the 67 week period regardless of location and planting method. Overall, WHC significantly increased over time. Substrates with 40% and 80% PBH resulted in greater WHC in fallow containers than when plants were present; otherwise, the presence of plants did not alter final WHC for the different substrates. The suggested range for WHC of substrates used in containers is 45-65% (6). Initially, substrates with 60% or more PBH had WHC percentages below that range; however, at 67 WAP substrates that contained up to 80% PBH fell within or above the recommended range, suggesting an improvement in WHC over time with the addition of PBH to the blend.
Initial DBD decreased as the percentage of PBH increase in the blend (Table 2). Dry bulk density significantly decreased over time for substrates with 0% and 20% PBH regardless of the location and planting method. In general, DBD in the different substrates was not affected by location nor planting method. The ideal DBD range is thought to be 0.19-0.70 g·cm-3 (6). By this standard, initial substrates with 40% or more PBH had a DBD below the ideal range. At 67 WAP only substrate with no addition of PBH from the Fayetteville location fell within the lower margin of the range. Initial results for the physical properties of the substrates suggested that in general, as PBH increased in the blends, TP and AS increased and consequently, WHC and DBD decreased. Similar results had already been reported for sphagnum peat-based substrates amended with PBH by Evans and Gachukia (3). They suggested that substrates containing up to 30% PBH had physical properties within the recommended ranges of container substrates, which is close to our results for the initial physical properties of the substrates.
When looking at the final physical properties (at 67 WAP), results suggested a general decrease in TP and AS, and consequently, an increase in WHC over time. These results have been previously reported in pine tree substrates after 70 weeks of growing Contoneaster horizontalis perpusillis under nursery growing conditions (5). Changes in physical properties over time are related to the breakdown of the particles that reduces the AS within the substrate and increases its WHC.
It is important to note that in contrast to what is expected to happen to the standard PB- substrate, physical properties of substrates amended with PBH seemed to improve over time. After 67 weeks, substrates with up to 60% PBH had physical properties that were generally within the sufficiency ranges used in container production (6). Similar to our results, previous work (1) had already suggested that the changes in physical properties of peat substrates that best related to the plant growth of Prunus × cistena sp. did not necessarily deteriorate over the 14 months of their study, but rather maintained or even improved.
Container Grown Plants 256
SNA Research Conference Vol. 56 2011
Literature Cited
1. Allaire-Leung, S.E., Caron, J. and L.E, Parent. 1999. Changes in physical properties of peat substrates during plant growth. Canadian J. of Soil Science. 79:137-139. 2. Day, M. 2009. Mulch producers tune into biofuel boom. Soil Mulch Producers News 3:1-3,16. Accesed on September 2, 2010. http://soilandmulchproducernews.com/archives/50-januaryfebruary-2009/117- mulch- producers-tune-into-biofuel-boom 3. Evans, M.R. and M.M. Gachukia. 2007. Physical properties of sphagnum peat- based root substrates amended with perlite or parboiled fresh rice hulls. HortTechnology 17:312-315. 4. Fonteno, W.C., C.T. Hardin, and J.P. Brewster. 1995. Procedures for determining physical properties of horticultural substrates using the NCSU Porometer. Horticultural Substrates Laboratory. North Carolina State University. 5. Jackson, B.E., R.D. Wright and J.R. Seiler. 2009. Changes in chemical and physical properties of pine tree substrate and pine bark during long-term nursery crop production. HortScience 44:791-799. 6. Yeager, T.H., D.C. Fare, J. Lea-Cox, J. Ruter, T.E. Bilderback, C.H. Gilliam, A.X. Niemiera, S.L. Warren, T.E. Whitwell, R.D. Wright, and K.M. Tilt. 2007. Best management practices: Guide for producing nursery crops. 2nd Ed. Southern Nurserymen’s Assoc., Marietta, GA.
Container Grown Plants 257
SNA Research Conference Vol. 56 2011
Table 1. Total porosity (TP), air-filled pore space (AS), and water-holding capacity (WHC) of pine bark (PB) substrates amended with parboiled rice hulls (PBH) initially and 67 weeks after planting (final) in # 5 containers at two locations with and without (fallow) spirea plants.z,y,x,w,v Final TP (%) Locationu Planting Methodu Substrate Initial TP (% PB:PBH) (%) Fayetteville Hope Fallow Containers w/plants 100:0 79.7 bt 78.2 g * 79.0 fg 78.8 e 78.4 e * 80:20 83.2 b 79.2 fg * 82.0 ef 82.8 cd 78.4 e * 60:40 90.3 a 81.4 efg * 84.9 cde * 85.2 bc * 81.2 de * 40:60 94.7 a 85.6 cd * 82.2 def * 84.4 cd * 83.5 cd * 20:80 95.2 a 86.9 bc * 87.7 bc * 88.6 ab * 86.0 bc * 0:100 93.7 a 91.7 a 90.0 ab * 89.7 a * 91.9 a Final AS (%) Locationu Planting Methodu Substrate Initial AS (% PB:PBH) (%) Fayetteville Hope Fallow Containers w/plants 100:0 26.5 ct 14.3 fg * 10.5 g * 10.8 g * 14.0 g * 80:20 35.5 c 20.8 e * 16.9 ef * 22.9 ef * 14.7 g * 60:40 46.0 b 27.1 d * 19.0 ef * 22.0 f * 24.0 ef * 40:60 54.1 b 29.3 d * 27.9 d * 27.2 de * 29.9 d * 20:80 66.0 a 41.8 c * 43.2 c * 39.1 c * 45.9 b * 0:100 70.6 a 60.6 a * 54.5 b * 59.1 a * 56.0 a * Final WHC (%) Locationu Planting Methodu Substrate Initial (% PB:PBH) WHC (%) Fayetteville Hope Fallow Containers w/plants 100:0 53.2 at 63.8 ab * 68.6 a * 67.9 a * 64.5 ab * 80:20 47.7 b 58.5 bc * 65.1 a * 59.9 bc * 63.7 ab * 60:40 44.3 bc 54.4 c * 65.9 a * 63.2 ab * 57.1 cd * 40:60 40.6 c 56.3 c * 54.4 c * 57.1 cd * 53.5 de * 20:80 29.3 d 45.1 d * 44.5 d * 49.5 e * 40.2 f * 0:100 23.1 e 31.0 e * 35.4 e * 30.5 g * 35.9 fg * zData collected from three samples per substrate and represented as means. Analysis performed using the North Carolina State University Porometer Method (Fonteno et al., 1995). yTotal porosity is WHC + AS. Suggested range for TP is 50-85% (Yeager et al., 2007). xAS is the volume of water drained from the sample ÷ volume of the sample. Suggested range for AS of substrates in containers is 10-30% (Yeager et al., 2007). wWHC is (wet weight – oven dry weight) ÷ volume of the sample. Suggested range for WHC of substrates in containers is 45-65% (Yeager et al., 2007). vSubstrates were individual blends of PB amended with 0, 20, 40, 60, 80, or 100% PBH (v/v). uMeans followed by the same letter are not significantly different based on Tukey’s HSD test (P = 0.05). *Indicates difference from its respective initial value (P = 0.05).
Container Grown Plants 258
SNA Research Conference Vol. 56 2011
Table 2. Dry bulk density (DBD) of pine bark (PB) substrates amended with parboiled rice hulls (PBH) initially and 67 weeks after planting (final) in # 5 containers at two locations with and without (fallow) spirea plants.z,y -3 w Initial Final DBD (g·cm ) Substrate DBD Fayetteville Hope (% PB:PBH)x (g·cm-3) Fallow Containers w/plants Fallow Containers w/plants 100:0 0.21 av 0.19 a * 0.19 ab * 0.17 abcdef * 0.18 abcde * 80:20 0.19 b 0.17 bcdef * 0.18 abcd * 0.18 abcdef * 0.18 abcdef * 60:40 0.17 c 0.16 cdef 0.16 def 0.16 fg 0.16 efg 40:60 0.14 d 0.14 gh 0.14 h 0.18 abc * 0.14 gh 20:80 0.11 e 0.13 hi * 0.12 ij 0.12 ij * 0.11 ij 0:100 0.10 e 0.10 j * 0.10 j * 0.11 ij 0.10 j zData collected from three samples per substrate and represented as means. Analysis performed using the North Carolina State University Porometer Method (Fonteno et al., 1995). yDBD after forced-air drying at 221 °F for 48 h. Suggested range for DBD of substrates in containers is 0.19-0.70 g·cm-3 (Yeager et al., 2007). xSubstrates were individual blends of PB amended with 0, 20, 40, 60, 80, or 100% PBH (by volume). wMeans followed by the same letter are not significantly different based on Tukey’s HSD test (P = 0.05). vMeans within column followed by the same letter are not significantly different based on Tukey’s HSD test (P = 0.05). *Indicates difference from its respective initial value (P = 0.05).
Container Grown Plants 259
SNA Research Conference Vol. 56 2011
Response of Containerized Hydrangea macrophylla 'Endless Summer' to a Mineral-polyacrylate Substrate Amendment and Reduced Overhead Water Application
Michael T. Kapsimalis, James S. Owen, Jr. and Heather M. Stoven Oregon State University, North Willamette Research and Extension Center 15210 NE Miley Rd. Aurora, OR 97002
James E. Altland USDA-Agricultural Research Service, Application Technology Research Unit Wooster, OH 44691
Index Words: Water absorbent polymer, overhead irrigation, soilless substrate, Douglas fir bark
Significance to Industry: Sphagnum peat prices are increasing and availability has been sporadic in recent years. Concurrently, fresh water for urban and agricultural use continues to become more limiting. The addition of polyacrylate is a potential alternative to peat that has been reported to increase crop water use efficiency. Four rates of a polyacrylate and 20% (by vol.) sphagnum peat were added to Douglas fir bark substrate to produce containerized Endless Summer hydrangea under normal and deficit irrigation. Decreased irrigation application rate linearly reduced hydrangea shoot growth 56% when the water applied to maintain a 0.50 leaching fraction (water leached from the container ÷ water applied to the container) was decreased by half. Both root and shoot dry weight responded curvilinearly to the addition of polyacrylate with maximum growth calculated at 3.9 and 4.0 kg⋅m-3, respectively. Hydrangea grown in fir bark amended with 4.7 kg⋅m-3 polyacrylate had the greatest root and shoot dry weight, which was comparable to hydrangea grown in the peat based substrate for both shoot and total dry weight.
Nature of Work: Water absorbent polymer additives are used in soil, sand, compost and soilless substrate to increase water buffering capacity (time to wilt) and increase dry mass of vegetables, floriculture, woody ornamental and forestry crops (2,6). The increase in crop growth and yield has been attributed to the alteration of the physiochemical properties, specifically increased water and nutrient holding capacity (4). Conversely, plant availability of polyacrylate stored water, detrimental increase in field or container capacity, and alteration of salt concentration or nutrient availability have remained concerns for growers when using a water absorbent polymer (5).
Sphagnum peat is readily utilized in greenhouse and nursery soilless substrates for production of woody ornamental and floriculture crops. The sustainability of peat remains in question, which has resulted in petitions for countries such as the United
Container Grown Plants 260
SNA Research Conference Vol. 56 2011
Kingdom to completely ban the extraction and sale of peat and replace it with cost effective alternatives (3). The similar properties, water holding capacity and nutrient retention of polyacrylate make it a potential replacement for peat. Furthermore, the addition of a polyacrylate to the substrate has the potential to conserve water because of reported increases in water buffering capacity allowing extended time between applications or reducing application volume (2). The objective of this study is to investigate hydrangea crop response to varying incorporation rates of polyacrylate under conventional and defecit irrigation.
Hydrangea macrophylla (Thunb.) Ser. 'Endless Summer' was planted in a 6 L (GL600, #2, Nursery Supplies Inc., Chambersburg, PA) container in a Douglas fir bark [Pseudotsuga menziesii (Mirbel) Franco] based substrate on May 25, 2010. The experiment was arranged into a split-plot experiment with irrigation application rate as the main plot factor and mineral-polyacrylate water absorbent (Geohumus®, Geohumus North America LLC, San Francisco, CA) rate as the subplot factor. Irrigation application rates (1.0x, 0.75x, and 0.5x) were based on a bi-monthly maintenance of a 0.5 leaching fraction for hydrangea grown in the industry representative substrate containing 20% peat by vol. (control). Plants received daily overhead irrigation at 83 L•hr-1 and 163 L•hr- 1 (22 gph and 43 gph) (Matched Precipitation Rate Spray Nozzles, 10Q/10H, Rain Bird Corporation, Azusa, CA). Each irrigation rate was replicated three times and arranged in a completely randomized block design. The polyacrylate was incorporated in Douglas fir bark <10mm (<3/8 inch) at 0, 2.4, 4.7 and 7.1 kg•m-3 (0, 4, 8, 12 lb•yd-3). Each polyacrylate rate was replicated with five individual containers per irrigation plot and arranged in randomized block design within each irrigation plot. Substrate was amended with 0.9 kg•m-3 Nitroform® (Agrium, Loveland, CO), 0.9 kg•m-3 (1.5 lbs•yd-1) #10 Ag dolomite, 0.9 kg•m-3 (1.5 lbs•yd-1) 1.5 lbs/yd #65 Ag dolomite, and 0.9 kg•m-3 (1.5 lbs•yd-1) lbs gypsum. An 18-6-11 (18N-2.6P-9.1K) 9-month heterogeneous controlled release fertilizer (J.R. Simplot, Boise, ID) was incorporated at 5.9 kg•m-3 (10 lbs•yd-1) into the soilless substrate before planting. Monthly pour-throughs were conducted to monitor substrate pH and electrical conductivity (EC) as described by Wright (7).
To determine substrate physical properties the following procedure was followed: soilless substrates were adjusted to approximately1.5 g•g-1 mass wetness, mixed with polyacrylate, and packed in aluminum cylinders 3.8 cm tall with 7.6 cm inside diameter (1). Aluminum cores were overhead irrigated for 4 days before being attached to North Carolina State University Porometers™ for determination of air space (AS). Cores were oven dried at 110°C (230°F) to determine container capacity (CC). Total porosity (TP) was calculated from the sum of AS and CC. All physical properties (TP, AS, CC) were calculated for the algebraic mean of the column. Bark bulk density (Db) was calculated as g•cm-3 on both a dry and wet basis.
Hydrangea were harvested on September 22, 2010. Shoot dry weight was obtained for three replicates of each polyacrylate rate within each irrigation rate. Shoot dry weight was analyzed with SAS 9.2 (Cary, NC) using PROC MIXED. Three replicates of roots were washed, dried, and weighed for each polyacrylate rate within the 0.75x irrigated
Container Grown Plants 261
SNA Research Conference Vol. 56 2011 blocks. Root and shoot data within 0.75x irrigation rate was subjected to univariate analysis of variance (ANOVA) to investigate the impact of water absorbent on plant carbon allocation. Substrate physical properties were analyzed with multivariate analysis of variance (MANOVA) using Wilk’s lambda for the test statistic to determine the influence of main effects on composite substrate physical properties. ANOVA was used to determine influence of main effects on individual parameters. Linear and curvilinear trends of plant dry mass were analyzed using contrast statements. Means separation with Fisher’s protected least significant difference test (α = 0.05) were used where appropriate.
Results and Discussion: The mixed model analysis used to analyze the main effects of irrigation application rate and polyacrylate water absorbent amendment rate on crop shoot growth revealed significant main effects, however there was no significant interaction. The mean pH and electrical conductivity across all treatments was 5.3 and 1.72 d•Sm-1, respectively.
Over the period of one growing season, reduced or deficit water application on hydrangea was not overcome by the addition of polyacrylate. Hydrangea shoot dry mass linearly increased (p=0.036) from 33, 50, to 53 g with increasing irrigation applicate rate of 0.5x, 0.75x and 1.0x, respectively.
At the 0.75x irrigation rate both root and shoot dry weight responded curvilinearly to the addition of the polyacrylate to the substrate. Maximum hydrangea root and shoot growth was calculated at incorporation of 3.9 and 4.0 kg⋅m-3, respectively, of the polyacrylate into the substrate. Hydrangea grown in substrate amended with 4.7 kg⋅m-3 of the polyacrylate had the greatest root, shoot and total dry weight, which was comparable to peat for both shoot and total dry weight (Table 1). Root to shoot ratio was comparable across polyacrylate substrate treatments, however plants grown in peat amended substrate had a reduced root to shoot ratio. Johnson and Piper (4) also found that water absorbent polymers increased shoot weight as well as fruit yields. In tomato, shoot dry weight increased in response to polyacrylate additions and fruit yield also increased ≈50% when grown in sand.
The addition of a polyacrylate increased the ability of the bark substrate to hold water and inversely decreased air space. Polyacrylate incorporated in the substrate at a rate of 7.1 kg⋅m-3 had 54% CC and 32% AS, whereas bark alone (no polyacrylate) resulted in 20% decreased container capacity and 46% air space (Table 2). An addition of peat (20% by vol) to bark substrate resulted in equal CC, AS and bulk density (wet or dry basis) as bark amended with 7.1 kg•m-3 polyacrylate. The dry bulk density was unaffected by substrate treatment, however wet bulk density linearly increased with the addition of polyacrylate. Although the addition of polyacrylates showed an increase in CC, plant water availability of the water held within the matrix of the polyacrylate is unknown. Continued research is needed to investigate alternatives to peat and methods to reduce water in both nursery and greenhouse industry. Although the addition of a polyacrylate did not increase plant growth in reduced water situations,
Container Grown Plants 262
SNA Research Conference Vol. 56 2011 under conventional irrigation application rates, the polyacrylate increased shoot growth when compared to Douglas fir bark alone and was comparable to peat when incorporated at a rate of 4.7 kg⋅m-3. Further investigation is needed to examine the effect of a polyacrylate on crop water availability as well as their effect on plants with varying levels of water tolerance.
Acknowledgements: Geohumus® and Oregon Department of Agriculture provided funding for this research. We would like to thank Bailey Nurseries Inc. for donating materials and Sarah Sydow for providing technical assistance.
Literature Cited 1. Fonteno, W.C. and T.E. Bilderback. 1993. Impact of hydrogel on physical properties of coarse structured horticultural substrates. J. Amer. Soc. Hort. Sci. 118: 217-222. 2. Gehring, J.M. and Lewis, A.J. III. 1980. Effect of Hydrogel on Wilting and Moisture Stress of Bedding Plants. J. Amer. Soc. Hort. Sci. 105:511-513. 3. GoPetition. July 2, 2007. Total ban on peat extraction in the UK. James, Nathan. http://www.gopetition.com/petitions/total-ban-on-peat-extraction-in-the-uk.html 4. Johnson, M.S. and Piper C.D. 1997. Cross-linked, Water-Storing Polymers as Aids to Drought Tolerance of Tomatoes in Growing Media. J. Agron. Crop Sci. 178:23-27. 5. Wang, Yin-Tung and Gregg, Lori L. 1990. Hydrophilic Polymers – Their Response to Soil Amendments and Effect on Properties of a Soilless Potting Mix. J. Amer. Soc. Hort. Sci. 115(6): 943-948. 6. Woodhouse, J. and Johnson, M.S. 1991. Effect of super absorbent polymers on survival and growth of crop seedlings. Agric. Water Manage. 20:63-70. 7. Wright, R.D. 1986. The pour-through nutrient extraction procedure. HortScience 21:227-229.
Container Grown Plants 263
SNA Research Conference Vol. 56 2011
Table 1. Hydrangea growth response when grown in Douglas fir bark substrate amended with varying rates of a polyacrylate or substrate containing 20% (by vol) peat (industry representative).
Polyacrylate Hydrangea dry mass distribution (g) rate Root:shoot (kg•m-3) Shoot Root Total ratio
0.0 43 bZ 9 b 52 b 0.20 2.4 49 ab 9 b 58 ab 0.20 4.7 63 a 12 a 76 a 0.21 7.1 44 b 9 b 52 b 0.19
peat 56 10 * 76 0.16 *
linear 0.487Y 0.505 0.482 0.774 quadratic 0.027 0.055 0.28 0.714
Zletters in column signify a difference using Fishers LSD Yp-value of linear and quadratic trends using contrast statements *signifies a difference in peat and 4.7 kg•m-3 using contrast statements
Container Grown Plants 264
SNA Research Conference Vol. 56 2011
Table 2. Physical properties of Douglas fir bark substrate amended with varying rates of a polyacrylate or substrate containing 20% (by vol) peat (industry representative).
Bulk density (g•cm-3) Polyacrylate Container Air Total rate capacity space porosity Oven Dry Container (kg•m-3) (% vol.) (% vol.) (% vol.) Dry capacity
0.0 34 cZ 46 a 80 c 0.18 0.53 c 2.4 46 b 40 b 86 b 0.19 0.65 b 4.7 48 b 42 ab 90 a 0.18 0.73 b 7.1 54 a 32 c 86 ab 0.18 0.73 a
peat 53 * 33 * 86 * 0.18 0.71 *
linear 0.001Y 0.001 0.001 0.137 0.001 quadratic 0.008 0.216 0.003 0.045 0.005
Zletters in column signify a difference using Fishers LSD Yp-value of linear and quadratic trends using contrast statements *signifies a difference in peat and 4.7 kg•m-3 using contrast statements
Container Grown Plants 265
SNA Research Conference Vol. 56 2011
Use of Neem Cake as an Organic Substrate Component
Cody W. Kiefer, Jeff L. Sibley, Dexter B. Watts, H. Allen Torbert, Glenn B. Fain, Charles H. Gilliam
Auburn University Department of Horticulture 101 Funchess Hall, Auburn University, AL 36849
Index Words: neem, urease, nitrification
Significance to Industry: Nursery and greenhouse growers continue to seek materials to decrease costs of plant production while maintaining environmental stewardship. Incorporation of neem cake as a substrate component could potentially impact nitrogen release as a result of altering substrate bacterial activity. This preliminary study investigates the impact of neem on substrate gas release and provides a starting point to further investigation regarding neem use as a substrate component.
Nature of Work: Fertilizer is an expensive part of any nursery’s program and environmental safety is becoming an increasingly important subject. Therefore, any cost-effective method that can reduce the volume of fertilizer needed is a valuable product. Now the question arises: How is fertilizer lost? Nitrogen is often viewed as the “limiting factor” in plant nutrition, and while there are many forms or sources of nitrogen, our study focused specifically on urea. Urea breaks down into ammonium with the aid of an enzyme known as urease. Ammonium then further breaks down into ammonia, which then undergoes volatilization. Therefore, slowing down this catalysis of urea could, in theory, prolong substrate nitrogen supplies. Since urease in soil is a byproduct of bacteria, limiting urease production by affecting the enzyme itself or its bacterial producers could inhibit the breakdown of urea.
Neem cake (neem) is a product derived from Azadirachta indica (the neem tree). With over 140 chemical compounds isolated from the neem tree, uses for neem have been numerous (everything from an analgesic to an anti-fungal and insecticidal agent) (1). One chemical in particular is azadirachtin, a compound found in many insecticides used in the United States. Only a few studies have evaluated neem products’ effect on nitrification within mineral soils. Mohanty et al (5) reported on the potential inhibitory effects of neem seed kernel powder on urease in three mineral soils native to India, showing slight suppression of urease activity when applied to acidic soils. Méndez- Bautista et al (4) studied the effects of neem leaf extracts on greenhouse gas emissions and inorganic nitrogen in urea-amended soil and reported that the leaf extract had no significant effect on urease, but may limit nitrification. Majumdar et al (3) coated urea with neem before adding to rice fields in North India, resulting in slight nitrification inhibition. Kumar et al (2) used neem oils to coat urea and added it to sandy-loam soils resulting in some nitrification inhibition as well.
Container Grown Plants 266
SNA Research Conference Vol. 56 2011
Mineral soils and soilless potting media, though, are two different worlds. Therefore, we tested neem’s effect on urea within a standard pine bark mix. The study consisted of three groups of treatments: pine bark (PB) + neem, PB + poultry compost (PC) + neem and PB + PC + urea + neem. Within each of these groups are several treatments with varying concentrations of neem and/or fertilizer. Within the PB + neem group are four pine bark treatments containing 0, 1, 2 and 3 percent neem. The second group also contains four treatments, but also included 20 percent poultry compost in the pine bark media and the same percentages of neem (0, 1, 2 and 3 percent). Group three contained the same pine bark and poultry compost stock mix as in group two, with the addition of Scott’s Osmocote Classic 19-6-12 at nine pounds per cubic yard.
Each of the twelve treatments contained four replicates for a total of 48 experimental units. The substrate was placed in trade-gallon containers without plants and placed in a glass greenhouse at the USDA Soil Dynamics Laboratory, Auburn University, Alabama. The substrates were watered as needed, but without leaching. Moist conditions were necessary to mimic rhizosphere microenvironments in order to facilitate microbial growth. Data were taken at regular intervals beginning in May 2010 and ended in August 2010. Data was collected for 3 days per week for the first two weeks and then once per week for the next 7 weeks. After that, data was collected once every two weeks. In order to determine substrate microbial activity, we relied on a secondary factor, gas emissions. Data collection consisted of an airtight gas chamber large enough to accommodate one pot each. The top of the gas chamber was outfitted with a rubber septum through which a needle could penetrate. Four evacuated collection vials were needed for each experimental unit, each one representing a time within the 15 minutes of collection (times 0, 1, 2 and 3 represent initial time and 5, 10 and 15 minutes, respectively). Gas samples were pulled for each experimental unit for each of the aforementioned times and results were analyzed using a gas chromatograph. Constituents of the gas samples tested for were: carbon dioxide (CO2), methane (CH4) and nitrous oxide (N2O), which will be representative of microbial respiration. Acid- coated glass tubes were also placed in hangers inside of each gas chamber to absorb any volatilized ammonia released from the substrate. Volatized ammonia, though, will not be presented in this paper. CO2, CH4 and N2O data were analyzed using Tukey’s Studentized Range Test in SAS Statistical Software (P = 0.05).
Results and Discussion: Overall: Notation for reporting data will adhere to the following guidelines: PB is pine bark; PC is poultry compost; fertilizer will refer to the Osmocote 19-6-12 urea; and when entire groups of treatments are referenced, the values that follow are given chronologically within the group’s treatments. The unit for gas emission values is µmol trace gas m-2 min-1. All data is presented in Table 1.
Carbon Dioxide (CO2): Increasing neem percentage (by volume) as a potting media component appeared to increase CO2 production. However, in the PB + neem treatments, there is no statistical difference among treatments. Within the PB + PC + neem group, the 3% neem treatment (247.27) is statistically larger than the 0% neem treatment (125.94). However, there is no statistical difference among treatments in the PB + PC + fertilizer + neem group.
Container Grown Plants 267
SNA Research Conference Vol. 56 2011
Across all groups, PB + PC +3% neem (247.27) has the highest value for CO2 production, though it is not statistically different than: PB + PC + 1 and 2% neem (172.01 and 198.01, respectively). The PB + 0% neem treatment had the lowest value for carbon dioxide (53.61), but was not statistically different than: any of the PB + neem treatments (85.39, 97.51 and 126.86), PB + PC + 0% neem (125.94), or PB + PC + fertilizer + 0% neem (142.82).
Methane (CH4): Methane’s relation to neem percentage does not seem to be as clear- cut as with carbon dioxide. Three percent neem used in conjunction with PB + PC is significantly higher than no neem in the same mixture (0.04150 and -0.00494, respectively). There was no significant difference in methane levels among treatments within the other two groups tested.
Again, among all groups PB + PC + 3% neem had the highest methane value (0.04150), but is not significantly different than: PB + 0 and 2% neem (0.01768 and 0.00279, respectively), PB + PC + 1 and 2 % neem (0.01426 and 0.02995, respectively) or PB + PC + fertilizer + 1, 2 and 3 % neem (0.01013, 0.00687 and 0.01235, respectively). The PB + PC + 0% neem had the lowest value for methane across all treatments (-0.00494), but was not statistically different from any treatment other than PB + PC + 3% neem (0.04150).
Nitrous Oxide (N2O): Nitrous oxide results yield that there are no statistical differences among treatments within the PB + neem group (0.0008, 0.0013, 0.0003 and 0.0006) or the PB + PC + neem group (0.0394, 0.0442, 0.1299 and 0.0993). The PB + PC + fertilizer + neem group, though, shows that 3% neem (1.7349) is significantly higher than 0 and 1% neem (1.0294 and 1.0998, respectively).
Across all treatments, 3% neem in PB + PC + fertilizer (1.7349) is significantly higher than all other treatments, other than 2% neem in PB + PC + fertilizer (1.1539). PB + PC + fertilizer + 2% neem is higher than all treatments from the PB + neem and PB + PC + neem groups. The 0 and 1% neem treatments within the PB + PB + fertilizer group (1.0294 and 1.0998, respectively) are also statistically higher than all treatments within the PB + neem and PB + PB + neem groups.
In summary, that data presented in this paper do not arrive to a clear conclusion. Studies to determine the fate of urease when neem is added are ongoing, with some supplemental data not having been analyzed yet. It seems reasonable to conclude that based on the presented data, neem does have an effect on soil respiration, though more testing to prove the extent to which this occurs is currently underway. Current testing includes the aforementioned acid-coated tubes for ammonia volatilization, pH and EC, as well as nutrient composition of the different treatments.
Container Grown Plants 268
SNA Research Conference Vol. 56 2011
Literature Cited 1. Brahmachari, G. 2004. Neem—An omnipotent plant: A retrospective. ChemBioChem 5:408-421. 2. Kumar, R., C. Devakumar, V. Sharma, G. Kakkar, D. Kumar and P. Panneerselvam. 2007. Influence of physiochemical parameters of Neem (Azadirachta indica A Juss) oils on nitrification inhibition in soil. J. Agric. Food Chem. 55: 1389-1393. 3. Majumdar, D., S. Kumar, H. Pathak, M.C. Jain and U. Kumar. 2000. Reducing nitrous oxide emission from an irrigated rice field of North India with nitrification inhibitors. Agriculture, Ecosystems and Environment 81: 163-169. 4. Méndez-Bautista, J., F. Fernández-Luqueño, F. López-Valdez, R. Mendoza- Cristino, J.A. Montes-Molina and F.A. Gutierrez-Miceli, L. Dendooven. 2009. Effect of pest controlling Neem (Azadirachta Indica A. Juss) and mata-raton (Gliricidia sepium Jacquin) leaf extracts on emission of greenhouse gases and Inorganic-N content in urea-amended soil. Chemosphere 76(3): 293-299. 5. Mohanty, S., A.K. Patra and P.K. Chhonkar. 2007. Neem (Azadirachta indica) seed kernel powder retards urease and nitrification activities in different soils at contrasting moisture and temperature regimes. Bioresource Technology 99:894- 899.
Container Grown Plants 269
SNA Research Conference Vol. 56 2011
Non-Chemical Solutions To Reduce Root Escape In Pot-In-Pot Nursery Production
Jimmy Klick, James S. Owen, Jr. and Heather M. Stoven
Oregon State University, North Willamette Research and Extension Center 15210 NE Miley Road, Aurora, OR 97002
Index Words: pot-in-pot production, root escape, non-conventional containers, Salix
Significance to industry: One major disadvantage of pot-in-pot production (PIP) is that aggressively rooting crops will root out of the plant pot drain holes and into the surrounding soil. The rooting of the plant into the surrounding soil decreases efficiency of harvesting and results in broken containers, damaged crops and possible increased plant stress due to root severance. To address this issue, five container production systems were compared. Results indicated that the water reservoir container and fabric liner systems had less root escape than conventional PIP containers.
Nature of work: Aggressively rooting plants grown in pot-in-pot production (PIP) often root out into the surrounding soil. To address this issue, growers often employ methods to increase air space between the socket and growing pot, use physical barriers such as geotextiles, and apply volatile chemical containing products that form a gaseous barrier between the pots. It has also been suggested that regular pot disturbance will prevent the crop from rooting into the surrounding soil and that biweekly 180 degree rotations of a plant pot could reduce rooting-out, however, labor costs render it prohibitive (5). Chemical control methods to date include copper coated containers, copper impregnated fabric liners and trifluoralin injected nodules. Geotextiles impregnated with trifluoralin nodules (Biobarrier , and SpinOut™) applied to container interiors have shown to control root escape in PIP (5, 6). SpinOut™ may also be incorporated in a fabric liner to prevent rooting out (1). Biobarrier comes in different sets of nodules, with the efficacy of nodule number variable by species. Harris et al (3), successfully controlled root escape in PIP in river birch and Yoshino cherry using 8 and 40 nodule Biobarrier , respectively. However, Ruter (7) found that 128 nodules were not enough to prevent root-out in crape myrtle. The nursery where this study was conducted uses 64 nodules on willow, arborvitae and falsecypress without success (Craig Hopkins, Woodburn Nursery and Azlaeas, personal communication).
Experiments were conducted at Woodburn Nursery & Azaleas Inc. (Woodburn, OR, 45º6’39.95”N 122º48’37.63”W) using Salix integra ‘Hakuro-Nishiki’. The five container production systems included Anovapot -in-Anovapot (AA; Anova Solutions, Chapel Hill, Australia), Anovapot -in-conventional pot (AC; conventional pot was produced by ProCal Inc., Middlefield, OH), rotated conventional pot-in-conventional pot (RC), un- rotated conventional pot-in-conventional pot (UC) and fabric lining in conventional-in- conventional pot (FC; High Caliper Growing Systems, Oklahoma City, OK). Woodburn
Container Grown Plants 270
SNA Research Conference Vol. 56 2011
Nursery & Azaleas use 22.7 liters (6 gallon) (#6 ProCal Inc., Middlefield, OH) conventional PIP containers with spacer (ProCal Inc., Middlefield, OH) and Biobarrier™ (BBA Nonwovens, Reemay, Inc., Old Hickory, TN) geotextiles with nodules that are treated with trifluoralin.
The research experiment began September 25, 2009. Willow roots completely filled the root ball. Several roots were observed growing out of planted pots and into surrounding soil. These roots were long and coarsely rooted. Every plant had roots growing out of drainage holes, which were pruned off prior to transplanting. Anovapots were installed by following manufacturer instructions. In AA treatment, an existing plant was removed from the conventional system and planted into an Anovapot that contained fresh substrate (using identical media as conventional system) from the base of the container to the top of the raised drainage hole, filling the water reservoir. The media used in all treatments was 86% Douglas fir bark and 14% pumice with 10.7 kg•m-3 (18 lb•yd-3) of 10-12 month 17-6-12 (Apex Woody Plant 17N-2.1P-9.1K, J.R. Simplot Company, CA) incorporated. The planted Anovapot was placed inside an Anovapot holder pot. The holder pot had a wick attached to an impermeable layer (corrugated plastic) placed over the centrally raised drainage hole. The planted pot, with three spacers (5 cm x 2.5 cm PVC) spaced evenly underneath the rim, was placed inside the holder pot. In AC treatment, the existing plant was removed from the conventional system and planted into an Anovapot containing fresh substrate from the base of the container to the top of the raised drainage hole. The planted Anovapot was placed inside a conventional holder pot without Biobarrier™ and spacer. In RC treatment, Biobarrier™ was removed from the conventional system. Planted pots were rotated 180 degrees every month. In UC treatment, Biobarrier™ was removed from the conventional system. In FC treatment, a fabric liner (Pot Pruner™, High Caliper Growing Systems, Oklahoma City, OK) was placed inside the conventional Woodburn Nursery PIP system, without the Biobarrier™. The experimental design was a CRBD with four blocks of two repetitions per treatment in each block. All plants were irrigated with spray stakes (5 GPH, Netafim Irrigation Inc., Fresno, CA). In February 2010, pour-thrus were conducted by collecting leachate from each plant and measuring pH and EC (2).
Woodburn Nursery and Azaleas produced Salix integra ‘Hakuro-Nishiki’ that were grafted onto 48 inch whips of Salix x smithiana one month after being planted in 3.8 liters (1 gallon) container in February, 2009. They were transplanted into 22.7 liters (6 gallon) containers four months later and put in PIP. Salix was sheared into a ball form shortly before experiment initiation. Biobarrier™ was removed from existing system.
In July, 2010, plants were harvested. Variables recorded included length of roots rooting out from container drainage hole to the end of the root, dry mass of roots outside containers, a rating of root escape severity, root dry weight, shoot dry weight, and root to shoot ratio. Data were analyzed using ANOVA LSD (α = 0.05) and a priori contrasts to compare selected treatments for effectiveness.
Results and Discussion: Dry weight of roots escaped out of containers was greatest in UC. RC, AA and FC had the lowest root dry weights (Table 1). All dry weight contrasts
Container Grown Plants 271
SNA Research Conference Vol. 56 2011 showed differences between treatments. Root length was lowest in FC (Table 1). AC, AA, UC and RC had higher root lengths and were not different from each other. Only AC, FC and RC were different in root length from UC. All treatments had a lower root escape severity rating than UC (Table 1).
AA willow roots grew into the water reservoir but not into the surrounding soil. Ruter (8) used a similar container called the “moat pot”, which also has a centrally raised drainage hole in the bottom of the pot, creating a water reservoir that reduces rooting- out via water root pruning. The moat pot successfully controlled root escape in Kanzan cherry and Chanticleer pear. Additionally, growth and color advantages for plants in moat pots were reported due to trapping of leached nutrients. Similarly, the AA treatment had a two-fold increase (0.2 dS•m-1) in EC over RC treatment, respectively. However, due to large root mass rooting out of the moat pot, postproduction handling difficulty and stressing plants by severing roots the moat pot was not recommended for production of the two species (8). However, stress severity is largely dependent on amount of roots removed.
Visual differences in root structure were observed between willows grown in AA, conventional and fabric containers: Anovapot roots were coarse, conventional roots were less coarse and fabric roots were fibrous. Root and shoot dry weights and root to shoot ratio were unaffected by treatment (Data not presented). AA treatment samples produced roots that escaped the plant pot, but further escape was prevented by the water reservoir. In FC treatment, only fine roots escaped.
Finding an economically sound solution to root escape will be difficult. Incorporating an alternative container type or fabric liner that may increase material costs will be challenging to introduce to PIP nursery production; however, these initial costs may be able to offset increased labor needed to harvest plants that are rooted into the surrounding soil. Additional issues observed with the Anovapot include rooting into the wicking system, stress from root pruning, and the habitat for pests such as mosquitoes and slugs provided by the water reservoir. However, the severity of Anovapot issues is likely less than conventional system issues.
In conclusion, RC, AA and FC reduced root escape and had little effect on crop quality. Additionally, these systems improve worker satisfaction by facilitating ease of harvest. However, each of these systems has its advantages and disadvantages. Further research is warranted to understand economic impacts, field performance and stress effects of each possible system.
Literature Cited 1. Beeson Jr, R.C. and K. Keller. Effect of cyclic irrigation on growth of magnolias produced using five in-ground systems. J. Environ. Hort. 21:148-152. 2. Bilderback, T.E. 2001. Using the PourThru procedure for checking the EC and pH for nursery crops. Horticulture Information Leaflet-401, North Carolina State University, North Carolina Cooperative Extension Service.
Container Grown Plants 272
SNA Research Conference Vol. 56 2011
3. Harris, J.R., A.X. Niemiera, R.D. Wright and C.H. Parkerson. 1996. Chemically controlling root escape in pot-in-pot production of river birch and Yoshino cherry. HortTech. 6:30-34. 4. Mathers, H. 2000. Pot-in-pot container culture. The Nursery Papers: 2:1. 5. Newman, S.E. and J.R. Quarrels. 1994. Chemical root pruning of container-grown trees using trifluralin and copper impregnated fabric. Proc. SNA Res. Conf. 39:75-76. 6. Ruter, J.M. 1994. Evaluation of control strategies for reducing rooting-out problems in pot-in-pot production systems. J. Environ. Hort. 12:51-54. 7. Ruter, J.M. 1996. Biobarrier rate influences rooting-out of five tree species produced pot-in-pot. Proc. SNA Res. Conf. 41:104-106. 8. Ruter, J.M. 1999. Production system influences growth of ‘Kanzan’ Cherry and ‘Chanticleer’ Pear. Proc. SNA Res. Conf. 44:34-36.
Table 1. Dry weight, length, and severity rating of escaped roots of Salix integra ‘Hakuro-Nishiki’. 0 rating = no root escape, 5 rating = high root escape.
Container Type Dry weight (g) Length (cm) Rating ______
Unrotated Convential (UC) 19 az 56 a 5.0 Rotated Conventional (RC) 5 c 38 ab 3.8 Anovapot-in-Anovapot (AA) 2 c 57 a 3.3 Anovapot-in-Conventional (AC) 12 b 58 a 3.3 Fabric-n-Conventional (FC) 1 c 31 b 3.3
Contrasts
AA vs AC **W NSy NS AA vs UC ** NS *x AC vs UC ** ** ** FC vs UC ** ** ** RC vs UC ** ** ** ______zMeans followed by different letters within a column are significantly different based on Fishers LSD means separation procedure (α = 0.05). yNS, Not significant xSignificant at P ≤ 0.01 wSignificant at P ≤ 0.05
Container Grown Plants 273
SNA Research Conference Vol. 56 2011
Pine Tree Substrate Properties: Before and After Production
Emily Lumpkin, Brian Jackson, Helen Kraus, Bill Fonteno, and Ted Bilderback
Department of Horticultural Science North Carolina State University, Raleigh, NC 27695-7609
Index Words: substrate, amendment, composted cotton stalks, cotton gin trash
Significance to Industry: Both pine bark (PB) based and whole pine tree (PT) based substrates amended with composted cotton stalks (CT), cotton stalks composted with a nitrogen source (CT+N), and cotton gin trash (CGT) maintained acceptable physical properties throughout a 22 simulated production period. Additionally, all PB-based and PT-based substrates amended with CT, CT+N, and CGT maintain physical properties over time that were more favorable, and potentially would support plant growth better, than PB alone.
Nature of Work: A survey by Lu, et al. (3) found a decline in pine bark availability across the southeast with associated increased cost due to less domestic forestry production, imported logs without adhering bark, increase rate of ‘in-forest’ wood harvesting that leaves bark behind on the forest floor, and increase use of pine bark as a fuel source. Consequently, less than 5% of the forest product inventory of pine bark is available for horticultural use. Pine bark is desirable as a nursery substrate for growing plants in containers because it is light in weight, well-drained, well-aerated, pathogen- free, disease suppressive, and relatively stable over time in production. The possibility of losing pine bark as a substrate has stimulated much research investigating alternatives to pine bark-based substrates.
Many alternative substrate components and substrate bases show promise in that they are non-toxic to plants and can be successfully used as an amendment with pine bark stretching our pine bark supplies and creating acceptable growing substrates. However, cost, regional availability, insufficient research and production guidelines for their use reduce their widespread adoption. Additionally, stability of substrate components over time must be evaluated to assess changes in air space and water hold capacity. Time in production (68 weeks) did not alter the total porosity (TP), plant unavailable water content (UW), or bulk density (BD) of pine bark amended with builders sand, expanded slate, or calcined attapulgite clay; however TP of granite and mortar sand amended pine bark substrates increased with time in production due decomposition of the larger faction of pine bark particles while BD of these substrates decreased (2). Air space (AS) and plant available water (AW) did not change over time with the granite and mortar sand amended pine bark substrates (2). Jackson, et al., (1) found that whole pine tree substrate (PTS) had greater AS than PB and that AS decreased in both substrates over time in production with AS remaining greater in the whole pine tree
Container Grown Plants 274
SNA Research Conference Vol. 56 2011 substrate than the aged pine bark. Decomposition of organic components in substrates may not remain stable and may decompose at different rates depending on the physical integrity of the organic constituent.
The goal of this project was to evaluate organic, alternative substrate components for their stability over time during production of nursery crops. This project is part of a larger goal to provide the nursery industry in the southeast with regionally available alternative potting substrates that will keep the industry competitive and continue demand for their products in the competitive nursery industry.
Fallow three quart (2.8 L) containers were filled with either pine bark-based (PB) or whole pine tree-based (PT) substrates that had been amended (v/v) with cotton stalks composted without a nitrogen (N) source (CS), cotton stalks composted with a N source (CS+N), or cotton gin trash (CGT). A factorial treatment arrangement of these substrate bases (PB and PT) and amendments (CS, CS+N, and CGT) resulted in six substrates: 4:1 PB : CS (PBCS), 4:1 PB : CS (PBCS+N), 9:1PB : CGT (PBCGT), 1:1 PT : CS (PTCS), 1:1 PT : CS+N (PTCS+N), and 1:1 (v/v) PT : CGT (PTCGT) arranged in a RCBD. An industry control 100% PB substrate was included in the experimental design for comparisons.
Fallow containers were irrigated as if in production. Irrigation was applied by a low volume spray stake (PC Spray Stake, Netafim, Ltd., Tel Aviv, Israel) that delivered 3.2 GPH. Leaching fractions were measured from each substrate every two weeks and irrigation volume was adjusted accordingly.
Physical properties [total porosity (TP), air space (AS), container capacity (CC), available water (AW), unavailable water (UW), and bulk density (BD) were determined from substrate in these fallow containers 4 weeks and 22 weeks after potting. Fallow containers were arranged in a RCBD with 2 sample times, 7 substrates, and 3 replications. All variables were tested for differences using analysis of variance procedures and lsd means separation procedures where appropriate. When a non- significant sample time x substrate interaction was in effect, only main effects of sample time and substrate were presented.
Results and Discussion: The sample time x substrate was significant for all the physical properties measured; therefore, the data were reanalyzed by sample time and substrate. TP, AS, CC, and UW decreased for most of the substrates over time (Table 1). However, AW increased for PBCS, PTCS, and PB while AW decreased for PBCS+N, PTCS+N, and PBCGT with time. TP and AS for all PT-based substrate was greater than the PB-based counterpart for both samples times (Table 1). Jackson et al., (1) also found that AS decreased with time in PT-based substrates and remained higher than PB-based substrates. However Jackson et al. (1) found that CC for PT-based and PB-based substrates were not different, while in our study CC was lower for all PT-based substrates than the PB- based counterpart at each sample time except PBCGT and PTCGT which were not different from each other (Table 1). At four weeks, AW was highest in the PTCGT
Container Grown Plants 275
SNA Research Conference Vol. 56 2011 substrate and lowest in the PB while UW was lowest with PTCGT and highest with the PBCGT and PB substrates. By 22 weeks, PBCS+N and PTCS+N had the greatest AW with all other substrates having lower and similar AW. PBCGT has the greatest UM values at 22 weeks.
Both PB-based and PT-based substrates amended with CT, CT+N, and CGT maintained acceptable physical properties throughout a 22 simulated production period (Table 1). Additionally, all PB-based and PT-based substrates amended with CT, CT+N, and CGT maintain physical properties over time that were more favorable, and potentially would support plant growth better, than PB alone.
Literature Cited: 1. Brian E. Jackson, Robert D. Wright, and John R. Seiler. 2009. Changes in Chemical and Physical Properties of Pine Tree Substrate and Pine Bark During Long-term Nursery Crop Production. HortScience 44:791-799. 2. Brian Jackson, Helen Kraus, and Ted Bilderback. 2010. What to do when pine bark runs short: physical properties of pine bark amended substrates. Proc. Southern Nursery Assoc. Res. Conf. 55: 416-418. 3. Lu, W., J.L. Sibley, C.H. Gilliam, J.S. Bannon, and Y. Zhang. 2006. Estimation of U.S. bark generation and implications for horticultural industries. J. Environ. Hort. 24:29-34.
Table 1. Effect of substrate on total porosity (TP), air space (AS), container capacity (CC), available water (AW), unavailable water (UW), and bulk density of pine bark (PB) based and whole pine tree (PT) based substrates. Substratez TP (% vol.) AS (% vol.) CC (% vol.) AW (% vol.) UW (% vol.) BD (g/cc3) 4 22 4 22 4 wks 22 4 22 4 wks 22 4 22 wks wks wks wks wks wks wks wks wks wks PBCS 88.5 75.7 31.9 19.8 56.7 56.0 20.4 28.8 36.2 27.2 0.23 0.26 ab d b cd bc a bc a bc abc b ab PTCS 92.5 93.2 39.0 36.2 53.5 c 57.0 24.5 34.2 29.0 22.8 0.12 0.11 a a a a a bc a de bc d d PBCS + N 88.8 75.3 29.4 24.2 59.4 51.2 24.4 21.6 35.1 c 29.6 0.24 0.25 ab d bc bc ab b bc b a b b PTCS + N 93.0 80.3 37.6 37.0 55.4 c 43.3 24.6 17.9 30.8 d 25.4 0.13 0.13 a c a a c b b bc d c PBCGT 85.9 74.9 25.8 17.0 60.1ab 57.9 21.0 18.7 39.2 a 30.3 0.26 0.27 b d c d a bc a c a a PTCGT 91.8 85.6 31.2 27.5 60.6 a 58.1 34.1 34.8 26.5 e 23.3 0.16 0.15 a b b b a a a bc c c PB 88.0 76.9 32.4 20.3 55.6 c 56.5 16.3 28.4 39.3ab 28.1 0.23 0.26 a d b cd a c a ab b ab zMeans within a column with different letters are significantly different from each other based on lsd mean separation procedures (p>0.05). The substrates consisted of: 4:1 PB : CS (PBCS), 4:1 PB : CS+N (PBCS+N), 9:1PB : CG (PBCG), 1:1 PT : CS (PTCS), 1:1 PT : CS+N (PTCS+N), and 1:1 PT : CG (PTCG). CS = composted cotton stalks, CS+N = composted cotton stalks with a nitrogen source added during composting, and CGT = aged cotton gin trash.
Container Grown Plants 276
SNA Research Conference Vol. 56 2011
Pruning Effects on Trade #3 Viburnum odoratissimum Growth and Leaf Area
Jeff Million1, Tom Yeager1 and Joseph Albano2
1Dept. of Environmental Horticulture, Univ. of Florida, IFAS, Gainesville, FL 2U.S. Horticultural Research Laboratory, USDA-ARS, Ft. Pierce, FL
Index words. biomass, root, shoot, size index, sweet viburnum
Significance to the Industry. The effects of several pruning schedules on subsequent growth of an ornamental shrub were determined. Results showed that delaying first prune from 9 to 16 weeks after planting improved subsequent plant growth. When pruned 9 weeks after planting, using a sickle bar cutter to make a horizontal prune of the plant canopy gave similar results to hand tip-pruning of main branches which may have labor implications. Pruning at 16 weeks after planting did not reduce growth compared to unpruned plants which indicated that properly-timed pruning can improve quality without negatively affecting crop time.
Nature of Work. Pruning of ornamental shrubs is practiced to create well-branched plants which will meet quality standards of the marketable product. Previously reported research with sweet viburnum grown in trade #1 containers (1) found that early pruning six weeks after transplanting severely reduced the growth of or killed young plants while pruning nine weeks after transplanting resulted in high quality plants. Unpruned plants required 15 weeks to achieve the same marketable height that pruned plants achieved in 21 weeks. The purpose of this study was to compare several pruning practices on subsequent growth of sweet viburnum grown in trade #3 containers. Results will be used in a systems model which simulates production based upon selected management practices such as pruning.
On 9 April 2008, sweet viburnum [Viburnum odoratissimum (L.) Ker Gawl.] liners were planted one per trade #3 container [28-cm (11 inch) top diameter and fill volume of 10 L; C1200, Nursery Supply Inc.; Kissimmee, FL] filled with a substrate composed (by volume) of 2 pine bark:1 sphagnum peatmoss:1 coarse sand. An 18N-2.6P-10K controlled-release fertilizer (Osmocote Classic 18-6-12, 8-9 month release at 75oF; Scotts Co.; Marysville, OH) was incorporated into the substrate at 90 g/container (3 lb N/yd3). Shoot height and plant width were measured at planting and two months later on June 10. Size on June 10 was used to distribute 96 plants into 12 pruning-harvest treatments (3 pruning schedules x 4 destructive harvests x 8 replications). Containers were placed in a pot-to-pot (784 cm2/container) arrangement for the first 16 weeks. Containers were spaced 15 cm (6 inch) apart (1620 cm2/container) on 1 August 2010 until 1 Oct 2010 at which time they were spaced 23 cm (9 inch) apart (2240 cm2/container) until the end of the experiment. Four pruning schedules were evaluated
Container Grown Plants 277
SNA Research Conference Vol. 56 2011
(Table 1). Mechanical pruning entailed using an electric hedge trimmer with a sickle bar cutting mechanism to make a horizontal cut at a height pre-determined to result in the removal of 1-2 of the uppermost nodes from main stems of most plants in the treatment group. Tip pruning entailed using hand shears to remove 1-2 terminal nodes from main branches. Destructive harvests were made at each prune date (Table 1) and on 20 Nov 2010 when the experiment was terminated (32 weeks after planting). Shoot height and width, shoot and root biomass, and leaf area (LA) were determined at each harvest. If pruned, size was measured before and after pruning and biomass and leaf area of pruned plant tissue determined. An ANOVA was conducted for each harvest using a RCBD with four pruning schedules and eight blocks (one replication per treatment- block).
For the two early pruning schedules, mechanical pruning reduced plant height 13% (24 vs. 21 cm) and width 8% (23 vs. 21 cm) while tip pruning reduced plant height 15% (27 vs. 23 cm) but width was unaffected (23 cm). Early mechanical pruning reduced shoot weight 22% (6.4 vs. 8.2 g/plant) and leaf area 27% (460 vs. 620 cm2/plant). Tip pruning resulted in less removal of biomass and LA than mechanical pruning, removing 14% of shoot weight and 20% of LA. Waiting until week 15 for first prune (midseason mechanical pruning treatment) resulted in lower percent reductions in height, biomass and leaf area than first prune for early pruning treatments. The first midseason mechanical pruning reduced plant height 5% (41 vs. 43 cm) and width 6% (47 vs. 50 cm) removing 7% shoot weight (39 vs. 42 g/plant) and 7% LA (3460 vs. 3720 cm2/plant).
The effect of pruning schedules on overall growth is depicted in Figs. 1-3. Subsequent growth of early pruned plants was not different for mechanical vs. tip treatments so only results for early tip pruning are given in these figures and discussed now. By the third harvest (week 23) height and width of unpruned plants averaged 61 and 76 cm, respectively. Pruned treatments resulted in plants at week 23 with heights of 53 to 55 cm and widths of 58 to 62 cm so that pruning, regardless of schedule, reduced plant height approximately 10% and width approximately 20%. While plant height and width at week 23 were unaffected by pruning method, early pruning resulted in lower shoot weight (93 vs. 112 g/plant), and LA (6710 vs. 7910 cm2/plant) than midseason pruning; unpruned plants had an average shoot weight of 131 g/plant and LA of 9860. During the last 9 weeks of growth, midseason-pruned plants continued to produce more biomass and leaf area than early pruned plants so that at the end of the experiment midseason-pruned plants had 21% greater shoot weight (271 vs. 225 g/plant) and 19% more LA (17210 vs. 14400 cm2/plant) than early-pruned plants. Final biomass and LA of unpruned plants were 277 g/plant and 17950 cm2/plant, respectively, which were not significantly different than respective values observed for midseason-pruned plants. Final root weight for early pruned plants (74 g/plant) was less than for unpruned plants (114 g/plant) but not significantly different than midseason pruned plants (90 g/plant). Pruning treatments had no effect on root weights determined for the earlier three harvests.
Container Grown Plants 278
SNA Research Conference Vol. 56 2011
Results indicate that waiting until 15 weeks after planting to first prune sweet viburnum grown in #3 containers resulted in greater final growth than if plants were first pruned after 9 weeks of growth. Under the conditions of this experiment, each pruning reduced plant height and width only 5-15% (3-11 cm); more severe pruning likely would have more significant effects on subsequent growth and quality.
Literature Cited
1. Million, J., T. Yeager, and J. Albano. 2009. Pruning effects on trade #1 sweetviburnum growth and leaf area. Proc. South. Nursery Assoc. Res. Conf. 54:195-197.
Acknowledgements. This project was made possible through grant support from the USDA-ARS Floral and Nursery Research Initiative. Mention of trade names and companies does not constitute an endorsement.
Table 1. Pruning schedules evaluated for sweet viburnum in trade #3 containers planted 9 April 2010 and finished 20 Nov 2010 (32 weeks after planting).
10 June July 26 16 Sept. Pruning treatment (week 9) (week 15) (week 23)
Early mechanical yes (sickle bar) yes (tip) yes (tip) Early tip yes (tip) yes (tip) yes (tip) Midseason mechanical no yes (sickle bar) yes (tip) Un-pruned no no no
Container Grown Plants 279
SNA Research Conference Vol. 56 2011
Fig. 1. Effect of pruning schedules on height and width of sweet viburnum in trade #3 containers. Early prune plants were first pruned 62 days after planting (DAP) while midseason pruned plants were first pruned 108 DAP. Early pruned plants were subsequently pruned on 108 DAP and again on162 DAP while midseason pruned treatment was also pruned 162 DAP. Symbols represent the average of 8 replications and error bars represent LSD0.05 for comparing means at each day measurements were taken. On prune days, values both before and after pruning are plotted.
Container Grown Plants 280
SNA Research Conference Vol. 56 2011
Fig. 2. Effect of pruning schedules on shoot and root biomass of sweet viburnum in trade #3 containers. Early pruned plants were first pruned 62 days after planting (DAP) while midseason pruned plants were first pruned 108 DAP. Early pruned plants were subsequently pruned on 108 DAP and again on162 DAP while midseason pruned treatment was also pruned 162 DAP. Symbols represent the average of 8 replications and error bars represent LSD0.05 for comparing means at each day measurements were taken. On prune days, shoot weight values both before and after pruning are plotted.
Container Grown Plants 281
SNA Research Conference Vol. 56 2011
Fig. 3. Effect of pruning schedules on leaf area of sweet viburnum in trade #3 containers. Early pruned plants were first pruned 62 days after planting (DAP) while midseason pruned plants were first pruned 108 DAP. Early pruned plants were subsequently pruned on 108 DAP and again on162 DAP while midseason pruned treatment was also pruned 162 DAP. Symbols represent the average of 8 replications and error bars represent LSD0.05 for comparing means at each day measurements were taken. On prune days, values both before and after pruning are plotted.
Container Grown Plants 282
SNA Research Conference Vol. 56 2011
Fertilizer Effects on Annual Growth in Sweetgum, Hickory, and Cedar Substrates
Anna-Marie Murphy1, Charles H. Gilliam1, Glenn B. Fain1, Tom V. Gallagher2, H. Allen Torbert3,and Jeff L. Sibley1
1Department of Horticulture, 101 Funchess Hall, Auburn University, AL 36849 2Dept. of Forestry/Wildlife Sciences, 602 Duncan Drive, Auburn University, AL 36849 3USDA-ARS National Soil Dynamics Laboratory, 411 S. Donahue Drive Auburn, AL 36832
Index Words: perlite, peat, container media, alternative substrates, WholeTree
Significance to Industry: Expanded perlite has long been used as an amendment in container mediums because of its ability to add air space to container substrates without adding to bulk density or affecting substrate pH and EC. Although products such as perlite are thought to be beneficial for plant growth, perlite itself has long been identified as a lung and eye irritant by growers across the country. Recent research has focused on identifying and evaluating potential alternatives to perlite for use in the greenhouse production of annual crops. Data from this study shows that petunias and vinca grown in a 75:25 peat:redcedar substrate are comparable to plants grown in a traditional 75:25 peat:perlite substrate. Additionally, data indicate that an increase in liquid fertilizer rate from 100 ppm N to 300 ppm N had no effect on flower count, growth indices or plant dry weight of petunias in sweetgum, hickory or cedar-amended substrates, and no effects on vinca growth indices in the same alternatives.
Nature of Work: For years, growers have voiced complaints about the hassle associated with amending their container substrate mixes with perlite. Up until now, perlite has simply been considered a general nuisance due to its dusty nature. However, recent literature has made possible associations between heavy exposure to perlite, persistent reactive airway disfunctive syndrome (1), and a decrease in the lung transfer factor, or carbon monoxide (CO) diffusing capacity (4). These findings have caused growers to seek alternative greenhouse substrate amendments with equivalent characteristics to perlite.
Previous work from these authors has identified several promising alternatives to perlite and peat, including sweetgum (SG) (Liquidambar styraciflua), hickory (H) (Carya spp.) and eastern redcedar (RC) (Juniperus virginiana) (3). Preliminary research has shown that substrates amended with up to 50% RC produce plants similar to plants grown in a traditional 75:25 peat:perlite substrate, and that SG and H could potentially be suitable alternatives with changes in standard greenhouse practices such as watering and fertilization regimes. The objective of the current study was to evaluate the performance of SG, H and RC-amended substrates with three different liquid fertilizer (LF) formulations (100, 200 and 300 ppm N).
Container Grown Plants 283
SNA Research Conference Vol. 56 2011
This study was conducted at the Paterson Greenhouse Complex on the campus of Auburn University. SG and H were harvested from the forest on February 16, 2009 and RC was cut on February 17, 2009. All trees were de-limbed at the time of cutting, and chipped through a Vermeer BC1400XL chipper on February 19, 2009. SG, H and RC were then stored in 55-gallon waterproof bins until milling date. Fresh WholeTree (WT) chips were obtained from Young’s Plant Farm (Auburn, AL) on August 4, 2009. All wood was then ground further through a ¼” screen in a swinging hammer-mill (No. 30; C.S. Bell, Tifton, OH) on August 4, 2009. Each wood material was combined with 75% (by volume) Canadian sphagnum peatmoss and compared with an industry standard mix of 75:25 peat:perlite (by volume). A 75:25 peat:WT blend was also used as a secondary standard. Substrate treatments were mixed on August 5, 2009, and were initially amended with 5 lb/yd3 dolomitic limestone. AquaGro-L® wetting agent was incorporated at mixing at a rate of 4 oz/yd3. Pots were filled with substrates level to the top of the container and two plugs from 288-cell flats of either petunia (Petunia hybrida ‘Celebrity Blue’) or vinca (Catharanthus roseus ‘Cooler Rose’).
On August 7, 2009 [2 days after planting (DAP)], 100 ml of one of three LF formulations was applied to each experimental unit each Monday and Friday. A total of thirteen LF applications occurred (Aug. 7, 10, 14, 17, 21, 24, 28, and 31; Sept. 4, 7, 11, 14, 18). The three LF formulations applied were either 100 ppm N 20-10-20, 200 ppm N (100 ppm N 20-10-20 + 100 ppm N 34-0-0), or 300 ppm N (100 ppm N 20-10-20 + 200 ppm N 34-0-0).
Data collected included pour-thru leachates on vinca to determine pH and electrical conductivity (EC) at 0, 7, 14, 30 and 45 DAP (n=4). In addition, flower count (number of open blooms or blooms showing color) and growth indices (GI) [(height + width1 + width2)/3] were determined at study termination (45 DAP) (n=8). Plant dry weights (PDW) were also determined from the above-ground shoot portion at 46 DAP (n=4).
Containers were arranged in a randomized complete block design (RCBD) with eight single-plant replications per treatment. Each plant species tested was treated as separate experiments. Data were subjected to analysis of variance using the general linear models procedure and multiple comparison of means was conducted using Tukey’s honest significant difference test at α=0.05. LF rates were tested for a linear and quadratic response using single degree of freedom orthogonal contrasts (Version 9.1.3; SAS Institute, Inc., Cary, NC).
Results and Discussion: The recommended range for initial pH of a growing medium containing vinca is between 5.5 and 6.0 (2). As the plant grows, the pH may climb higher, but is not recommended to climb over 6.5, due to potential iron deficiencies in vinca. Before planting, pH was highest in the 75:25 peat:SG substrate (5.4), although it was similar to the traditional 75:25 peat:perlite substrate (5.3) (Table 1). Neither substrate nor liquid fertilizer rate had any effect on pH at both 7 and 14 DAP. By 30 DAP, pH values in the 75:25 peat:WT substrate increased with increasing fertilizer rate, but no other substrates were affected. LF rate had no affect on pH of any substrate treatment by 45 DAP, although substrate alone did have some affect; 75:25 peat:SG
Container Grown Plants 284
SNA Research Conference Vol. 56 2011 substrates had the highest pH values of any reported [6.9 at 100 and 300 ppm N and 7.0 at 200 ppm N). Previous research on the use of SG as a substrate amendment did not reflect these high pH values by 45 DAP (3). EC values are not recommended to rise above 1.0 dS/m for substrates containing vinca (2). At no point throughout the study did any EC value from any treatment reach 1.0 dS/m (Table 1). At planting, the 75:25 peat:RC treatment had the highest EC value of any substrate (0.93 dS/m). The 75:25 peat:WT treatment had the lowest EC value (0.58 dS/m). At 7 DAP, EC values in the traditional 75:25 peat:perlite, 75:25 peat:SG and 75:25 peat:H substrates increased with increasing LF rates. Both 75:25 peat:RC and 75:25 peat:WT substrates were unaffected by LF rate at 7 DAP. By the end of the study (45 DAP), no substrates were linearly affected concerning EC by an increase in LF rate.
In general, petunia flower number was greatest in the traditional 75:25 peat:perlite substrate, although flower numbers for both the 75:25 peat:RC and 75:25 peat:WT substrates were comparable (Table 2). Petunias in the 75:25 peat:perlite substrate were the only ones affected by LF rate, as flower count generally increased with an increase in LF rate. Vinca flower number was also greatest in the 75:25 peat:perlite substrate. However, in addition to the 75:25 peat:perlite substrate, both the 75:25 peat:H and 75:25 peat:WT substrates were positively affected by an increase in LF rate. For both petunia and vinca in the study, GI was not affected by substrate or LF rate (Table 2). Petunia and vinca PDW were generally greatest in the 75:25 peat:perlite treatments, although with both species the 75:25 peat:RC and 75:25 peat:WT treatments were similar (Table 2). Petunia PDW increased in the 75:25 peat:perlite treatment with an increase in LF rate, although no other substrates were affected. Alternatively, vinca PDW increased with an increase in LF rate in every substrate with the exception of 75:25 peat:SG.
Combined, this data shows that petunias and vinca grown in a 75:25 peat:RC substrate are comparable to plants grown in a 75:25 peat:perlite substrate. Additionally, data indicate that an increase in LF rate from 100 ppm N to 300 ppm N had no effect on flower count, GI or PDW of petunias in SG, H or RC-amended substrates, and no effects on vinca GI in these same alternatives.
Literature Cited 1. Du, C., J. Wang, P. Chu, and Y. Guo. 2010. Acute Expanded Perlite Exposure with Persistent Reactive Airway Dysfuntion Syndrome. Industrial Health 48:119-122. 2. Kessler, J.R., Jr. 1998. Greenhouse Production of Annual Vinca. Alabama Coop. Ext. Sys. ANR-1119. 3. Murphy, A.M., C.H. Gilliam, G.B. Fain, T.V. Gallagher, H.A. Torbert, and J.L. Sibley. 2010. Hardwood Amended Substrates for Annual Plant Production. Proc. Southern Nursery Assn. Res. Conf. 55:385-388. 4. Polatli, M., M. Erdinç, E. E Erdinç, and E. Okyay. 2001. Perlite Exposure and 4-Year Change in Lung Function. Environ. Res. 86:238-243.
Container Grown Plants 285
SNA Research Conference Vol. 56 2011
Container Grown Plants 286
SNA Research Conference Vol. 56 2011
Container Grown Plants 287
SNA Research Conference Vol. 56 2011
Evaluation of Eight Slow-release Fertilizers on the Growth of Container-grown Spiraea x bumalda L. ‘Anthony Waterer’
James Robbins and Celina Gomez
Univ. of Ark. CES, 2301 S. Univ. Ave, Little Rock, AR 72204
Index Words: nutrition, nursery
Significance to Industry: Based on the visual quality rating and the growth data, it would appear that container growers have several new slow-release fertilizer options. This project illustrates the value to growers in establishing small scale fertilizer trials to evaluate appropriate products under their growing conditions.
Nature of Work: Slow-release fertilizers are the primary product used in the container nursery industry today. These technologies offer advantages to growers when compared to soluble granular fertilizer sources in that they offer the potential to reduce the amount of leachate loss of nutrients and decrease the number of applications required (1,2,3,4,5,6). The primary purpose of this research was to evaluate some of the newer slow-release fertilizers available to container growers.
The experiment was conducted on an outdoor gravel container bed gravel area at the University of Arkansas Horticulture Research Farm (UAHRF) in Fayetteville, AR. On 6 May 2010, spirea (Spiraea x bumalda L. ‘Anthony Waterer’) liners were potted in # 2 plastic containers (Classic 600, Nursery Supplies Inc., Chambersburg, PA) using composted pine bark (SunGro, Pinebluff, AR) amended with pelletized dolomitic lime (M.K. Minerals, Manhattan, KS) at a rate of 15 lb·yd-3. Fertilizer products (Table 1) were applied at planting. The incorporation of fertilizer into the media was done by hand.
Irrigation was applied as needed by hand watering. Treatments consisted of 8 single plant reps. The design was a completely randomized design. Containers were initially spaced can-tight, but spread to a 1X spacing after mid-July.
Total soluble salts were measured 12 times over the 130 days of the study using the Virginia Tech pour-through method. Plants were harvested on 13 September 2010. Final plant width and height was recorded and a growth index (π x r2 x height) calculated. Shoots were dried in a forced-air oven (40 °C) for 48 hr and recorded as dry weight data.
Results and Discussion: In general, leachate ECs for incorporation treatments were higher than for topdress (Table 2). All EC values tended to be the highest within the first 3 DAT but fell to acceptable levels by the end of the first week. For fertilizers that were incorporated, EC’s for Crystal Green 17-5-9 (P) were higher during the period 28
Container Grown Plants 288
SNA Research Conference Vol. 56 2011
DAT to 56 DAT than both Osmocote fertilizers (L & M), however, the Crystal Green was lower than both Osmocote products at day 98.
Although a subjective measure, all spirea were of a saleable quality at harvest except for the unfertilized plants (F). In general, the trends for the final growth index and the shoot dry weight (SDW) were quite similar (Table 3). Shoot dry weight for all fertilizer treatments was significantly greater than for unfertilized plants (F). Incorporation of Osmocote Plus Hi-start 16-9-12 (L) resulted in the greatest SDW, however, this was statistically similar to results for Osmocote 16-9-11 topdress (A ), Osmocote 17-5-11 topdress (C), and Plantacote 14-8-15 (K). It is worth noting that in mid-July plants fertilized with the Crystal Green 17-5-9 fertilizer displayed a striking ‘bleaching’ of the new foliage, however, this symptom was totally absent at the final harvest. The 4-5 month Crystal Green 15-5-12 fertilizer performed well against the other 8-9 month longevity fertilizers especially considering how atypically hot the Fayetteville summer was.
Literature Cited
1. Cabrera, R. I. 1997. Let the Nutrients Flow….Slowly. American Nurseryman 185(5): 32-35 2. Hulme, F. 2008. Controlled-release Fertilizers Give Growers Results. Nursery Management & Production. 24(3): 51-53 3. Landis, T.D. and R.K. Dumroese. 2009. Using Polymer-coated Controlled- release Fertilizers in the Nursery and After Outplanting. Forest Nursery Notes 29(1): 5-12 4. Ruter, J.M. 1992. Leachate Nutrient Content and Growth of Two Hollies as Influenced by controlled Release Fertilizers. J. Environ. Hort. 10(3): 162-166. 5. Worrall, R.J., G.P. Lamont, M.A. O’connell, and P.J. Nicholls. 1987. The Growth Response of Container-grown Woody Ornamentals to Controlled-release Fertilizers. Scientia Hortic. 32:275-286 6. Zinati, G. 2005. Nutrients and Nutrient Management of Containerized Nursery Crops. Rutgers Coop. Ext. Serv. Bulletin E303
Container Grown Plants 289
SNA Research Conference Vol. 56 2011
Table 1. Fertilizer products, rates, and method of application. Fertilizer Manufacturer/Brand Analysis Longevity lb N/ Applied As Treatment (mo) yd3 Code J Nutricote Total 17-7-8 8 - 9 [Type 1.5 topdress A Scotts/Osmocote Plus 16-9-12 8270] - 9 1.5 topdress L Scotts/OsmocoteHi-start* Plus 16-9-12 8 - 9 2.0 incorporation C Scotts/OsmocoteHi-start* Pro* 17-5-11 8 - 9 1.5 topdress M Scotts/Osmocote Pro* 17-5-11 8 - 9 2.0 incorporation P Crystal Green blend* 17-5-9 8 2.0 incorporation H Crystal Green blend* 15-5-12 4 - 5 1.5 topdress K Plantacote* 14-8-15 8 - 9 1.5 topdress B Florikote* 17-5-11 8 – 9 [Type 1.5 topdress E Harrells 18-4-8 8270] - 9 1.5 topdress F Unfertilized check - - - - *’new’ fertilizer technology
Table 2 Leachate electrical conductivity (EC) measurements over 126 days for #2 container- grown spirea grown in Fayetteville, AR in 2010. Values represent an average of at least two leachate samples collected using the pour-through method. EC (mmho/cm) - DAT Fertilizer 1 3 5 7 14 21 28 42 56 70 98 126 Treatment Code J 0.1 0.13 0.17 0.1 0.19 0.12 0.21 0.29 0.28 0.15 0.2 0.15 A 0.23 0.58 0.43 0.6 0.45 0.5 0.38 0.4 0.3 0.19 0.23 0.19 L 1.02 1.15 1.48 0.83 0.58 1.05 0.53 0.78 0.63 0.25 0.33 0.15 C 0.5 0.95 0.82 0.48 0.28 0.3 0.2 0.3 0.2 0.15 0.17 0.15 M 1.47 0.85 1.07 0.25 0.33 0.5 0.25 0.55 0.39 0.23 0.9 0.16 P 1.7 1.05 1.07 0.4 0.41 0.78 0.85 1.5 0.82 0.18 0.23 0.16 H 1.0 1.45 1.05 0.35 0.48 0.62 0.35 033 0.38 0.15 0.15 0.13 K 0.2 0.57 0.38 0.33 0.33 0.37 0.35 0.78 0.4 0.18 0.23 0.18 B 0.31 1.0 0.58 0.25 0.13 0.15 0.28 0.4 0.37 0.18 0.23 0.15 E 0.37 0.45 0.4 0.17 0.1 0.27 0.4 0.73 0.47 0.21 0.2 0.19 F 0.1 0.1 0.1 0.1 0.1 0.1 0.15 0.15 0.15 0.1 0.1 0.1
Container Grown Plants 290
SNA Research Conference Vol. 56 2011
Table 3. Effect of fertilizer treatments on the final growth of container-grown spirea. z Fertiilzer Growth Index Shoot Dry Treatment (m3) Weight (g) Code J 0.013 bcdY 67.4 bc A 0.021 abc 71.5 ab L 0.027 a 75.7 a C 0.015 bc 67.7 abc M 0.019 abc 65.9 bc P 0.015 bc 64.5 bc H 0.011 cd 60.9 c K 0.023 ab 70.3 ab B 0.010 cd 59.9 c E 0.012 bcd 62.1 c F 0.002 d 50.2 d Z growth index: π x r2 x height Y Mean separation within a column by Tukey LSD (P=0.05)
Container Grown Plants 291
SNA Research Conference Vol. 56 2011
Cedar Substrate Particle Size Affects Growth of Container-Grown Rudbekia
Zachariah Starr, Cheryl Boyer, Jason Griffin
Kansas State University Department of Horticulture, Forestry and Recreation Resources, Manhattan, KS 66506
Index Words: alternative substrates, container media, eastern redcedar, nursery crops, pine bark, Rudbeckia fulgida
Significance to Industry: This study evaluated the growth of a perennial crop, Rudbeckia fulgida var. fulgida (black-eyed susan), in five substrates consisting of either pine bark (PB) or cedar (Juniperus virginiana L.) chips ground to pass a 3/16-, 3/8-, 1/2- or 3/4-inch screen. As substrate particle size increased shoot dry weight decreased though plant growth indices was generally similar and most plants were marketable. Substrate EC did not vary between treatments at any rating date while pH varied at each rating date until termination at which time pH of all treatments pHs had reached a similar level. These results indicate that J. virginiana chips can be used as a substrate for container-grown Rubeckia when processed at all 4 screen sizes, but performed best at 3/16-inch screen size.
Nature of Work: Pine bark is the typical material used for nursery production of container grown plants throughout the much of U.S. (11). With the closing and relocation of timber mills and use of PB as an alternative energy source for those mills, PB is becoming less available and more costly to purchase (4, 6). Regions without large pine forests, such as the Great Plains, experience a compounded price increase due to transportation costs for nursery substrates. This has lead to a demand for alternative substrates to supplement or replace PB supplies. Eastern red cedar is endemic to the Great Plains and has spread rapidly due to reduced natural controls (community development resulting in less natural fires). In addition, its use in wind breaks and for wildlife cover has resulted in an increased seed population which has lead to an eastern red cedar population boom (2, 8). This large eastern red cedar population has negative effects on the native grasslands of the Great Plains by altering species composition (species richness, forb cover, and grass cover), soil moisture, blocking incoming solar radiation, decreasing soil temperature and alterations to litter dynamics (5, 3). As loss of native grasslands increases, less forage area for livestock is available which increases handling costs for the livestock industry (7). Utilization of eastern redcedar whole tree chips as a substrate component could alleviate PB demand in the Great Plains with a sustainable, local resource that improves the grassland ecosystem by reducing unwanted eastern redcedar populations. Previous work showed that eastern redcedar chips milled to pass a 3/4-inch screen can function as a substrate for Taxodium distichum (Bald Cypress) but worked best as an amendment to a PB mix (9). Plants
Container Grown Plants 292
SNA Research Conference Vol. 56 2011 grown in substrates that contained 80% eastern redcedar chips and 20% sand had reduced container capacity due to elevated air-space when compared to other mixes containing both PB, cedar, and sand or PB and sand (9). The purpose of this investigation was to determine at what particle size, if any, cedar can be used to produce a container-grown perennial crop, Rudbeckia fulgida var. fulgida, comparable to plants grown in PB.
Juniperus virginiana chips (cedar) (Queal Enterprises. Pratt, KS) from whole trees harvested in Barber County, KS (aged for six months) were ground in a hammer mill (C.S. Bell Co., Tiffin, OH, Model 30HMBL) to pass a 3/16-, 3/8-, 1/2-,or 3/4-inch (4.76 mm, 9.53 mm, 12.70 mm, 19.05 mm) screen on April 28th 2010. The cedar and a PB (SunGro, Bellevue, WA) control were then blended with sand to make a series of five 80% wood : 20% sand (by vol.) substrate mixes. Substrates were pre-plant incorporated with 2 lbs/yd3 (1.17 kg/m2) micronutrient package (Scotts, Micromax, Marysville, OH) and controlled release fertilizer at a medium rate of 14.5 lbs/yd3 (8.60 kg/m2) (Scott’s, Osmocote Classic , 18-6-12, 8 to 9 month release, Marysville,OH). Two-gallon (8.7 L) containers were then filled and planted with liners (one per container from a 72 cell pack) of Rudbeckia fulgida var. fulgida L (Creek Hill Nursery, Leola, PA.). Containers were placed on an outdoor gravel container pad and irrigated daily via overhead sprinklers supplying approx. 1-in. of precipitation daily. Data collection began on May 13th, 16 days after planting (DAP), and continued once every 4 weeks (43 DAP, 71 DAP) until termination on August 11 (106 DAP). Data collected included pH and electrical conductivity (EC) using the PourThru technique (10), leaf greenness as measured with a SPAD meter, and growth indices [(widest width + perpendicular width + height) ÷ 3] at 16, 43, 71, and 106 DAP. Shoot dry weight was recorded at the conclusion of the study (106 DAP) by drying in a forced air oven (The Grieve Co. Model SC-400, Round Lake, IL) at 160oF (71.11 °C) for 7 days. Substrate physical properties were determined using North Carolina State University porometers (Raleigh, NC), which measured substrate air space, water holding capacity, substrate bulk density, and total porosity (1). Data were analyzed using SAS (Version 9.1 SAS Institute Inc. (Cary, NC) The experimental design was a randomized complete block with a factorial arrangement of treatments and eight single plant replications.
Results: All cedar-based substrate had pH reading that were similar to each other at 16 and 43 DAP, and higher than the PB substrate (Table 1). Greater variation occurred at 71 DAP with pH of PB remaining low compared to cedar substrates, while 3/4-inch cedar had the highest pH. There were no significant differences in pH between treatments at the conclusion of the study106 DAP. Irrigation water pH averaged 7.52. There were no significant differences between substrate EC in any treatment at all measurement dates (Table 1).
Growth indices of Rudbeckia fulgida var. fulgida at 106 DAP varied by substrate with plants growing in PB and 3/16-inch cedar producing the largest plants and 1/2-inch cedar producing the smallest plants (Table 2). Plants grown in substrates containing 3/4-and 3/8-inch cedar were similar to all other treatments. Dry weight of the shoot
Container Grown Plants 293
SNA Research Conference Vol. 56 2011 tissues varied greatly between treatments. Plants grown in PB had the greatest shoot dry weight with 3/16-inch cedar producing the greatest mass of the cedar substrates. Substrates of 1/2- and 3/4-inch cedar were similar and had the least mass while plants grown in 3/16-inch cedar had the greatest mass of the cedar treatments (Table 2). Leaf greenness, measured with a SPAD meter on four recently matured leaves, initially varied at 16 DAP but there were no significant differences between substrates thereafter (data not shown).
Generally, as cedar particle size increased container capacity decreased with increasing air space as shown in the previous study (11). Correspondingly, shoot dry weight and growth indices decreased in a similar manner. Pine bark had the greatest container capacity and least air space produced plants with the greatest shoot dry weight and growth indices. Container capacity of both 1/2- and 3/4- inch cedar was outside the recommended range of 45% to 65%. Similarly, airspace of 1/2- and 3/4- inch cedar was also outside the recommended range of 10 – 30%. However, container capacity and air space of 3/8-inch cedar was close to the recommended ranges. Interestingly, PB also fell outside of the recommended ranges for container capacity and air space. However, 3/16-inch cedar substrate was within recommended ranges for both container capacity and air space and had the second greatest growth and shoot dry weight after plants grown in PB. Pine bark had greater bulk density and total porosity than all cedar treatments, which were similar regardless of processed screen size (11) (Table 3).
Despite not performing quite as well as PB, 3/16-cedar could be a viable substrate for Rudbeckia fulgida var. fulgida. The savings on substrate materials could make up for slightly less plant growth. Additionally, the decreased bulk density of cedar could decrease the cost of shipping finished products while smaller plant size might also allow for more plants to be shipped per load. Despite less growth, most plants were in marketable condition at the conclusion of the study (3 months). All cedar treatment plants were root bound to the container and plants grown in PB had the upper half of the container densely populated with roots (data not shown). Future studies could involve evaluating root growth of perennial crops grown in cedar based substrates, alterations to cedar substrate pH, and mixing substrate particle sizes. This is encouraging for Plains states growers as they look for new sources of nursery substrate materials. Additionally property owners with large cedar populations could earn income from harvest and sale of eastern red cedar trees to horticultural industries.
Literature cited:
1. Fonteno, W.C. and T.E. Bilderback. 1993. Impact of hydrogel on physical properties of coarse-structured horticultural substrates. J. Amer. Soc. Hort Sci. 118: 217-222. 2. Ganguli, A.C., D.M. Engle, P.M. Mayer, and E.C. Hellgren. 2008. Plant community diversity and composition provide little resistance to Juniperus encroachment. Botany 86:1416-1426.
Container Grown Plants 294
SNA Research Conference Vol. 56 2011
3. Gehring, J.L. and Bragg, T.B. 1992. Changes in prairie vegetation under eastern red cedar (Juniperus virginiana L.) in an eastern Nebraska Bluestem prairie. The American Midland Naturalist. 128(2): 209-217. 4. Griffin, J.J. 2009. Eastern red-cedar (Juniperus virginiana) as a substrate component for container production of woody plants. HortSci. 44:1131. 5. Linneman J.S. and M.W. Palmer. 2006. The effect of Juniperus virginiana on plant species composition in an Oklahoma grassland. Community Ecology 7(2): 235-244. 6. Lu, W., J.L. Sibley, G.H. Gilliam, J.S. Bannon, and Y. Zhang. 2006. Estimation of U.S. bark generation and implications for horticulture industries. J. Environ. Hort. 24: 29- 34. 7. Ortmann, J., J. Stubbendieck, R.A. Masters, G.H. Pfeiffer, and T.B. Bragg. 1998. Efficacy and costs of controlling eastern redcedar. J. of Range Mgmt. 51: 158-162. 8. Owensby C.E., K.R. Blan, B.J. Eaton, and O.G. Russ. 1973. Evaluation of Eastern redcedar infestations in the Northern Kansas Flint Hills. J. of Range Mgmt. 26: 256-259. 9. Starr, Z., C. Boyer, and J. Griffin. 2010. Growth of containerized Taxodium distichum in a cedar-amended substrate. Proc. Southern Nurs. Assoc. Res. Conf. (In Press) 10. Wright, R.D. 1986. The pour-thru nutrient extraction procedure. HortSci. 21: 227- 229. 11. Yeager T. (editor). 2007. Best management practices: Guide for producing nursery crops. 2nd ed. The Southern Nursery Association, Atlanta, GA.
Table 1. pH and EC of cedar- and PB-based substrates. 16 DAPz 43 DAP 71 DAP 106 DAP EC Substrates pH (µS/cm) pH EC pH EC pH EC 6.02 0.96 6.80 1.09 Pine Bark 1.16 a 6.06 b 0.64 a 6.28 c by a a a 3/16- inch 0.73 6.84 1.26 6.88 a 1.10 a 7.28 a 0.83 a 6.80 b cedar a a a 7.21 1.00 7.03 1.31 3/8-inch cedar 6.94 a 1.02 a 7.18 a 0.67 a ab a a a 0.96 6.95 1.37 1/2-inch cedar 6.92 a 1.02 a 7.24 a 0.75 a 7.04 ab a a a 0.94 7.22 1.30 3/4-inch cedar 7.05 a 1.01 a 7.39 a 0.64 a 7.34 a a a a zDays after planting yMeans within column followed by the same letter are not significantly different based on Waller-Duncan k ratio t tests (α = 0.05, n = 4).
Container Grown Plants 295
SNA Research Conference Vol. 56 2011
Table 2. Growth and shoot dry weight of Rudbeckia fulgida in cedar- and PB- based substrates. Growth index Shoot dry weight Substrate (cm)z (g)y Pine Bark 49.42 ax 142.65 a 3/16- inch 49.67 a 100.56 b cedar 3/8-inch cedar 44.71 ab 85.88 cb 1/2-inch cedar 41.00 b 76.43 c 3/4-inch cedar 46.75 ab 70.75 c z Growth Index = (Height + width + perpendicular width)÷ 3 (1cm = 0.397 inch) yShoots were harvested at the container surface and oven dried at 160oF (71.11 °C) for 7 days (1 g = 0.0035 oz.). xMeans within column followed by the same letter are not significantly different based on Waller-Duncan k ratio t tests (α = 0.05, n = 8).
Table 3. Physical properties of cedar- and PB-based substratesz. Total Container Air porosityy capacityx spacew Bulk density Substrates (% Vol) (g.cm-3)v 4.70 Pine Bark 73.5 au 68.83 a 0.52 a e 3/16- inch 20.17 70.23 b 50.07 b 0.45 b cedar d 29.93 3/8-inch cedar 70.07 b 40.10 c 0.46 b c 33.87 1/2-inch cedar 69.97 b 35.17 d 0.45 b b 40.10 3/4-inch cedar 69.00 b 29.90 e 0.47 b a zAnalysis performed using the North Carolina State University porometer. yTotal porosity is container capacity + air space. xContainer capacity is (wet wt - oven dry wt) / volume of the sample. wAir space is volume of water drained from the sample / volume of the sample. vBulk density after forced-air drying at 105°C (221.0 °F) for 48 h (1 g · cm-3 = 62.4274 lb/ft3). uMeans within column followed by the same letter are not significantly different based on Waller-Duncan k ratio t tests (α = 0.05, n = 3).
Container Grown Plants 296
SNA Research Conference Vol. 56 2011
Pine Tree Substrate pH as Affected by Storage Time and Lime and Peat Moss Amendments
Linda L. Taylor, Alex X. Niemiera, and Robert D. Wright
Department of Horticulture, Virginia Tech, Blacksburg, VA 24061
Index Words: Container crop production, Pinus taeda L.
Significance to Industry: Pine tree substrate (PTS), one of the newly emerging substrates for container crop production (1), is manufactured by chipping and then milling pine (Pinus taeda L.) logs to a desired particle size. The pH of freshly manufactured PTS is generally within the 5.6 to 6.2 range recommended for soilless substrates (2), but with storage, PTS pH has been observed to decrease to values below those recommended (unpublished data). Further, PTS is often amended with peat moss, and this has been shown to decrease substrate pH compared to 100% PTS (3). In this work, we found that a lime rate of 1 kg·m-3 (1.7 lbs·yd-3) was sufficient to keep PTS pH values at 5.8 or higher when stored for up to 1 year, whereas a lime rate of 4 kg·m-3 (6.7 lbs·yd-3) was necessary to maintain pH values of PTS amended with 25% peat moss (v:v) at 5.8 or higher. Thus growers need to be aware that lime may be needed in instances where PTS is stored or amended with peat moss to maintain substrate pH values at or above the desired minimum value.
Nature of Work: Pine bark and peat moss are the major substrates used for container crop production in the greenhouse and nursery industries. However, more affordable, sustainable, and available alternatives are being developed; pine tree substrate (PTS) is one such alternative. PTS is manufactured by chipping and then milling pine (Pinus taeda L.) logs. Whereas pine bark and peat moss are both composted materials with established liming rates, PTS is not composted and therefore its chemical parameters, such as pH, may change over time. The objective of this study was to determine how PTS pH is affected by storage time and lime and peat moss amendments. There were 10 substrate treatments. Five treatments were 100% PTS, passed through a 4.76 mm (3/16 inch) screen and amended with pulverized dolomitic limestone at rates of 0, 1, 2, 4, or 6 kg·m-3 (0, 1.7, 3.4, 6.7, and 10.1 lbs·yd-3), and five treatments consisted of PTS passed through a 15.88 mm (5/8 inch) screen, amended with peat moss in a ratio (vol:vol) of 3PTS:1 peat moss (PTSP), and with pulverized dolomitic limestone at the rates of 0, 1, 2, 4, or 6 kg·m-3. All substrate treatments received 0.59 kg·m-3 (1 lb·yd-3) of calcium sulfate (Espoma Organic Traditions). Substrates were placed in 0.08 m3 (2 cubic foot) perforated plastic storage bags (April 2009) and stored on shelves in an open shed in Blacksburg, Virginia. Substrates were subsampled at 1, 42, 84, 168, 270, and 365 days. At the time of subsampling, each substrate treatment was mixed to ensure uniformity, a subsample was taken, and six 1-Liter containers were filled. Each
Container Grown Plants 297
SNA Research Conference Vol. 56 2011 container then received 500 ml of tapwater. The following day, substrate solutions were extracted using the Virginia Tech Extraction Method (VTEM) and solution pH was measured.
Results and Discussion: For all days and all lime rates, PTS had higher pH values than the corresponding PTSP treatments, except the 6 kg·m-3 lime rate on day 1 where values were equal, due to the acidifying effect of peat moss (Table 1). For PTS, the increase in pH between the 0 and 1 kg·m-3 lime rates was greater than the increases between the higher lime rates for all subsampling times. In general, there were relatively large pH increases with the incremental additions of lime for PTSP throughout the 365 days except between 4 and 6 kg·m-3. From the first subsampling day to day 42, pH values decreased in all substrate and lime treatments. However, by day 84, pH values for all limed PTS treatments had increased to values higher than those found at the first subsampling date. For PTSP, day 84 pH values were as high, or higher than first subsampling day values in only the 4 and 6 kg·m-3 lime rates. From days 84 to 168, pH values for all treatments remained relatively stable. By day 270, pH in PTS had decreased by 0.2 units in both the 0 and 1 kg·m-3 lime rate treatments, while remaining stable in the 2, 4, and 6 kg·m-3 lime rate treatments. In contrast, pH in PTSP had decreased in all lime rate treatments with larger decreases in the lower lime rate treatments. By the end of the experiment, day 365 (April 2010), pH values of all the limed PTS treatments were as high, or higher, than day 1 values, while the pH of unlimed PTS decreased from 5.8 to 5.0. For PTSP, pH values of all treatments, unlimed and limed, were lower than day 1 values, with the pH of the unlimed treatment decreasing from 5.2 to 4.1.
In this study the acidifying effect of both storage time and peat moss amendment on PTS was clearly evident. A lime rate of 1 kg·m-3 was sufficient to maintain PTS pH at or above 5.6 (the lower limit of the recommended range for soilless substrates) under storage conditions for at least 365 days. A lime rate of 4 kg·m-3 was required in this study to maintain a pH value of at least 5.6 in PTSP under storage conditions for 365 days.
Literature Cited: 1. Wright, R.D. and J.F. Browder, 2005. Chipped pine logs: a potential substrate for greenhouse and nursery crops. HortScience 40: 1513-1515. 2. Bailey, D.A., 1996. Alkalinity, pH, and acidification. In: Water, media and nutrition for greenhouse crops. D.W. Reed, ed., Batavia, Ill., Ball Publishing. 3. Jackson, B.E., R.D. Wright, and N. Gruda, 2009. Container medium pH in a pine tree substrate amended with peatmoss and dolomitic limestone affects plant growth. HortScience 44: 1983-1987.
Container Grown Plants 298
SNA Research Conference Vol. 56 2011
Table 1. Substrate solution pH values of pine tree substrate (PTS) and pine tree substrate amended with peat moss (PTSP) at increasing lime rates and lengths of storage (n=6). pH Substrate (lime Day Day Day Day Day Day 1 rate kg·m-3) 42 84 168 270 365 PTS (0) 5.8 5.2 5.3 5.2 5 5 PTS (1) 6.2 5.8 6.3 6.4 6.2 6.3 PTS (2) 6.3 6 6.7 6.6 6.6 6.5 PTS (4) 6.5 6.3 6.8 6.8 6.8 6.7 PTS (6) 6.6 6.5 7 6.9 6.9 6.8 PTSP (0) 5.2 4.3 4.4 4.4 4 4.1 PTSP (1) 5.7 5 5.1 5.1 4.8 4.7 PTSP (2) 6.1 5.4 5.7 5.7 5.5 5.4 PTSP (4) 6.4 6.1 6.4 6.4 6.2 6.1 PTSP (6) 6.6 6.4 6.8 6.7 6.6 6.4
Container Grown Plants 299
SNA Research Conference Vol. 56 2011
Utilization of Potato Sludge Waste as a Substrate Amendment in Horticulture Crop Production
Matthew S. Wilson and Jeff L. Sibley
Auburn University Department of Horticulture 101 Funchess Hall Auburn University, AL 36849-5408
Index Words: tomato, petunia, herbaceous ornamentals, alternative media Significance to Industry: ‘Dreams Burgundy’ petunia and ‘Champion II’ tomato were grown in soilless substrates containing various percentages of dried potato sludge waste. Preliminary results indicate dried potato sludge used in small proportions may be used to grow plants in a pine bark: sand media. Nature of Work: Businesses are facing increasingly stringent regulation of waste and manufacturing by-products from government agencies and environmental protection groups. To meet new regulations and increase marketability among environmentally conscious customers, businesses need to find environmentally appropriate solutions to re-use and dispose of current waste products. Additionally, many in the horticulture industry are finding the traditional soilless substrates such as pine bark (PB) and peat (P) are in short supply and increased demand and pricing due to recovery of PB by pulp mills to offset energy costs, increased shipping/fuel costs to transport P from Canada and the northern U.S., and decrease of domestically grown lumber due to cheaper imports (1). By deploying and integrating various waste materials within horticultural production substrates, both businesses and nursery producers may find environmentally and economically favorable benefits in working together. Potato sludge waste (PSW) is a by-product of the potato chip manufacturing process. PSW consists of soil residue, potato peels, water used to clean potatoes and equipment, some starch, and polymers used to bring solids out of suspension. PSW (minus polymers) is the solid portion of the effluent normally discharged to sewer systems, requiring expense for the manufacturer and extensive cleanup by municipal sewage treatment facilities. With increasing regulation and costs associated with treatment of the effluent, many potato chip manufacturers are incorporating on-site treatment facilities to collect the solids (PSW) and clean and treat the water for storm water and industrial stream discharge. Depending on scale of the operation and volume of production, potato chip manufacturers may be left with large amounts of PSW to dispose into landfills. In 2010, a preliminary trial was conducted to evaluate PSW as a potential substrate amendment for the growth of two herbaceous plants. In June of 2010, petunia (Petunia x hybrida ‘Dreams Burgundy’) and tomato (Lycopersicon lycopersicum ‘Champion II’) #512 size plugs were planted into 3 in. diameter pots for petunia and 3.5 in diameter, tall (5 in.) pots for tomato containing one of four prescribed substrate treatments using various percentages of pine bark (PB), sand (S), and dried potato sludge waste (PSW). The four substrates were 85:15 PB:S;
Container Grown Plants 300
SNA Research Conference Vol. 56 2011
77:13:10 PB:S:PSW; 68:12:20 PB:S:PSW; and 59:11:30 PB:S:PSW. All substrates 3 ™ contained pre-plant incorporations of 1 lb/yd Micromax (Scotts Company, Marysville, Ohio), 10 lbs/yd3 dolomitic limestone, and 5.5 lbs/yd3 Osmocote™ (19-6-12, 3-4 mo.) (Scotts Company). Each species was arranged in a randomized complete block design (RCBD) inside a greenhouse at the Paterson Greenhouse Complex in Auburn, Alabama. Each species contained twelve blocks with four plants per block. All plants were hand watered as necessary. One week after planting, all plants were irrigated with a 75 ppm fertilizer solution alternating (20-10-20) and (14-4-14) for petunia and (14-4-14) only for tomato. Three to eight weeks after planting, all plants were fertilized at 100 ppm alternating (20- 10-20) and (14-4-14) for petunia and every three days with (14-4-14) for tomato. Plants were irrigated with clear water on weekends (petunias) and between fertilizations (tomatoes). Fertilization rates were 50% of the recommended rate (Ball Horticultural Company, West Chicago, Illinois) (2) due to incorporation of slow release fertilizer. The experiment was terminated eight weeks after planting. Growth indices, root ratings, flower counts (petunia), and foliar chlorophyll content were collected. Growth indices were measured and calculated by averaging one width, the width perpendicular to width 1, and the height in centimeters. Root ratings were assessed and assigned using a 1 - 4 numeric scale based on the estimated percent root coverage of the root ball (1 = 0-25%, 4 = 75-100%). Average foliar chlorophyll content of three leaves per plant was collected using the SPAD-502 Chlorophyll Meter (Konica Minolta, Tokyo). Data was analyzed using Fisher’s Least Significance Difference (LSD) (α = 0.05). Results and Discussion: Analysis of the data for both petunia and tomato revealed that 85:15 PB:S and 77:13:10 PB:S:PSW performed similarly in growth indices and foliar greenness (Table 1). 85:15 PB:S had the highest root rating for tomato and had a similarly high root rating as 77:13:10 PB:S:PSW in petunia (Table 1). Treatments 68:12:20 PB:S:PSW and 59:11:30 PB:S:PSW performed below treatments containing 10 percent or less PSW in regard to growth indices and root rating for both species. Additionally, substrates containing 30 percent PSW performed significantly less than substrates containing 0 or 10 percent PSW (Table 1) for both petunia and tomato. Fewer differences were seen with petunia, based on visual observation and root ratings, which indicated that petunias had a better tolerance for the increased percentages of PSW than tomato (Table 1). Visual observations during root rating suggests that water holding capacity may have the most significant role in determining the suitability of potato sludge waste as a soilless media amendment. Media containing more than 20 percent PSW were soaked at the bottom of the container and had a malodorous scent, suggesting anaerobic conditions brought on by increased water holding capacity of the substrate. A replication study examining the nutrient effects of the substrates amended with PSW through maintaining equal substrate moisture content across substrates is currently in progress. Results suggest ‘Dreams Burgundy’ petunias and ‘Champion II’ tomatoes can be grown in PB:S substrates containing 10 percent or less PSW.
Container Grown Plants 301
SNA Research Conference Vol. 56 2011
Literature Cited:
1. Lu, W., J.L. Sibley, C.H. Gilliam, J.S. Bannon, and Y. Zhang. 2006. Estimation of U.S.bark generation and implications for horticultural industries. J. Environ. Hort. 24:29-34. 2. Ball Horticultural Company. 2010. Grower Facts.
Container Grown Plants 302
SNA Research Conference Vol. 56 2011
Landscape
Amy Wright Section Editor and Moderator
Landscape 303
SNA Research Conference Vol. 56 2011
Growth and Flowering Responses of Three Novel Landscape Plants to Summer Shade Levels in Central Texas
Michael A. Arnold, Andrew R. King, and Sean T. Carver
Texas A&M University, Dept. of Horticultural Sciences, M.S. 2133, College Station, TX
Index words: Justicia brandegeana 'Fruit Cocktail' (fruit cocktail shrimp plant), Lithodora diffusa 'Grace Ward' (Grace Ward scrambling gromwell), Otacanthus azureus (Brazilian snapdragon).
Significance to Industry: Light shade greatly increased flowering of Justicia brandegeana D.C. Wassh. & L.B. Smith ‘Fruit Cocktail’, along with strong canopy growth in light (33%) or heavy shade (66%) compared to full summer sun exposure. While surviving longer with shade than in full sun, Lithodora diffusa (Lag.) I.M. Johnst. 'Grace Ward' growth and flowering were not acceptable in any treatment during a Central Texas summer (borderline USDA zones 8b/9a). Otacanthus azureus (Linden) Ronse grew well vegetatively during summer in a range of light exposures from full sun to heavy shade, but flowering was progressively reduced by increasing shade levels.
Nature of Work: Lithodora diffusa 'Grace Ward', often listed as hardy in USDA zones 6 to 8, and Otacanthus azureus, considered cold hardy in USDA zones 9 to 11, had both flowered well in greenhouse trials and protected landscape locations for us under cool short days in previous trials, but data on potential summer growth and light requirements were lacking. Justicia brandegeana has long been cultivated in our region (1), but the cultivar ‘Fruit Cocktail’ was anecdotally reported to flower more heavily in shade. Thus a study was undertaken to investigate the growth and flowering of these three novel taxa under varied shade levels across the summer growing season in Central Texas using procedures detailed in Arnold et al. (2).
Justicia brandegeana 'Fruit Cocktail', L. diffusa 'Grace Ward', and O. azureus cuttings were rooted in 4 in liner pots containing Metro Mix 700 in April 2008 in a greenhouse under intermittent mist. Rooted cuttings were acclimated for 3 days in the greenhouse without mist, then moved to an outdoor nursery under 50% light exclusion until transplant to the landscape.
Irradiance screenings in the landscape were conducted in specially constructed portable shade structures that were 120 in long, 96 in wide, and 57 in tall (2). Frames consisted of 1.25 in interior diameter tubular cast-metal pipes covered in shade cloth. Frames were designed to be open on the north side, to a 4 in height around the base, and with an overhang above an 8 in average gap at the top to facilitate air movement. Irradiance treatments included full sun (mean of 1949 µmol·m-2·s-1 PAR above the canopy), 33 %
Landscape 304
SNA Research Conference Vol. 56 2011 light exclusion (1234 µmol·m-2·s-1), and 66% light exclusion (613 µmol·m-2·s-1). Two structures each of the 33% and 66% shade, each containing three plants of each of the four species, were planted on 24 April 2008. Two replicate plantings were established in adjacent plots in full sun. Plots were established in a sandy loam soil in 8 in tall raised beds, mulched with 2 in of pine bark mulch, and drip irrigated throughout the growing season. Plants were fertilized 3 times during the growing season with a 13-13- 13 granular fertilizer at the rate of 1 lb. N per 1000 ft2.
Plants were monitored for growth (height, widest and narrowest canopy width) and flowering (number of individual flowers for L. diffusa and O. azurea, flower panicles for J. brandageana) through the growing season. Plant indices were calculated as height x widest width x narrowest width to create a pseudo-volume estimate of canopy size. Data were analyzed using the general linear models procedures in SAS version 9.1 (3). Means were compared using least squares means procedures at alpha ≤ 0.05.
Results and Discussion: Significant (P ≤ 0.05) three-way interactions were observed for height, plant index, and flower number among species, shade levels, and time in the landscape (Table 1). Light shade (33%) increased J. brandegeana height and canopy volume over that of those grown in full sun, and heavy shade (66%) increased late summer and fall canopy volume over that of full sun (Table 1). However, J. brandegeana flowering was 115 to 130% greater with light shade than either full sun or heavy shade (Table 1). The species type is noted for its ability to provide color in shaded borders (1), and the cultivar ‘Fruit Cocktail’ also grew and flowered well under similar conditions (Table 1). By mid-summer all L. diffusa grown in full sun were dead, although plants survived longer under shade, by late autumn L. diffusa was dead under all light regimes (Table 1). Strong canopy growth occurred with O. azureus in full sun to 66% shade, however by the end of the growing season flowering was reduced by 19% in 33% shade and 39% in 66% shade compared to full sun (Table 1).
Literature Cited: 1. Arnold, M.A. 2008. Landscape Plants For Texas And Environs, Third Ed. Stipes Publ. L.L.C., Champaign, IL. p. 1334. 2. Arnold, M.A., G.V. McDonald, G.C. Denny, S.T. Carver, and A.R. King. 2010. Screening potential new tropical ornamentals for alkalinity, salinity, and irradiance tolerances. J. Environ. Hort. (In submission). 3. SAS, Inc. 2003. SAS version 9.1 for Windows. SAS Institute Inc., Cary, NC.
Landscape 305
SNA Research Conference Vol. 56 2011
Table 1. Three-way interactions among species (Justicia brandegeana 'Fruit Cocktail', Lithodora diffusa 'Grace Ward', and Otacanthus azureus), shade levels (0, 33, and 66 % light exclusion) and date (April 25 to October 28, 2008) in a central Texas landscape. Plants were grown in raised beds containing a sandy loam soil and drip irrigated.
Shade Plant Plant Flower number (% light height index or panicles Species exclusion) Date (cm) (cm3) (#/plant) J. brandegeana 0% April 25 14.0 ey 2234 g 0.3 d July 31 45.0 cd 49280 fg 10.7 d Sept. 12 52.0 abc 167195 de 32.3 c Oct. 28 41.7 d 206817 cd 63.8 b 33% April 25 11.3 e 1558 g 0.7 d July 31 42.6 cd 84199 efg 8.6 d Sept. 12 56.3 ab 280788 bc 66.3 b Oct. 28 61.5 a 584467 a 137.8 a 66% April 25 12.0 e 2451 g 0.0 d July 31 41.7 d 131839 def 5.8 d Sept. 12 55.0 ab 221619 cd 32.5 c Oct. 28 47.8 bcd 322407 b 59.7 b L. diffusa 0% April 25 8.2 a 695 c 0.2 a July 31 - - - Sept. 12 - - - Oct. 28 - - - 33% April 25 8.2 a 860 c 0.8 a July 31 8.0 bc 7424 b 0.0 a Sept. 12 11.0 a 12210 a 0.0 a Oct. 28 - - - 66% April 25 8.0 b 770 c 0.0 a July 31 8.7 a 13352 a 0.0 a Sept. 12 5.0 c 8190 b 0.0 a Oct. 28 - - - O. azureus 0% April 25 24.3 e 8704 e 3.8 e July 31 63.3 cd 385810 d 43.5 c Sept. 12 72.0 bc 834711 b 40.7 cd Oct. 28 65.8 bcd 1374245 a 146.7 a 33% April 25 24.0 e 9966 e 5.8 de July 31 58.0 d 361827 d 20.2 cde Sept. 12 71.0 bc 730225 bc 39.8 cde Oct. 28 59.2 d 938134 b 118.8 ab 66% April 25 23.2 e 11446 e 4.8 e July 31 58.7 d 451688 cd 24.5 cde Sept. 12 83.7 a 920891 b 29.2 cde Oct. 28 76.8 ab 1497750 a 90.0 b
Landscape 306
SNA Research Conference Vol. 56 2011
General linear model effects: Species ***z *** *** Shade ns ns ** Species x shade ns ** ** Date *** *** *** Species x date *** *** *** Shade x date ns ns ** Species x shade x date * ** * yValues represent means of 6 observations; means within a column and species followed by the same letter are not significantly different from each other using least squares means procedures at P # 0.05. Missing data indicates that the plants in that treatment all died. z*, **, ***, or ns indicate significant effects in the general linear models procedures at P ≤ 0.05, P ≤ 0.01, P ≤ 0.001, or not significant, respectively.
Landscape 307
SNA Research Conference Vol. 56 2011
Effects of Pre-plant Compost and Subsequent Fertigation on Landscape Performance of Organically-grown Marigold
Guihong Bi1, William B. Evans1, Mengmeng Gu2 and Vasile Cerven1
1Mississippi State University, Truck Crops Station, Crystal Springs, MS 39059 2Department of Plant and Soil Sciences, Mississippi State, MS 39762
Index Words: Compost, organic fertilizer, broiler litter, Tagetes patula L.
Significance to Industry: The ornamental industry has moved into several niche markets over the years. One of the latest of these is production of organically-grown bedding plants and container stocks. Billmann (4) states that the worldwide production of organic ornamentals is moving from a very small niche into a more mainstream sector of horticulture. Indeed, in a new survey of nurseries across the United States (5), over 60% of respondents were using organic composts, more than 40% were using organic fertilizers, more than 20% were using waste products in substrates, more than 15% were using certified organic substrates, and nearly 5% were using non-plastic (alternative) pots in their production systems. With a significant portion of the industry moving to serve consumers wanting organically produced ornamentals, the industry needs sound production management techniques for organic production and the ability to educate wholesale and retail customers about best management practices for performance of these products in landscape settings. In this study, we evaluated the effects of pre-plant compost and subsequent fertigation on landscape performance of organically-grown marigold. Results showed that appropriate rates of pre-plant compost applications and subsequent fertigation can lead to good performance of marigolds in an organic landscape setting. We found that as with more standard fertilizer practices, higher rates of fertilizer may not be needed and can actually reduce plant quality. This study provides preliminary data on organic fertility management for marigold in the landscape, and may be used as a basis for testing and developing appropriate organic fertility management for a range of landscape materials.
Nature of Work: One important aspect of organic systems is the utilization of natural fertilizers and composts. Organic fertilizers are often complex products with soluble and insoluble nutrient sources that are released over extended periods of time. Several organic liquid fertilizers have been shown to produce N recovery rates at or above those of soluble synthetic ammonium sulfate (6). Compost has multiple roles in organic systems, and several types of compost have been shown to improve soil or substrate quality, and enhance ornamental crop growth in the greenhouse (7) and the landscape (8). For the present work, we evaluated the influence of pre-plant compost application and subsequent fertigation with organic fertilizer on field performance, growth, and flowering of organically-grown marigold plugs after transplanting to an organic landscape setting.
Landscape 308
SNA Research Conference Vol. 56 2011
This study was conducted at the Mississippi State University Truck Crops Branch Experiment Station in Crystal Springs, MS, using practices within the National Organic Standards, under USDA’s National Organic Program (9). Organically-grown French marigold (Tagetes patula L. ‘Janie Deep Orange’) seedlings grown in standard 216 cell packs in a greenhouse were transplanted to raised beds in a certified organic field in late summer 2010. The soil was Providence silt loam.
A locally produced organic composted broiler litter (Currie Farms, Raleigh, MS) was selected for initial soil amendment in the field. A liquid catfish processing byproduct MultiBloom (2-2-2 or 2N-0.8P-1.6K) (Hydrosylate Company of America, Isola, MS) was chosen as organic fertilizer for fertigation after transplanting. The study was arranged as a randomized complete block design with three replications. The three pre-plant compost treatments included control (no compost), composted broiler litter at a low rate (3 tons/acre), and composted broiler litter at a high rate (6 tons/acre). The compost was incorporated into the top 6 inches of soil in the raised bed before laying the drip irrigation tape and black plastic mulch. A single drip tape was placed in the center of each bed and buried 1 inch below the top of the bed. Irrigation was supplied as needed through the drip tape. There were three fertigation treatments: no fertilizer (water only), organic low (100 ppm N from MultiBloom), and organic high (200 ppm N from MultiBloom). Starting 20 days after planting (DAP), each plant was supplied with 200 ml of solution for each fertigation treatment twice a week. Each treatment combination contained 15 marigold plants at 1 ft. spacing in a single row.
On 20 DAP, before fertigation started, leaf greenness (chlorophyll content) was quantified using a SPAD-502 Chlorophyll Meter (Minolta Camera Co., Ramsey, NJ). For each plant, three recently fully expanded leaves were randomly chosen for SPAD measurement and the average of the three readings was recorded. Plant growth index [PGI = (height + widest width + perpendicular width) ÷ 3] was recorded. Plant height was measured from the soil surface to the tallest plant part. Plant growth index was measured again at 40 DAP. The number of open flowers per plant was counted on 52 DAP during peak bloom.
Results and Discussion: Incorporating composted broiler litter into the soil before transplanting significantly affected plant growth index (PGI) and leaf SPAD readings. On 20 days after transplanting (DAP), plants that received composted broiler litter had significantly higher PGI and SPAD readings than plants that did not receive any compost (Table 1). There were no significant differences on PGI or SPAD between plants that received high rate (6 tons/acre) of compost and plants that received low rate (3 tons/acre) of compost (Table 1).
There were significant main effects of compost and fertigation with no interaction between compost and fertigation on PGI on 40 DAP (Table 1). Regardless of fertigation treatment, plants that received pre-plant compost either at the high rate or at the low rate had significantly higher PGI than plants that did not receive any compost, suggesting pre-plant compost improved plant growth. Plants that received the high rate of pre-plant compost had similar PGI as plants that received low rate of compost,
Landscape 309
SNA Research Conference Vol. 56 2011
suggesting that high rate of pre-plant compost may not have been needed for optimal growth. Regardless of compost treatment, plants that received the low rate of fertigation had significantly higher PGI than plants that received the high rate of fertigation, suggesting the high rate fertigation we used may indicate excessive fertilization which led to reduced plant growth (Table 2). Plants that did not receive any fertigation had similar PGI as plant that received the high rate of fertigation.
There were significant main effects of compost and fertigation with no interaction on the number of flowers per plant on 52 DAP. Regardless of fertigation treatment, plants that received the high rate of pre-plant compost had significantly higher numbers of flowers than plants that received the low rate of compost. Plants that did not receive any compost had the fewest flowers (Table 1). Regardless of compost treatment, plants that received the high rate of fertigation had a similar number of flowers as plants that received the low rate of fertigation, and plants that did not receive any fertigation had the lowest number of flowers (Table 2).
The present work shows the efficacy of broiler litter compost as a nutrient source for landscape application in marigold, just as uncomposted chicken litter (3), pre-leached mushroom compost (10) and vermicompost (1,2) have proven suitable in production of marigolds in greenhouse substrates. We have also shown that feeding marigolds with appropriate rate of liquid organic fertilizer can produce high quality plants in the landscape. It is important to note that over-application, and its associated negative environmental impacts, are possible with organic fertilizers and composts, just as with synthetic fertilizer sources. We recommend users of these materials test them thoroughly before incorporating them into their practices.
Literature Cited: 1. Atiyeh, R.M., N.Q. Arancon, C.A. Edwards and J.D. Metzger. 2002. The influence of earthworm-processed pig manure on the growth and productivity of marigolds. Biores. Tech. 81(2): 103-108. 2. Bachman, G.R. and J.D. Metzger. 2008. Growth of bedding plants in commercial potting substrate amended with vermicompost. Biores. Tech. 99(8): 3155-3161. 3. Bi, G., W.B. Evans, J.M. Spiers and A.L. Witcher. 2010. Effects of organic and inorganic fertilizers on marigold growth and flowering. HortScience 45(9): 1373-1377. 4. Billmann, B. 2008. Development of the Organic Ornamentals Sector Worldwide. 16th IFOAM Organic World Congress. http://orgprints.org/12701/1/Billmann-2008- Organic_Ornamentals-ifoam2008-final_version.pdf 5. Dennis, J.H., R.G. Lopez, B.K. Behe, C.R. Hall, C. Yue and B.L. Campbell. 2010. Sustainable Production Practices Adopted by Greenhouse and Nursery Plant Growers. HortScience 45(8):1232-1237. 2010. 6. Hartz, T.K., R. Smith and M. Gaskell. 2010. Nitrogen availability from liquid organic fertilizers. HortTech. 20(1): 169-172. 7. Krucker, M., R.L. Hummel and C. Cogger. 2010. Chyrsanthemum production in composted and noncomposted organic waste substrates fertilized with nitrogen at two rates using surface and subirrigation. HortSci. 45(11): 1695-16701.
Landscape 310
SNA Research Conference Vol. 56 2011
8. Loper, S., A.L. Shober, C. Wiese., G.C. Denny, C.D. Stanley and E.F. Gilman. 2010. Organic soil amendment and tillage affect soil quality and plant performance in simulated residential landscapes. HortScience 45(10): 1522-1528. 9. USDA, 2010. National Organic Program. http://www.ams.usda.gov/AMSv1.0/nop . Nov. 11, 2010 10. Young J.R., E.J. Holcomb and C.W. Heuser. 2002. Greenhouse growth of marigolds 'in three leached sources of spent mushroom compost over a 3-year period. HortTech. 12(4): 701-705.
Table 1. Effects of pre-plant broiler litter compost on plant growth index (PGI), leaf SPAD reading, and the number of flowers of ‘Janie Deep Orange’ French marigold grown in an organic field. 20 DAPy 40 DAP 52 DAP No. of Compostz PGIx SPAD PGI flowers/plant High Rate 12.39 aw 50.38 a 23.06 a 32.90 a Low Rate 12.01 a 49.76 a 23.30 a 30.81 b Control 11.09 b 48.09 b 21.68 b 27.40 c
zCompost = composted broiler litter; high rate = 6 lbs/acre; low rate = 3 lbs/acre; control = no compost. yDAP = days after planting. xPGI = plant growth index [(height + widest width + perpendicular width) ÷ 3]. wMeans followed by the same letter within each column are not significantly different according to Fisher’s protected LSD test (P = 0.05).
Table 2. Effects of fertigation on plant growth index (PGI) and the number of flowers of ‘Janie Deep Orange’ French marigold grown in an organic field. 40 DAPy 52 DAP Fertigationz PGIx Number of flowers High Rate 22.43 bw 32.82 a Low Rate 24.23 a 31.85 a Control 21.76 b 26.58 b
zFertigation = MultiBloom; high rate = 200 ppm N from MultiBloom; low rate = 100 ppm N from MultiBloom; control = water. yDAP = days after planting. xPGI = plant growth index [(height + widest width + perpendicular width) ÷ 3]. wMeans followed by the same letter within each column are not significantly different according to Fisher’s protected LSD test (P = 0.05).
Landscape 311
SNA Research Conference Vol. 56 2011
Evaluation of Landscape Plants for Use on Green Roofs in the Texas Gulf Coast Area
1Anthony W. Camerino, 1Carol S. Brouwer and 2Astrid Volder
1Texas AgriLife Extension Service, Harris County Office 3033 Bear Creek Drive Houston Texas 77084 2Department of Horticultural Sciences, Texas A&M University, College Station, TX 77845
Index Words: Dianella caerulea ‘Cassa Blue’, Dianella revoluta ‘Baby Bliss’, Dianella revoluta ‘Big Rev’, Dianella revoluta ‘Little Rev’, Dianella tasmanica ‘Tasred’, Lomandra hystrix ‘Tropic Belle’, Lomandra longifolia ‘Breeze’, Lomandra longifolia ‘Katrinus Deluxe’, green roof, Moraea iridioides
Significance to Industry: The use of green roofs is becoming more common in urbanized areas of Texas as real estate developers, local planners, and municipal employees discover the associated benefits of reduced cooling and heating costs, stormwater mitigation, and air purification. Currently most plant selection for green roofs is based on anecdotal evidence and experience. This study adds to the body of data needed by nurseries, landscapers, and green roof designers to guide the selection of plants for green roofs in the southern United States.
Nature of Work: Extensive green roofs are a subject of growing interest in the southern United States due to their many documented benefits, including a reduced urban heat- island effect and lowered cooling costs for buildings where they are installed (4). In addition, green roofs help to mitigate stormwater runoff and provide wildlife habitat (3). Throughout the world, most green roofs are located in temperate climates, such as northern parts of Europe and the United States (3). Information about the design and use of green roofs in subtropical regions of the United States is limited.
Very little information has been published about plants suitable for green roofs in the southern United States, where summer temperatures, which often reach 100°F or more, may cause physiological damage to many species and varieties of landscape plants. High winds and humidity of coastal areas may also affect plant health. In Texas, plants that have been tested for use on green roofs include Delosperma cooperi, Delosperma ‘Beaufort West’, Lantana X hybrida ‘New Gold’, Sedum album, Sedum kamtschaticum, Phyla nodiflora, Santolina virens, Santolina chamaecyparisus, Ruellia brittoniana ‘Katie’, and Tachelopspermum asianticum (1, 2), but these trials were not located near the coastal area.
Ozbreed Ltd., an Australian-based plant breeding and introduction company, markets their ‘Celebrated Plants’ line as requiring little or no irrigation. This study evaluated the
Landscape 312
SNA Research Conference Vol. 56 2011
‘Celebrated Plants’ line as well as other well-adapted, drought-tolerant plants, including butterfly iris, a wildflower mix, and a native grass mix, for use on a green roof in coastal southeast Texas under irrigation-limited conditions.
Eight new ornamental grasses from OzBreed’s ‘Celebrated Plants’ line called the ‘Aussie Mix’ were planted on a green roof at 2000 West Parkwood Suite 100, Friendswood, Texas on January 15, 2009. The building is the corporate headquarters of Jacob White Construction. The plants were grown in 3.5-in square containers before installation. The plants were completely rooted-out in the containers at the time of planting. Six plants of each cultivar from the Aussie Mix were planted in a randomized, complete-block design. The native grass mix and the wildflower mix were established from seed. The seeding rate for the native grass mix was 5.13 oz/100 ft2 and 1.29 oz/100 ft2 for the wildflower mix. Each butterfly iris replication consisted of 12 one-gallon completely rooted-out container plants.
The green roof growing media was provided by a local landscape soil distributor and was installed in late October 2008 to a depth of six inches after settling. The media consisted of: • 60% expanded shale • 30% leaf mold compost • 10% enriched loam • 1.25 pound per yard Microlife Ultimate fertilizer (8-4-6) • 0.25 pound per yard ECO-MIN
Table 1 lists the plants evaluated in the trial.
The plants were watered by overhead irrigation three times each week with 0.17 inches applied per irrigation event (i.e. 0.5 inches per week) in the early morning when wind speeds are typically lowest. Once the plants were established, all treatments were split into two different irrigation regimes (July 19, 2009). Half the replications received drip irrigation every day at the rate of 1.0 inches water per day (complete saturation of growing media), while the other replications received no further irrigation. The plants were checked every two weeks thereafter. When saturated, the green roof soil media holds up to 0.9 inches of water (personal communication, Jacob White Construction representative).
The evaluation concluded on October 30, 2009, and plant quality scores were taken. The rating scale used values from 0 to 9, with 0 indicating a dead plant, 6 indicating an acceptable quality and 9 indicating a perfect plant with no blemishes. Each Aussie Mix plant was rated individually by four Harris County Extension Master Gardener volunteers. Each treatment was also rated as a whole by the same four Harris County Extension Master Gardener volunteers.
Landscape 313
SNA Research Conference Vol. 56 2011
Results and Discussion: No Aussie Mix plants died after July 19, 2009 (the date the irrigation scheme was altered), but the other treatments did experience some mortality (data not shown). Survival rates for the eight Aussie Mix species are presented in Table 2.
Table 3 presents the average plant quality score of the individual Aussie Mix plant species and cultivars as a whole and grouped according to irrigation treatment (excluding dead plants) on October 20, 2009.
There was no significant difference in quality ratings between the irrigated and non- irrigated Aussie Mix plants. One possible reason is that the total amount of rainfall received over the duration of the trial was adequate to sustain quality plant material on this green roof. From January 15, 2009 through July 15, 2009, 24.37 inches of rainfall was recorded. During April, 13.37 inches of the total rain fell during two rain events only five days apart. While the spring and summer of 2009 were noted for above average temperatures and below average rainfall, 22.64 inches of rain fell from July 16, 2009 to October 30, 2009. Weather data for the research site was obtained from a weather station located 2.8 miles away at the Pearland Regional Airport.
The average quality ratings of the Aussie Mix, butterfly iris, and the native grass mix treatments were significantly higher than the average quality rating of the wildflower mix (Table 4). There was no significant difference in quality ratings among the Aussie Mix, butterfly iris, and the seeded native grass mix (Table 5, Chart 1).
Within the Aussie Mix, Dianella revoluta ‘Little Rev’, Dianella revoluta ‘Big Rev’, and Dianella caerulea ‘Cassa Blue’ quality ratings were significantly better than the others in the mix with no significant difference among their own ratings (Table 6, Table 7, Chart 2). It is likely that a plant mix consisting of the highest scoring Aussie plants would have scored significantly better as a single treatment compared to the butterfly iris, wildflower mix, and native grass mix treatments. While Dianella revoluta ‘Baby Bliss’, Dianella tasmanica ‘Tasred’, Lomandra hystrix ‘Tropic Belle’, Lomandra longifolia ‘Breeze’, and Lomandra longifolia ‘Katrinus Deluxe’ are noted as having good heat and drought tolerance, the artificial growing media, shallow soils, and constant wind may have affected the performance of these plants.
Literature Cited 1. Harp, Derald A. and Chelsea Suttle. 2009. Performance of ornamental groundcovers and perennials in Texas green roof gardens. SNA Res. Conf. 54:240–244. 2. Harp, Derald A. and Steven Pulatie. 2008. Preliminary Evaluation of Landscape Plants for Use on Green Roofs in Texas. SNA Res. Conf. 53:433–435. 3. Thompson, J. William and Kim Sorvig. 2000. Sustainable Landscape Construction. Island Press, Washington D. C. 4. United States Environmental Protection Agency. 2003. Cooling summertime temperatures: strategies to reduce urban heat islands. Publication No. 430-F-03- 014.
Landscape 314
SNA Research Conference Vol. 56 2011
Table 1. Evaluated Plants Aussie mix Dianella caerulea ‘Cassa Blue’ Perennial 3.5 in container Dianella revoluta ‘Baby Bliss’ Perennial 3.5 in container Dianella revoluta ‘Big Rev’ Perennial 3.5 in container Dianella revoluta ‘Little Rev’ Perennial 3.5 in container Dianella tasmanica ‘Tasred’ Perennial 3.5 in container Lomandra hystrix ‘Tropic Belle’ Perennial 3.5 in container Lomandra longifolia ‘Breeze’ Perennial 3.5 in container Lomandra longifolia ‘Katrinus Deluxe’ Perennial 3.5 in container Wildflower mix Percent of seed mix Texas Bluebonnet Annual 18.90% Indian Blanket Annual 8.00% Scarlet Flax Annual 6.60% Tickseed Perennial 6.45% Lemon Mint Annual/Perennial 6.23% Purple Coneflower Perennial 5.86% Drummond Phlox Annual 5.29% Cornflower Annual 4.40% Rocket Larkspur Annual 4.40% Baby Blue Eyes Annual 4.40% Ox-Eyed Daisy Perennial 4.18% California Poppy Annual/Perennial 3.14% Yellow Cosmos Annual 2.86% Baby's Breath Annual 2.86% African Daisy Annual 2.75% Plains Coreopsis Annual 2.24% Clasping Coneflower Annual 1.98% Black-Eyed Susan Annual/Perennial 1.76% Tuber Vervain Perennial 1.44% Corn Poppy Annual 1.40% Toadflax Annual 1.21% Dwarf Red Coreopsis Annual 1.10% Standing Cypress Perennial 1.00% Showy Primrose Perennial 0.77% Mexican Hat Annual/Perennial 0.56% Texas Paintbrush Annual/Perennial/Biennial 0.22% Native grass mix Percent of seed mix Buffalograss Perennial 80% Blue Grama Perennial 20% Butterfly Iris Moraea iridioides Perennial 1 gallon container
Landscape 315
SNA Research Conference Vol. 56 2011
Table 2. Aussie mix establishment and treatment survival rates. Treatment 1 Non- irrigated Treatment 2 Establishment Survival Irrigated Survival Rate Rate Survival Rate Plant (7/19/2009) (10/30/2009) (10/30/2009) Dianella caerulea ‘Cassa Blue’ 6 of 6, 100% 3 of 3, 100% 3 of 3, 100% Dianella revoluta ‘Baby Bliss’ 4 of 6, 67% 2 of 2, 100% 2 of 2, 100% Dianella revoluta ‘Big Rev’ 6 of 6, 100% 3 of 3, 100% 3 of 3, 100% Dianella revoluta ‘Little Rev’ 6 of 6, 100% 3 of 3, 100% 3 of 3, 100% Dianella tasmanica ‘Tasred’ 6 of 6, 100% 3 of 3, 100% 3 of 3, 100% Lomandra hystrix ‘Tropic Belle’ 5 of 6, 83% 2 of 2, 100% 3 of 3, 100% Lomandra longifolia ‘Breeze’ 3 of 6, 50% 3 of 3, 100% n/a Lomandra longifolia ‘Katrinus 5 of 6, 83% 3 of 3, 100% 2 of 2, 100% Deluxe’
Table 3. Aussie mix plant quality ratings on 10/30/2010. Overall Non-irrigated Irrigated Dianella caerulea ‘Cassa Blue’ 7.8 8.0 7.6 Dianella revoluta ‘Baby Bliss’ 4.5 7.25 6.4 Dianella revoluta ‘Big Rev’ 8.2 7.9 8.4 Dianella revoluta ‘Little Rev’ 8.4 8.3 8.6 Dianella tasmanica ‘Tasred’ 5.2 5.2 5.3 Lomandra hystrix ‘Tropic Belle’ 5.2 6.6 6.0 Lomandra longifolia ‘Breeze’ 3.5 7.0 n/a Lomandra longifolia ‘Katrinus 4.25 5.6 4.4 Deluxe’
Landscape 316
SNA Research Conference Vol. 56 2011
Table 4. Repeated measures ANOVA comparing quality ratings of Aussie mix, native wildflower mix, native grass mix plots, and butterfly iris. p=0.05. Native Grass Aussie Mix Butterfly Iris Wildflower Mix Mix N Valid: 24 24 24 24 Mean: 6.938 5.979 3.792 6.250 Std. Dev: 1.651 2.324 1.961 1.726
ANOVA Source of Variance SS DF MS F Factor A 133.135 3.000 44.378 14.487 Factor S 132.490 23.000 5.760 A x S 211.365 69.000 3.063 Total 476.990 95.000
P 0.000 Eta Squared 0.386
Table 5. Post-Hoc test comparing quality ratings of Aussie mix, wildflower mix, native grass mix, and butterfly iris treatments. p=0.05. Mean P - P - Eta Post Hoc tests Comparison Difference T-Value Unadjusted Bonferroni Squared Aussie Mix Aussie and Butterfly 0.958 2.051 0.052 0.311 0.149 Aussie and Wild 3.146 7.239 0.000 0.000 0.686 Aussie and Grass 0.688 1.728 0.097 0.585 0.111 Butterfly Butterfly and Wild 2.188 3.000 0.006 0.038 0.273 Butterfly and Grass 0.271 0.644 0.526 1.000 0.017 Wild Wild and Grass 2.458 4.839 0.000 0.000 0.494
Landscape 317
SNA Research Conference Vol. 56 2011
Table 6. Quality ratings of Aussie mix selections. Tropic Cassa Katrinus Little Baby Big Rev Belle Blue Deluxe Breeze Tasred Rev Bliss N Valid: 24 24 24 24 24 24 24 24 N Missing: 0 00000 00 Mean: 8.167 5.208 7.792 4.250 3.500 5.208 8.417 4.542 Std. Dev: 0.702 2.637 1.215 2.996 3.659 1.179 0.584 3.671
ANOVA Source of SS DF MS F Variance Factor A 631.979 7.000 90.283 18.237 Factor S 272.479 23.000 11.847 A x S 797.021 161.000 4.950 Total 1701.479 191.000
P 0.000 Eta 0.442 Squared
Landscape 318
SNA Research Conference Vol. 56 2011
Table 7. Post-hoc comparison of Aussie mix selections. Mean P - P - Eta Comparison Difference T-Value Unadjusted Bonferroni Squared Big Rev Big Rev and Tropic Belle 2.958 5.896 0.000 0.000 0.592 Big Rev and Cassa Blue 0.375 1.334 0.195 1.000 0.069 Big Rev and Katrinus Deluxe 3.917 5.992 0.000 0.000 0.599 Big Rev and Breeze 4.667 5.883 0.000 0.000 0.591 Big Rev and Tasred 2.958 11.756 0.000 0.000 0.852 Big Rev and Little Rev 0.250 2.304 0.031 0.857 0.181 Big Rev and Baby Bliss 3.625 4.649 0.000 0.003 0.474 Tropic Belle Tropic Belle and Cassa Blue 2.583 4.315 0.000 0.007 0.437 Tropic Belle and Katrinus Deluxe 0.958 1.475 0.154 1.000 0.083 Tropic Belle and Breeze 1.708 1.692 0.104 1.000 0.107 Tropic Belle and Tasred 0.000 0.000 1.000 1.000 0.000 Tropic Belle and Little Rev 3.208 6.239 0.000 0.000 0.619 Tropic Belle and Baby Bliss 0.667 0.954 0.350 1.000 0.037 Cassa Blue Cassa Blue and Katrinus Deluxe 3.542 6.621 0.000 0.000 0.646 Cassa Blue and Breeze 4.292 5.793 0.000 0.000 0.583 Cassa Blue and Tasred 2.583 8.272 0.000 0.000 0.740 Cassa Blue and Little Rev 0.625 2.532 0.019 0.521 0.211 Cassa Blue and Baby Bliss 3.250 3.894 0.001 0.020 0.387 Katrinus Deluxe Katrinus Deluxe and Breeze 0.750 1.105 0.281 1.000 0.048 Katrinus Deluxe and Tasred 0.958 1.558 0.133 1.000 0.092 Katrinus Deluxe and Little Rev 4.167 6.734 0.000 0.000 0.654 Katrinus Deluxe and Baby Bliss 0.292 0.461 0.649 1.000 0.009 Breeze Breeze and Tasred 1.708 2.206 0.038 1.000 0.169 Breeze and Little Rev 4.917 6.341 0.000 0.000 0.626 Breeze and Baby Bliss 1.042 1.072 0.295 1.000 0.046 Tasred Tasred and Little Rev 3.208 13.772 0.000 0.000 0.888 Tasred and Baby Bliss 0.667 0.924 0.365 1.000 0.034 Little Rev Little Rev and Baby Bliss 3.875 5.069 0.000 0.001 0.517
Landscape 319
SNA Research Conference Vol. 56 2011
Chart 1. Average quality ratings of the Aussie mix, butterfly iris, wildflower mix, and native grass mix.
Landscape 320
SNA Research Conference Vol. 56 2011
Chart 2. Average quality ratings of Ozbreed selections.
Landscape 321
SNA Research Conference Vol. 56 2011
Fertilizer Regimes during Production Affect Coleus Growth and Quality in the Landscape
Yan Chen, Allen Owings, Regina Bracy
LSU AgCenter Hammond Research Station 21549 Old Covington Highway, Hammond LA 70403
Index Words: nitrogen, phosphorus, irrigation frequency, Solenostemon scutellarioides
Significance to Industry: Coleus plants are used in landscape plantings for foliage colors and early flowering is unfavorable. This study evaluated the effects of fertilization rates during production on landscape growth and flowering of coleus. Coleus cultivars ‘Trusty Rusty’ and ‘Redhead’ were grown under 3 N (70, 140, and 280 mg·l-1) x 2 P (6 or 37 mg·l-1) x 2 fertigation frequencies (20% or 40% container capacity loss) for 8 weeks and then transplanted into landscape plots and maintained under the same fertilizer and irrigation practices. These production treatment levels were chosen because they produce similar quality plants as indicated in previous experiments (data not presented). Plants were evaluated for growth and quality over 22 weeks post- transplant (WPT). At 16 WPT, plants fertilized with 280 mg·l-1 N during production were larger with better foliage color but less compact than plants that received 70 or 140 mg·l- 1 N during production. High N rate also resulted in earlier flowering in ‘Trusty Rusty’ than lower N rates. Phosphorus rates during production had no effect on post-transplant growth and quality of both cultivars. Plants fertigated less frequently during production (40% container capacity loss) were larger than those that were fertigated more frequently throughout the landscape evaluation period. Foliage color and compactness of the plants were similar between the two fertigation frequencies. Based on these results, coleus should be produced with a moderate N rate to avoid early flowering in the landscape. Production P rate can be reduced to 6 mg·l-1 without affecting landscape growth and quality of coleus.
Nature of Work: Coleus cultivars are being selected and used in the landscape for their colorful variegated leaves. Because the switch from vegetative growth to flowering may affect foliage growth and overall visual quality, coleus cultivars that flower early during landscape establishment are less favorable. As a result, some cultivars released in recent years have been selected for both foliage color and late flowering. On the other hand, production regimes such as fertilization (1, 2) and irrigation (3, 4) may affect post transplant performance of ornamentals. Nitrogen and P have also been reported to impact flower earliness and longevity (5). Therefore, the objective of this study was to evaluate how production regimes may affect growth, quality, and flowering of coleus after being transplanted into landscape beds. Cultivars ‘Trusty Rusty’ and ‘Redhead’, which flower later than most other cultivars, were selected for this study.
Landscape 322
SNA Research Conference Vol. 56 2011
Forty-eight rooted cuttings of each cultivar were potted into 5.5 inch azalea pots on 17 Mar. 2010 and grown for 8 weeks in a greenhouse. Plants were divided into two groups, each fertigated at either 20% ± 5% or 40% ± 5% container capacity loss. When weights of representative pots dropped within the range of container capacity for the assigned fertigation frequency, plants were hand-fertigated with one of the six fertilizer solutions with four pots per solution. Leaching fraction was kept between 10% to 15%. The nutrient solutions were combinations of N at 70, 140, or 280 mg·l-1 with P at 6 or 37 mg·l-1. Potassium, Ca, Mg, and other nutrients were kept constant across nutrient solutions. Plants were grown for 8 weeks and transplanted into 4 raised landscape plots (10 feet wide x 30 feet long) on May 12, 2010. Raised plots were made by adding and tilling garden soil mix (Nature’s Best, Baton Rouge, LA) into the top 8-inch of native soil. Each plot consisted of 24 plants that consisted of one replication of the 2 cultivars x 2 fertigation frequencies x 3 N x 2 P factorial treatment structure. These plants were randomly arranged within a plot. A 6-inch layer of pine straw was added after planting as mulch. Plots were broadcasted with Osmocote 14-14-14 (8 to 9 months southern) at 2 lb N/1000 ft2. Overhead irrigation was scheduled to deliver half-inch water every other day for the first 2 weeks and then twice per week thereafter. Irrigation was postponed by half- inch rainfall events. Plants were measured at planting and 8, 12, and 16 weeks post transplant (WPT) for plant size (height x the widest-width x the width perpendicular to the widest-width). The Increased Size was the difference between plant size measured at the sample dates and the initial transplant size. Plants were rated for foliage color intensity (1 to 5) and compactness (1 to 5) at 16 WPT. Plants with vivid leaf color and compact shape were rated higher than plants with dull foliage color and stretched appearance. Number of inflorescence were recorded when first inflorescence appeared on ‘Trusty Rusty’ and then at the study termination (22 WPT). The length of the first inflorescence appearing on each plant was also measured weekly from 13 to 17 WPT.
Results and discussion: No interactions between N and other treatment factors were found. N affected plant growth and quality regardless of P rate and fertigation frequency. At 16 WPT, plants fertigated with 280 mg·l-1 N during production were larger with higher foliage color ratings but were less compact than plants receiving 70 or 140 mg·l-1 N (Table 1). The high N rate also resulted in earlier flowering in ‘Trusty Rusty’ than lower rates as indicated by longer first-inflorescence (Table 2) and more inflorescence overtime (Table 3). Interactions between P and fertigation frequency were significant for plant size at 12 WPT without significant trend (Table 1). Overall, P had no effect on post-transplant growth and quality (Table 1). P at the low rate resulted in marginally significant early flowering as indicated by number of flowers at the first week when flowers were observed (Table 3). As a result, plants fertilized with 280 mg·l-1 N and 6 mg·l-1 P at 40% container capacity loss flowered two weeks earlier than plants fertilized with 140 mg·l-1 N with 20% fertigation frequency (data not shown). Based on these results, coleus should be produced with a moderate N rate at 140 mg·l-1 to avoid early flowering in the landscape. P rate during production can be as low as 6 mg·l-1 without affecting plant growth and quality in the landscape. Plants fertigated less frequently (40% container capacity loss) during production were larger than plants fertigated more frequently
Landscape 323
SNA Research Conference Vol. 56 2011 throughout the landscape evaluation (Table 1) with more inflorescences in ‘Trusty Rusty’ (Table 2). Because roots were not sampled in this study, it was difficult to explain why coleus grown with less total amount of water and fertilizer were larger in size after growing 8 weeks in the landscape. Further research is needed to investigate this effect.
1. Cabrera, R.I. and D.R. Devereaux. 1999. Crape myrtle post-transplant growth as affected by nitrogen nutrition during nursery production. J. Amer. Soc. Hort. Sci. 124(1):94-98. 2. Iersel, M.W. van, R.B. Beverly, P.A. Thomas, J.G. Latimer, and H.A. Mills. 1999. Nitrogen, phosphorus, and potassium effects on pre- and post-transplant growth of salvia and vinca seedlings. J. Plant Nutrition 22:1403-1413. 3. Gilman, E.F., R.J. Black, and B. Dehgan. 1998. Irrigation volume and frequency and tree size affect establishment rate. J. of Arboriculture 24:1-9. 4. Bates, R.M. and A.X. Niemiera. 1994. Mist irrigation reduces post-transplant desiccation of bare-root trees. J. of Environ. Hort. 12:1-3. 5. Druege, U. 2001. Postharvest responses of different ornamental products to preharvest nitrogen supply: role of carbohydrates, photosynthesis and plant hormones. Acta Horticulturae 543:97-102.
Landscape 324
SNA Research Conference Vol. 56 2011
Table 1: Increase in plant size of two coleus cultivars ‘Trusty Rusty’ and ‘Redhead’ at 8, 12, and 16 weeks compared to the plant size at transplant (0 WAT), and foliage quality (color and density) at 16 WAT . Plants were treated with 3N x 2P x 2 Irrigation frequency during the 8-week of production period and kept under the same maintenance practices after transplant.
Treatment Increased Size Quality Rating (103 cm3) (16 WPT) 8 WPT 12 WPT 16 WPT Foliage Compactness Color (1-5) (1-5) p-values z Cultivar 0.0003 <0.0001 0.0088 0.3228 0.5671 N <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 P 0.5532 0.9265 0.7137 0.6163 0.1690 Fertigation Frequency 0.0010 <0.0001 <0.0001 0.1428 0.3111
Cultivar ‘Trusty Rusty’ 123.2 by 353.5 b 470.6 b 3.7 3.5 ‘Redhead’ 161.6 a 486.0 a 566.5 a 3.5 3.4 LSD0.05 21.2 51.8 70.5 NS NS
N 70 ppm 93.3 b 343.2 b 437.1 b 3.4 b 3.9 a 140 ppm 113.3 b 352.5 b 409.0 b 3.4 b 3.1 b 280 ppm 223.2 a 566.8 a 726.9 a 4.0 a 3.3 b LSD0.05 25.9 63.5 86.4 0.2 0.3
Fertigation Frequency 20% 121.3 b 355.7 b 429.5 b 3.5 3.4 40% 162.4 a 480.1 a 602.7 a 3.7 3.5 LSD0.05 21.2 51.8 70.5 NS NS zSignificance at p < 0.05. Interactions between treatment factors were not significant for most variables except Increased Size at 8 WPT in P x FF. yMeans with the same letters were not significantly different. NS = no significant difference was found among treatments.
Landscape 325
SNA Research Conference Vol. 56 2011
Table 2. Length of the first inflorescence observed on the plants from 13 to 17 WPT.
Treatment Length of the first inflorescence (cm) 13 WPT 15 WPT 17 WPT p-values z N 0.0005 0.0003 0.0004 P 0.2162 0.0262 0.2801 Fertigation Frequency 0.1477 0.1216 0.0572
N 70 ppm 0.1 b 4.4 b 11.0 b 140 ppm 0 b 5.2 b 13.9 b 280 ppm 1.3 a 18.7 a 29.8 a LSD0.05 0.6 6.7 2.1
P 6 ppm 0.6 12.6 a 20.2 37 ppm 0.3 6.3 b 16.3 LSD0.05 NS 5.5 NS
Fertigation Frequency 20% 0.3 7.3 14.6 40% 0.6 11.6 21.9 LSD0.05 NS NS NS zSignificance at p < 0.05. Interactions between treatment factors were not significant.
Landscape 326
SNA Research Conference Vol. 56 2011
Table 3. Total number of inflorescence per plant when the first inflorescence was observed (13 WAT) and at experiment termination (22 WAT).
Treatment Number of inflorescence 13 WAT 22 WAT p-values z N 0.0001 <0.0001 P 0.0353 0.1057 Fertigation 0.2743 0.0019 Frequency
N 70 ppm 0.08 by 4.5 b 140 ppm 0 b 5.3 b 280 ppm 0.58 a 15.0 a LSD0.05 0.25 2.8
P 6 ppm 0.3 a 9.2 37 ppm 0.1 b 7.4 LSD0.05 0.2 NS
Irrigation Frequency 20% 0.2 6.4 40% 0.3 10.2 LSD0.05 NS 2.3 zSignificance at p < 0.05. Interactions between treatment factors were not significant except Number of Inflorescence at 16 WPT in P x IF. yMeans with the same letters were not significantly different. NS = no significant difference was found among treatments.
Landscape 327
SNA Research Conference Vol. 56 2011
Market Demand for Smilax smalli? A Survey of Design Use in the South
Brad E. Davis, RLA
University of Georgia, College of Environment and Design 609 Caldwell Hall, Athens, GA 30602
Index Words: native plants, design, evergreen vine, drought tolerance, landscape preference
Significance to Industry: The landscape architecture and design professions and the Green Industry have been changing significantly over the past two decades. Consumer interest and appreciation for native plants and the native landscape have been on the increase; partially fueled by water shortages and the need for lower maintenance landscapes, but also through education of the public on other benefits of natives such as increased attraction and support of indigenous pollinators and local food systems, and a growing appreciation of the aesthetics of a regionally identifiable landscape as supposed to one that is more artificial and demanding greater inputs. This paper highlights a rather unique landscape conundrum as Smilax smalli is virtually non-existent in the growing industry, yet one can find it intentionally used in diverse landscape designs across the South. Is this a plant worth reconsidering by the Green Industry? Will the Green Industry find ways to embrace ‘slower’ plant material in the coming years in tandem with the public’s increased desire for ‘slow’ or more locally grown food?(1). The current and historic uses of Smilax smalli present an excellent case study and make a strong argument for the introduction of this plant into the mainstream. Smilax s. is a drought tolerant, long lived, disease free, native evergreen vine with attractive foliage and an extremely workable architecture. The beauty of the vine has been noted from the early naturalists such as John Lawson (2) to present day writers such as James Cothran (3) and Steve Bender (4). Many have scoffed at the idea of using Smilax for anything other than kindling (many also confuse it with the other less desirable species,) but the design examples, Figures 1-8, speak for themselves.
Nature of Work: This study involves a targeted survey of communities and neighborhoods identified through the experience and travel of the author as well as by recommendation of gardeners and other plant enthusiasts who could recall memorable landscapes where Smilax smalli was observed as a landscape design element. Five communities and specific neighborhoods therein were identified including the Westmorland and Sequoia Hills neighborhoods of Knoxville, TN; older neighborhoods of Athens and Cleveland, TN; the Twickenham historic district in Huntsville, AL; and the Mountain Brook neighborhood in Birmingham, AL. In traveling the South other notable demonstrations of Smilax as a deliberate landscape act were observed by the author such as at Southern Progress corporate headquarters in Birmingham, AL and in the conservatory at Longwood Gardens in Kennett Square, PA. In each of the
Landscape 328
SNA Research Conference Vol. 56 2011 neighborhoods the author walked the streets, photographed and recorded use of Smilax on a map. Whenever possible homeowners were interviewed to discuss their use of Smilax and where they acquired the vine. This study also includes interviews with a wide range of professionals from landscape architects and contractors, garden historians, nursery owners and growers, in addition to the homeowners who grow the vine as an ornamental. While this study is small and not a statistically significant representation of the greater population, it is a considerable amount of evidence supporting the idea that there may be an untapped market warranting effort towards the introduction of Smilax smalli into the larger Green Industry.
Smilax smalli has been observed by the author for many years as a landscape design plant as well as an important cut branch in the floral industry. S. smalli has long been used in the South for holiday and wedding decoration. One of the common names, Jackson Vine, is reported to have come from its use as table decoration for Stonewall Jackson during the Civil War (3). In the early part of the twentieth century a booming cut greenery industry existed in the South with orders for S. smalli being sent to large floral markets such as the famous wholesale floral district in New York City, NY. (5) In addition to its ornamental qualities, Smilax has historically been used as a food source by native peoples. The tuber may be dug and cooked much like a potato and the new spring growth may be cut and prepared like Asparagus. Today in the coastal south Smilax is often referred to as Chainey Briar and the spring growth is a favorite culinary treat with many recipe books including directions for its preparation(6). Today Smilax s. may be purchased by mail order from Woodlanders Nursery (7) in Aiken, SC as a 4” container plant. An online search will occasionally produce an independent seller offering the tubers. Cut branches may be purchased mail order from EastTexassmilax.com (8).These are the only sources known to this author apart from collection in the wild.
Results and Discussion: The survey of design use in the five identified neighborhoods reveals a high preference for Smilax s. as a vine for the designed landscape. In the Twickenham Historic District in Huntsville, AL certain streets, such as Eustis and Randolph streets, exhibit high conformity in that literally nearly every house on the street prominently displays Smilax s. as the vine trained along the porch, wrapping columns, swaging the balustrade or the fence, shading the carport, or a myriad of other uses. When residents were asked how they obtained the vine, most report it as a “passalong” plant that has been shared by family and friends. The repeated use of the plant is remarkable and functions as a strong identifier of place and as an act of community making and belonging (9).
Occasionally residents report that the vine was installed by a landscape contractor. A landscape contractor in Birmingham, AL reports that they occasionally dig the vine from the wild for use in installations, but also keep a stockpile of the tubers on their nursery lot. Several highly successful landscape architects in the South regularly specify the vine on their garden design plans, such as Ben Page in Nashville, TN, Steven W. Hackney in Knoxville, TN, and Alec Michaelides in Atlanta, GA. In spite of their preference for the vine all report that problems are often encountered in landscape
Landscape 329
SNA Research Conference Vol. 56 2011
installations where either homeowners are too impatient to allow Smilax to mature and thus request a different vine, or landscape maintenance contractors unwittingly remove the vine thinking it is weed. These problems could easily be alleviated if larger containerized and trellised material was available for installation, similar to Clematis armandii, rather than having to rely on division of the tubers which causes a significant delay in the production of attractive foliage. A nursery owner in the Mountain Brook neighborhood of Birmingham, AL reports that they often received requests for Smilax but would not consider offering it for sale as this would compete with their landscape contractor clientele who typically dig the vine from the wild and charge large fees for installation.
It is apparent from this survey that when people are exposed to successful design applications of Smilax s. that there is strong preference for it as evidenced by neighborhood pockets where the vine has become a visually dominant landscape plant. Other factors influencing preference include familiarity as a traditional passalong plant and a means of remembering family and friends as well as culinary tradition. As native plants and landscapes continue to increase in demand, the Green Industry may need to re-evaluate plants such as Smilax s. and other natives that have been passed over in the past but may possess greater landscape longevity in terms of drought and disease tolerance, non-invasive growth habits, and considerable aesthetic and cultural value.
Literature Cited: 1. N. Bakker, M. Dubbeling, S. Guendel, U. Sabel Koschella, H. de Zeeuw (eds.). Growing Cities, Growing Food, Urban Agriculture on the Policy Agenda. 2001; pp. 99-117, DSE, Feldafing. 2. Lawson, John. A New Voyage to Carolina. London: n.p., 1709. Reprinted as A New Voyage to Carolina. Edited with an introduction and noted by Hugh Talmadge. Chapel Hill: University of North Carolina press, 1967. 3. Cothran, James. Gardens and Historic Plants of the Antebellum South. Columbia, SC. University of South Carolina Press. 2003. 4. Bender, Steve. One Fine Vine. Southern Living, Vol. 37, December 2002. 5. Phone Interview with the owner of Mountain Brook Flower Shop, Birmingham, AL. June 2008. 6. Taylor, John Martin. Hoppin’ John’s Lowcountry Cooking: Recipes and Ruminations from Charleston and the Carolina Coastal Plain. New York, NY, Houghton Mifflin Company. 2000. 7. www.Woodlanders.com accessed November 1, 2010. 8. www.easttexassmilax.com accessed November 1, 2010. 9. Thayer, Robert. The experience of sustainable landscapes. Landscape Journal, 1989; 8,101- 109.
Landscape 330
SNA Research Conference Vol. 56 2011
Table 1. Smilax smalli Observations in Huntsville, Alabama and the Southeast.
Number and type of Design Applications Observed* Street Residential Commercial Public Eustis 15 Holmes 1 White 6 Circle Wells 7 Tollgate 1 Randolph 30 Franklin 4 Humes 4
Huntsville, AL Twickenham Historic District Stevens 1 7 (arbors leading to entrance) Southern Progress Corporat e 1 (Conservatory) Longwoo d Gardens, Kennett * Similar results of residential surveys are available from the author for neighborhoods in Knoxville, Cleveland, and Athens, Tennessee; as well as Birmingham, Alabama.
Landscape 331
SNA Research Conference Vol. 56 2011
Figure 1. Smilax smalli beginning to be trained on a series of arbors leading into Southern Progress Corporate headquarters in Birmingham, Alabama. Photo by the author.
Figure 2. Smilax smalli trained over the doorway in Mountain Brook Park, a townhouse development in Birmingham, Alabama. Nearly every Townhouse in this neighborhood had Smilax trained this way. Photo by the author.
Landscape 332
SNA Research Conference Vol. 56 2011
Figure 3. One of the more graceful yet typical residential applications of Smilax smalli in Mountain Brook neighborhood, Birmingham, Alabama. Photo by the author.
Figure 4. A residential application of Smilax smalli in Twickenham Historic District, Huntsville, Alabama. Photo by the author.
Landscape 333
SNA Research Conference Vol. 56 2011
Figure 5. Smilax smalli is commonly swaged along porches as on this house in the Twickenham Historic District, Huntsville, Alabama. Photo by the author.
Figure 6. Smilax smalli used to grace a less imposing house in Huntsville, Alabama. Photo by the author.
Landscape 334
SNA Research Conference Vol. 56 2011
Figure 7. Smilax smalli swags add elegance and grace to this otherwise simple colonial home in Sequoia Hills, Knoxville, Tennessee. Photo by the author.
Figure 8. Smilax smalli graces a set of windows in the Conservatory at world famous Longwood Gardens in Kennett Square, Pennsylvania. Photo by the author.
Landscape 335
SNA Research Conference Vol. 56 2011
Does Potting Depth of Container Grown Maples Affect Landscape Performance?
Donna C. Fare
US National Arboretum Otis L. Floyd Nursery Research Center 472 Cadillac Lane McMinnville, TN 37110
Index words: Acer rubrum L. ‘October Glory’, red maple, root flare, tree liners, girdling roots
Significance to the Industry : From this test, it is inconclusive that potting depth of October Glory maple affected the landscape performance during the first 5 years after transplanting. Height growth during the production phase and the landscape phase was similar among potting depths. Some variability was observed with trunk caliper growth; however, plants grown with the root flare at the correct depth as well as plants grown with root system 6 inches too deep were similar. Shoot dry weight was similar among all potting depth treatments. One concern is the quality of root system that developed during the 5 years in the landscape. All trees had at least one girdling root and several trees had other roots that were beginning to impact the girth of the trunk. It is suspected that these root problems developed from a lack of root remediation at the end of the production phase rather than the impact from the potting depth treatments.
Nature of the Work: Planting depth of ornamental trees has become a point of discussion among arborists, growers and landscapers. Some arborists have raised concerns about an increased number of landscape trees in which the root system was potted too deeply in the growing container or buried in the soil of a balled and burlapped root system, and speculate that this may be the reason for poor landscape performance (1). Often trees are potted deep in the container to prevent wind-throw due to the oversize tree liner and the low bulk density of the container substrate. Concern exists that excessive potting depth predisposes plants to reduced growth and promotes poor quality root systems with circling and potentially girdling roots. In this test, roots had completely filled the container after 18 months regardless of potting depth. In another test, potting depth in containers only affected growth with 1 out of 5 species tested (3). Gilman et al. (6) found reduced top growth with 2 of 3 cultivars when the root system was potted at various depths in containers, though the difference was minimal. After assessing container grown trees, Gilman and Kane (5) predicted root deformation (kinked or girdled) within the container may not have a long-term effect on growth of red maple in the landscape, since the majority of roots generally grew down and in a circular manner in the container. This study was initiated to evaluate landscape performance of maples 5 years after trees had been subjected to four potting depths during the container production cycle.
Landscape 336
SNA Research Conference Vol. 56 2011
On 17 March 2005, 4-5 ft (122-152 cm) bare root Acer rubrum L. ‘October Glory’ liners were potted in #15 nursery containers with pine bark substrate amended with 9.0 lb (5.3 kg) of 19-5-9 (19N-2.2P-7.5K) Osmocote Pro controlled-release fertilizer (The Scotts Co., Marysville, OH) and 1.5 lb (0.9 kg) of Micromax (The Scotts Co., Marysville, OH) per yard3 (per m3). Kinked or crossover roots were removed to ensure a quality root system prior to potting. The root flare was identified on each tree and a mark painted on the trunk that indicated 0, 2, 4 or 6 inches (0, 5.1, 10.2, or 15.2 cm) above the root flare. The liners were then potted with the root flare 0, 2, 4, 6 inches below the substrate surface. Trees were grown for one year in a pot-in-pot system with micro irrigation in a CRD. On 10 April 2006, plants were removed from the pot-in-pot system and the root system was scored with one inch deep slits from top to bottom six times equidistance around the perimeter on eight replications per treatment. Trees were transplanted in a field plot with Waynesboro silt loam soil at the TSU Nursery Research Center in McMinnville, Tenn with the surface of the root ball level with the field soil so that potting depth treatments were retained A CRD design with a 15 x 15 ft (4.6 x 4.6 m) off-set grid planting pattern was used to simulate a landscape setting. Plants were fertilized and mulched at planting and each spring during the test. Plant maintenance, i.e. irrigation, nutrition and weed control, followed traditional landscape guidelines. Data collected included annual height and caliper growth measured 6 inches (15.2 cm) above the soil surface. In August 2010, trees were harvested by cutting the trunk at the soil line then dried at 56C to determine biomass. The root systems were removed from the soil using an air knife and roots within a 30 cm (12 inch) radius of the trunk were evaluated for circling or girdling potential. The area between the root flare and the point on the trunk at soil level was checked for adventitious roots. All data were subjected to analysis of variance with the GLM procedure of SAS (SAS for Windows Version 9.1, SAS Institute, Cary, NC) and differences among treatments were separated by a Fisher’s least significant difference, P<0.05.
Results and Discussion At the end of the one year production phase in the pot-in-pot system (April 2006) plants had similar height and caliper growth regardless of potting depth treatments (Table 1). The root system of a subset of each potting depth was rated for the quality and root balls on all treatments had completely encompassed the container capacity. After each growing season (2006-2010) in the landscape setting, height measurements showed similar growth among potting depth treatments (Table 1). Trunk diameter measurements were similar after the first year in the landscape setting (Dec 06). In Oct 07 after 2 years in the landscape, the plants that were originally potted 6 inches above the root flare had less trunk caliper than plants that were potted 2 and 4 inches above the root flare, but had similar caliper growth to plants that were potted where the root flare was at the substrate surface. By the fall of 2009, plants with root flares 2 inches below the surface had the greatest trunk caliper, but were similar to trees planted at 0 and 6 inches below the surface. Maples planted with the root flare 4 inches below grade had the least trunk caliper but were similar to plants planted at 0 and 6 inches below the surface. This trend continued until harvest in August 2010. Bryan et al. (2), reported landscape performance of Chinese elm had reduced height but similar trunk growth of elms that had been grown in a container production system where the
Landscape 337
SNA Research Conference Vol. 56 2011 plants were potted 2 inches (5 cm) below the root collar then shifted into larger containers and potted another 2 inches (5 cm) below the root collar.
The visual observations made during the experiment (leaf out, fall color) revealed no signs of stress or indications that plants were suffering from potting depth treatments (data not shown). After 5 years in the landscape setting, shoot biomass was similar regardless of original potting depth of plants. However, the plants that had root flares 4 inches below grade with the smallest trunk diameter also had the least amount of shoot dry weight (Table 1).
There were no adventitious roots present on the trunks of the maples between the root flare and the potting depth mark on the trunks in the test. This is in contrast to a report by Gilman and Harchick (4) whereby Cathedral live oak developed adventitious roots on the trunk portion of trees planted deep in the soil. However, in this test, there was at least one girdling root on every tree regardless of potting depth (Figure 1). Some trees had up to 3 girdling roots, but each treatment averaged 2 girdling roots per tree. Within the 12-inch radius of the root system, the 0, 2, 4, and 6 inch potting depth had 2.7, 2.7, 2.5, and 3, respectively, roots circling around the main structural roots. The circling and girdling roots may not be a result of potting depth, but a result of the roots being confined during the period of time in the container production phase. The root balls were scored 6 times equidistance around the perimeter and each score was about one inch deep at transplanting; however, this only addressed roots on the perimeter of the root ball. A more aggressive root remediation at transplanting may be necessary to prevent circling and girdling roots. Potting depth can impair plant growth and quality with some species (2, 3, 4, 5) during container production so prudent potting guidelines should be followed.
Literature Cited
1. Appleton, B. 2001. Find the correct root depth. NMPro 17(11)51-55. 2. Bryan, D.L., M.A. Arnold, A. Volder, T.W. Watson, L. Lombardini, J.J. Sloan, L.A. Valdez- Aguilar, and A.D. Cartmill. 2010. Planting depth during container production and landscape establishment affects growth of Ulmus parvifolia. HortScience 45:54-60. 3. Fare, D.C. 2005. Should potting depth be a concern with container crown trees? p. 25-28, In Proceedings of Trees and Planting: Getting the Roots Right Conference. The Morton Arboretum, Lisle, IL. Nov. 10, 2005. 4. Gilman, E.F. and C. Harchick. 2008. Planting depth in containers affects root form and tree quality. J. Environ. Hort. 26:129-134. 5. Gilman E.F and M.E. Kane. 1990. Root growth of red maple following planting from containers. HortScience 25:527-528. 6. Gilman, E.F., C. Harchick, and M. Paz. 2010. Planting depth affects root form of three shade tree cultivars in containers. Arboric. Urb. For. 36:132-139
Landscape 338
SNA Research Conference Vol. 56 2011
Table 1. Height, caliper and shoot dry weight of October Glory red maple harvested 5 years after transplanting from a #15 nursery container with the root flare at 0, 2, 4, or 6 inches below substrate surface.
Depth of root flare below substrate surface, Shoot inches (cm) Apr 06Z Dec 06 Oct 07 Nov 08 Dec 09 Aug 10 dry wt, g Height, cm Aug 10 0 300 aY 305 a 325 a 386 a 411 a 462 a 7305 a 2 ( 5.1 cm) 285 a 289 a 319 a 386 a 420 a 477 a 7524 a 4 (10.2 cm) 298 a 298 a 318 a 376 a 395 a 428 a 5682 a 6 (15.2 cm) 289 a 310 a 329 a 384 a 405 a 450 a 6428 a LSD 47 39 31 33 36 78 519
Caliper, cmX 0 2.6 A 4.1 A 5.3 AB 6.4 AB 8.0 AB 8.3 AB 2 ( 5.1 cm) 2.7 A 4.1 A 5.4 A 6.7 A 8.5 A 8.8 A 4 (10.2 cm) 2.6 A 4.1 A 5.4 A 6.1 B 7.1 B 7.5 B 6 (15.2 cm) 2.6 A 3.9 A 4.9 B 6.0 B 8.0 AB 8.3 AB LSD 0.3 0.3 0.5 0.6 0.9 0.9
Z Height and caliper of plants immediately after transplanting into field plot. Y Means with different letters within a column and growth heading are significantly different separated by least significant difference test (α=0.05). X Trunk diameter measured at 6 inches (15.2 cm) above container substrate surface.
Landscape 339
SNA Research Conference Vol. 56 2011
Figure 1. Girdling roots on October Glory red maple harvested 5 years after transplanting from a #15 nursery container with the root flare at 0 (A), 2 (B), 4 (C), or 6 (D) inches below substrate surface.
Landscape 340
SNA Research Conference Vol. 56 2011
Effect of Repeated Short Interval Flooding on Growth of Four Native Shrub Taxa
Kaye Jernigan and Amy Wright
Department of Horticulture, 101 Funchess Hall, Auburn University, AL 36849
Index Words: Water, Rain garden, Fothergilla ×intermedia L. ‘Mount Airy’, Ilex verticillata ‘Winter Red’, Clethra alnifolia ‘Ruby Spice’, Viburnum nudum Brandywine™
Significance to Industry: Plants in rain gardens must be able to tolerate repeated short intervals of flooding. Research was conducted to screen five native landscape shrub taxa for tolerance to repeated flooding events: Fothergilla ×intermedia ‘Mt. Airy’ (dwarf witchalder), Ilex verticillata ‘Winter Red’ (winterberry), Clethra alnifolia ‘Ruby Spice’ (summersweet), and Viburnum nudum Brandywine™ (possumhaw). Overall, in two runs, all taxa, with the exception of F. ×intermedia ‘Mt. Airy’, maintained good visual quality, did not have any reduction in RDW, and exhibited minimal effects of flooding on shoot growth. F. ×intermedia ‘Mt. Airy’ exhibited poor visual quality, with growth adversely affected by flooding, suggesting this taxon would not be a good choice for rain garden use. Conversely, all other taxa appeared tolerant of flooding and would be appropriate native shrub selections for rain gardens.
Nature of work: Rain gardens, are natural or dug shallow depressions designed to capture and absorb stormwater runoff from a roof, lawn, or other impervious surface such as a driveway, walkway, and even compacted turf (1, 5). Benefits of rain gardens and other bioretention areas include decreased surface runoff, increased groundwater recharge, and reduction of pollutants (2, 3). The nature of hydrology in rain gardens requires that plants selected for use in rain gardens be able to tolerate alternating periods of flooding and drying. Previous studies completed at Auburn University by Werneth (5) suggested a need for continued research to identify native plants with tolerance to repeated flooding for use in rain gardens. Therefore, the objective of this research was to determine the effect of repeated, short-term flooding events on growth of five native landscape shrubs taxa.
Materials and Methods: Run 1. On 13 Aug. 2009, 30 each 3.8 L (1 gal) Fothergilla ×intermedia ‘Mount Airy’, Ilex verticillata ‘Winter Red’, Clethra alnifolia ‘Ruby Spice’, and Viburnum nudum Brandywine™, were potted into 11.3 L (3 gal) containers in 5:3:1 (by volume) pine bark : peat : perlite. Substrate was amended with 2 lbs·yd-3 dolomitic limestone, 1.5 lbs·yd-3 micronutrient fertilizer (Micromax™ Scott’s Company, Marysville, OH), and 13.8 lbs·yd-3 controlled release fertilizer (CRF) (Polyon™ 18N-2.6P-9.96K, Agrium Advanced Technologies, Sylacauga, AL). Containers were placed on raised greenhouse benches at the Paterson Horticulture Greenhouse Complex, Auburn University, AL. Flooding treatments were initiated on 28 Aug. 2009 [15 days after planting (DAP)]. Plants were flooded using a pot-in-pot method. The pot containing the plant had holes in the bottom to allow for drainage and was placed inside an outer pot
Landscape 341
SNA Research Conference Vol. 56 2011
without holes. Tap water was added by hand to each container until the water level was even with the substrate surface; additional water was added to the container as needed to keep the water level even with the substrate surface. Approximately 1 gal was added initially in order to flood plants, and approximately 0.1 gal was added daily to maintain the flood level. Plants were flooded for 0 (non-flooded), 3, or 6 days. Following flooding, outer containers were removed and plants were allowed to drain for 6 days. No additional water was added to the containers during the 6 days of draining. Initial and final growth indices (GI) [(height + widest width + width perpendicular to widest width) / 3] were taken on 17 Aug and 15 Oct 2009, respectively. At termination, shoots were severed at the substrate level, and roots were washed to remove substrate. Shoots and roots were dried separately in an oven for 48 hours at 66°C (150°F) for determination of shoot dry weight (SDW) and root dry weight (RDW).
Run 2. The above experiment was repeated with all four taxa planted as described above beginning on 7 Oct. 2009 with supplemental lighting from 400 watt high pressure sodium lamps set on a 14 hr photoperiod (6:00 AM to 8:00 PM CST). Flooding treatments were initiated on 26 Oct. 2009 (19 DAP) and terminated on 9 Dec. 2009 (64 DAP) for plants flooded for 3 days and on 12 Dec. 2009 (67 DAP) for non-flooded plants and plants flooded for 6 days. All plants were harvested on 14 Dec. 2009 (69 DAP). Initial and final GIs were recorded on 22 Oct. 2009 and at harvest, respectively, and SDW and RDW determined as described above. In both runs, plants were arranged in a completely randomized design with each taxa representing a separate experiment. Data were analyzed using glimmix and mixed models procedures with least square means (P<0.05) (SAS Institute, Cary, NC). Data were analyzed to determine the effect of flooding length on GI, RDW, and SDW. Data are presented only where significant.
Results and Discussion: Fothergilla ×intermedia ‘Mount Airy’. In run 1, GI decreased with increasing flood length, and SDW and RDW were higher in plants flooded for 0 or 3 days than in plants flooded for 6 days (Table 1). In run 2, GI of plants flooded for 0 days was higher than that of plants flooded for 6 days (Table 2). Flooding length did not affect SDW, and RDW was lowest in plants flooded for 6 days in run 2. Fothergilla ×intermedia ‘Mt. Airy’ had poor visual quality, with growth adversely affected by flooding in both runs. Thus, this taxon would not appear to be a good choice for use in rain gardens. However, even under flooded conditions, F.×intermedia ‘Mt. Airy’ was still able to produce flowers on some plants, and no plants died.
Ilex verticillata ‘Winter Red’. Flooding length did not affect GI, SDW, or RDW in run 1 or GI or RDW in run 2. Shoot dry weight was lower in plants flooded 0 or 3 days than in plants flooded for 6 days in run 2 (Table 2). Visual appearance of I. verticillata ‘Winter Red’ was fair. The plants did not produce growth that was as full or dense as in other taxa, but this could be contributed to the slow growth rate and the overall growth habit of this cultivar. Although not compared statistically, Ilex verticillata ‘Winter Red’ seemed to have one of the slower growth rates of the taxa in the experiment. In spite of this, the plants produced new shoots, and all plants were relatively the same size, regardless of treatment, suggesting that flooding did not affect the growth rate. Plants appeared
Landscape 342
SNA Research Conference Vol. 56 2011
generally healthy and over time, possibly with additional acclimation, might be able to develop into a larger, denser plant.
Clethra alnifolia ‘Ruby Spice’. Flooding length did not affect SDW or RDW in run 1 or GI, SDW, or RDW in run 2. GI was higher in plants flooded for 0 or 3 days than in plants flooded for 6 days in run 1 (Table 1). Clethra alnifolia ‘Ruby Spice’ seemed to thrive under flooded conditions in this experiment. The plants had dense canopies and prominent upright growth habit and had started to colonize in the container by sending up new suckers. This result is different from results by Werneth (2010) who found that C. alnifolia ‘Ruby Spice’ did not tolerate flooding. The difference may be that in the current work, plants were grown in 3 gal containers, while in the previous work, plants were grown in trade gallon containers. It’s possible that bigger larger root system on older, more established plants made the larger plants more tolerant of flooding. No flowers were seen on the plants during flooding. Plants were susceptible to broad mites and aphids, but after pesticide application no other problems occurred.
Viburnum nudum Brandywine™. Flooding length did not affect GI, RDW or SDW in run 1or SDW or RDW in run 2. In run 2, GI of plants increased with increasing flood length; plants flooded for 6 days had a higher GI than plants flooded for 0 days (Table 2). Viburnum nudum Brandywine™ produced plants with good visual quality and dark green foliage. Plants consistently produce new shoots throughout the runs, and growth did not appear stunted by flooding.
With the exception of F. ×intermedia ‘Mt. Airy’, taxa maintained good visual quality, had no reduction in root dry weight, and exhibited minimal effects on shoot growth regardless of flooding length. As a result, these taxa appear to be appropriate selections for rain garden use. It should be noted that in run 2, the growth index of V. nudum Brandywine™ actually increased with flooding, suggesting that this taxa may even thrive under flooded conditions. Although flooded conditions in this experiment were of longer duration than may typically be expected for a rain garden, all plants survived, and in fact, several taxa thrived in these conditions. Rain gardens typically remain inundated for no longer than 48 h but can hold water for up to 72 to 96 h (1). It appears as if plants that tend to have faster rates of root and shoot growth may be best equipped to tolerate the fluctuating hydrology of a rain garden and in particular short periods of inundation. This work, as well as past research (4), has demonstrated that several deciduous shrubs native to the southeastern United States provide flood tolerant, attractive options for use in rain gardens in the Southeast.
Landscape 343
SNA Research Conference Vol. 56 2011
Literature Cited 1. Davis, A.P., W.F. Hunt, R.G. Traver, and M. Clar. 2009. Bioretention technology: an overview of current practice and future needs. J. Environ. Eng. 135:109-117. 2. Dietz, M.E. 2007. Low impact development practices: a review of current research and recommendations for future directions. Water Air Soil Pollution 186:351-363.
Table 1. Main effect of flooding length (days) on growth index (GI), shoot dry weight (SDW), and root dry weight (RDW) of Fothergilla ×intermedia ‘Mt. Airy’, Clethra alnifolia ‘Ruby Spice’, and Callicarpa dichotoma ‘Early Amethyst’ grown in a greenhouse, Aug. to Oct. 2009. Flooding F. ×intermedia C. alnifolia C. Length dichotoma (days)z GI (cm) RDW (g) SDW (g) GI (cm) SDW (g) 0 50.3ay 19.3ab 10.4a 65.2a 47.0a 3 44.6ab 22.3a 11.1a 58.2a 36.0b 6 38.5b 10.3b 2.8b 45.2b 22.3c z Plants were flooded for 0, 3, or 6 days followed by 6 days of draining. The flood-drain cycle occurred five times on plants flooded for 3 days and four times for plants flooded for 6 days. y Lowercase letters denote mean separation within a column using Proc Glimmix at P<0.05 (SAS Institute, Cary, NC).
Table 2. Effect of flooding length (days) on growth index (GI), shoot dry weight (SDW) and root dry weight (RDW) on Fothergilla ×intermedia ‘Mt. Airy’, Ilex verticillata ‘Winter Red’, and Viburnum nudum Brandywine™ grown in a greenhouse from Oct. to Dec. 2009. Flooding Length F. ×intermedia I. verticillata V. nudum (days)z GI (cm) RDW (g) SDW (g) GI (cm) 0 34.6ay 61.0a 29.1b 37.9b 3 32.6ab 59.0a 28.6b 39.5ab 6 30.4b 48.0b 32.6a 41.8a z Plants were flooded for 0, 3, or 6 days followed by 6 days of draining. The flood-drain cycle occurred five times on plants flooded for 3 days and four times for plants flooded for 6 days. y Lowercase letters denote mean separation within a column using Proc Glimmix at P<0.05 (SAS Institute, Cary, NC).
Landscape 344
SNA Research Conference Vol. 56 2011
Soil Carbon as Affected by Horticultural Species and Growth Media
S. Christopher Marble1, Stephen A. Prior2, G. Brett Runion2, H. Allen Torbert2, Charles H. Gilliam1, Glenn B. Fain1, Jeff L. Sibley1, and Patricia R. Knight3
1Department of Horticulture, Auburn University, AL 36849 2USDA-ARS National Soil Dynamics Laboratory, 411 S. Donahue Dr., Auburn, AL 36832 3Mississippi State University Coastal Research and Extension Center, Biloxi, MS 39532
Index Words: Carbon Sequestration, Climate Change, Alternative Media
Significance to Industry: Increasing atmospheric concentrations of greenhouse gases (GHG) are widely believed to be a main contributing factor to climate change. United States agriculture is one of the largest contributors of GHG emissions, trailing only energy production, which leads scientists to believe that emissions from agriculture must be reduced to slow climate change. However, emission reductions alone may not sufficiently curtail negative environmental impacts and, therefore, long-term capture and storage of carbon (C) will be necessary. To date, most research on GHG emissions and C sequestration has focused on row crop and forest systems with virtually no work on ornamental horticulture. Farmers in other agricultural sectors are now earning additional income in the emerging C trading market for reducing C emissions and pledging to alter management practices which will provide C offsets by increasing C sequestration. The ornamental horticulture industry also has the potential to sequester C through transplanting container-grown ornamentals into urban and suburban landscapes which sequester C in biomass and soils. In addition, transplant growth media can be an additional C sink that has not been accounted for in previous research. Our data shows that when ornamental species are planted in the landscape, the addition of media from container-grown plant production increased soil carbon levels 4 to 12 times higher than soil C levels observed in native soils. If future legislation requires caps to be placed on agricultural emissions, the horticulture industry will need to demonstrate possible benefits it has on the atmospheric environment. The objective of this research is to determine the effects of growth media on soil carbon levels from commonly grown horticultural species planted into the landscape.
Nature of Work: While still debatable, there is widespread belief in the scientific community that anthropogenic-driven climate change poses serious threats to the global environment. Atmospheric concentrations of the three most important, long-lived greenhouse gases [i.e., carbon dioxide (CO2), methane (CH4) and nitrous oxide (N2O)] have increased over the past 255 years (5).
In the United States, agriculture is the second largest contributors to GHG emissions behind energy production (7). Emissions from agriculture collectively account for an estimated one-fifth of the annual increase in global GHG emissions. When land use
Landscape 345
SNA Research Conference Vol. 56 2011
changes involving clearing of land, biomass burning, and soil degradation are included, the overall radiative forcing from agriculture production is one third of the man-made greenhouse effect (2). Many scientists believe that emissions from agriculture must be reduced to slow climate change; however, emission reductions in agriculture alone may not curtail the negative impacts of agriculture on the environment. Therefore, long term capture and storage of these gases will also be necessary. Carbon from atmospheric CO2 can be stored for long periods in biomass and soils (19). Carbon sequestration in agriculture has been a heavily researched topic, particularly in the last 15 to 20 years. Conservation tillage or “no-till” farming has been shown to reduce fossil fuel use, increase soil C storage (13), and improve soil characteristics (8). Further, improved forestry management practices such density control and nutrient management have been shown to increase C storage in biomass and soil (19).
Due to the large land area they cover in the U.S., most work on C sequestration has focused on row crop (280 million acreas) and forest (740 million acres) systems (17; 3). However, non-agricultural land (e.g., urban and suburban) in the U.S. comprise 150 million areas (10). A significant proportion of this land is (or could be) planted with ornamental trees and shrubs. If C sequestration in agriculture is necessary to mitigate climate change, it is important to examine the contributions from all sectors of agriculture, including specialty crop industries such as ornamental horticulture.
Ornamental horticulture is an industry which impacts the landscape of rural, suburban, and urban environments through production and planting of ornamental horticulture species. Hall (6) showed the economic impact of the green industry (including nursery, greenhouse, and sod) to be $148 billion in the U.S. In 2006, there were 7,300 nursery producers in the top 17 states, encompassing one-half million production acres (18). Ornamental horticulture is one of the fastest growing sectors in agriculture; however, its potential impacts on climate change (either positively or negatively) have been virtually ignored in previous research. While this industry may have some negative impacts on the environment (e.g. CO2 and trace gas efflux), it also has potential to reduce GHG emissions and increase C sequestration. Previous research has shown the potential of urban trees have for sequestering CO2 as well as other pollutants (11). In a study by Rowntree and Nowak (14) it was estimated that total urban forest C storage in the U.S. was approximately 800 million tons. In addition to storing CO2, urban trees have also been shown to cool ambient air and provide shade which allows residents to minimize annual energy costs (14). While ornamental plants have been shown to take up CO2 and accumulate C in biomass, a large amount of C is also transferred belowground in the form of various growth media (e.g., pine bark, or new alternative substrates such as WholeTree or Clean Chip Residual). However, little is known concerning the impact of these growth media on belowground C sequestration. The objective of this research is to determine the effects of growth media on soil carbon levels from commonly grown horticultural species planted into the landscape.
Materials and Methods: In order to explore the effects of growth media on soil C sequestration, three commonly grown nursery crops, crape myrtle (Lagerstroemia x ‘Acoma’), southern magnolia (Magnolia grandiflora) and Shumard Oak (Quercus
Landscape 346
SNA Research Conference Vol. 56 2011
shumardii) were evaluated. These three species were transplanted from 7.6 cm (3 in), 10.2 cm (4 in), or 2.7 L (trade gallon) liners, respectively, into 11.6 L (3 gal) containers on 25 March 2008. Plants were potted using one of three growth media; Pine Bark (PB), Whole Tree (WT), or Clean Chip Residual (CCR). Each growth medium was mixed with sand (6:1, v:v) and 8.3 kg·m-3 (14 lbs/yd3) 18-6-12 Polyon control-release fertilizer, 3.0 kg·m-3 (5 lb/yd3) lime, and 0.9 kg·m-3 (1.5 lb/yd3) Micromax were added. Whole Tree (4) and CCR (1), are by-products of the forestry industry which are currently being investigated as alternative media sources due to decreasing PB supplies (9). Plants were grown in the 11.6 L (3 gal) containers for an entire growing season and then outplanted to the field on 11 December 2008. Outplanted species were arranged as a randomized complete block design with three replicate blocks. Belowground soil C was assessed in Summer, 2009. Two soil cores [3.8 cm (1.5 in) diameter x 60 cm (23.6 in) depth] were collected from each treatment within all blocks according to methods described by Prior et al. (12). In addition, samples of native soil (no plant or growth media) were collected within each block for comparison. All cores were divided into 15 cm (5.9 in) depth segments, sieved (2 mm), and oven dried at 55˚ C (131˚ F). Ground subsamples of soil (0.15 mm sieve) were analyzed for C on a LECO TruSpec CN analyzer (LECO Corp., Saint Joseph, MI). Data were analyzed using the Proc GLM procedure of SAS (SAS version 9.1).
Results and Discussion: Soil analysis indicated that soil C in the top depth of soil (0 - 15 cm) was higher for PB compared to WT, CCR and the native soil for all three species (Figures 1-3). Soil C for the other two media did not differ in any species. Although soil C was much lower at the 15 - 30 cm depth, the same treatment pattern was observed in crape myrtle and magnolia; however, there were no differences in soil C for the oaks at this depth. No soil C differences were observed among media or the native soil in any species at the lower two depths (i.e. 30 - 45 and 45- 60 cm). These initial soil C data indicate that the media were contained in the upper 15 cm of the soil profile with a possibility that some of the PB was incorporated slightly below that depth in the crape myrtles and magnolias. It has been shown that changes in agricultural management practices that minimize soil disturbance and increase surface crop residues, such as conservation tillage (“no-till”) can enhance soil C sequestration potential (16; 8), however this soil C increase may only be realized many years after adoption of these practices (15). Data from this study show that soil C ranged from 9 - 25% compared to about 2% found in the native soil. These data clearly show that planting containerized ornamentals into the landscape transfer a large amount of C belowground instantly; however, uncertainty remains regarding how long this C will remain sequestered. Future studies are needed to determine the residence time of this C in the soil when planted into the landscape and to fully understand the role of the ornamental horticulture industry on C sequestration. These data will prepare the horticulture industry for possible future legislation as well as provide homeowners a means of directly contributing to the mitigation of climate change via soil C sequestration while improving the aesthetic value of their homes.
Landscape 347
SNA Research Conference Vol. 56 2011
Literature Cited: 1. Boyer, C.R., H.A. Torbert, C.H. Gilliam, G.B. Fain, T.V. Gallagher, and J.L. Sibley. 2008. Physical properties and microbial activity in forest residual substrates. Proc. Southern Nurs. Assn. Res. Conf. 53:42-45. 2. Cole, C.V., J. Duxbury, J. Freney, O. Heinemeyer, K. Minami, A. Mosier, K. Paustian, N. Rosenburg, N. Sampson, D. Sauerbeck, and Q. Zhao. 1997. Global estimates of potential mitigation of greenhouse gas emissions by agriculture. Nutr. Cycl. Agroecosystems. 49: 221-228. 3. Environmental Protection Agency. 2009. Major crops grown in the United States. Accessed 10 October 2010. http://www.epa.gov/agriculture/ag101/cropmajor.html. 4. Fain, G.B., C.H. Gilliam, J.L. Sibley, and C.R. Boyer. 2006. Evaluation of an alternative, sustainable substrate for use in greenhouse crops. Proc. Southern Nurs. Assn. Res. Conf. 51:651-654. 5. IPCC. 2007. Contribution of Working Group II to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change. M.L. Parry, O.F. Canziani, J.P. Palutikof, P.J. van der Linden and C.E. Hanson (eds). Cambridge University Press, Cambridge, UK. 6. Hall, C.R., A.W. Hodges, and J.J Haydu. 2005. Economic impacts of the green industry in the U.S. 4 June 2010.
Landscape 348
SNA Research Conference Vol. 56 2011
16. Smith, P., D. S. Powlson, M.J. Glendining, and J.U. Smith. 1998. Preliminary estimates of the potential for carbon mitigation in European soils through no-till farming. Global Change Biol. 4:679-685. 17. Smith, B.W., J.S. Vissage, D.R. Darr, and R.M. Sheffield. 2001. Forest Resources of the United Sates, 1997. General Technical Report NC.219. USDA Forest Service, North Central Research Station. 18. USDA. 2007. Nursery Crops 2006 Summary. Publ. No. Sp Cr 6-3. U.S. Department of Agriculture, National Agriculture Statistics Service. 19. USDA. 2008. U.S. agriculture and forestry greenhouse gas inventory: 1990-2005. 29 Mar. 2009.
Figure 1. Media effects on soil carbon per centage in crape myrtle. Bars with the same letter are not significantly different according to the Least Significant Differences Test (alpha = 0.05). ns = not significant according to the Least Significant Differences Test. PB = Pine Bark, WT = WholeTree, CCR = Clean Chip Residual.
Landscape 349
SNA Research Conference Vol. 56 2011
Figure 2. Media effects on soil carbon percentage in magnolia. Bars with the same letter are not significantly different according to the Least Significant Differences Test (alpha = 0.05). ns = not significant according to the Least Significant Differences Test. PB = Pine Bark, WT = WholeTree, CCR = Clean Chip Residual.
Figure 3. Media effects on soil carbon percentage in oak. Bars with the same letter are not significantly different according to the Least Significant Differences Test (alpha = 0.05). ns = not significant according to the Least Significant Differences Test. PB = Pine Bark, WT = WholeTree, CCR = Clean Chip Residual.
Landscape 350
SNA Research Conference Vol. 56 2011
Impact of Post-establishment Applied Organic Mulch on Gas Exchange and Growth of Two Oak Tree Species
Thayne Montague, Cynthia McKenney, Kaylee Decker
Department of Plant and Soil Science, Texas Tech University Lubbock, Texas, 79409-2122
Index words: landscape maintenance, photosynthesis, stomatal conductance, soil moisture, soil temperature
Significance to Industry: Organic mulch (pine bark, pruning chips, pine needles, etc.) is thought to provide many benefits to urban landscapes (reduced weed competition, increased soil moisture levels, soil temperature moderation). In fact, many in the landscape industry advise the public to place organic mulches on soils surrounding new landscapes and trees in existing landscapes. However, limited research has been conducted to determine if organic mulch provides benefits to established landscape trees. Our research confirms that soil abiotic factures are influenced by organic mulch placed over soil. Our research also determined that depending on a tree species genetic composition, organic mulch placed around root zones of established trees may limit or enhance tree gas exchange and growth. Our data confirm tree species may be sensitive to the influence organic mulch has on soil abiotic factors. Cultural practices around established trees (such as the use of organic mulch) should be carefully considered prior to making recommendations.
Nature of Work: Organic mulch (pine bark, pruning chips, pine needles, etc.) is thought to provide many benefits to urban landscapes (2). In fact, many in the landscape industry advise the public to place organic mulches on soils surrounding new and existing landscape trees. However, limited research has been conducted to determine if organic mulch provides benefits to established landscape trees. Our research objectives were to compare gas exchange (stomatal conductance and photosynthetic rates) and growth (budbreak, leaf area, and shoot growth) of established trees which had, and which did not have organic mulch placed on the soil surface surrounding each tree.
Research was conducted on trees at the Texas Tech University Research Farm in Lubbock, Texas. Trees were planted in 2002 in a randomized complete block design. Although seven species were studied [Quercus muehlenbergii (chinquapin oak), Q. robur (English oak), Acer truncatum (shantung maple), Cercis canadensis mexicana (Mexican redbud), C. canadensis texensis (Texas redbud), C. canadensis texensis ‘Oklahoma’ (Oaklahoma redbud), C. canadensis texensis ‘Alba’ (white Texas redbud)] data presented will include two species (chinquapin and English oak). There were three blocks with two plants of each species within each block. Each plant of each species
Landscape 351
SNA Research Conference Vol. 56 2011
within each block was randomly assigned a mulch treatment: no mulch (8.0 feet (2.4 m) diameter area around tree kept weed free), or mulch (8.0 feet (2.4 m) diameter area around each tree covered with 4.0 inches (10 cm) of cypress bark mulch). To contain mulch near the tree, plastic edging was placed around mulched trees. Three trees of each species were randomly assigned mulch or non-mulch treatments. Mulch was applied Fall 2008 and reapplied Fall 2009. During the 2009 and 2010 growing seasons (May – October) each tree received weekly irrigation (based upon total weekly reference evapotranspiration and soil surface area within the 8 foot (2.4 m) diameter below each tree) from three 1 gallon (3.8 L) hour-1 emitters placed within 3 feet (0.9 m) of the trunk.
To collect climatic data required to calculate reference evapotranspiration (shortwave radiation, wind speed, humidity, and air temperature), a weather station was installed on site. In addition to climatic data, soil temperature and soil moisture content sensors were installed 1 inch (2.5 cm) below the soil surface of one mulched and one non- mulched tree. Sensors were installed 3 feet (0.9 m) from the trunk of each tree. One set of sensors were also installed between tree rows to measure the non-irrigated portion of the experiment. Budbreak data from each tree was collected Spring 2009 and 2010. Throughout the 2009 and 2010 growing season, mid-day stomatal conductance was collected on numerous occasions from each tree. In addition, during the 2010 growing season mid-day photosynthetic rates were collected two times on each tree. At the end of each growing season, shoot growth was measured on selected shoots from each tree. In addition, leaf area on 100 leaves from each tree was measured with a leaf area meter.
Gas exchange (seasonal means) and growth data were exposed to ANOVA appropriate for a randomized block design. When significant treatment differences were observed, means were separated by Fisher’s least significance procedure (SAS). Due to data collection delays, presented growth data is from the 2009 growing season. All other presented data is from the 2010 growing season.
Results and Discussion: Throughout the growing season, soil temperature data indicate soil under mulch was cooler, had greater soil moisture, and fewer temperature and moisture fluctuation extremes when compared to soil under non-mulched trees and non-irrigated soil (Figures 1, 2). Organic mulch placed over a soil is known to act as insulation for the soil below (3). Previous research indicates soils covered with organic mulch generally have fewer extremes in temperature, moisture, and energy fluctuations (1). Data from this research indicate budbreak was influenced by mulch treatment. However, influence of mulch on budbreak differed for each species. Budbreak was earlier for non-mulched chinquapin oak when compared to mulched chinquapin oak, but budbreak was later for mulched English oak when compared to non-mulched English oak (Figure 3). Because of late season frosts, early budbreak can be a serious concern for many regions of the United States. In Lubbock, during the 2009 growing season there was a hard frost in early April. Trees which had broken bud prior to the frost suffered excessive leaf and flower damage.
Landscape 352
SNA Research Conference Vol. 56 2011
Gas exchange data does not indicate specific trends for mulch versus non-mulched trees. Chinquapin trees without mulch had greater mid-day stomatal conductance when compared to mulched trees (Figure 4). However, mid-day photosynthetic rate for chinquapin trees did not differ (Figure 5). The reverse trend was true for English oak trees. Stomatal conductance for English oak trees did not differ, but photosynthetic rate for English oak trees with mulch was greater when compared to photosynthetic rate for English oak trees without mulch (Figures 4, 5). For English oak shoot growth was similar for trees grown with mulch when compared to trees grown without mulch (Figure 6). However, shoot growth for chinquapin oak was greater for mulched trees when compared to non-mulched trees (Figure 6). For each species, leaf area data did not differ between mulch and non-mulch treatments (Figure 7).
Previous research indicates response of established trees to organic mulch placed around a tree’s root zone will be species and structure specific (1). Our research confirms these findings with established English and chinquapin oaks. Depending on a tree species genetic composition, organic mulch (which will influence soil temperature and soil moisture, and may also influence soil aeration and soil nutrient levels) placed around root zones of established trees may limit or enhance tree gas exchange and growth. Our data confirm tree species may be sensitive to the influence organic mulch has on soil abiotic factors. Cultural practices around established trees (such as the use of organic mulch) should be carefully considered prior to making recommendations.
Literature Cited 1. Montague, T. and L. Fox. 2008. Gas exchange and growth of transplanted and nontransplanted field-grown Shumard red oak trees grown with and without organic mulch. HortScience 43:770-775. 2. Montague, T., C. McKenney, M. Maurer, and B. Winn. 2007. Influence of irrigation volume and mulch on establishment of select shrub species. Arboricult. Urban For. 33(3):202-209. 3. Montague, T., R. Kjelgren, and L. Rupp. 2000. Surface energy balance affects gas exchange and growth of two irrigated landscape tree species in an arid climate. J. Amer. Soc. Hort. Sci. 125:299-309.
Landscape 353
SNA Research Conference Vol. 56 2011
110 Control Non-mulch Mulch 100
90
80
70
60 Soil temperature (F)
50
40
30 1 Mar 31 Mar 30 April 30 May 29 June 29 July 28 Aug 27 Sept Figure 1. Mid-day soil temperature for mulched, non-mulched, and control (within row) surfaces.
Control Non-mulch 0.6 Mulch
0.5
0.4
0.3 Soil moisture (%) moisture Soil
0.2
0.1
1 Mar 31 Mar 30 April 30 May 29 June 29 July 28 Aug 27 Sept Figure 2. Mid-day soil moisture for mulched, non-mulched, and control (within row) surfaces.
Landscape 354
SNA Research Conference Vol. 56 2011
30 Apr Chinquapin oak non-mulch Chinquapin oak mulch a a English oak non-mulch 15 Apr b English oak mulch b
31 Mar
16 Mar
1 Mar
14 Feb Day of the year (2010) year the of Day
30 Jan
15 Jan
Figure 3. Mean budbreak day for established mulched and non-mulched Quercus muehlenbergii (chinquapin oak) and Q. robur (English oak) trees.
550 Chinquapin oak non-mulch Chinquapin oak mulch 500 English oak non-mulch English oak mulch a 450 ) -1
s b -2 400
350
300
250
200
150 Stomatal conductancem (mmol 100
50
Figure 4. Mean, mid-day stomatal conductance for established mulched and non- mulched Quercus muehlenbergii (chinquapin oak) and Q. robur (English oak) trees.
Landscape 355
SNA Research Conference Vol. 56 2011
Chinquapin oak non-mulch a Chinquapin oak mulch b 20 English oak non-mulch English oak mulch ) -1 s -2 15
10 Photosynthetic rate (umol m 5
Figure 5. Mean, mid-day photosynthetic rates for established mulched and non-mulched Quercus muehlenbergii (chinquapin oak) and Q. robur (English oak) trees.
6 Chinquapin oak non-mulch a Chinquapin oak mulch English oak non-mulch English oak mulch 5
4 b
3 Shoot growth (inches) 2
1
Figure 6. Mean shoot elongation for established mulched and non-mulched Quercus muehlenbergii (chinquapin oak) and Q. robur (English oak) trees.
Landscape 356
SNA Research Conference Vol. 56 2011
7 Chinquapin oak non-mulch Chinquapin oak mulch English oak non-mulch 6 English oak mulch
5 ) 2 4
Leaf area (inLeaf 3
2
1
Figure 7. Mean leaf size for established mulched and non-mulched Quercus muehlenbergii (chinquapin oak) and Q. robur (English oak) trees.
Landscape 357
SNA Research Conference Vol. 56 2011
LSU AgCenter People’s Choice Landscape Award Winners – Spring 2010
Allen Owings, Yan Chen, Roger Rosendale and Regina Bracy LSU AgCenter – Hammond Research Station, Hammond, LA 70403
Index Words: Landscape Trials, Bedding Plants, Landscape Performance, Cultivar Trials
Significance to Industry: The LSU AgCenter conducts landscape evaluation trials on annual bedding plants and herbaceous perennials each year. Included are cool season trials and warm season trials. Results of these trials provides wholesale nursery growers, greenhouse growers, landscapers, and retail garden centers with valuable, useful information on performance of new cultivars.
Nature of Work: Green industry professionals, home gardeners and Louisiana Master Gardeners participated in the People’s Choice plant award selections at the LSU AgCenter’s Hammond Research Station in May 2010. Attendees at the Landscape Horticulture Field Day (green industry professionals), Master Gardener Open House (Master Gardeners) and Sun Garden Stroll (home gardeners) were given the opportunity to “pick their winning plants” from the sun garden evaluation trial gardens at the station. Over 360 varieties were planted this year. The planting mostly consists of cool- and warm-season annual bedding plants and herbaceous perennials, but new roses and some “companion” woody ornamental shrubs (such as Southern Living plants) are also included. The majority are “new” plants to the industry, but a few are industry standards planted for “comparison” and “side-by-side” evaluation purposes.
Results and Discussion: In the home gardening category, Carefree Marvel rose and Amazon Rose Magic dianthus tied for most votes (Gold Winner). Amazon Neon Purple was named the Silver Winner and Butterfly Blush gaura was named the Bronze Winner. An additional 13 plants were named honorable mention winners.
In the master gardener category, Carefree Marvel rose was the Gold Winner with Silver Anouk lavandula being the Silver Winner and Passionate Kisses rose being the Bronze Winner. An additional 10 plants were named honorable mention winners.
In the green industry professional category, Carefree Marvel rose was named the Gold Winner. The Silver Winner was Pinstripe petunia. The Bronze Winners were Dark Secret heuchera and Black Velvet petunia. An additional 10 plants were named honorable mention winners.
Landscape 358
SNA Research Conference Vol. 56 2011
Home Gardeners Gold Winner – Carefree Marvel rose and Amazon Rose Magic dianthus Silver Winner – Amazon Neon Purple dianthus Bronze Medal – Butterfly Blush gaura
Other Winners:
Redbor ornamental kale Silver Anouk lavendula Amazon Neon Cherry dianthus Phantom petunia Sorbet Yellow Duet viola Passionate Kisses rose Knock Out rose Pinstripe petunia Knock Out Blushing rose Elation Red dianthus Swan Violet White columbine Carefree Celebration rose Swirling Fantasy heuchera
Master Gardeners
Gold Medal – Carefree Marvel rose Silver Medal – Silver Anouk lavandula Bronze Medal – Passionate Kisses rose
Other Winners:
Amazon Neon Purple dianthus Sweet Red w/White Eye dianthus Cinco de Mayo rose Amazon Rose Magic dianthus Elation Red dianthus Traviata rose Songbird Nightingale columbine Butterfly Blush gaura Knock Out rose Swan Mix columbine
Landscape 359
SNA Research Conference Vol. 56 2011
Green Industry Professionals
Gold Winner – Carefree Marvel rose Silver Winner – Pinstripe petunia Bronze Winner – Dark Secret heuchera and Black Velvet petunia
Other Winners:
Amazon Neon Cherry dianthus Illusion Midnight Lace ornamental sweet potato Illusion Emerald Lace ornamental sweet potato Redbor ornamental kale Senorita Rosalita cleome Amazon Neon Purple dianthus Amazon Rose Magic dianthus Julia Child rose Little Leaf tibouchina Jade Frost erygium
Landscape 360
SNA Research Conference Vol. 56 2011
Landscape Performance and Invasive Potential of 12 Ligustrum sinense, Ligustrum lucidum and Ligustrum japonicum Cultivars Grown in North and South Florida
Sandra B. Wilson1 and Gary W. Knox2
1 Indian River Research and Education Center, Department of Environmental Horticulture, University of Florida-IFAS, 2199 South Rock Road, Fort Pierce, FL 34945;
2 North Florida Research and Education Center, Department of Environmental Horticulture, University of Florida-IFAS, 155 Research Road, Quincy, FL 32351
Index Words: variety trialing, seed viability, privet
Significance to Industry: Plant growth, visual quality, flowering, fruit production and seed viability were assessed for 12 privet (Ligustrum) taxa planted in north and south Florida. Data generated from this 2.5 year study will potentially identify safe alternatives that are ornamentally attractive with little to no seed set and prioritize non-invasiveness into breeding protocols.
Nature of Work: Florida ranks second among U.S. states in the degree of ecosystem devastation as a result of exotic invasive species. Significant efforts have been made to accurately assess and predict invasiveness in Florida (2). Some of the ornamentals listed as invasive by the Florida Exotic Pest Plant Council (1) or University of Florida Institute of Food and Agricultural Sciences (UF-IFAS) Risk Assessment are still in commercial production (4). Over the last decade, our research efforts have focused on assessing the invasive traits of popular ornamentals, closely related genera, and/or cultivated forms to identify safe alternatives (3). The overall objective of this study was to evaluate plant performance, growth, flowering, fruit yield, and seed viability of 12 Ligustrum taxa planted in north and south Florida.
Chinese privet (Ligustrum sinense) and glossy privet (Ligustrum lucidum) have widely naturalized throughout the southeast United States, dominating the understory of mesic forests and displacing native plant communities. Both are serious environmental weeds in Australia and New Zealand. In Florida, glossy privet and Chinese privet have escaped cultivation in 12 and 25 counties, respectively (5), are listed by the Florida Exotic Pest Plant Council as Category I invasives (1), and are not recommended for planting by the University of Florida IFAS status assessment protocol (2) (Table 1). A third privet, Japanese privet (Ligustrum japonicum) has escaped cultivation but is not listed as invasive in Florida. All three species have ornamental value, with numerous cultivars commercially available. Twelve Ligustrum taxa were selected for this study based on popularity and availability (Table 2). Seedlings of Chinese privet, glossy privet and Japanese privet (wildtype selections) and clonally propagated cultivars, including one hybrid (L. lucidum x L. japonicum), were obtained in finished 1 gal pots. Field
Landscape 361
SNA Research Conference Vol. 56 2011
plantings of nine uniform plants of each were installed 7 ft on center under full sun conditions in south FL (Fort Pierce, USDA Cold Hardiness 9b) and north FL (Quincy, USDA Cold Hardiness, 8b). Plants were evaluated monthly for flowering and fruiting, and tri-monthly for visual quality. Visual quality was based on a scale from 1 to 5 where 1=very poor performance, and 5=excellent landscape performance. Mesh bags were placed over fully formed fruit to avoid predation. After 72 weeks, growth indices were calculated for each plant as an average of the measured height (measured from crown to natural break in foliage) and two perpendicular widths [(height + width1 + width2)/3]. After 84 weeks, all fruit was removed from each plant at each site and counted. Plants were kept in the ground to collect a second year of data.
For initial seed viability and germination tests, mature fruit were collected from independent and larger populations of Chinese privet, glossy privet and Japanese privet in north Florida. Seeds were cleaned and subjected to pre-germination viability tests using two replications of 100 seeds treated with 1.0% tetrazolium for 18 hr at 30-35 °C (MidWest Seed Services, Inc., Brookings, SD). An additional 400 seeds (4 reps of 100) were placed in sand-filled germination boxes and subjected to germination tests at 35/25, 30/20, 25/15, and 20/10 °C with a 12 hr photoperiod for 60 days. Data were subjected to ANOVA and significant transformed means separated by Duncan’s MRT at P=0.05.
Results and Discussion: Visual quality and flowering varied by cultivar and site. Regardless of cultivar, after 104 weeks (July 2010), north FL plants received higher visual quality ratings than south FL plants. However, ‘Howard’ Japanese privet, ‘Jack Frost’ Japanese privet, and ‘Variegatum’ chinese privet had very good to excellent landscape performance at both sites. After 72 weeks, north FL plants were 1.2 to 2.8 times larger and produced 31 times more fruit than south FL plants (data not presented). Lower viability of Japanese privet could be associated with the presence of ligustrum weevil (Ochyromera ligustri). Seeds germinated similarly in dark (data not presented) or light, with varying response to temperature. Under a 12 hr photoperiod, Chinese privet had the greatest germination (79%) at 20/10 °C, followed by glossy privet (76%) at 20/10 °C, followed by Japanese privet (71%) at 25/15 °C (Table 3). These field trials will continue in order to generate enough seed from cultivars to complete all germination tests, and to assess variegation stability. As early as 72 weeks, the variegated Chinese privet already showed some reversion to the invasive green form.
Landscape 362
SNA Research Conference Vol. 56 2011
Literature Cited: 1. Florida Exotic Pest Plant Council (FLEPPC). 2009. Florida exotic pest plant council’s 2009 list of invasive plant species. < http://www.fleppc.org/list/09list_brochure.pdf >. Accessed 1 Nov 2010.
2. IFAS Invasive Plant Working Group. 2008. IFAS Assessment of non-native plants in Florida’s natural areas.
3. Wilson, S.B., G.W. Knox, Z. Deng and R. Freyre. 2010. Characterizing the invasive potential of ornamental plants. Acta Hort. In press.
4. Wirth, F.F., K.J. Davis, and S.B. Wilson. 2004. Florida nursery sales and economic impacts of 14 potentially invasive landscape plant species. J. Environ. Hort. 22(1):12-16.
5. Wunderlin, R.P. and B.F. Hansen. 2009. Atlas of Florida Vascular Plants. [S.M. Landry and K.N. Campbell (application development), Florida Center for Community Design and Research]. Institute for Systematic Botany, Univ. of South Florida, Tampa.
Acknowledgements Authors gratefully acknowledge financial support from the Florida Department of Environmental Protection. We extend gratitude to Keona Muller, Jim Aldrich, and Patricia Frey for providing technical assistance throughout the study.
Landscape 363
SNA Research Conference Vol. 56 2011
Table 1. Invasive status and leaf and seed morphology of 3 Ligustrum species in Florida. No. UF-IFAS seeds Botanical Common FLEPPC ratingy per Seed name name ratingz fruit Leaf size size
Ligustrum Japanese Not rated Not a 2 japonicum Privet problem
Ligustrum Glossy Category Caution 2 lucidum Privet I (N,C)
Ligustrum Chinese Category Invasive 1 sinense Privet I (N,C,S)
z Florida Exotic Pest Plant Council (FLEPPC) Category I species are invasive exotics that are altering native plant communities by displacing native species, changing community structures or ecological functions, or hybridizing with natives (FLEPPC, 2009).
y Invasive status in Florida determined by the University of Florida Institute of Food and Agricultural Science (UF-IFAS) Invasive Plant Assessment Protocol (IFAS Invasive Plant Working Group, 2008).
Landscape 364
SNA Research Conference Vol. 56 2011
Table 2. Description of 3 Ligustrum species and respective cultivars trialed in north and south FL. Species/cultivar Description L. japonicum Dense evergreen shrub or small tree with upright habit. Heavily branched habit responds well to pruning into hedges, topiary or small trees. Fast grower to 6 to 12 feet tall, 6 to 8 feet wide. White flowers in spring, black berries maturing in fall.
‘Howard’ Also known as 'Frazieri'. New leaves are yellow turning to glossy, dark green with age, although older leaves may retain a splash of yellow. Moderate growth rate.
‘Jack Frost’ Shiny, leathery green leaves have creamy white margins. Grows 6 to 12 feet tall and 6 to 8 feet wide. Small white flowers in spring.
‘Lake Tresca’ Slow-growing, compact shrub up to 8 feet tall with small, rounded leaves on a plant with a mounding habit. Creamy-white flowers. An FNGA (now FNGLA) Plant of the Year in 1999.
‘Rotundifolium’ Also known as 'Coriaceum'. Attractive crinkled, thick, dark green leaves appear crowded on stems. Plant habit is stiff and upright, growing 4 to 6 feet tall. Considered less hardy than the species. White flowers in summer. Introduced from Japan by Fortune in 1860.
‘Texanum’ Sometimes listed as L. texanum. Large glossy dark green leaves on a compact, upright plant. Grows up to 10 feet tall. Spring flowers.
L. lucidum Fast-growing evergreen tree, 25 to 40 feet tall (occasionally up to 50 feet) and 25 to 35 feet wide. Glossy green leaves are large, 4 to 6 inches long, with narrow, translucent margins. Terminal, 6 to 10-inch panicles of small, white flowers are produced in late spring and are followed by blue-black fruit.
‘Davidson Hardy’ This selection is more cold hardy than the species. It has been hardy at Davidson College, Davidson, NC, where foliage wasn't damaged by -15F. Leaves are a flat dark green and the plant is larger and coarser than cultivars like 'Nobilis' and 'Recurvifolium'. This cultivar was received as Ligustrum lucidum but it has been variably assigned to L. lucidum and L. japonicum.
Landscape 365
SNA Research Conference Vol. 56 2011
Table 2 (continued). Description of 3 Ligustrum species and respective cultivars trialed in north and south FL.
L. sinense Evergreen to semi-evergreen shrub growing 10 to 15 feet tall and wide (rarely 20 feet tall). Adapted from full sun to dense shade and from dry to wet soils. Panicles of creamy-white flowers are 2 to 3 inches long and occur in late spring. Flowers are followed by waxy black fruit that may persist through winter.
‘Swift Creek’ An improved selection of L. sinense 'Variegatum' with leaves that show more variegation and less green area. The plant grows slower and is said to be much less likely to revert to solid green foliage. It is a new form from Lanny Thomas at Swift Creek Nursery in North Carolina. Mature plant size is 8 to10 feet tall and wide.
‘Variegatum’ Leaves have cream- to white margins. This selection is not as fast-growing as the species and attains heights of 6 to 8 feet (occasionally 15 feet). Branches are known to revert to all-green leaves. Flowers in late spring or early summer.
L. japonicum x L. Said to be a hybrid of Ligustrum japonicum and L. lucidum. Dark green lucidum ‘Suwannee evergreen leaves on a plant with a compact, mounding form. Slow-growing River’ to 4 feet tall, 3 to 4 feet wide. White flowers in spring.
Landscape 366
SNA Research Conference Vol. 56 2011
Table 3. Viability and germination of seed collected from 3 ligustrum species in north FL. Seeds were cleaned and germinated with light (12 hr photoperiod) in germination boxes placed in growth chambers set at 20/10, 25/15, 30/20 and 35/25 °C (68.0/50.0, 77.0/59.0, 86.0/68.0 and 95.0/77.0 °F) for 60 days. Germination (%) Species Viability (%)z 20/10 25/15 30/20 35/25
Ligustrum japonicum 57.3 cy 68.0 a 71.0 a 61.0 a 54.0 b
Ligustrum lucidum 91.8 a 75.5 a 70.5 a 51.0 a 2.0 c
Ligustrum sinense 81.0 b 78.5 a 70.5 a 70.0 a 72.5 a
z Determined by positive staining after seeds were subjected to 1.0% tetrazolium for 18 hr.
y Significant transformed means separated by Duncan’s MRT at P=0.05 level.
Landscape 367
SNA Research Conference Vol. 56 2011
Evaluation of Evergreen Acer at the JC Raulston Arboretum
Mark Weathington
JC Raulston Arboretum, NC State University Department of Horticultural Science, Campus Box 7522, Raleigh, NC 27695
Index words Acer, maple, landscape trials, species trials
Significance to the Industry New plants help fuel the growth of the green industry but nursery professionals must balance new plants with the public’s often slow acceptance of the unknown. Entirely new genera often need a longer learning curve before the public accepts them. The public accepts familiar genera, such as Acer, more readily even when the species are novel to them.
Evergreen Acer offer the nursery industry a group of plants that fit many needs of the public. They offer year-round interest, form small to medium trees suitable for suburban landscapes, are generally easy to grow and relatively quick in production, and are from a familiar genera. Due to their limited hardiness, they will be relegated to warmer southeastern gardens, mostly zone 8 and warmer. Several species are currently available in small numbers from specialty nurseries and provide opportunities to acquire plants for use as propagation stock.
Nature of Work The JC Raulston Arboretum (JCRA) evaluates a wide diversity of woody plants for suitability to the central piedmont region of North Carolina and the broader southeastern US. Acer have been an important component of the collections of the JCRA since its inception in the 1970’s. In recent years, evergreen and semi-evergreen species have gradually been accumulated through wild collections and from cultivated material. Many of these Acer are poorly understood and rarely grown even in botanic gardens but may be suitable for wider use throughout the southern US.
The genus Acer formerly included in its own family, the Aceraceae, is now widely placed in the Sapindaceae family (1). The genus was first described in 1700 by French botanist Joseph Tournefort and the name derives from the Proto-Indo- European word meaning “sharp”. It was officially assigned in 1753 by Linnaeus in Species Plantarum. Acer is a widespread genus with members ranging from North America to Europe and north Africa and across to Asia and Indonesia where they cross to the southern hemisphere. There are approximately 125-150 species of Acer with relatively few that are evergreen or mostly evergreen. The majority of these evergreen forms are native to southeast Asia and the
Landscape 368
SNA Research Conference Vol. 56 2011
Himalayan region with a couple of outliers in the eastern Mediterranean region. This paper summarizes the plants under evaluation at the JCRA, provides landscape characteristics, and production observations.
Results and Discussion Eleven taxa that are now or have been in the JCRA collection are presented below with brief information on the habit, propagation, and hardiness as presently known. All of the Asian species presented here grow naturally as understory trees in mixed woodland. They will all tolerate and probably perform best if grown under high shade in a moist, well-drained location out of winter winds. Acer obtusifolium will grow best in a well-drained sunny location. Published information for these and other evergreen Acer is often difficult to locate and the following resources offer the best information (2,3,4,5,6,7,8,9,10,11,12,13,14,15).
Acer albopurpurescens Hayata – An evergreen tree to 15 m (50 ft) endemic to Taiwan. It is closely related to the similar A. oblongum and some taxonomists place both of these species in A. laevigatum. A. albopurpurescens is distinguished primarily by the indistinct basal nerves on the leaves. The foliage is leathery and glossy pale green above while the underside is glaucous white to purplish beneath. Leaves are oblong 5-13 cm (2-5 in) long by 2.5-5 cm (1-2 in) wide with a narrow tip. Trees develop an upright oval habit and are quite showy. Fall can bring plum tones to the underside of the leaves adding interest to the winter landscape. It ranges from low to medium altitudes throughout Taiwan. We have not been able to test this plant in the landscape yet. One plant grown from seed obtained through the Taiwan Forestry Research Institute has been planted on the grounds but has not been planted out long enough to evaluate its hardiness. The author has seen this plant growing above 1525 m (5000 ft) in Taiwan which corresponds roughly to zone 8b although reports show it to grow another 500 m (1600 ft) higher. Provenance may play a strong role in determining hardiness. Plants can be propagated by seed or by grafting on A. buergerianum.
A. albopurpurescens growing wild in central Taiwan.
Landscape 369
SNA Research Conference Vol. 56 2011
Acer buergerianum var. ningpoense (Hance) Rehd. (Ningpo trident maple) – This variety of trident maple is reliably deciduous in zone 7 and has been growing at the JCRA since 1994. In warmer areas it may be evergreen if adequate moisture is supplied through summer and into fall. In the wild in east China (Ningpo, Zhejiang Province) it can attain heights of 18 m (60 ft) but typically forms a small to medium tree in the landscape. The JCRA specimen has grown more than 9 m(30 ft) in 13 years. Somewhat bluish tinged foliage varies from 3 lobes to none and is about 5 cm (2 in) long and wide. Although not evergreen at the JCRA, it may make a nice evergreen or semi-evergreen specimen in the deep south. The bark peels attractively in thick sheets on mature trees. Propagation is from seed, although isolated specimens often form non-viable parthenocarpic fruit, grafting to A. buergerianum seedlings, or softwood to semi-hardwood cuttings taken from May to September. Overwintering rooted cuttings can be difficult and success may be best with cuttings from early in the season.
Acer buergerianum var. formosanum (Hance) Sasaki (Formosan trident maple) – Another form of A. buergerianum, endemic to Taiwan. High elevation forms have proven to be hardy into at least zone 8. It is similar in other respects to the species with a powdery blue underside to the leaves. The JCRA’s plants have not yet been planted out to determine their suitability in zone 7.
Acer coriaceifolium Lev. (syn. A. cinnamomifolium Hayata) (leatherleaf maple) – This small tree has been growing at the JCRA for 9 years where it has grown into a 3.5 m (12 ft) tall tree. In the wild it can grow to nearly 15 m (50 ft) but seems to want to grow as a shrub in cultivation although a single leader can be trained if desired. The foliage is unlobed, dark to medium green above and paler and tomentose below. It tends to break dormancy early in the spring which can be a problem in areas subject to late frosts. New growth emerges pale green and is covered in silvery to coppery hairs providing a striking contrast to the older dark green leaves. The evergreen foliage is sometimes damaged during cold spells but plants in the Carolina piedmont have grown remarkably well. Most (all?) plants grown in the west are from a distribution by the Shanghai Botanic Garden in 1983 as A. cinnamomifolium. Further hardiness could come from germplasm collected at the highest elevations of its distribution in southwest China. Propagation is typically from seed although cuttings can be rooted in late May through June.
New growth on A. coriaceifolium.
370 Landscape SNA Research Conference Vol. 56 2011
Acer erythranthum Gag. (red-flowered maple) – This rare evergreen maple has only recently come into cultivation in the west. It appears to be very closely related to A. laevigatum and may at some point be placed in this species. This species is endemic to a small area of Vietnam near the Chinese border. Small unlobed foliage 6-12 cm (2.5- 4.7 in) long by 2-3 cm (0.8-1.2 in) wide emerges reddish in the spring before deepening to dark green. The early spring flowers are reddish against the evergreen foliage. The JCRA’s plant comes from a collection by Dan Hinkley (DJH 06147) who feels that it should prove to be hardy in central North Carolina. It has not been evaluated outdoors as of yet. Propagation is by seed.
Acer fabri Hance (Faber’s maple) – This evergreen maple is perhaps the most readily available in the trade in the west. Narrow, lanceolate leaves emerge coppery red before turning dark, glossy green. This has proven to be among the showiest of maples in flower with dark red buds opening in late March to reveal white flowers held on crimson pedicels. The fruit is also bright red and continues the show against the glossy foliage. Young stems are green or occasionally reddish. Plants in the wild can grow to 20 m (65 ft) but are typically closer to half that size in cultivation. It tends to grow as a multi- stemmed or low branching tree unless trained differently. A. fabri appears to be perfectly hardy in central NC with only minimal damage to the branch tips and discoloring of some of the foliage during cold spells. The JCRA plant has been in the ground for over a decade and has performed admirably, growing to 4 m (13 ft) in that time. Propagation is by seed or grafting on A. palmatum.
A. laevigatum Veitch (smoothleaf maple) – A medium sized tree to 15 m (50 ft) in the wild. Young plants have serrate margins on lanceolate leaves Flowers on A. fabri. but become entire as the plants mature. New growth is bright red which contrasts nicely with the yellow early spring flowers. Young branches are olive green often with a purplish tinge. Summer fruits also emerge purple-maroon. This tree is found scattered through southeast Asia. The JCRA has plants grown from seed collected at the Shanghai Botanic Garden in 2009 so has not been able to assess its growth in the arboretum. Other plants growing throughout the southeast have performed well and a specimen at the Charles Keith Arboretum in Chapel Hill, NC is over 3 m (10 ft) tall after being in the ground for 12 years. Propagate by seed or grafting on A. palmatum.
371 Landscape SNA Research Conference Vol. 56 2011
A. laurinum Hassk. – This rare tree was grown at the JCRA from 1996 to 2000 as the synonymous A. decandrum when it died due to late season drought. It is mainly a subtropical evergreen tree to over 25 m (80 ft) tall in the wild although presumably it will be much smaller in cultivation. New growth emerges bright red-maroon. Hardiness for A. laurinum will depend heavily on the provenance of the germplasm. With a range from China and Cambodia to India, Malaysia, and Thailand this is the only maple to cross the equator. The hardiest plants will come from the northernmost populations and, most importantly, from the highest elevations near 2000 - 2500 m (6500-8500 ft). Propagation is by seed.
A. oblongum DC. (flying moth maple) – This Asian tree grows at medium altitudes to 2000 m (6500 ft) in mountainous regions of Nepal to central China. It forms an upright, oval headed tree to 15 m (50 ft) in the wild but will be much smaller in cultivation. It is typically described as evergreen but is a variable species in the wild ranging from fully evergreen to deciduous. The foliage is often tri-lobed on young vigorous plants becoming oblong to ovate with maturity. The foliage is never serrate as in some other closely related evergreen maples. Leaves are leathery, sage green above and paler beneath. Fall color on deciduous plants can be brilliant red to nice yellow to almost nonexistent. The bark is smooth and attractive and there are reports that the bark can peel off in irregular plates but this has not been the case for trees at the JCRA. The JCRA has several trees in cultivation from different sources. One tree grown from seed of a cultivated plant near Tokyo has been in the ground since 2006 and grown to 1.5 m (5 ft). It is fully evergreen but has taken significant damage during most typical zone 7 winters with killed back branches and damaged foliage. Two other seedlings from wild collected Chinese seed received from the University of Nebraska and planted in 1996 and 1997 have grown to about 9 m (30 ft) each. One tree has proven to be completely deciduous with excellent fall Evergreen A. oblongum after January 2008 color every 3-4 years. It has made a very freeze. handsome and garden worthy tree. The other tree has leaves which are semi-persistent with no fall color. While the evergreen forms may have potential for deep south gardens, the fully deciduous form is a tree worth consideration over a wider area and should be trialed in colder regions. Propagation is by seed, but there has been some success in preliminary cutting trials. Grafting on Acer buergerianum may also be possible.
372 Landscape SNA Research Conference Vol. 56 2011
Acer oblongum var. concolor Pax – This plant, similar to the species, has conspicuously white undersides to the leaf and a bluer color overall. The JCRA plants come from Dan Hinkley wild collected Vietnamese material (DJHV 8019) and have not been grown long enough for evaluation.
A. obtusifolium Sib. – This plant is one of the more western species of evergreen maple ranging from eastern Turkey into Syria, Lebanon, Palestine, and Cyprus along coastal mountains. It forms a shrub or can be trained into a small tree about 5 m (16 ft) tall. The foliage is leathery A. oblongum fall color on northern germplasm. and varies from unlobed to tri-lobed.
Leaves are typically 5-10 cm (2-4 in) long and gray-green and reliably evergreen in areas milder than central NC. In cooler areas the foliage will shrivel and eventually drop with no fall color. The JCRA plant survived outdoors for about 3 years. Its death was probably due to a combination of winter cold and wet. Plants will likely perform best if planted in a free draining soil with some protection from drying winter winds. A. obtusifolium is sometimes lumped with A. sempervirens but the former’s leaves are conspicuously larger often to near twice the size. It is synonymous with the names A. orientale and The tri-lobed foliage of A. obtusifolium A. syriacum. Propagation is by seed or grafting on is similar to A. sempervirens. A. monspessulanum or A. pseudoplatanus. A. paxii Franch.(Pax’s maple) – This maple from Yunnan Province in China is very similar to the closely related A. buergerianum with the main distinction being its evergreen foliage. It grows to 10 m (32 ft) in the wild. The foliage is glossy green and typically tri-lobed, but unlobed leaves also appear. The JCRA plant has not been in the collection long enough for an evaluation of its hardiness although reports indicate small trees are very tender while larger specimens may withstand zone 7b winters. It makes a handsome small tree and can be propagated by seed or grafting on A. buergerianum.
373 Landscape SNA Research Conference Vol. 56 2011
Literature Cited
1. Stevens, P. F. (2001 onwards). Angiosperm Phylogeny Website. Version 9, June 2008 [and more or less continuously updated since]. 5 Oct. 2010 http://www.mobot.org/MOBOT/research/APWeb/. 2. Bean, W. J. 1976. Trees and Shrubs Hardy in the British Isles. vol I. 8th ed., 2nd impression. John Murray Ltd., London, UK. 3. Clarke, D. L. 1988. Trees and Shrubs Hardy in the British Isles Supplement. John Murray Ltd., London UK. 4. De Beaulieu, A. H. 2003. An Illustrated Guide to Maples. Timber Press, Inc., Portland, OR. 5. Grimshaw, J., Bayton, R., 2009. New Trees: Recent Introductions to Cultivation. Royal Botanic Gardens, Kew, Richmond, UK. 6. Hogan, S. 2008. Trees for All Seasons: Broadleaved Evergreens for Temperate Climates. Timber Press, Inc., Portland, OR. 7. Hooker, J. D. 1875. The Flora of British India. vol. I. L. Reeve & Co., London, UK. 8. Krussman, G. 1984. Manual of Cultivated Broad-Leaved Trees & Shrubs. Vol. I. Timber Press, Beaverton, OR. 9. Li, H. L. 1963. Woody Flora of Taiwan. Livingston Publishing Co., Narberth, PA 10. Sargent, C. S. 1988. Plantae Wilsonianae. vol. I. Dioscorides Press, Portland OR. 11. Tropicos.org. Missouri Botanical Garden. 5 Oct 2010
374 Landscape SNA Research Conference Vol. 56 2011
Irrigation Frequency Affects Growth and Photosynthetic Capacity of Four Conifer Species
Joshua Pool, Jason Griffin, Cheryl Boyer, and Stuart Warren
Kansas State University, Department of Horticulture Forestry and Recreation Resources 2021 Throckmorton Plant Science Building, Manhattan, KS 66506
Index words: Abies nordmanniana, Cupressus arizonica, drought, landscape establishment, Picea engelmannii, Thuja ‘Green Giant’
Significance to the industry: Containerized Thuja L. ‘Green Giant’ (‘Green Giant’ arborvitae), Cupressus arizonica Greene (Arizona cypress), Abies nordmanniana (Steven) Spach (Nordmann fir), and Picea engelmannii Parry ex Engelm. (Engelmann spruce) were subjected to recurring short-term moderate to severe drought in a greenhouse environment. Results suggest C. arizonica and A. nordmanniana, and T. ‘Green Giant’ are capable of tolerating some level of water deficit and recovering. Picea engelmannii, however, lacked the ability to recover basic photosynthetic capacity following two drought events. These species are potential choices for evergreen landscape ornamentals in the Great Plains.
Nature of Work: Pine trees and conifers in general, are an important part of the landscape in the Midwest and Great Plains. While they are aesthetic, they are also necessary and functional tools for wind abatement, control of soil erosion, and wildlife habitat. Unfortunately, long established pine (Pinus L.) trees are dying rapidly and with increasing frequency due to pine wilt disease. Exacerbating this situation are frequent and prolonged droughts which coupled with increasing water use restrictions can induce severe drought stress leading to tree death. Thus, a concerted effort to find and introduce conifers that establish easily with minimal amounts of irrigation is a priority.
Prolonged drought, high summer temperatures, and cold winter temperatures make it particularly difficult to grow conifer species in Kansas. Water stress is a primary factor leading to plant failure after transplanting and is one of the most limiting factors for growth (2,4). This water stress increases the plant’s vulnerability to pests and diseases (6). Therefore, the objective of this work was to examine the influence of short-term recurring drought had on photosynthetic capacity and growth of four conifer species.
On 14 April 2010, 24 plants each of Thuja ‘Green Giant’ (‘Green Giant’ arborvitae), Cupressus arizonica (Arizona cypress), Abies nordmanniana (Nordmann fir), and Picea engelmannii (Englemann spruce) were potted into containers filled with an amended pine bark substrate. Container size was selected based on the size of the plant’s root system at potting. ‘Green Giant’ arborvitae were potted in 6.0 L (1.6 gal) containers,
Landscape 374.3
SNA Research Conference Vol. 56 2011
Arizona Cypress were in 2.8 L (0.75 gal) containers, and Nordmann fir and Engelmann spruce were in 10.8 L (2.9 gal) containers. The substrate consisted of pine bark:sand (8:1, by vol.) amended with 0.91 kg·m-3 (1.5 lbs·yd-3) Micromax (Scotts, Marysville, OH), 7.1 kg·m-3 (12 lbs·yd-3) controlled release fertilizer (Osmocote 18-6-12, Scotts, Marysville, OH), and 0.45 kg·m-3 (1.0 lbs·yd-3) dolomitic limestone. Plants were grown under partial shade for 7 weeks. On 4 June 2010 the plants were moved into a glass greenhouse (Manhattan, KS) and allowed to acclimate for 5 weeks. Plants were grown under natural photoperiod and irradiance and watered as needed to avoid moisture stress. Greenhouse temperatures were set to 27°C day / 18 °C night (80 °F day / 65 °F night).
Initial substrate water holding capacity was determined by sub-irrigating individual containers in a large reservoir until water was observed glistening on the surface of the container substrate. Water was then allowed to drain slowly from the bottom of the reservoir and containers. The containers were allowed to drain two hours and then weighed to obtain weight at container capacity (CC). Treatments were initiated on 7 July 2010 by withholding irrigation. Plants were weighed daily at 0600 hr and irrigated back to CC when they had reached one of the three predetermined treatments: 90% CC (well watered control), 80% CC (moderate drought) or 70% CC (severe drought).
Photosynthesis measurements began on 31 August 2010. Photosynthetic capacity (Pnet) of each plant was measured using a CIRAS-1 (PP Systems, Haverhill, MA) -1 -2 -1 infrared gas analyzer supplying 2000 µL·L CO2, 1000 µmol·m ·s photosynthetically active radiation (PAR), and a leaf temperature of 30 °C (86 °F). All plants were irrigated 1-day prior to photosynthesis measurement to minimize stomatal limitations. A terminal shoot containing current season’s growth was placed in the cuvette and data recorded when carbon assimilation stabilized. Plants were then destructively harvested, roots were washed of substrate, and growth data was collected including: height, shoot dry weight, and root dry weight. Growth Index (GI) was calculated as (plant height + maximum plant width + perpendicular plant width) ÷3. Dry weights were recorded following 7-days of drying at 66 °C (150 °F) in a forced air drying oven.
The experimental design was a randomized complete block design with eight single plant replicates. Data were analyzed using GLM procedures and means separation using Fisher’s Protected LSD at p = 0.05 (5). No statistical comparisons were made between species.
Results and Discussion: Due to differences between species in root system size at the time of planting and the inherent differences in rate of growth of the root system, each species filled the container volume at a different rate and therefore, each species experienced the drought treatments at different frequencies. Throughout the duration, 90% CC plants were watered on alternating days. Species reached 80% CC with the following frequencies; C. arizonica (19 times), P. engelmannii (4 times), T. ‘Green Giant’ (10 times), and A. nordmanniana (4 times). Species reached 70% CC with less frequency; C. arizonica (13 times), P. engelmannii (2 times), T. ‘Green Giant’ (3 times), and A. nordmanniana (2 times).
Landscape 374.3
SNA Research Conference Vol. 56 2011
Among the four species, T. ‘Green Giant’ was the most responsive to recurring short- term drought. Height, shoot dry weight, and GI were reduced when the plants were exposed to drought (Table 1). Interestingly, root dry weight and Pnet were not affected suggesting that plants may be able to recover quickly when soil moisture is improved.
In contrast, P. engelmannii and A. nordmanniana were nearly unaffected by the drought treatments (Table 1). Short-term drought greatly reduced the Pnet of P. engelmannii, which may lead to long term survival difficulties. However, other measurements were unaffected for the two species. This was not entirely unexpected since these two species have determinate growth habits and seasonal growth had occurred prior to treatment initiation.
Cupressus arizonica is known for its drought tolerance (1, 3). Therefore, it was not surprising that few of the growth parameters were influenced by the short-term drought (Table 1). Shoot dry weight was the only growth variable affected. However, height and GI were unaffected suggesting that the species compensated for moisture deficit by producing a less dense plant with less leaf area for transpiration, while maintaining a relatively large root system for obtaining soil moisture.
Data herein suggests that C. arizonica and A. nordmanniana may be able to survive repeated short term droughts that frequently occur in the Midwest and Great Plains. Thuja ‘Green Giant’ appears to have the capacity to recover quickly from short-term drought by maintaining Pnet and a robust root system, whereas P. engelmannii may lack the ability to recover basic photosynthetic capacity after exposure to drought.
Literature Cited 1. Fink, D. and W. Ehrler. 1986. Christmas tree production using the runoff farming system. HortScience. 21: 459-461. 2. Gilman, E., T. Yeager, and D. Weigle. 1996. Fertilizer, irrigation and root ball slicing affects burford holly growth after planting. J. Environ. Hort. 14: 105-110. 3. Harrington, J., M. Loveall, and R. Kirksey. 2005. Establishment and early growth of dryland plantings of Arizona cypress in New Mexico, USA. Agrofor. Syst. 63: 183- 192. 4. Mathers, H.M., S.B. Lowe, C. Scagel, D.K. Struve, and L.T. Case. 2007. Abiotic factors influencing root growth of woody nursery plants in containers. HortTechnology. 17: 151-162. 5. SAS Institute, Inc. 2004. SAS user’s guide. Release 9.1. SAS Institute, Inc. Cary, NC. 6. Schroder, T., D. McNamara, and V. Gaar. 2009. Guidance on sampling to detect pine wood nematode Bursaphelenchus xylophilus in trees, wood and insects. Bulletin OEPP. 39: 179-188.
Landscape 374.3
SNA Research Conference Vol. 56 2011
Table 1. Height (Ht), shoot dry weight (Sdw), root dry weight (Rdw), growth index (GI), and net photosynthesis (Pnet) of Cupressus arizonica, Picea engelmannii, Thuja ‘Green Giant’ and Abies nordmanniana grown under recurring drought cycles of 90%, 80%, or 70% container capacity. C. arizonica P. engelmannii T. ‘Green Giant’ A. nordmanniana 90% 80% 70% 90% 80% 70% 90% 80% 70% 90% 80% 70% Ht (cm) 65.4NS 60.3 59.4 42.0NS 42.3 43.0 58.6**a 49.5b 43.1c 35.5NS 34.3 32.6
** NS ** NS Sdw (g) 43.4 a 35.4b 33.9b 40.3 39.0 33.4 52.5 a 46.3a 33.1b 55.8 53.0 50.9
NS NS NS NS Rdw (g) 9.2 6.7 7.3 19.2 21.2 15.6 8.2 7.4 5.3 39.9 37.6 31.8
GI 45.1NS 42.5 43.2 29.9NS 29.2 30.6 49.2**a 42.5b 42.4b 39.0NS 36.4 35.8
1 NS ** NS NS Pnet 5.4 6.2 8.6 6.2 a 5.6a 1.4b 2.3 3.2 3.2 3.4 3.0 2.8 NS,**,* Not significant, significant at P≤0.01, or significant at P≤0.05 within a species and within a row.
Means followed by a different letter within a species and within a row are significantly different, Fishers Protected LSD ( = 0.05), n=8.
1 -2 -1 Net photosynthesis (Pnet) measured in µmol CO2•m •s
374.4 Landscape SNA Research Conference Vol. 56 2011
Plant Propagation
Gene Blythe Section Editor and Moderator
Propagation 375
SNA Research Conference Vol. 56 2011
Grafting Fraser fir (Abies fraseri): Effect of Grafting Date, Shade, and Irrigation
Haley Hibbert-Frey, John Frampton, Frank A. Blazich, and L. Eric Hinesley
North Carolina State University, Department of Forestry and Environmental Resources Raleigh, NC 27695-8008
Index Words: Abies bornmuelleriana, Christmas trees, Phytophthora cinnamomi, rootstock, scion, vegetative propagation, cleft graft
Significance to Industry: Grafting Fraser fir [Abies fraseri (Pursh) Poir.] scions onto rootstocks of Turkish fir (Abies bornmuelleriana Mattf.) is a strategy used by some Christmas tree growers in the Southern Appalachian Mountains of North Carolina to reduce losses by phytophthora root rot caused by Phytophthora cinnamomi Rands. Results indicated it is prudent to graft Fraser fir in late winter/early spring with freshly collected dormant scion material.
Nature of Work: Fraser fir is one of the most popular Christmas tree species in the United States and is indigenous to isolated mountain tops at elevations between 1370 and 2037 m (4495 and 6683 ft) in southwestern Virginia, western North Carolina, and eastern Tennessee (5). Christmas tree plantations of this species are scattered throughout the southern Appalachian region where Christmas tree sales provide an important economic resource. In 2006, revenue from Christmas tree sales in North Carolina totaled $134 million (6). Fraser fir is grown for its fragrance, soft dark green needles, strong branches, excellent needle retention, and natural Christmas tree shape (2).
Phytophthora cinnamomi, the primary cause of phytophthora root rot, has spread rapidly throughout soils in western North Carolina, causing large economic losses. Once a site is infested, the pathogen is nearly impossible to eradicate. Fraser fir seedlings can die within 2 or 3 weeks from infection (1). Thus, there is a large demand in the region for planting stock that is resistant to, or tolerant of, this pathogen. To ameliorate the impact of this disease, some Christmas tree growers in the region are grafting Fraser fir onto rootstocks of more resistant fir (Abies Mill.) species. Grafting onto resistant rootstocks is a widely accepted method of managing phytophthora root rot (4). In a controlled inoculation study (1), momi fir (A. firma Sieb. et Zucc.) was the species most resistant to P. cinnamomi. Although it is the favored Abies rootstock for phytophthora resistance, it is not planted for Christmas tree production because it has undesirable sharp, prickly, light green needles and breaks bud early leaving it susceptible to late frosts. Turkish fir was less resistant than momi fir (1) but has desirable Christmas tree qualities. Furthermore, because momi fir transplants are in short supply most years (as the case for this study), Turkish fir is the next best rootstock choice.
Propagation 376
SNA Research Conference Vol. 56 2011
Fraser fir is usually grafted in early spring (April) when the rootstock and scion are dormant, but this is a busy time for growers. The opportunity to graft at other times of the year, e.g., late summer or early fall, would allow Christmas tree growers more flexibility. Therefore, the objectives of this investigation were to (A) compare success and growth of grafting fresh Fraser fir scions onto Turkish fir rootstocks during the traditional time of grafting (April), with other grafting dates; (B) assess the affect of shade and irrigation treatments on graft success and growth; and (C) evaluate grafting (mid-July through mid-October) using dormant Fraser fir scions collected during April and stored at -1°C (30°F). The study compared the traditional time of grafting (April), using a cleft graft, with eight biweekly summer/early fall grafting dates from mid-July through mid-October (3). Shade and irrigation treatments were also superimposed on the drafting dates.
Results and Discussion: Results indicated that to ensure optimal grafting success, grafting should be performed in the late winter/early spring (April) when scions are dormant and the rootstocks are becoming active (3). April graft success was 95% but when grafting fresh scions in summer/fall, graft success decreased from 52% in July to 0% in October. Shade improved summer graft success (52% with, 38% without). Irrigation did not significantly affect graft success or subsequent growth. In a supplemental storage study, grafting of stored scion material in summer/early fall was not successful (less than 1%).
Literature Cited: 1. Benson, D.M., L.E. Hinesley, J. Frampton, and K.C. Parker. 1988. Evaluation of six Abies species to phytophthora root rot caused by Phytophthora cinnamomi. Biological and Cultural Tests for Control of Plant Diseases 13:57-58. 2. Frampton, J. 2001. North Carolina’s Christmas tree genetics program. Proc. 26th Southern Forest Tree Improvement Conf., Athens, Ga., 26-29 June 2001. 3. Hibbert-Frey, H., J. Frampton, F.A. Blazich, and L.E. Hinesley. 2010. Grafting Fraser fir (Abies fraseri): Effect of grafting date, shade, and irrigation. HortScience 45:617-620. 4. Hinesley, E. and J. Frampton. 2002. Grafting Fraser fir onto rootstocks of selected Abies species. HortScience 37:815-818. 5. Liu, T.-S. 1971. A monograph of the genus Abies. Dept. For., College of Agr., Natl Taiwan Univ., Taipei, Taiwan, Republic of China. 6. U.S. Department of Agriculture, Economic Research Services. 2007. Amber waves – Did you know? Bull. 19 Oct. 2009. < http://www.ers.usda.gov/AmberWaves/November07/PDF/Did You Know.pdf>.
Propagation 377
SNA Research Conference Vol. 56 2011
Grafting Fraser fir (Abies fraseri): Effect of Scion Origin (Crown Position and Branch Order)
Haley Hibbert-Frey, John Frampton, Frank A. Blazich, Doug Hundley, and L. Eric Hinesley
North Carolina State University, Department of Forestry and Environmental Resources Raleigh, NC 27695-8008
Index Words: cleft graft, orthotropic growth, plagiotropism, topophysis, vegetative propagation, Christmas trees
Significance to Industry: Success and subsequent growth of Fraser fir [Abies fraseri (Pursh) Poir.] cleft grafts were studied in relation to origin and type of scion material in the tree crown. Results indicated the origin of the scions regarding crown position and branch order has an influence on subsequent growth of successful grafts and should be considered prior to grafting.
Nature of Work: Fraser fir is one of the most popular Christmas tree species in the United States. It occurs naturally at elevations above 1370 m (4495 ft) on isolated mountain tops in the southern Appalachian Mountains from southwest Virginia through western North Carolina and into eastern Tennessee (16). It is grown commercially as a Christmas tree because of its pleasant fragrance, dark green foliage, natural conical shape and strong branches (5). In addition, it has good postharvest keepability (11). North Carolina has more than 1500 Christmas tree growers and 12,000 ha (29,652 acres) in production (17) with Fraser fir representing more than 95% of production. The farm-gate value of Christmas trees in North Carolina was about $134 million in 2006 (20).
Fraser fir normally is propagated by seed, but there is also interest in grafting it onto rootstocks of other Abies Mill. (fir) species with more resistance to phytophthora root rot (Phytophthora cinnamomi Rands) (12). Resistant fir species might help reclaim infested land previously abandoned for Christmas tree production. Grafting also provides an opportunity to clonally propagate trees with desirable Christmas tree phenotypes.
During the 1980s, the North Carolina Division of Forest Resources used grafting to establish the first clonal seed orchard of Fraser fir near Crossnore, North Carolina. Subsequently, grafting has been used to establish several other seed orchards and clone banks of Fraser fir. Despite this history, there is little published information for grafting Fraser fir. Traditionally, it is grafted in March or April when stock plants are dormant – a busy time for Christmas tree growers. Efforts to identify alternative grafting dates have been unsuccessful (8).
Propagation 378
SNA Research Conference Vol. 56 2011
Origin of scion material within the tree crown might affect graft success. Owing to correlative inhibition and differences in vigor, shoots produced in the same year decrease in length and diameter downward and inward within the crown (13, 15, 21). In contrast, entire branches increase in age, length, and diameter from top to bottom of the tree. In vegetative propagation studies, stem cuttings of higher order often root in greater percentages than those of lower order (4,6), but this generalization is not universal (3). Growth following rooting is usually best for first-order shoots because they initially have greater caliper and larger buds (14, 15). In general, rooting capacity of Fraser fir stem cuttings decreases with age of the ortet (10, 18) and is best for cuttings collected lower in the crown (18). However, Garlo (6) found no significant difference in rooting of second-order stem cuttings from the upper and lower crown of 24-year-old Fraser fir in a seed orchard at Crossnore, North Carolina.
Comparisons such as rooting capacity of stem cuttings from the upper vs. lower crown, and first-order vs. second-order cuttings, relate to topophysis, the effect of the position of the propagule in the source plant (ortet) on the growth and phenotype of progeny (ramets) (7). The same issues, but often less pronounced, are relevant for grafting. Because Christmas tree selections normally are made when trees are young, prior to the transition to the adult growth phase, grafts and rooted cuttings initially are not sexually mature so that all growth is vegetative.
Factors affecting rooting of Fraser fir stem cuttings are well understood (1), whereas factors affecting grafting success have received little attention. Garlo (6) found no consistent relationship between rooting capacity and graft success for cuttings and scions from the upper and lower crown. Traditionally, Fraser fir is grafted using dormant scion material from the upper crown.
Plagiotropism – growth at an oblique angle to vertical – can reduce uniformity of rooted stem cuttings and grafted material and decreases overall shoot growth (19). A plagiotropic plant has no vertical (orthotropic) leader; it continues growing like a branch. Abies sp. such as Fraser fir are well known for plagiotropism following rooting of stem cuttings (1). The time for grafts to become orthotropic appears to decrease with increasing rootstock vigor at the time of grafting (2), but it might also be influenced by stock plant age, scion position in the ortet, and the propagation environment. If plagiotropism were similar for shoots from all parts of the crown, it would increase the availability of suitable scion material for grafting. Therefore, the objective of this study was to investigate success and growth of Fraser fir grafts as affected by (A) scion origin in the crown (e.g., upper vs. lower) and (B) branch order (first vs. second). The investigation involved collection of first- and second-order shoots (current year) from five zones in the crown, ranging from top to bottom, which were then grafted using a cleft graft to 5-year-old Fraser fir transplants in April (9).
Results and Discussion: Success rates were similar for first- and second-order scions, whereas budbreak and subsequent growth were best for first-order scions (9). In general, results were best for first order scions taken from the upper crown. Plagiotropism of grafts was similar for all crown zones and shoot types.
Propagation 379
SNA Research Conference Vol. 56 2011
Literature Cited: 1. Blazich, F.A. and L.E. Hinesley, 1994. Propagation of Fraser fir. J. Environ. Hort. 12:112-117. 2. Copes, D.L. 1980. Effect of rootstock vigor on leader elongation, branch growth, and plagiotropism in 4-year and 8-year old Douglas-fir grafts. Tree Planters’ Notes 31(1):11-15. 3. Copes, D.L. 1987. Rooting sitka spruce from southeast Alaska. Pacific Northwest Forest and Range Expt. Sta., Res. Note PNW-RN-465. 4. Copes, D.L. 1992. Effects of long-term pruning, meristem origin, and branch order on the rooting of Douglas-fir stem cuttings. Can. J. For. Res. 22:1888-1894. 5. Frampton, J. 2001. North Carolina’s Christmas tree genetics program. Proc. 26th Southern For. Tree Improvement Conf., Athens, Ga., 26-29 June 2001. 6. Garlo, A. 1980. Vegetative propagation of Fraser fir seed orchard trees by rooted cuttings and grafting. MS Thesis, N.C. State Univ., Raleigh. 7. Hartmann, H.T., D.E. Kester, F.T. Davies, Jr., and R.L. Geneve. 2002. Hartmann and Kester’s plant propagation: Principles and practices. 7th ed. Prentice Hall, Upper Saddle River, N.J. 8. Hibbert-Frey, H., J. Frampton, F.A. Blazich, and L.E. Hinesley. 2010. Grafting Fraser fir (Abies fraseri): Effect of grafting date, shade, and irrigation. HortScience 45:617-620. 9. Hibbert-Frey, H., J. Frampton, F.A. Blazich, D. Hundley, and L.E. Hinesley. 2010. Grafting Fraser fir (Abies fraseri): Effect of scion origin (crown position and branch order). HortScience 46:91-94. 10. Hinesley, LE. and F.A. Blazich. 1980. Vegetative propagation of Abies fraseri by stem cuttings. HortScience 15:96-97. 11. Hinesley, L.E. and G.A. Chastagner. 2002. Christmas tree keepability, 11 p. In: K.C. Gross, C.Y. Wang, and M. Saltveit (eds.). The commercial storage of fruits, vegetables, and florist and nursery crops. Draft revision of Agric Hdbk. 66, U.S. Dept. Agr., Agricultural Res. Serv., Beltsville, Md. 12. Hinesley, E. and J. Frampton. 2002. Grafting Fraser fir onto rootstocks of selected Abies species. HortScience 37:815-818. 13. Kozlowski, T.T. 1964. Shoot growth in woody plants. Botanical Rev. 30:335-392. 14. Kozlowski, T.T. 1973. Predictability of shoot length from bud size in Pinus resinosa Ait. Can. J. For. Res. 3:34-38. 15. Little, C.H.A. 1970. Apical dominance in long shoots of white pine (Pinus strobus). Can. J. Bot. 48:239-253. 16. Liu, T-S. 1971. A monograph of the genus Abies. Dept. For., College Agr., Natl. Taiwan Univ., Taipei, Taiwan (Republic of China). 17. North Carolina Department of Agriculture and Consumer Services. 2004. N.C. Christmas tree facts. 15 Oct. 2008.
Propagation 380
SNA Research Conference Vol. 56 2011
19. Timmis, R., G.A. Ritchie, and G.S. Pullman. 1992. Age-and position-of-origin and rootstock effects in Douglas-fir plantlet growth and plagiotropism. Plant Cell, Tissue Organ Cult. 29:179-186. 20. U.S. Department of Agriculture, Economic Research Services. 2007. Amber Waves – Did You Know? Bul. 19 Oct. 2009.
Propagation 381
SNA Research Conference Vol. 56 2011
Softwood Cutting Propagation of Agastache and Buddleja Using IBA and IBA+NAA Solutions
Eugene K. Blythe Coastal Research and Extension Center, Mississippi State University, South Mississippi Branch Experiment Station, Poplarville, MS 39470
Index Words: auxin, indole-3-butyric acid, naphthaleneacetic acid, vegetative propagation
Significance to Industry: The availability of unrooted cuttings from offshore producers in recent years has made it increasingly possible for growers to propagate a wide assortment of crops without the need to maintain their own stock plants. Softwood cuttings from intensively managed stock plants may or not benefit from a quick-dip in auxin prior to sticking, and may respond differently than cuttings obtained from conventional container-grown or landscape-grown stock plants. Using terminal softwood cuttings obtained from an offshore supplier, this study determined that cuttings of Agastache 'Tutti Frutti' rooted best using a quick-dip in 1000 ppm IBA or 1000 ppm IBA + 500 ppm NAA, and cuttings of Buddleja davidii 'Attraction' rooted best using a quick- dip in 500 ppm IBA or 500 ppm IBA + 250 ppm NAA.
Nature of Work: Since the 1980s, the availability of unrooted cuttings from offshore producers has made it increasingly possible for growers to propagate a wide assortment of crops without the need to maintain their own stock plants (2). Auxin treatment prior to sticking cuttings can be required for economical rooting of some crops, but are ineffective or unnecessary with others (3).
In many cases, maintenance of healthy stock plants specifically for volume production of unrooted cuttings at offshore production facilities has eliminated the need for routine use of auxins (2). Situations that may warrant the use of an auxin treatment include below-optimum substrate or air temperatures, uneven mist coverage, moderate delays in delivery of cuttings to the grower, reduced light levels during the rooting phase, or varieties that often tend to be slow or uneven in rooting (2).
Auxins are generally applied to herbaceous and softwood cuttings of various crops at concentrations of 500 to 1,500 ppm, and can be applied as powders or as quick-dip solutions. The latter offer the advantages of uniformity, consistency, and ease of use (3). Agastache will root from softwood cuttings prepared with at least one node (3); however, recommended concentrations have not previously been published. Buddleja cuttings root readily from terminal or single-node softwood cuttings (4). An application of 1,000 to 3,000 ppm IBA (and up to 8,000 ppm IBA) as a solution or powder has been recommended for cuttings of Buddleja, especially if semi-hardwood cuttings are being used (1, 3).
Propagation 382
SNA Research Conference Vol. 56 2011
The objective of this study was to evaluate the rooting and initial shoot growth of terminal softwood cuttings of Agastache 'Tutti Frutti' ('Tutti Frutti' hummingbird mint) and Buddleja davidii 'Attraction' ('Attraction' butterfly bush) with and without the use of a quick-dip in alcohol-based solutions of IBA and IBA+NAA. Agastache 'Tutti Frutti' is an herbaceous perennial originating from a hybrid between A. barberi and A. mexicana, with plants growing 3 to 4 feet in height and producing clusters of lavender-pink flowers. Buddleja davidii 'Attraction' is a deciduous shrub with purplish-red flowers and a more compact habit than 'Royal Red'.
Auxin solutions were prepared by diluting Dip 'N Grow concentrate (10,000 ppm IBA + 5000 ppm NAA; Astoria-Pacific, Inc., Clackamas, OR) to final concentrations of 1000 ppm IBA + 500 ppm NAA and 500 ppm IBA + 250 ppm NAA, and by diluting Dip 'N Grow Lite concentrate (experimental formulation with 10,000 ppm IBA; Astoria-Pacific, Inc.) to final concentrations of 1000 ppm IBA and 500 ppm IBA. Solutions were prepared with isopropyl alcohol and deionized water to contain 50% alcohol (by volume) in the final product.
Cuttings of Agastache 'Tutti Frutti' and Buddleja davidii 'Attraction' were donated by Yoder Brothers Inc. (Lancaster, PA) and shipped from Flores del Amanecer S.A. (Cundinamarca, Colombia) on March 10, 2008 and received at the South Mississippi Branch Experiment Station in Poplarville, MS on March 12. Cuttings of Agastache were 3 cm in length and cuttings of Buddleja were 5 cm in length. Cuttings received a 1- second basal quick-dip in their respective auxin solutions (cuttings in one treatment were not treated with auxin), stuck into 50-cell trays in Fafard 3B substrate (Conrad Fafard, Inc., Agawam, MA) using a completely randomized design, and placed under intermittent mist in a greenhouse. There were 40 cuttings per treatment for a total of 200 cuttings per variety.
After one month, all cuttings had rooted. Cuttings were removed from the plug trays and washed to remove substrate. Root systems were scanned and analyzed using WinRHIZO software (Regent Instruments Inc., Quebec, Canada) and each shoot was measured for length. Data was analyzed using the GLIMMIX procedure of SAS (SAS Institute Inc., Cary, NC) with treatment comparisons made using the Schaffer-Simulated method.
Results and Discussion: Cuttings of Agastache 'Tutti Frutti' exhibited the best rooting using the two treatments with the highest concentrations of auxin (1000 ppm IBA and 1000 ppm IBA + 500 ppm NAA, with total root length using these treatments being significantly greater than with nontreated cuttings (Table 1). Cuttings of Buddleja davidii 'Attraction' exhibited the best rooting using the two treatments with the lower concentrations of auxin (500 ppm IBA and 500 ppm IBA + 250 ppm NAA, with total root length using these treatments being significantly greater than with nontreated cuttings (Table 1). No indication of shoot growth inhibition was exhibited by either variety.
Based on our results, we conclude that terminal softwood cuttings of Agastache 'Tutti Frutti' and Buddleja davidii 'Attraction' benefit from the use of an auxin treatment by
Propagation 383
SNA Research Conference Vol. 56 2011
producing larger root systems than nontreated cuttings. Larger root systems are generally better able to stabilize the substrate plug for transplanting and have the potential for faster establishment of root systems in growing substrate after transplanting.
Literature Cited: 1. Hartmann, H.T., D.E. Kester, F.T. Davies, and R.L. Geneve. 2011. Hartmann and Kester's plant propagation: Principles and practices. 8th edition. Prentice Hall, Upper Saddle River, NJ. 2. Klopmeyer, M, M. Wilson, and C.A. Whealy. 2003. Propagating vegetative crops, p. 165-184. In: D. Hamrick (ed.). Ball redbook. 17th edition. Vol. 2: Crop production. Ball Publishing, Batavia, IL. 3. Scoggins, H.L. 2006. Cutting propagation of herbaceous perennials, p. 173-185. In: Cutting propagation: A guide to propagating and producing floriculture crops. Ball Publishing, Batavia, IL. 4. Toogood, A. 1999. Plant propagation. DK Publishing, New York.
Table 1. Rooting and initial shoot growth on terminal softwood cuttings of Agastache 'Tutti Frutti' and Buddleja davidii 'Attraction' obtained from an offshore supplier, treated with a basal quick-dip in selected auxin treatments, and rooted under intermittent mist in a greenhouse (n=40). Total root length Shoot length Variety Treatment (mm) (mm) Agastache 'Tutti Frutti' 1000 ppm IBA + 500 ppm NAA 581 az 219 a 1000 ppm IBA 540 ab 209 ab 500 ppm IBA + 250 ppm NAA 434 cd 208 ab 500 ppm IBA 482 bc 212 ab nontreated 373 d 193 b
Buddleja davidii 'Attraction' 1000 ppm IBA + 500 ppm NAA 614 ab 152 ab 1000 ppm IBA 651 ab 155 ab 500 ppm IBA + 250 ppm NAA 670 a 159 a 500 ppm IBA 690 a 160 a nontreated 571 b 136 b zMeans followed by the same letter within a variety are not significantly different at the 0.05 level according to the Schaffer-Simulated method.
Propagation 384
SNA Research Conference Vol. 56 2011
Improving the Success of Microcutting Establishment from Native Azaleas
K.L. Bowen Department of Entomology and Plant Pathology Auburn University, AL 36849
Significance to Industry: Propagation of desirable plants that may be found in their native settings can often be difficult. Micropropagation of such plants has several benefits including conservation of the original plant and the potential for large scale production. One of the problems that can arise when attempting such micropropagation is fungal contamination. This study demonstrates that fungicide amendment of media used for establishment of viable explants in culture can increase incidence of shoot survival.
Nature of Work: There are sometimes occasions when it is desirable to propagate a unique plant found in a natural setting. Often propagation by cuttings is unsuccessful and source material is limited. Micropropagation, however, allows conservation of the original plant and has the potential for large scale production from limited source materials. Problems can also arise with micropropagation such as fungal contamination of cultures. Fungal contaminants can escape disinfestation or may have colonized tissues without showing deleterious symptoms (5). Because of the potential such contaminants have for preventing the establishment of viable explants, micropropagators are advised to grow source plants in a protected environment such as a greenhouse prior to taking cuttings (4), which may not be feasible.
In the two years preceding this study, success of establishing aseptic plant cultures for micropropagation of deciduous native azaleas (Rhododendron spp.) has been severely limited, primarily due to fungal contaminants; bacterial contaminants were rare. This study sought to evaluate the feasibility of using fungicides in propagation media.
Shoots of two southern native azaleas, Rhododendron flammeum (n = 3) and R. canescens (n = 5), growing on private property, were collected in April 2010. These plants had never been treated with fungicide or other pesticides. Excised shoot tips, 7 to 10 cm (3 to 4 inches) in length, were kept in moistened paper towels at ambient conditions until processing which was done within several hours of collection. Leaves were removed from shoots and shoots were placed in 0.5% sodium hypochlorite solution (bleach) containing 1 ml Tween per liter. Shoots in bleach solution were continually stirred for 15 minutes then rinsed 3 consecutive times in sterile, distilled water. In a laminar flow hood, the basal end was re-cut and the apical tip was trimmed on each shoot. The remaining stem was cut into 1- to 2-cm explant pieces, each having at least one node. In most cases, an individual shoot was cut into three pieces. Pieces of each shoot were placed on the three different media.
Propagation 385
SNA Research Conference Vol. 56 2011
The culture medium was similar to that used by Economou and Read (3), except that adenine sulfate (80 ppm) was added. The medium also contained 1 ppm indole acetic acid and 12 ppm 2iP. Medium amendments, in addition to a non-amended control, were fungicides. One amendment was azoxystrobin (at 100 ppm) (Heritage®, 50% active ingredient), the second was benomyl (at 20 ppm) (Benlate, 50%). The pH of each medium was adjusted to pH 5.0 after which sucrose (20 gms per L; 2.7 oz per gal) and agar (6 gms per L; 0.8 oz per gal) were added and dissolved. Media was dispensed into test tubes, in 10 ml aliquots, then autoclaved.
Explants were visually examined every 2 to 4 days for contamination or death (browning then blackening of explants), at which point they were removed from the study. Days of survival and survival incidence were recorded. Generalized linear model analysis was done to determine treatment differences in survival with P < 0.10.
Results and Discussion: Some explants were observed to have swelling buds by day 13 on culture media. After day 28, no additional removal of explants due to contamination or browning was needed. Numbers of apparently healthy shoots, especially on non-amended and azoxystrobin-amended media, declined rapidly after 10 days in culture (Fig. 1). Two-thirds of the shoots from R. flammeum were apparently free from any fungal colonization or had been completely disinfested, and pieces of these shoots remained healthy even on non-amended media. Similarly, two-fifths of R. canescens shoots were apparently free of fungal contaminants. Among shoots from which fungal contaminants developed when a piece was on non-amended media, the proximal piece on benomyl-amended medium stayed healthy (Fig. 1). All shoot pieces of R. canescens that were started on the benomyl-amended medium remained healthy. Despite the low number of shoots that were collected, differences in percent survival were found due to fungicide amendment (P = 0.07) after 28 days in culture (Table 1).
After 44 days on fungicide-amended media, explants with growth of axillary shoots were placed onto fresh media without fungicide amendment. At the time of this writing, these microshoots are developing normally, with transfers being made every 5 to 6 weeks to fresh media, as observed with previous Rhododendron explants by this author.
Azoxystrobin and benomyl are both systemic fungicides used for control of a fairly broad range of fungi. The melting point of benomyl (572°F) (2) is somewhat higher than that of azoxystrobin (240°F) (1). It may be that the azoxystrobin became degraded during autoclaving, which decreased its effectiveness in controlling contamination. However, several of the shoot pieces on azoxystrobin turned brown then blackened without evidence of contamination. Browning of shoots with exposure to azoxystrobin may have been due to the use of too high a concentration of that fungicide in the medium, and further tests may be needed.
Propagation 386
SNA Research Conference Vol. 56 2011
Literature Cited 1. Anonymous. 1997. Azoxystrobin: Pesticide Information Profile. Published on-line on EXTOXNET. Pesticide Management Education Program, Cornell University. 2. Anonymous. 1996. Benomyl: Pesticide Information Profile. Published on-line on EXTOXNET. 3. Economou, A.S., and P.E. Read. 1984. In vitro shoot proliferation of Minnesota deciduous azaleas. HortSci. 19: 60- . 4. Kyte, L., and J. Kleyn. 1996. Plants from Test Tubes. 3rd edition. Timber Press, Portland, Oregon, U.S.A. 5. Thomas, P. 1010. Plant tissue cultures ubiquitously harbor endophytic microorganisms. Acta. Hort. 865: 231-239.
Table 1. Explant survival (%) after 28 days on culture media amended with fungicides or non-amended. Data are means of the proportion of the number of shoots as noted. Media amendment R. canescens R. flammeum Total ---- n=5 ------n=3 ------n=8 --- None 40 ax 67 a 50.0 ab Azoxystrobin 20 a 0 a 12.5 a Benomyl 100 a 67 a 88.0 b xLetters following means, when different, indicate significant difference according to generalized mixed model analysis with P < 0.10.
Fig. 1. Percent survival of explants of R. flammeum (dashed lines) and R. canescens (solid lines) on non-amended (squares), and with media amended with benomyl at 20 ppm (open circles) and azoxystrobin at 100 ppm (triangles) for 27 days after placement on media.
Propagation 387
SNA Research Conference Vol. 56 2011
Fig. 2. Shoot pieces of R. flammeum, cut from a single shoot and placed sequentially (as noted by arrows), after 5 days on amended media. From left to right, media amendments are azoxystrobin (100 ppm), benomyl (20 ppm), and non-amended control.
Propagation 388
SNA Research Conference Vol. 56 2011
Effect of Cell Size on Growth and Physiology of Mexican Fan Palm (Washingtonia robusta H. Wendland: Arecaceae) Seedlings
Andrés Adolfo Estrada-Luna1; Horacio Claudio Morales Torres2; Victor Olalde-Portugal2; Esteban Camarena Olague1; Carlos Romero González1
1 Escuela de Agronomía. Universidad De La Salle Bajío. Av. Universidad 602, Col. Lomas del Campestre. León, Gto., México. C.P. 37150 2CINVESTAV-IPN. Km. 12.5. Libramiento Norte, Carretera Irapuato-León. Irapuato, Gto., México. C.P. 36821
Index Words: palms, seed germination, Mexican Washington palm, sexual propagation, Arecaceae
Significance to Industry: The Mexican fan palm (Washingtonia robusta H. Wendland), also known as the Mexican Washington palm, is an endemic plant species native to the desert regions in northwest Mexico (1, 4). It is a fast growing palm that can be adapted to different climate conditions, water-limited areas, and different types of soils (1, 3, 4). Because of this and its peculiar morphology and beauty, it has successfully been planted throughout Mexico and many other countries. The Mexican fan palm is a multipurpose plant that is used as an ornamental, to reforest degraded areas, as a natural barrier, and to recover eroded soils (3, 4, 5). Recently, we started a research program with the goal of studying its biology and physiology to determine the optimum conditions for commercial cultivation and preservation. As a result, we have learned how to manipulate seeds to reduce the germination time, increase germination rates, and standardize seedling emergence (2). Currently, we are performing experiments to determine the interaction of this palm with soil microorganisms including mycorrhizal fungi and plant growth promoting rhizobacteria. Data obtained from this study will benefit the nursery industry, propagators, and growers since optimization of factors affecting plant growth and physiology will provide more uniform and healthy material for commercial uses.
Nature of Work: We evaluated the effect of cell size on seedling growth, performance, and physiology in order to determine the optimum size and stage for transplantation of the Mexican fan palm to be used in commercial propagation systems. In order to begin the study, we collected healthy and mature fruits from selected plants at Irapuato, Guanajuato, Mexico. Healthy seeds were cleaned by immersion in a 2% H2SO4 solution for 48 hours to facilitate removal of pulp tissue from the seed. Remaining pulp was manually removed by macerating fruits in a sieve and cleaning with several washes with running tap water. Finally, seeds were dried at room temperature for three days and stored in paper bags. Before planting, seeds were subjected to a priming treatment consisting of an immersion in distilled water (with daily changes of fresh water) for 6 days in an incubator at 28 ± 4° C and 125 rpm of shaking. In a simple experiment, we
Propagation 389
SNA Research Conference Vol. 56 2011
evaluated the effect of two cell sizes on seedling growth, performance, and physiology. Treatment one (cell type A) included plastic germination containers (140 mL; 4.5 X 16.5 X 3.0 cm), while treatment two (cell type B) included germination trays with 60 cells (200 mL capacity; 5 X 12 X 2.5 cm dimensions). Before planting the seeds, germination containers were filled with a sterilized substratum composed of sandy-loam top soil, leaf turf, sunshine potting soil Mix 3 (Sun Gro Horticulture, Canada, Ltd), perlite, and vermiculite, (1:2:3:1:1). There were 60 seedlings in each treatment (n= 60).
After sowing the seeds, containers were transferred to a glasshouse and grown with maximum photosynthetic photon flux density (PPFD) of 1,100 μmol/m2/s-1 at plant level and an average of day/night temperature of 27/20 ± 3° C. Irrigation was supplied as needed with distilled water and fertilization was provided once a week (200 ppm N) after seedling emergence with Peters Professional 20-20-20 (Scotts-Sierra Horticultural Products Co., Marysville, OH, USA). Seedling growth measurements including plant height (cm), total root length, number of secondary roots, average secondary root length, total secondary root length, leaf, root, and total seedling dry mass, root to shoot ratio and shoot to root ratio recorded every 45 days for three times (135-day-old seedlings) after seedling emergence. Gas exchange measurements including net photosynthesis, stomatal conductance (gs), and stomatal resistance (rs), were also performed between 9:00 to 12:00 am on the first fully expanded leaf using a LI-6200 Portable Photosynthesis System (LI-COR, Inc., Lincoln, NE).
Treatment effects in the experiment were determined by using analysis of variance (ANOVA) and LSD (α= 0.01 and 0.05) for mean separation (6).
Results and Discussion: Seed germination and emergence varied from 13 to 16 days in both types of containers. After 45 days of culture, seedlings from the two treatments had produced a pair of leaves; however, greater growth was observed on root systems of seedlings growing in cell type A (Table 2). Net photosynthesis and stomatal conductance were also higher in this treatment; however, no statistical differences were detected in net photosynthesis data (Table 1). In contrast to what was observed after 45 days of culture, after 90 days seedlings growing in cell type B recovered and showed better growth than in the other treatment (Table 3 and 4). Overall plant growth was greater; however, net photosynthesis showed lower values (Table 3). A similar tendency was observed after 135 days (Table 2, Figure 1). After one year of culture the plants appeared in good condition; however, the overall growth was drastically reduced compared with plants transplanted to larger containers. We conclude that the best time to transplant the Mexican fan palm is between 45 and 90 days after emergence. After this period, seedling growth slows drastically.
Acknowledgements: The authors express thanks for the financial support provided by the Universidad De La Salle Bajío through the Office of the Research Council.
Propagation 390
SNA Research Conference Vol. 56 2011
Literature Cited: 1. Bullock, S.H. and Heath D. 2006. Growth rates and age of native palms in the Baja California desert. Journal of Arid Environments 67: 391–402. 2. Estrada-Luna, A.A. and Rojas García, A. 2010. Improving Germination of the Mexican Fan Palm (Washingtonia robusta H. Wendland) seeds through physical and chemical treatments. 55th Annual Southern Nursery Association Research Conference. Research Conference Proceedings 2010, vol. 55, 2010. 314-318 pp. 3. Gilman, E.F and D.G. Watson. 1994. Washingtonia robusta Washington Palm. Fact Sheet ST-670, a series of the Environmental Horticulture Department, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, University of Florida. 1-4pp. 4. Ishihata K. And Murata H. Morphological Studies in the Genus Washingtonia: On the Intermediate Form between Washingtonia filifera (L. Linden) H. Wendland and Washingtonia robusta H. Wendland. Ibusuki Experimental Botanic Garden. 331- 354pp. 5. Jones, D.L. 1995. Palms Throughout The World. Reed Books. U.S.A. 6. SAS Institute Inc. 1996. The SAS System for Windows, release 6.12 SAS Institute Inc., Cary NC, USA.
Table 1. Effect of cell size on net photosynthesis (A), stomatal resistance (rs), and stomatal conductance (gs) on Mexican fan palm (Washingtonia robusta) seedlings 45 days after emergence. 2 -1 -1 2 -1 Cell Type A(µmol/m /sec ) rs(sec/cm ) gs(mol/m /sec ) A 9.769 a 4.810 a 0.317 a B 9.133 a 3.503 b 0.237 b Means with the same letter are not significantly different according to Fisher's LSD (∝ = 0.05). n = 10.
Table 2. Effect of cell size on seedling growth of Mexican fan palm (Washingtonia robusta) seedlings 45 days after emergence. Cell Plant Total Secondary Average Total Shoot Root Plant Root Shoot Type Height Root Roots Secondary Secondary Dry Dry Dry to to (cm) Length (no.) Root Root Length Weight Weight Weight Shoot Root (cm) Length (cm) (g) (g) (g) Ratio Ratio (cm) A 14.4 a 14.1 a 42 a 5.1 a 207 a 0.14 a 0.10 a 0.24 a 0.74 a 1.42 b B 16.1 a 11.9 a 32 b 4.0 b 128 b 0.16 a 0.06 b 0.22 a 0.35 b 3.06 a Means with the same letter are not significantly different according to Fisher's LSD (∝ = 0.01). n = 10.
Propagation 391
SNA Research Conference Vol. 56 2011
Table 3. Effect of cell size on net photosynthesis (A), stomatal resistance (rs), and stomatal conductance (gs) on Mexican fan palm (Washingtonia robusta) seedlings 90 days after emergence. 2 -1 -1 2 -1 Cell Type A (µmol/m /sec ) rs (sec/cm ) gs (mol/m /sec ) A 14.21a 1.19 b 0.84 a B 9.68 b 1.60 a 0.72 b Means with the same letter are not significantly different according to Fisher's LSD (∝ = 0.05). n = 10.
Table 4. Effect of cell size on seedling growth of Mexican fan palm (Washingtonia robusta) seedlings 90 days after emergence.
Cell Plant Total Secondary Secondary Total Shoot Root Dry Plant Root Shoot Type Height Root Roots Root Secondary Dry Weight Dry to to (cm) Length (no.) Length Root Weight (g) Weight Shoot Root (cm) (cm) Length (g) (g) Ratio Ratio (cm) A 27.9 b 13.7 a 62 b 5.5 a 348.2 b 0.84 b 0.43 b 1.26 b 0.52 a 1.97 b B 33.2 a 13.2 a 67 a 5.7 a 382.5 a 1.64 a 0.64 a 2.28 a 0.39 b 2.60 a Means with the same letter are not significantly different according to Fisher (LSD) test (∝ = 0.01). n = 10.
Table 5. Effect of cell size on net photosynthesis (A), stomatal resistance (rs), and stomatal conductance (gs) on Mexican fan palm (Washingtonia robusta) seedlings 135 days after emergence. 2 -1 -1 2 -1 Cell Type A (µmol/m /sec ) rs (sec/cm ) gs (mol/m /sec ) A 11.41 a 1.09 b 0.74 a B 9.68 a 1.86 a 0.68 a Means with the same letter are not significantly different according to Fisher's LSD (∝ = 0.05). n = 10.
Table 6. Effect of cell size on seedling growth of Mexican fan palm (Washingtonia robusta H. Wendland) seedlings 135 days after emergence. Cell Plant Total Secondary Secondary Total Shoot Root Plant Root Shoot Type Height Root Roots Root Secondary Dry Dry Dry to to (cm) Length (no.) Length Root Weight Weight Weight Shoot Root (cm) (cm) Length (g) (g) (g) Ratio Ratio (cm) A 30.9 b 14.2 a 70 b 5.5 a 378.2 b 0.96 b 0.48 b 1.45 b 0.50 a 2.00 b B 35.3 a 13.8 a 72 a 5.9 a 388.7 a 1.95 a 0.74 a 2.69 a 0.38 b 2.64 a Means with the same letter are not significantly different according to Fisher's LSD (∝ = 0.01). n = 10.
Propagation 392
SNA Research Conference Vol. 56 2011
Rooting of Two Woody Ornamental Plants in Eight Propagation Substrates
Celina Gómez and James Robbins University of Arkansas, Department of Horticulture, Fayetteville, AR 72701
Index words: Parboiled rice hulls, coconut coir, Lagerstroemia × ‘Natchez’, Forsythia × intermedia Zab.
Significance to the Industry: Parboiled rice hulls (PBH) and coconut coir (CC) were evaluated as substrate alternatives to peat moss (PM) and perlite (PER) in the rooting of semi-hardwood cuttings from two woody ornamentals. Based on rooting percentages and number of roots per cutting, PM was the leading substrate when used alone or when combined with PER. Coconut coir and PBH also appear to be good rooting substrates when combined with PER and PM, respectively.
Nature of work: While peat moss and perlite are considered staple substrates in cutting propagation, coconut coir and rice hulls have been evaluated as potential alternatives. Limited research has been conducted on the use of fresh (6), burnt (7,8), composted (1,2,3), and parboiled (4) rice hulls in propagation. The use of coconut coir as a rooting substrate has also shown to increase rooting of several woody ornamentals (5).
Cutting wood from terminal shoots of ‘Natchez’ crapemyrtle (Lagerstroemia ‘Natchez’) and border forsythia (Forsythia ×intermedia Zab.) was collected on 26 May 2009 and 5 May 2010 from stock plants grown in full sunlight. Cutting wood was wrapped in moist paper towels and held in a cooler until cuttings were prepared. On 27 May 2009 and 6 May 2010 cuttings were prepared by stripping basal leaves and trimming the cuttings to a finished length of 8-11 cm (4-5 nodes) and 8-10 cm (3-4 nodes), respectively, for forsythia and crapemyrtle. Prior to sticking the cuttings, the basal 3.5 cm of the cuttings was dipped in Schultz TakeRoot Rooting Hormone talc (Schultz Co., St. Louis, MO; 0.1% indole-3-butyric acid) and inserted into one of eight propagation substrates.
Substrates were horticultural coarse-grade perlite (PER; Scotts Miracle Grow, Marysville, OH), peat moss (PM; Majestic Earth, Agawam, MA), coconut coir (CC; AgroCoir, Agrococo, Laguna Niguel, CA; initial EC = 0.5 mmhos/cm) and parboiled rice hulls (PBH; Riceland Foods, Stuttgart, AR). Substrates were used individually or in combination (1:1 by volume) as listed in Table 1. Cuttings were stuck in 38-cell plastic trays (5.5 cm top ID and 3.8 cm bottom ID and 5.8 cm height) to a depth of 4 cm. Trays were placed under intermittent mist in a poly covered greenhouse with 50% black shade cloth. The greenhouse temperature was maintained between 70° F and 90° F. The mist cycle was controlled by an electronic leaf (Phytotronics, Inc., Earth City, MO) with an average cycle of 15 sec/6 min during 24 hours.
Propagation 393
SNA Research Conference Vol. 56 2011
Rooting results for crapemyrtle and forsythia were evaluated on 29 July 2009 and 13 July 2010 (62 days after sticking). Rooting substrate was carefully removed from the cuttings. Rooting performance was assessed by measuring the length of the longest root (RL) per cutting and the number of roots per cutting. Roots were excised from the cutting using a razor blade and weighed; root fresh weight (RFW) was also used to evaluate rooting performance. Moreover, cutting mortality was monitored during the rooting period. Substrate pH was determined in substrates used at planting and at harvest using the saturated paste method.
The treatment design for the rooting responses was an 8 × 2 × 2 factorial with eight substrates, two species, and two years. The experimental design was a completely randomized design with nine cutting replications per treatment combination (n = 9). Data were subjected to ANOVA and means were separated by Tukey’s HSD. All data were analyzed with JMP 8 (SAS Institute, Inc., Cary, NC).
Results and Discussion: During the first year of the experiment, substrate pH resulted in a general decrease during the rooting period (Table 1); the exceptions to this were PER and PER:PM in which substrate pH increased. Results for the second year were quite surprising in that, in general, pH increased during the rooting period.
For all substrates, mean number of roots per cutting were significantly greater with forsythia than crapemyrtle (Table 2). For forsythia, all PM-based substrates yielded a greater number of roots per cutting compared to substrates with only PER or PBH. Rooting substrate had no effect on the number of roots per cutting for crapemyrtle. Cuttings from PER:PM substrate yielded significantly longer roots (17.4 cm) than those grown in only PER, or in PBH- or CC-based substrates (≤ 13.8 cm).
For each substrate, results for RFW were the same for both years (Table 3). However, differences among substrates for each year suggested that in 2009 all PM-based substrates yielded a greater root mass than substrate with only PER. In 2010, substrate with PER:PM yielded significantly greater root mass (1293 g) compared to those grown in only PER, PBH- or CC- based substrates (≤ 638 g). Results from the species by substrate interaction also suggested that substrate with PER:PM yielded greater RFW than when PER was used alone, regardless of plant species. Other differences in RFW between species are most likely related to the previously mentioned smaller number of roots per cuttings in crapemyrtle compared to forsythia.
Based on the rooting percentage and the number of roots per cutting under these rooting conditions, PM continues to be a very good rooting substrate. This is somewhat surprising considering the low substrate pH (approximately 3.5). Based on these same criteria, PER:PM and CC:PER also appear to be good rooting substrates under these rooting conditions. Parboiled rice hulls appear to be a suitable rooting substrate when combined with peat moss.
Propagation 394
SNA Research Conference Vol. 56 2011
Literature Cited: 1. Agbo, C.U. and C.M. Omaliko. 2006. Initiation and growth of shoots of Gongronema latifolia Benth stem cuttings in different rooting media. Afr. J. Biotechnol. 5:425-428. 2. Baiyeri, K.P. and S.C. Aba. 2005. Response of Musa species to macro-propagation. I: Genetic and initiation media effects on number, quality and survival of plantlets at prenursery and early nursery stages. Afr. J. Biotechnol. 4:223-228. 3. Baiyeri, K.P. and B. N. Mbah. 2006. Effects of soilless and soil-based nursery media on seedling emergence, growth and response to water stress of African breadfruit (Treculia africana Decne). Afr. J. Biotechnol. 5:1405-1410. 4. Gómez, C. and J. Robbins. 2010. Rooting of three ornamental plants in eight propagation substrates. Comb. Proc. Intl. Plant Prop. Soc. 59:524-528. 5. Stoven, J. and H. Kooima. 1999. Coconut-coir based media versus peat-based media for propagation of woody ornamentals. Comb. Proc. Intl. Plant Prop. Soc. 49:373-374. 6. Tsakaldimi, M. 2005. Kenaf (Hibiscus cannabinus L.) core and rice hulls as components of container media for growing Pinus halepensis M. seedlings. Bioresource Technol. 97:1631-1639. 7. Yahya, A., S.S. Anieza, R.B. Mohamad and S. Ahmad. 2009. Chemical and physical characteristics of cocopeat-based media and their effects on the growth and development of Celosia cristata. Am. J. Agric. Biol. Sci. 4:63-71. 8. Yahya, A., S.S. Anieza, R.B. Mohamad and S. Ahmad. 2010. Growth dynamics of Celosia cristata grown in cocopeat, burnt rice hull and kenaf core fiber mixtures. Am. J. Agric. Biol. Sci. 5:70-76.
Table 1. Initial and final pH substrates evaluated on the rooting of forsythia and crapemyrtle cuttings.z 2009 2010 y Substrate Final Final Initial Initial Crapemyrtle Forsythia Crapemyrtle Forsythia PER 6.1 7.1 7.1 5.4 5.4 5.1 PER:PM 3.5 3.7 3.8 3.5 5.0 4.9 PM 3.6 3.4 3.3 3.5 4.5 4.5 PM:PBH 4.4 4.1 4.1 4.1 4.7 4.5 PBH 6.2 6.0 6.1 6.3 5.8 5.8 PBH:CC 6.1 5.3 5.6 5.9 6.0 6.1 CC 6.1 5.7 5.6 5.6 5.6 6.0 CC:PER 5.6 5.3 5.6 5.6 6.1 5.9 zSubstrate pH was measured using saturated paste method. ySubstrates were used individually or in combination (1:1 by volume). PER = Perlite; PM = Peatmoss; PBH = Parboiled rice hulls; CC = Coconut Coir.
Propagation 395
SNA Research Conference Vol. 56 2011
Table 2. Effect of rooting substrate on mean number of roots per cutting for forsythia and crapemyrtle averaged over two years (2009 and 2010). Mean no. of roots Substratez Forsythia Crapemyrtle PER 8 cdy 4 e PER:PM 13 a 5 de PM 14 a 5 de PM:PBH 11 ab 5 de PBH 8 cd 4 e PBH:CC 9 bc 4 e CC 10 bc 4 de CC:PER 11 abc 4 de zSubstrates were used individually or in combination (1:1 by volume). PER = Perlite; PM = Peatmoss; PBH = Parboiled rice hulls; CC = Coconut Coir. ySimilar letters were not significantly different at P = 0.05 using Tukey's HSD test.
Table 3. Effect of rooting substrate on root fresh weight for forsythia and crapemyrtle. Root fresh weight (g) Substratez Yeary Speciesy 2009 2010 Crapemyrtle Forsythia PER 449 dy 446 d 451 d 464 d PER:PM 993 ab 1293 a 915 bc 1371 a PM 996 ab 876 abcd 833 bcd 1038 ab PM:PBH 948 abc 486 cd 510 cd 924 bc PBH 687 bcd 585 bcd 562 bcd 710 bcd PBH:CC 680 bcd 517 cd 453 cd 744 bcd CC 593 bcd 505 cd 382 d 715 bcd PER:CC 858 bcd 638 bcd 448 d 1048 ab zSubstrates were used individually or in combination (1:1 by volume). PER = Perlite; PM = Peatmoss; PBH = Parboiled rice hulls; CC = Coconut Coir. ySimilar letters were not significantly different at P = 0.05 using Tukey's HSD test.
Propagation 396
SNA Research Conference Vol. 56 2011
Direct Seed Germination Methods for Assessing Phytotoxicity of Alternative Substrates
Anthony L. Witcher1, Eugene K. Blythe2, Glenn B. Fain3, Kenneth J. Curry4, and James M. Spiers1
1USDA-ARS Southern Horticultural Laboratory, Poplarville, MS 39470 2Coastal Research and Extension Center, Mississippi State University, South Mississippi Branch Experiment Station, Poplarville, MS 39470 3Auburn University, Department of Horticulture, Auburn, AL 36849 4University of Southern Mississippi, Department of Biological Sciences, Hattiesburg, MS 39406
Index Words: propagation media, Pinus taeda, whole pine tree
Significance to Industry: Whole pine tree (WPT) substrates can be used for horticulture crop propagation and production, although optimum plant growth may require using increased fertilizer rates and/or storing substrates for a period of time before use. Phytotoxicity associated with chemical compounds in pine trees could also affect plant development. This study demonstrated fresh pine needles negatively affected seed germination and initial root growth of sensitive plant species. Detrimental effects were less pronounced between aged and fresh WPT. The methods used in this study could be valuable for quickly assessing potential phytotoxicity of alternative substrates.
Nature of Work: Horticulture crop producers have increasing access to materials not traditionally used as container substrates. Composted materials are used to improve substrate chemical properties and are a source of essential plant nutrients, while wood- based materials can provide improved substrate physical properties and be consistently processed from various tree species (2, 8, 10). Reduced plant growth in wood-based substrates, compared with traditional substrates, has been overcome with increased fertilizer rates (5). Greater plant growth has been reported in aged WPT compared with fresh WPT (4), while less total root length has been reported for stem cuttings rooted in WPT compared with PB (9). A variety of factors have been attributed to reduced plant growth in WPT substrates including nitrogen immobilization, particle size distribution, and reduced cation exchange capacity (3, 11). Phytotoxicity, associated with certain organic compounds found in pine trees, could be another factor contributing to differences in plant development among WPT and traditional substrates (7).
Seed germination and seedling growth tests are used extensively to assess potential phytotoxicity. Such biological tests are less expensive and more practical than chemical analyses and have been adapted for various applications including determining compost maturity and identifying allelochemical activity and possible soil contamination
Propagation 397
SNA Research Conference Vol. 56 2011
(1, 6). Ideally, a biological test would involve direct contact between the seed and the substrate or substrate solution, similar to the interaction that would occur in a production environment. The objective of our research was to evaluate methods for identifying potential phytotoxicity in WPT.
Two experiments were performed at the Thad Cochran Southern Horticultural Laboratory in Poplarville, MS. In Experiment 1, a Phytotoxkit™ was used to evaluate seed germination and initial root growth of three test plant species [one monocot: sorghum (Sorghum saccharatum) and two dicots: cress (Lepidium sativum) and mustard (Sinapis alba)] in five treatment substrates and a reference soil (RS). The Phytotoxkit™ is a rapid, reproducible test designed for direct contact of seed with substrate solution, yet allows for direct observation and root measurement of germinated seeds. Treatment substrates included aged (WPTA) and fresh (WPTF) whole pine tree, aged (PNA) and fresh (PNF) pine needles, and saline pine bark (SPB).
Whole pine tree substrates were produced from 8- to 10-inch loblolly pine (Pinus taeda) trees harvested and chipped on Sept. 29, 2009 (WPTA) and May 26, 2010 (WPTF) in Macon County, AL, then ground with a Williams Crusher hammer mill (Meteor Mill #40, Williams Patent Crusher and Pulverizer Co., Inc St. Louis, MO) to pass a 3/8-inch screen. Pine needles were collected from a 12-year-old loblolly pine plantation in Stone County, MS, either directly from trees (PNF) or from the ground (PNA) surrounding the same trees. Pine needles were hammer-milled (model 30; C.S. Bell Co., Tiffin, OH) to pass a 3/16-inch (PNA) or 1/4-inch (PNF) screen. Saline pine bark, pine bark soaked in a sodium chloride (NaCl) solution (30 mS/cm for mustard or 16 mS/cm for cress and sorghum), was included to produce a negative effect on seed germination and initial root growth.
Substrates were passed through a 2-mm sieve to eliminate coarse particles. Three 95- ml samples (loosely filled) were collected in a coffee-filter-lined container (T.O. Plastics SVD-250) for each substrate, bottom-saturated to the upper substrate surface with deionized water (NaCl solution used for SPB) for 1 hour, drained and transferred to individual test plates, and covered with filter paper onto which 10 seeds of a test species were placed in a single row. A clear plastic cover was placed on each test plate, then test plates were incubated vertically in a dark growth chamber at 77°F for 4 (cress) or 5 (mustard and sorghum) days. Data collected included germination percentage and root length (mm), and percent inhibition of germination and root growth was calculated for each substrate compared with RS [percent inhibition = (A – B / A)*100; A = mean germination or root length in RS; B = mean germination or root length in test substrate].
In Experiment 2, a traditional seedling growth test was used to evaluate seedling root growth of two test plant species [lettuce (Lactuca sativa) and tomato (Solanum lycopersicon)] in four substrates. Substrates included WPTA, WPTF, a peat-lite (PL) substrate (3:1:1 peatmoss:perlite:vermiculite), and pine bark (PB). Individual cells (cut from 72-cell propagation trays) were filled with substrate (36 replications), completely
Propagation 398
SNA Research Conference Vol. 56 2011 randomized into 72-cell propagation trays (36 cells per tray), and saturated. Two seeds of a single test species were sown on the substrate surface. Trays were grouped by species and placed in separate growth chambers at 77°F with no light until germination occurred, thereafter receiving a 14-hour light and 10-hour dark photoperiod. Seedlings were thinned to 1 per cell at 8 days after sowing. At 35 (tomato) and 39 (lettuce) days after sowing, roots were washed and digitally scanned for analysis using WinRhizo software to obtain total root length. Root length data were analyzed with analysis of variance using the GLIMMIX procedure of SAS (SAS Version 9.1.3; SAS Institute, Inc., Cary, NC). Differences between treatment means were determined using the simulation step-down method.
Results and Discussion: In Experiment 1, cress and sorghum germination percentage was lowest in PNF, while mustard had 100% germination in all substrates except SPB (43%) (Table 1). Compared with RS, PNF inhibited germination by 90% in cress and 18% in sorghum, while PNA inhibited germination by 3.5% for both species. The greatest root length for cress and sorghum occurred in WPTA, yet root length was greatest in WPTF for mustard. Compared with RS in cress, PNF and PNA attained 97% and 10% inhibition of root growth, respectively. Sorghum root growth inhibition was 48% (PNF) and 39% (PNA) compared with RS. Percent root growth inhibition was actually negative in WPTA for cress and sorghum, although it was negative in WPTF for mustard. Initial substrate pH ranged from 4.8 (PNA) to 5.7 (WPTF).
In Experiment 2, total root length was greatest in PL and least in WPTA for tomato and lettuce (Table 2). Tomato total root length was 12% greater in WPTF and PB compared with WPTA. Lettuce total root length was 16% and 8% greater in WPTF and PB, respectively, compared with WPTA. Tomato total root length was 2.5 times greater in PL compared with WPTA, and 4.5 times greater in PL compared with WPTA for lettuce. Initial substrate pH ranged from 4.6 (PL) to 6.1 (WPTA).
The Phytotoxkit™ provided the most sensitive test for phytotoxicity, although the seedling growth test could be used for a more practical assessment of potential phytotoxicity for alternative substrates under typical production practices. In both tests, root growth was a more sensitive indicator of phytotoxicity compared with germination. Obviously, one or more chemical compounds present in pine needles can be phytotoxic to certain plant species during the early stages of root development following germination. Future research will include a more complete chemical analysis of substrate treatments to identify potential phytotoxic compounds, and methods for overcoming such issues will be evaluated.
Literature Cited: 1. Emino, E.R. and P.R. Warman. 2004. Biological assay for compost quality. Compost Sci. and Utilization 12:342-348. 2. Fain, G.B., C.H. Gilliam, J.L. Sibley, and C.R. Boyer. 2008. WholeTree substrates derived from three species of pine in production of annual vinca. HortTechnology 18:13-17.
Propagation 399
SNA Research Conference Vol. 56 2011
3. Fain, G.B., C.H. Gilliam, J.F. Sibley, C.R. Boyer and A.L. Witcher. 2008. WholeTree substrate and fertilizer rate in production of greenhouse-grown petunia (Petunia hybrida Vilm.) and marigold (Tagetes patula L.). HortScience 43:700-705. 4. Gaches, W.G.. 2010. Evaluation of WholeTree as an alternative substrate component in production of greenhouse-grown annuals. Auburn University, Auburn, AL. MS Thesis. 1 Nov. 2010
Propagation 400
SNA Research Conference Vol. 56 2011
Table 1. Mean seed germination percentage and root length of three plant species as indicators of potential phytotoxicity. Percent inhibition of seed germination and root growth in test substrate were compared with a reference soil supplied with the test kit. Inhibitionz Germination Root Length Germination Root Species Substrate (%) (mm) (%) Growth (%) Saline Pine Barky 20 1.9w b 79.3 85.0 Fresh Pine 10 2.1 b 89.7 97.1 Needles Aged Pine Cress 93 39.2 a 3.5 10.2 Needles Fresh WPTx 90 46.5 a 6.9 4.0 Aged WPT 97 51.0 a 0.0 -30.6 Reference Soil 97 42.9 a - - Saline Pine Bark 43 1.4 c 56.7 98.0 Fresh Pine 100 42.0 ab 0.0 22.7 Needles Aged Pine Mustard 100 29.4 b 0.0 44.9 Needles Fresh WPT 100 61.0 a 0.0 -18.1 Aged WPT 100 36.3 ab 0.0 21.0 Reference Soil 100 50.5 ab - - Saline Pine Bark 83 45.1 c 10.7 45.8 Fresh Pine 77 33.4 c 17.8 48.4 Needles Aged Pine Sorghum 90 51.2 bc 3.5 38.9 Needles Fresh WPT 83 55.5 abc 10.7 41.3 Aged WPT 93 92.2 a 0.0 -3.2 Reference Soil 93 88.8 ab - - zPercent inhibition = (A – B / A)*100; A = mean germination or root length in reference soil; B = mean germination or root length in test substrate. yPine bark soaked in a saline solution. xProcessed whole pine tree. wMeans followed by different letters within columns indicate significant difference at P < 0.05 using the simulation step-down method.
Propagation 401
SNA Research Conference Vol. 56 2011
Table 2. Mean total root length of lettuce and tomato seedlings. Total Root Length
(cm) Substrate Lettuce Tomato Peat-litez 223.7y a 178.7 a Pine bark 43.3 b 82.2 b Fresh 46.8 b 85.1 b WPTx Aged WPT 42.5 b 80.7 b zPeat-lite = 3:1:1 peatmoss:perlite:vermiculite yMeans followed by different letters within columns indicate significant difference at P <0.05 using the simulation step-down method. xProcessed whole pine tree
Propagation 402
SNA Research Conference Vol. 56 2011
Engineering, Structures and Innovations
Gary Bachman Section Editor and Moderator
Engineering, Structures and Innovations 403
SNA Research Conference Vol. 56 2011
Biomass Productivity Potential by Selected Cellulosic Herbaceous Perennials in Acid Impacted Soil
E. Kudjo Dzantor1, Vallaban Murugesan2, Roger Painter2 and Dafeng Hui3
1Department of Agricultural Science, 2Department of Environmental Engineering and 3Department of Biological Sciences, Tennessee State University, 3500 John A. Merritt Blvd; Nashville TN 37209
Index Words: Bioenergy, cellulosic herbaceous perennial, soil acidity, marginal lands switchgrass, eastern gamagrass, big bluestem
Significance to Industry Global climate change, energy supply and security, concerns over land, air and water degradation have converged to intensify debate on renewable energy. Central to this debate is bioenergy, renewable energy derived from biological sources, including biomass from plant material, which can be converted to heat, electricity, or vehicle fuel. The focus and national support for the development of bioenergy alternatives to fossil fuels offer the agricultural sector of the nation a crucial role in the establishment and growth of the bioenergy and biobased product industries. The nursery industry has long addressed issues of energy and environmental sustainability, including reduced consumption of non-renewable energy resources, and conversion of biomass wastes to materials for the production of floral and nursery crops (http://aggiehorticulture.tamu.edu/GREENHOUSE/nursery/environ/2000.html). More recently, undoubtedly due in part to the enthusiasm surrounding bioenergy, UDSA investigators have reported that switchgrass, the model bioenergy crop, may be a viable nursery container substrate (1). This finding offers the nursery industry a welcome solution for a looming shortage of pine-bark based container media in certain parts of the country. Additionally, the industry has began direct involvement in issues pertaining to dedicated biomass crop production, including assessment of agronomic suitability of alternative feedstocks (2), their breeding, propagation and evaluation (3) as well as forecasting the effects of insects and other pests on perennial biomass crops (4).
We recently began explorations issues of large-scale, sustainable production of bioenergy feedstock. This report describes the initial stages of these explorations that started with determining boundary productivity potentials of selected native grasses in acid impacted soil.
Nature of Work Background. Bioenergy is one solution to the global problem of energy security and environmental degradation. However, it can be limited by availability of suitable land that does not compete with growing food, feed and fiber. Currently, grain- based crops, notably corn, account for over 90% of ethanol production in the U.S. However, high input requirements of corn production on the one hand, and on the other, the requirement of production on prime land has caused attention to be focused on cellulosic materials such as herbaceous perennials as well woody species for bioenergy
Engineering, Structures and Innovations 404
SNA Research Conference Vol. 56 2011
production. The most well-known cellulosic herbaceous perennial (CHP) is switchgrass, which was selected by the US Department of Energy (DOE) as the model bioenergy crop because of desirable qualities including potential high biomass productivity, nutrient use efficiency, environmental enhancement, wide geographic distribution and ability grow well on marginal lands (5) . It is the goal of DOE to replace 30% current US petroleum consumption with bioethanol by 2030 using CHPs. Achieving this goal will require production of billions of tons of biomass annually (6). Not only will this necessitate enhancement of productivity of switchgrass, but also it will be necessary expand the collection of potential feedstocks as well as their cultivation on marginal or less than prime lands.
One limitation to crop productivity worldwide is soil acidity. It is estimated that up to 30- 40% of the world’s arable land has been rendered unproductive by soil acidification and this trend increasing (7). Soil acidification generally results from a sequence of events some of which can be naturally occurring but can be exacerbated by human activities including agriculture. Acid soils generally result from parent materials that are naturally low in base forming cations (Ca2+, Mg2+, K+ and Na+) to begin with, or because these elements have been leached from soil, replaced (exchanged) by Al3+ and H+. When pH is low enough, dissolution of Al- and then Fe-containing minerals occurs, releasing toxic metals. A major appeal of CHPs as bioenergy feedstock stems from the fact that they can be produced on marginal land, thereby saving prime cropland food and feed. In this study, we report pot experiments that were conducted in the summer 2010 to determine boundary productivity measures of biomass yield and photosynthesis rate of selected CHPs growing on acid impacted soil.
Approaches. The soil investigated was Amour silt loam collected from the Tennessee State University Agricultural Research Farm in Nashville, TN. The cellulosic herbaceous perennials evaluated were switchgrass (Panicm virgatum), eastern gamagrass (Tripsacum dactyloides) and big bluestem (Andropogon gerardii).
Biomass productivity of the grasses was assessed at three soil pH levels, namely 6.6, 5.0 and 4.5. The soil pHs were adjusted to the desired levels following modifications of protocols described by Islam et al., 2004. Briefly, increments of AlK2(SO4)3.18H2O or CaCO3 were added to soil and dose-response curves were generated that enabled estimation of amounts of the chemicals required to bring a known amount of soil to pHCa levels evaluated (1:5, w:v, soil:10mM CaCl2). For acidification, 0, 15, 30, 60, 120mg [AlK2(SO4)3.18H2O] were weighed into 125 ml plastic bottles, each containing 10g of air dried soil. Fifty milliliters (50) of 10 mM CaCl2 were added and bottles were agitated on a rotary shaker at 200 rpm for 24 h. For raising pH, similar increments of CaCO3 were added to 10g air dry soil in each bottle and shaken on rotary shake for 24h Plots of pH and AlK2(SO4)3.18H2O or CaCO3 that were used to determine exact amounts of chemicals used to bring soil pH levels to desired levels (Figure 1a, 1b).
Seeds of each plant were initially sown in germination trays filled with potting mix (Fafard® #2 mix). Seedlings of the grasses were transplanted into 5 inch pots
Engineering, Structures and Innovations 405
SNA Research Conference Vol. 56 2011
containing test soil to give four plants per 5 pot (because of low germination efficiencies of seedlings of eastern gamagrass (GG) were transplanted three days later than those of switchgrass (SG) and big bluestem (BB). Each treatment was replicated four times. The plants were watered as needed and the pot locations were randomly rotated at least every 2-3 days to minimize random error. After two months in pots, the grasses were harvested by cutting their tops to heights of 15 cm. Leaves from each treatment were bagged separately and dried at 70oC over five days and weighed. Biomass data were analyzed by ANOVA.
Light-saturated photosynthetic rates (Amax) of leaves of the grasses under three pH treatments were measured on September 16, 2010 and September 30, 2010. The measurements were made using a Li-6400 Portable Photosynthesis System (Li-Cor, Lincoln, NB) with a 2 x 3-cm cuvette with a LED light source (Li-6400 02B). A single leaf on each of the two plants in the pot was measured. The leaf was marked and the area was measured for each leaf and used for leaf photosynthesis correction. Full spread young leaves were selected. The measurements were made with CO2 in the reference chamber set to 390 ppm and the light was set to 1500 µmol m-2s-1. Temperature in the greenhouse was controlled using air conditioners and we set the leaf temperature at the ambient air temperature (32oC). Leaf photosynthesis data were analyzed using a two- factor random design ANOVA considering both grass species and pH treatment with 4 replications.
Results and Discussion Results showed that SG produced significantly higher amounts of biomass than GG or BB. Furthermore, soil acidity had no apparent on biomass productivity between pH 6.5 to 4.5. Average biomass production was 3.9, 4.2 and 3.8 grams per pot for plants cut to 15cm height. Biomass productivity by GG at pH 6.5 and 5.0 did not differ significantly from the productivity by BB at the corresponding levels of pH (Table 1). In contrast to what was observed with SG, soil acidity significantly caused decreases in biomass productivity of GG and BB. Average biomass production of GG was 2.5 and 2.8 grams per pot at pH 6.5 and 5.0 respectively this decreased to 0.7 grams at pH 4.5. Similarly, average biomass production of BB was 2.0 and 2.1 at pH 6.5 and 5.0 respectively to 1.0 gram per pot (Table 1).
Cellulosic crops are expected to become more important than corn for bioethanol production with progressive advances in conversion technologies. Although the DOE selected SG as the model herbaceous perennial for production of bioenergy other crops are needed to add to the collection of plants that can be used for bioenergy production. The appeal of biomass crops is their environmental protection and enhancement qualities. We previously investigated the same native CHPs for abilities to remediate environmental contamination, through phytoremediation (9, 10). Accordingly, our current focus represents efforts at coupling environmental remediation to biomass (and bioenergy) production with emphasis on enhancing biomass production on degraded lands.
Modern crop technologies are increasingly providing insights about how crops may be endowed with enhanced traits including biomass productivity and tolerance to stresses
Engineering, Structures and Innovations 406
SNA Research Conference Vol. 56 2011
that limit the attribute thereof. While these technologies are still in their infancy, we have begun to explore feasibility enhancing biomass productivity the crops tested using traditional approaches. One such approach capitalizes on the symbioses between grasses and mycorrhizae. Arbuscular mycorrhizal fungi are ubiquitous soil inhabitants that form close associations plant roots where they confer on the plant numerous benefits including improved tolerance to soil acid and heavy metals toxicity (11) Experiments are underway evaluate strains of mycorrhizae to be used to counteract. The boundary biomass productivity measures from this study provide us a starting point.
Results of photosynthesis measurements between September 16 and September 30 are shown in Table 2. We found significant differences among the grass species, but no differences were found among the pH treatment and the species and pH interactions. Bluestem and gamagrass had higher photosynthetic rates than switchgrass (Table 2). During the period, photosynthetic rate of switchgrass increased while these of bluestem and gamagrass decreased. The short duration of our measurements do not allow us to draw definitive conclusions about the relative efficiencies of the grasses to capture and convert light energy. Experiments are ongoing to monitor photosynthesis for an extended duration and develop photosynthetic responses to temperatures and CO2 concentrations. One consequence of the global climate change is potentials of elevated atmospheric CO2 and consequently impacts on biomass productivity. It is important to understand how this CHPs will respond to elevated atmospheric CO2.
Literature Cited
1. Atland J.E. and C. Krause. 2009. Use of switchgrass as container substrate. HortScience 44: 1861-1865 2. Christensen, C. 2010. Development of dedicated energy crops to supply the biofuel and biopower industries Ceres, Inc. 8th Annual Bioenergy Feedstock Symposium; Univresity of Illinois Urbana-Champaign; January 11-12, 2010. 3. Tiessen D. 2010. The Commerical oppurtunity of biofuels: fuelling Ontario's greenhouse industry with biomass. Pyramid Farms, Leamington, Ontario. 8th Annual Bioenergy Feedstock Symposium; Univresity of Illinois Urbana-Champaign; January 11-12, 2010.4. Prasifka J. 2010. Forecasting the effects of insects and other pests on perennial biomass crops. Energy Biosciences Institute; 8th Annual Bioenergy Feedstock Symposium; Univresity of Illinois Urbana-Champaign; January 11-12, 2010. 5. McLaughlin, S., J. Bouton, D. Bransby, B. Conger, W. Ocumpaugh, D. Parrish C. Taliaferro, K. Vogel and S. Wullschleger. 1999. Developing switchgrass as a Bioenergy crop. In J. Janick (ed) Perspectives of New Crops and Uses. ASHS Press, Alexandria VA. pp 282-299. 6. Perlack, R.D., L. L. Wright, R.F. Turhollow, R.L. Graham, B.J. Stokes and D,D. Erbach. 2005. Biomass as feedstock for a bioenergy and bioproducts industry: The technical feasibility of a billion-ton annual supply DOE/GO-102005-2135 ORNL/TM- 2005/66, http://www1.eere.energy.gov/biomass/pdfs/final_billionton_vision_report2.pdf 7. von Uexkull, H. R. and E. Mutert. 1995. Global extent, development and economic impact of acid soils. Plant and Soil 171: 1-15.
Engineering, Structures and Innovations 407
SNA Research Conference Vol. 56 2011
8. Islam, M. A., P. J. Milham, P. M. Dowling, B. C. Jacobs, and D. L. Garden. 2004. Improved Procedures for Adjusting Soil pH for Pot Experiments. Communications in Soil Science and Plant Analysis. 35: 25-37 9. Dzantor, E. K., T. Chekol, and L. R. Vough. 2000. Feasibility of using forage grasses and legumes for phytoremediation of organic pollutants. J. Environ. Sci. Health Part A 35:1645-1661. 10. Dzantor E.K., D.E. Long and T.K. Amenyenu. 2006. Use of plant systems for mitigating environmental impacts of pesticides. Pp580-583 In M. Taylor (ed.), Proceedings of the Southern Nurserymen Association Annual Conference. August 9, 2005. 11.Thangaswamy, S., S. Padmanabhan, J.J. Yu and K. Hoon. 2005. Occurrence and quantification of versicular arbuscular mycorrhizal (VAM) fungi in industrial polluted soils. J. Microbiol. Biotechnol. 15:147-154.
Table 1a. Biomass yield and plant of switchgrass eastern gamagrass and big bluestem Cellulosic Biomass Yield (g) at Indicated pH Herbaceous 6.5 5.0 4.5 Perennial
Switchgrass 3.9a 4.2a 3.8a
Eastern Gamagrass 2.5b 2.8b 0.7b
Big Bluestem 2.0b 2.1b 1.0b Mean values
Table 1b. Light-saturated photosynthetic rate of leaves of three grass species. Species 9/16/2010 9/30/2010
Switchgrass 9.97b 16.02b
Eastern gamagrass 24.47a 19.71a
Big bluestem 25.29a 20.73a Mean values with same letters are not significantly different.
Engineering, Structures and Innovations 408
SNA Research Conference Vol. 56 2011
Figure 1. Mean carbohydrate utilization pattern of microbial populations in Armour rhizosphere soil after 10 weeks of planting.
Figure 2. Mean carboxylic acid utilization pattern of microbial populations in Amour rhizosphere soil after 10 weeks of planting.
Engineering, Structures and Innovations 409
SNA Research Conference Vol. 56 2011
Figure 3. Mean amino acid utilization pattern of microbial populations in Amour rhizosphere soil after 10 weeks of planting.
Engineering, Structures and Innovations 410
SNA Research Conference Vol. 56 2011
Design and Construction of a Machine for Grafting Prickly-pear Cactus (Opuntia spp., Cactaceae) Cladodes
Andrés Adolfo Estrada-Luna1; Francisco Javier Martínez Serrano2; Sergio Ortiz Mendoza2; Manuel Domingo Vargas Aguayo2, Carlos Patricio Achurra Sánchez2
1 Escuela de Agronomía, 2 Escuela de Ingenierías. Universidad De La Salle Bajío. Av. Universidad 602, Col. Lomas del Campestre. León, Gto., México. C.P. 37150.
Index Words: cacti, seed germination, prototype, asexual propagation, Cactaceae, graft, grafting machine.
Significance to Industry: Cactus pear or Prickly pear cactus (Opuntia spp.) is the most important species in the Cactaceae. It is a multi-purpose plant widely disseminated in America and many countries through the world (1), which is primarily cultivated for its fruit production; however, young cladodes are also used as vegetables or consumed as relish or for animal feed (2,3). Other valuable byproducts obtained include candies, wine, and the red dye acetocarmine obtained by the cultivation of dacti (Dactilopius coccus Costa) (4). Traditional propagation systems of this plant rely on several asexual techniques including rooting of single or multiple cladodes (5), rooting small portions of mature cladodes derived from the dissection of tissues comprising two or more areoles, or by using fruits as propagules (6). Other available asexual methods include apomixis, micrografting, and tissue culture (7,8,9). Commercial propagation of prickly-pear cactus through grafting has not been implemented. This method of propagation may be used to rejuvenate old plantations, produce high quality plants, to establish ornamental combinations with increased commercial value or to enhance productivity, extent the ecological limits of selected genotypes or to program fruit harvest. Because of this, our objectives were to design and build a machine capable of making accurate tissue cuts to establish inverted wedge grafts. Through the mechanization of this process the mexican growers, propagators, and the whole nursery industry will benefit, since selected genotypes might be conserved and more uniform and healthy material would be propagated for commercial exploitations.
Nature of Work: The project was divided in two stages: 1) designing and construction, and 2) evaluation and modification of the machine. For the designing and construction stage, we establish several important considerations regarding the functions of the machine including the type of cut to be performed (inverted wedge), the construction materials to obtain a strong but light machine, and the force needed to operate it. Because of this, we initially obtained data to determine the force needed to cut the prickly pear cladodes and to determine whether the machine could be manually operated. A texture analyzer (TAXTT2i, brand Stable Microsystems) was used to get the information. At the same time, we characterize the morphology of mature cladodes
Engineering, Structures and Innovations 411
SNA Research Conference Vol. 56 2011
(one-year old) to be used in the grafts (stocks and scions) from different cultivars and species in order to establish the dimensions and some others parameters to build the prototype. To sketch the prototype, our research team discussed all details before making the layouts and manufacturing the pieces to build the prototype. To evaluate the assembled machine, we confirmed the functioning of each part and elements through computer simulation or performing real cuts. Then, homo, auto, and heterografts have been performed to establish particular details regarding the wounding process and the cladode handling to optimize the process.
Results and Discussion: Data obtained from the morphological characterization showed that cladodes dimensions largely vary and range from 4 to 35 cm in diameter and from 5 to 42 cm for the different Opuntia spp. evaluated. The cladode thickness, which is an important trait to be considered to establish accurate and intimate union areas, also varied from 0.7 to 3.42 cm and from 0.5 to 2.89 cm at the central and edge areas, respectively (Table 1). Data obtained from the texture analyzer help us to design the knives for dissecting the cladodes and to determine that the cuts could be manually performed (Table 2). We end with an assembled prototype that includes a structure to support the whole device and three mechanisms for cutting (knives) and transmit movement to knives, immobilize the cladodes and to raise and control the position (angle) of the cladode to be dissected. (Figure 1: a, b). We can conclude that the machine built is a light and easy to handle tool, which meet all the requirements established to perform accurate and fine cuts that facilitate an intimate contact between stock and scion tissues.
Acknowledgements: Authors want to thank for the economical support provided by the Universidad De La Salle Bajío through the Office of the Research Council and the Council of Science and Technology of the State of Guanajuato (CONCYTEG) (Agreement No. 09-15-K662-070).
Literature Cited: 1. Pimienta B., E., 1994. Perspectiva general de la producción de tuna en el mundo, p. 25-39. In: Esparza F., G. and Méndez G., S.J. (eds.) Memorias sobre Aportaciones Técnias y Experiencias de la Producción de Tuna en Zacatecas. CECCAM, Morelos, Zacatecas. 2. Barbera, G. 1995. History, economic and agro-ecological importance. In: Agro- ecology, cultivation and uses of cactus pear. Barbera, G., Iglese, P., and Pimienta- Barrios, E. (eds.). FAO, Rome, Italy, 1-8. 3. Sáenz-Hernández, C. 1995. Food manufacture and by-product. In: Agro-ecology, cultivation and uses of cactus pear. Barbera, G., Iglese, P., and Pimienta-Barrios, E. (eds.). FAO, Rome, Italy, 137-143. 4. Flores-Flores, V. 1995. Dacti (Dactilopius coccus Costa) dye production. In: Agro- ecology, cultivation and uses of cactus pear. Barbera, G., Iglese, P., and Pimienta- Barrios, E. (eds.). FAO, Rome, Italy, 167-185.
Engineering, Structures and Innovations 412
SNA Research Conference Vol. 56 2011
5. Lazcano, C.A., Davies, F.T. Jr., Estrada-Luna, A.A., Duray, S. and Olalde-Portugal, V. 1999. Effect of auxin and wounding on adventitious root formation of prickly-pear cactus cladedes. HortTechnology, 9: 99-102. 6. Maldonado, L.J. Zapien, M.B., 1977. El nopal en México. Ed. Campo Experimental Forestal de Zonas Aridas ´La Sauceda´, Coahuila, Mexico. 7. Escobar A., H.A. Villalobos A.V.M., Villegas M.A., 1986. Opuntia micropropagation by axillary proliferation. Plant Cell, Tissue and Organ Culture 7, 269-277. 8. Estrada-Luna, A.A. López-Peralta C. Cárdenas-Soriano, E., 2002. In vitro micrografting and histology of the graft union formation of selected species of prickly pear cactus (Opuntia spp). Scientia Horticulturae 92, 317-327. 9. García-Aguilar, M. Pimienta-Barrios, E., 1996. Cytological evidences of agamospermy in Opuntia (Cactaceae). Haseltonia (Iowa) 4: 39-42.
Table 1. Data of the morphological characteristics obtained from one-year old cladodes of prickly-pear cactus (Opuntia spp.). Central zone Edge zone Cladode Cladode Scientific name thickness thickness diameter lenght (Cultivar name) (cm) (cm) (cm) (cm) O. ficus-indica 2.46 1.84 40 48 (pelón forrajero) O. ficus-indica 3.49 2.78 22 34 (pelón tunero) O. spp 2.15 1.70 17 28 (espinoso) O. mycrodasis 0.70 0.50 4 5 (cegador) O. robusta 3.42 2.89 32 39 (tapón) O. streptacantha 2.88 2.54 28 35 (cardón) O. amyclaea 3.20 2.80 34 43 (fafayuco)
Engineering, Structures and Innovations 413
SNA Research Conference Vol. 56 2011
Table 2. Data of the force required to cut one-year old prickly-pear (Opuntia spp.) cladodes.
Scientific name Force at central area Force at edge area (Cultivar name) (Newtons) (Newtons) O. ficus-indica 756.76 782.23 (nopal pelón forrajero) O. ficus-indica 1,245.12 720.75 (nopal pelón tunero) O. spp 1,213.35 932.02 (nopal espinoso)
A B
C
Figure 1. Details of the pricly-pear cactus grafting machine. A. Knives performing cuts to produce inverted wedge grafts, B. Overview of cuts produced to cladodes. C. Homografts cultivated on glasshouse.
Engineering, Structures and Innovations 414
SNA Research Conference Vol. 56 2011
Elucidating Rhizodegradation for Use in Phytoremediation of Synthetic Pyrethroids
Le, X., D1. Hui2, and E.K. Dzantor1 Department of Agricultural Science1 and Department of Biological Sciences2
Tennessee State University, 3500 John A. Merritt Blvd; Nashville TN 37209
Index Words: Pyrethroids, bifenthrin, phytoremediation, rhizodegradation, microbial communities, carbon utilization profiles.
Significance to Industry: Two important insect pests of the nursery industry in Tennessee and other parts of the nation are the Japanese beetle and imported fire ants. Both the US Domestic Japanese Beetle Harmonization Plan and the Federal Imported Fire Ant Quarantine Program require quarantine treatment of nursery stock from areas infested by these two pests (1, 2). One insecticide that is recommended for quarantine treatment for Japanese beetles and imported fire ants is bifenthrin. Bifenthrin belongs in the family of synthetic pyrethroids, which are noted for their efficacy at low concentrations. The family also contains such members as cyfluthrin, cyhalothrin and cypermethrin that are under investigation for nursery production. These insecticides are becoming increasingly important in the industry as the older, well-known organophosphate insecticides such as chlorpyrifos (dursban) have come under increasing scrutiny because their environmental pervasiveness. The environmental behaviors of the new generation pyrethroids have not been have thoroughly evaluated; our study provides information that contributes to our understanding of behavior of bifenthrin and possibly related synthetic pyrethroids in nursery production. This information may be used for developing plant-mediated strategies for mitigating unwanted impacts of insecticides in the environment.
Nature of Work: Background: The nursery industry relies quite heavily on pesticides, nutrients and water to ensure quality production. The combination of frequent applications of water, nutrients and pesticides can generate discharges that threaten human and ecosystem health. Japanese beetles and imported fire ants are two important insect pests of the nursery industry in Tennessee and other parts of the nation. Traditionally, the industry relied on organophosphate insecticides, like chlorpyrifos for quarantine treatments for these pests. However, the over-reliance on the insecticide has become a major environmental concern because of its pervasiveness. A survey by the U.S. Geological Survey a little over 10 years ago cited chlorpyrifos as the third most frequently detected insecticide in urban streams and it was one of the top 15 pesticides routinely detected in surface water surveys (3). As chlorpyrifos has come under increasing scrutiny, alternatives continue to be vigorously sought. One alternative is pyrethroids, a family of synthetic chemicals that are
Engineering, Structures and Innovations 415
SNA Research Conference Vol. 56 2011
manufactured based on the natural pesticide pyrethrum, which is produced by chrysanthemum flowers. The first pyrethroid, alletrin was produced in 1965. Since then, scientists have progressively enhanced the pesticidal activities of pyrethroids to what is referred to as the fourth and current generation of 17 chemistries that include bifenthrin and cyfluthrin ( http://ipmworld.umn.edu./chapters/ware.htm)
Bifenthrin and related pyrethroids are characterized by their effectiveness in the 0.01- 0.05 lb acre active ingredient ai/Ac range. They are relatively insoluble in water and they partition preferentially partition into lipophilic phases so concerns about their leaching into groundwater are minimal. These characteristics make bifenthrin a valuable insecticide in nursery production; however, they can make the insecticide persistent in contaminated matrices. Phytoremediation is the use of plant systems for cleaning up unwanted concentrations of pesticides and other contaminants. The mechanisms that facilitate use of phytoremediation of organic compound are phytodegradation (4, 5), phytovolatilization (6), plant assisted bioremediation, also known as rhizodegradation (7). Information available in the literature indicates that bifenthrin is not translocated in plants (8, 9). This suggests that application of plant-mediated strategies for removal of unwanted concentrations of the insecticide must proceed via rhizodegradation.
Rhizodegradation is a process in which substrates supplied by plants stimulate soil microbial populations in plant root zones (rhizospheres) to cause removal (biodegradation) of undesirable levels of contaminants. In order to take advantage of phytoremediation, it is important to understand the components (microbes, root exudates) and root processes (biodegradation) that facilitate rhizodegradation. Here, we describe experiments aimed at establishing correlation between microbial communities and dissipation of bifenthrin to allow us to enhance processes that mitigate unwanted impacts of insecticide in soil and water.
Approaches: The formulation of bifenthrin used was Talstar® P, 7.9%, EC distributed by FMC Corporation. Plants selected for these investigations were switchgrass (Panicum virgatum L) big bluestem (Andropogon gerardii Vitman) and alfalfa (Medicago sativa L). They were selected from previous experiments that screened abilities of different plant rhizospheres to enhance dissipation of different pesticides (10). The plants were grown in two soil types: Armour silt loam collected TSU agricultural experimental station in Nashville TN, and Sullivan sandy loam collected from Tennessee Technological experimental station in Cookeville TN. Soil preparation and incubation were similar to those described previously for other soil contaminants (11). Briefly, Talstar® was added to soil to provide a nominal concentration of ~ 10ppm of bifenthrin in soil. Approximately 50g aliquots of contaminated soil were incubated in the greenhouse in soil microcosms for 10 weeks.
We used the Biolog carbon utilization method for characterizing microbial communities in our treatments. The carbon utilization profile approach (CUP) involved incubation of a soil suspension in 96 well plates and assessing the abilities and extent of utilization of selected substrates by particular communities, as measured by the absorbance (A590) of
Engineering, Structures and Innovations 416
SNA Research Conference Vol. 56 2011
respiratory dye at 590nm during incubation. The Biolog method was originally developed for classifying bacteria based on relative abilities to metabolize 95 substrates on a 96-well plate (one control). It was since been adapted to provide valuable information on physiological profiles of microbial communities in a given sample (12). In its modified version, 31 of the original 95 substrates are replicated three times on a plate (EcoLog) to allow quantitative analysis of microbial community profiles (13) In selecting the 31 substrates on the EcoLog an attempt was made to chose those represented in environmental matrices.
To assess dissipation of bifenthrin, parent residues were extracted from soil with ethyl acetate using a rotary shaker and the extracts were analyzed by electron capture gas chromatography using an Agilent 6890 system with a JW Scientific DB 608 capillary column (30m x 0.25mm x 0.25!m). Oven temperature was programmed from an initial 80oC rising at a rate of 15oC to 320oC. Injector and detector temperatures were 250oC and 300oC respectively. Carrier gas was He at a constant flow rate of 2 ml/min and make-up gas was Ar-CH4 at 58 ml/min. Dissipation of bifenthrin was analyzed SAS.
Results and Discussion Plots of rhizosphere substrate utilization profiles (measured as absorbance in EcoPlate at 590nm) are shown for carbohydrates, carboxylic acids and amino acids (Figures 1-6). These representations provide a qualitative measure of the abilities of different rhizosphere communities to metabolize 31 substrates in a Biolog plate. In general, utilization of each substrate category by rhizosphere microbial communities was greater in planted soils than in corresponding unplanted soil types. In both soil types, utilization of carbohydrates provided the greatest separation between microbial community profiles in plated and unplanted soil.
The carbon utilization profiles assays are a useful approach for differentiating between microbial communities in different ecosystems. The approach has found applications from a wide range of habitats; its value lies in its ability to establish a link between microbial communities and some function in that community (functional measure). In our case, this link is between substrate utilization profiles to the communities’ ability to cause dissipation of unwanted levels of bifenthrin. Such a link is necessary to identify individuals or consortia of microorganisms that are most responsible for dissipation of bifenthrin.
Dissipation of bifenthrin in Armour and Sullivan soils after 10 weeks of incubation in the greenhouse is shown in Table 1. The results show that significantly more bifenthrin was recovered from both unplanted soil types than recoveries in planted soils. Different recoveries of bifenthrin were observed in planted Armour soil but the levels were not significantly different. Recoveries of bifenthrin in planted Sullivan soil were different but in contrast to observation in Armour soil differences in bifenthrin recoveries from planted Sullivan soil were statistically significant.
We used the multivariate canonical discrimnant analysis procedure to attempt to link bifenthrin dissipation and microbial community profiles. Preliminary results shows that
Engineering, Structures and Innovations 417
SNA Research Conference Vol. 56 2011
substrate utilization were sufficiently separated into three distinct groups: 1) all unplanted soils, 2) Sullivan soils planted with AL and 3) Amour soils planted with SG (Figure 2). The canonical discriminant analyses are ongoing to resolve further other groupings and to allow us to establish relationships between dissipation microbial community profiles bifenthrin. This information will be used together with data on microbial community structure to allow rhizospheres to be modified to favor removal of unwanted chemicals.
Literature Cited: 1. U.S. Geological Survey. 1999. The quality of our nation’s waters-nutrients and pesticides. U.S. Geol. Surv. Circ. 1225. 2. USDA. 2005. Imported fire ant quarantine treatments for nursery stock and other regulated articles. Program Aid No. 1822. 3. Natinal Plant Board, 2004. U.S. Domestic Japanese Beetle Harmonization Plan. 4. De Farias et al. (2009). Phytodegradation Potential of Erythrina crista-galli L., Fabaceae, in Petroleum-Contaminated Soil. Appl Biochem Biotechnol 157(1): 10-22 5. Xia, H. (2008). Enhanced disappearance of dicofol by water hyacinth in water. Environ Technol 29(3): 297-302 6. Arnold, C.W. et al. (2007). Field note phytovolatilization of oxygenated gasoline- impacted groundwater at an underground storage tank site via conifers. Int J Phytoremediation 9(1): 53-69 7. Dzantor, E. K. 2007. Phytoremediation: the state of rhizosphere engineering for accelerated rhizodegradation of xenobiotic contaminants. J. Chem. Technol. Biotechnol. 82:228-232. 8. Gan, J., S. J. Lee, W. P. Liu, D. L. Haver, and J. N. Kabashima. 2005. Distribution and persistence of pyrethroids in runoff sediments. J. Environ. Qual. 34:836–841 9.Fecko, A. 1999. Environmental fate of bifenthrin. Environmental Monitoring and Pest Management Branch. Department of Pesticide Regulation. Sacramento, CA 95814 10. Dzantor E.K., D.E. Long and T.K. Amenyenu. 2005. Use of plant systems for mitigating environmental impacts of pesticides. Pp580-583 In M. Taylor (ed.), Proceedings of the Southern Nurserymen Association Annual Conference. August 9, 2005. 11. Dzantor, E. K. and J. E. Woolston. 2001. Enhancing dissipation of aroclor 1248 (PCB) using substrate amendment in rhizosphere soil. J. Environ. Sci. Health Part A 36:1861-1871. 12. Garland , J .L. and A.L. Mills. 1991. Classification and characterization of heterotrophic microbial communities on the basis of patterns of community-level sole- carbon-source utilization. Applied and Environmental Microbiology, 1991, v.57:. 2351- 2359.
Engineering, Structures and Innovations 418
SNA Research Conference Vol. 56 2011
Table 1 Dissipation of bifenthrin in rhizospheres of two soils ______% of initially added bifenthrin in two rhizosphere soils of three crops after 10 weeks
Armor Soil Sullivan Soil ______No plant 11.07 (2.7) a 83.49 (3.7) a
Alfalfa 70.30 (8.9) b 59.93 (10.5) abc
Big bluestem 6.7.09 (7.2) b 41.15 (4.7) b
Switchgrass 83.49 (12.1) b 62.31 (3.5) c Means of four replicates; means in within a column followed by different letter are significantly different (p<0.05)
Engineering, Structures and Innovations 419
SNA Research Conference Vol. 56 2011
Figure 2. Separation of carbon substrate utilization profiles by microbial communities in Armour and Sullivan soils using canonical discrininant analysis. NNP- Nashville (Armour) soil/ No plant; NAL-Nashville/alfalfa; NSG-Nashville/switchgrass; NBB- Nashville soil/big bluestem. CNP-Cookevill (Sullivan) soil/no plant; CAL- Cookeville/alfalfa; CSG-Cookeville/switchgrass, CBB-Cookeville/big bluestem
Engineering, Structures and Innovations 420
SNA Research Conference Vol. 56 2011
Demonstration Results From Greenhouse Heating with Liquified Wood
Philip Steele, Don Parish and Jerome Cooper
Department of Forest Products, Mississippi State University Mississippi State, MS 39762 USA [email protected]
Index Words: Greenhouse, heating, fuel, bio-oil, pyrolysis, wood
Significance to Industry A boiler fuel known as Lignocellulosic Boiler Fuel (LBF) was developed at the Department of Forest Products, Mississippi State University for potential application for heating agricultural buildings. LBF was field tested to heat green houses in cooperation with Natchez Trace Greenhouses (NTG) located in Kosciusko, Mississippi. MSU modified an idled natural gas boiler located at NTG to combust the LBF. Thirty gallons of bio-oil were produced at the MSU Bio-oil Research Laboratory. The bio-oil was produced from the fast-pyrolysis of southern pine (15 gal) and white oak (15 gal) feedstocks and subsequently upgraded by a proprietary process.
Preliminary field testing was conducted at (NTG). The LBF was produced from each wood species was tested separately and co-fed with diesel fuel to yield three fuel formulations: (1) 100% diesel; (2) 87.5% LBF from southern pine bio-oil co-fed with 12.5% diesel and (3) 87.5% LBF from white oak co-fed with 12.5% diesel fuel formulations. Each fuel formulation was combusted in a retrofit NTG boiler. Fuel consumption and water temperature were measured periodically. Flue gas from the boiler was analyzed by gas chromatograph.
The 100% diesel fuel increased water temperature at a rate of 4 oF per min. for 35 min. to achieve the target 140 oF water temperature increase. The 87.5% pine LBF fuel co- fed with 12.5% diesel attained the 140 oF water temperature increase in 62 min. at a rate of 2.3 oF per min. The 87.5% white oak LBF fuel co-fed with 12.5% diesel reached the 140 oF water temperature increase in 85 min. at a rate of 1.6 oF per min.
Fuel that contained 87.5% pine LBF co-fed with 12.5% diesel yielded nitrogen and oxygen at a ratio of 5.3 and carbon dioxide and carbon monoxide at a ratio of 22.2. Fuel formulations that contained 87.5% white oak LBF co-fed with 12.5% diesel yielded nitrogen and oxygen at a ratio of 4.9 and carbon dioxide and carbon monoxide at a ratio of 16.4. Neither the pine LBF nor the white oak LBF fuel showed any measureable methane emissions from the NTG boiler flue gas. These results indicate a viable potential for mildly upgraded bio-oil to become an alternative fuel source for greenhouse operations.
Nature of Work Natural gas ranks second in U.S. energy consumption after petroleum, providing 38% of total energy demand (4). Natural gas price increases accelerated over the decade through July of 2008 with the peak price reaching a level
Engineering, Structures and Innovations 421
SNA Research Conference Vol. 56 2011
above $14 per MM Btu. Following this peak price, technological advances have increased supply and economic recession has reduced international demand for natural gas; price has, therefore, declined to an approximate current mean price of just above $5.00. However, long-term expectations are that price increases will resume in following decades as the fields in which new production technology can be applied decline in number and international economic activity resumes to pre-recession levels (4).
Historically, the greenhouse industry has depended on natural gas as a convenient and low-cost energy resource for greenhouse heating. Energy cost ranks second, behind labor, as the largest cost for the greenhouse industry, comprising 60% of total production costs. Increased costs through 2008 had forced a contraction in greenhouse businesses nationwide as some entities could not compete effectively because of the high level of energy costs they were required to absorb. Some greenhouse operations have converted to heating with biomass but this source of energy is as convenient to use as a liquid fuel.
Development of lower-cost fuels as a future supplement or replacement for natural gas is important for preserving the economic viability of the greenhouse industry. A potential alternative fuel for greenhouse heating is the use of bio-oil produced from the fast pyrolysis of biomass. Fast pyrolysis processes thermally convert biomass materials to produce a liquid fuel, generally referred to as bio-oil. In a typical pyrolysis process biomass particles are heated to between 400 and 550°C very rapidly in the absence of oxygen followed by cooling to condense the pyrolysis vapors to a liquid. This treatment fractures plant cellular material molecular bonds converting the biomass to the final bio- oil. The yield of bio-oil can be relatively high at about 65% dry weight basis or higher depending on the production process.
Bio-oil chemical properties vary with the feedstock pyrolyzed but woody biomass typically produces a mixture of 30% water, 30% phenolics, 15% aldehydes and ketones, 15% alcohols, and 10% miscellaneous compounds. As a fuel, bio-oil has environmental advantages when compared to fossil fuels producing no SOx and half the NOx; because bio-oil is derived from biomass it is CO2 neutral (3). In general, liquid fuels are more convenient to transport, store, and combust than gas or solid fuels. Thus, a primary benefit offered by fast pyrolysis is the production of a more convenient and more readily marketable liquid fuel. One drawback to bio-oil is that the chemical mix is water soluble and is, therefore, immiscible in petroleum products. This precludes an easy route to utilization of bio-oils through mixing with diesel or gasoline to extend petroleum product supply. A method of producing a fuel from bio-oil without mixing with petroleum fuels is required.
Cernik and Bridgwater (1) have published the most recent description of utilization of bio-oil for heating fuels. They point out that limitations to utilization of raw bio-oils include poor volatility and corrosiveness. These limitations are produced by the bio-oil acidity, relatively high water content and the oxygenated nature of the bio-oil chemical compounds. Nearly all of these limitations can be eliminated if bio-oil is catalytically
Engineering, Structures and Innovations 422
SNA Research Conference Vol. 56 2011
hydrodeoxygenated (HDO). However, catalytic HDO has proven very difficult to apply to bio-oil, mainly due to rapid catalyst coking (1). No reports of successful commercial application of HDO to produce an upgraded bio-oil have been reported.
A U.S. producer of liquid smoke from pyrolysis of wood reports utilization of the non- commercial bio-oil fraction as a fuel for their 5 MWth swirl burner citation. Space heating is provided by a heat-exchanger system incorporated into the burner. Finnish researchers have burned bio-oil in a dual-fuel burner that required only minor modifications to account for lower combustibility of the mix. A second Finnish research project tested an additional furnace configuration. Main findings were that some modifications were required to improve combustion, a secondary support fuel was required for startup, and emissions were within the environmentally acceptable range (1).
Researchers at MSU have developed a bio-oil upgrading process that increases bio-oil energy content, reduces acidity and stabilizes the fuel over time. The yield of this product is 100% because the reaction is produced by addition of chemicals and the reaction produces no production of gas as does the HDO process. This upgraded product is known as Lignocellulosic Boiler Fuel (LBF). Table 1 gives the properties of LBF compared to raw bio-oil prior to upgrading. Water content is increased by 1.2 percent from 24.2 to 24.5; acid value decreased by 44.4% from 99.3 to 55.2; higher heating value (HHV) increased by 36% from 17.5 MJ/kg to 23.8 MJ/kg; viscosity was reduced by 56.6% from 29.7 cSt to 12.9 cSt. A decrease in acid value will eliminate the corrosion issue involved with using bio-oil as a liquid fuel. While the water content increased slightly based on a chemical reaction the total energy value of the upgraded bio-oil was significantly higher. The increase in HHV moves bio-oil to an energy level of just over half that of diesel fuel making LBF much more competitive as a liquid fuel than is raw bio-oil. The ash content of raw bio-oil is a very low 0.04% and LBF maintains this low level. Low ash content will eliminate a source of coking on boiler parts.
The exact upgrading process applied in the MSU bio-oil upgrading process is currently proprietary but is somewhat similar to the process applied to produce bio-diesel. The process is relatively simple and much more cost effective than application of HDO with its process requirements for high pressure and heat combined with relatively expensive catalysts and hydrogen. MSU has developed both batch and continuous processes for upgrading raw bio-oil to LBF and a patent protecting the technology is pending.
The bio-oil that is upgraded to LBF is currently produced in the MSU auger pyrolysis reactor. Characteristics of the bio-oil produced by this auger reactor have been described in detail by Ingram et al. (2). The MSU bio-oil reactor typically pyrolyzes wood particles produced from hammer milling wood to particles of 1 to 3 mm diameter. These particles are very close in size to those produced in sawmilling.
The Department of Forest Products performed the boiler conversion and testing in cooperation with Natchez Trace Greenhouses (NTG), located in Kosciusko, Mississippi. NTG is a medium-sized wholesale producer of plant products with 20,000 square feet of plant material under glass.
Engineering, Structures and Innovations 423
SNA Research Conference Vol. 56 2011
NTG provided access to an idle natural gas hot water boiler which was converted by MSU researchers to burn bio-oil. An adjustable output waste oil burner was retrofit into the boiler. The new burner has the capability to combust fuel types ranging from No. 2 heating oil up to 90 wt. gear oil. The waste oil burner used compressed air to accomplish fuel atomization starting at 2 psi.
Thirty gallons of bio-oil were produced by the MSU auger pyrolysis reactor. Fifteen gallons of bio-oil were produced from the fast pyrolysis of southern pine and fifteen gallons from white oak feedstocks. Both fuels were subsequently upgraded to LBF. Initial burn tests showed that intermittent failure of the LBF flame resulted from increased water content and higher flash point temperature. To prevent intermittent flame failure, the three fuel-nozzle burner system incorporated into the output waste oil burner was modified to inject upgraded bio-oil through two injectors and diesel through the third injector. This resolved the flame failure problem and enhanced the combustion of the LBF with the result shown in Figure 1.
Preliminary field testing was conducted at NTG. LBF from southern pine and white oak biomass types were co-fed with diesel fuel in varying ratios to yield three different fuel formulations: (1) 100% diesel; (2) 87.5% LBF from southern pine co-fed with 12.5% diesel and (3) 87.5% LBF from white oak co-fed with 12.5% diesel. Each fuel formulation was combusted in the retrofit boiler at a rate of four gallons per hour. Fuel consumption and water temperature were measured periodically. The time needed to increase the boiler water temperature to 140oF was measured. Flue gas from the boiler was analyzed by gas chromatograph (GC) to identify its chemical components for the fuel formulations containing 87.5% pine LBF with 12.5% diesel and 87.5% white oak LBF with 12.5% diesel. The flue gas was tested for oxygen, nitrogen, methane, carbon monoxide and carbon dioxide.
Results Each fuel tested was capable of producing enough heat to achieve a 140 oF water temperature increase. Bio-oil is a lower energy fuel, containing approximately 50 percent of the heat content of diesel fuel oil and therefore, provides about half the water heating capability. Thirty gallons of LBF were consumed during the boiler testing phase. Figure 2 shows the time required for a 140 oF water temperature increase by boiler fuel type. The 100% diesel fuel required 35 min. to achieve the 140 oF increase in water temperature. The 87.5% pine LBF and 87.5% white oak LBF each separately co-fed with 12.5% diesel required 62 min. and 85 min. to reach the 140 oF water temperature increase, respectively.
Figure 3 gives the rate of water temperature increase by fuel type. The 100% No. 2 diesel fuel yielded a water temperature increase of 4.0 oF per min. The 87.5% pine LBF and 87.5% white oak LBF each separately co-fed with 12.5% diesel resulted in respective water temperature increase rates of 2.3 oF/min. and 1.6 oF/min.
Table 2 shows flue gas comparison data from heating experiments with the retrofit NTG boiler. Fuels that contained 87.5% pine LBF co-fed with 12.5% diesel yielded nitrogen and oxygen at a ratio of 5.3 and carbon dioxide and carbon monoxide at a 22.2. Fuels
Engineering, Structures and Innovations 424
SNA Research Conference Vol. 56 2011
that contained 87.5% white oak LBF co-fed with 12.5% diesel yielded nitrogen and oxygen at a ratio of 4.9 and carbon dioxide and carbon monoxide at a ratio of 16.4. Neither the pine LBF nor the white oak LBF fuel contained any measurable methane emissions from the NTG boiler flue gas.
It was determined from the Table 1 and 2 data that approximately 100% more bio-oil will be needed to provide the same energy as diesel fuel. While additional bio-oil will be required to equal the performance of diesel fuel it will also be true that the bio-oil fuel will be marketed at a price reflecting the reduced energy value. Therefore, the reduction in the amount of diesel fuel required when used in combination with LBF should be a viable environmentally friendly alternative future fuel source for greenhouse operations.
Table 1. Physical and chemical properties of raw bio-oil and bio-oil upgraded to Lignocellulosic Boiler Fuel. Raw bio-oil Upgraded bio-oil Water (%) 24.2 24.5 Acid value (% acetic acid) 99.3 55.2 Higher heating value (MJ/kg) 17.5 23.8 Viscosity at 40oC (cSt) 29.7 12.9 Ash (wt %) 0.04 0.04 Specific gravity at 20oC (g/ml) 1.25 1.12 Metals (ppm) < 15 < 15
Table 2. Flue gas chemical compounds produced during combustion of LBF in the retrofit NTG boiler. Molar percent (%) 87.5% pine LBF co- 87.5% white oak LBF co- fed with 12.5% fed with 12.5% diesel Compound diesel Oxygen 12.66 14.03 Nitrogen 67.41 68.62 Methane 0.00 0.00 Carbon Monoxide 0.30 0.35 Carbon Dioxide 6.65 5.73 Unknown 12.98 11.27 Total 100.00 100.00
Engineering, Structures and Innovations 425
SNA Research Conference Vol. 56 2011
Figure 1. Flame produced from combustion of LBF in the retrofit NTG boiler.
Figure 2. Heating time required to reach 140 oF water temperature by boiler fuel type.
Engineering, Structures and Innovations 426
SNA Research Conference Vol. 56 2011
Figure 3. Mean time in degrees F per min. to bring boiler water temperature to 140 oF.
References 1. Cernik, S. and A.V. Bridgwater. 2005. Applications of biomass fast pyrolysis oil. Fast Pyrolysis of Biomass: A Handbook, Vol. 3. A.V. Bridgwater, Ed. CPL Press, Newbury, UK. 221 p. 2. Ingram, L D.Mohan, M.Bricka, P.Steele, D. Strobel, D. Crocker, B. Mitchell, J. Mohammad, K. Cantrell, and C. U. Pittman. 2008. Pyrolysis of Wood and Bark in an Auger Reactor: Physical Properties and Chemical Analysis of the Produced Bio-oils. Energy & Fuels. 22: 614-625. 3. Mulraney, H., I. H. Farang, C. E. LaClaire, and C. J. Barrett. 2002. Technical, environmental and economic feasibility of BioOil in New Hampshire's north country. www.unh/p2/biooil/bounhif.pdf. 4. U. S. Energy Information Administration. 2008. Price of natural gas sold to commercial consumers in the U.S. http://tonto.eia.doe.gov/dnav/ng/hist/n3020us3A.htm.
Engineering, Structures and Innovations 427
SNA Research Conference Vol. 56 2011
Acknowledgement : This material is based upon work performed through the Sustainable Energy Research Center at Mississippi State University and is supported by the Department of Energy under Award Number DE-FG3606GO86025.
The authors also gratefully acknowledge the generous support of Natchez Trace Greenhouses in allowing them to convert their boiler to combust bio-oil upgraded to LBF.
Disclaimer: “This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any specific commercial product, process, or service by trade name, trademark, manufacturer, or otherwise does not necessarily constitute or imply its endorsement, recommendation, or favoring by the United States Government or any agency thereof. The views and opinions of authors expressed herein do not necessarily state or reflect those of the United States Government or any agency thereof.”
This manuscript is publication #FP582 of the Forest and Wildlife Research Center, Mississippi State University.
Engineering, Structures and Innovations 428
SNA Research Conference Vol. 56 2011
Integration of Aquaculture Waste with Horticulture Crop Production
Jeremy M. Pickens1, Jesse A. Chappell2, Jeff L. Sibley1, Adam M. Sleeper1 Wheeler G. Foshee1 and Sami Abdul Rhaman2
1Department of Horticuture, 2Department of Fisheries and Allied Aquacultures Auburn University, Auburn AL 36849
Index of words: sustainability, water efficiency, nutrient recovery
Significance to Industry Agriculture is pressured to increase production while improving sustainability to meet the demands of natural resource conservation and issues feeding, clothing, and providing shelter for an ever increasing population. Of all agricultural industries, two are considered the most intensive, aquaculture and horticulture. Aquaculture is the fastest growing animal production industry worldwide (3). Horticulture involves many facets spanning thousands of crops, each crop requiring specific cultural needs. While aquaculture and horticulture can be very intensive they can also be highly adaptable. The flexibility and adaptability of horticulture and aquaculture crops allows for many areas of integration. Integration can provide opportunities for cost sharing and increased sustainability, while also diversifying products and markets. Large quantities of water used in both intensive aquaculture and the nursery and greenhouse industries provide many opportunities for integrating on several scales.
Intensive fish production usually involves concentrations significantly more concentrated (20,000-600,000 pounds per acre) than conventional pond culture (7,000 to 8,000 lbs per acre) (2, 5). Concentrations of fish at these levels require constant water quality monitoring and management due to the buildup of toxic nutrients to the cultured fish species. The primary nutrient toxicity of concern in regards to fish health is un-ionized ammonia and nitrite. Un-ionized ammonia NH3 is the toxic form of what is collectively called total ammonia nitrogen (TAN) with its concentration heavily dependent upon the - culture water pH. Nitrite (NO2 ) is an intermediary form of nitrogen that exists in between ammonium (NH4) and nitrate (NO3) synthesis through the biological process of nitrification. Both NH4 and NO3 are relatively safe for fish within reasonable concentrations. There are many culture techniques that deal with these toxic nutrients but the least difficult is through water exchange. In most parts of the world were environmental restrictions are almost nonexistent, water exchange is the least difficult and in some cases the least expensive means of water quality treatment. In some culture systems such as trout culture, water is completely exchanged several times during the day in flow-through raceways.
A more sustainable approach is utilizing the integration of plant culture with fish culture. Integration of plant/fish production systems has been researched extensively in an effort to reduce the nutrient loads (nitrogen and phosphorus) of fish culture water and to conserve water in arid regions of the world. This research usually involves zero or minimum discharge systems in which the fish culture water is recirculated through
Engineering, Structures and Innovations 429
SNA Research Conference Vol. 56 2011
hydroponic culture of vegetable crops, usually leafy greens. Although water is becoming scarcer, there are some parts of the world that still have an ample supply of irrigation water -- be it ground water, or collected water from precipitation. Areas with ample water supplies still face water concentration concerns due to industrial activities and population needs. The container nursery industry in the southeast U.S. is known to use ample amounts of water through overhead irrigation and water usage in this industry is likely to become more stringent in the near future.
Nature of Work: Several advantages exist in integrating fish production with container nursery production. The sustainable benefits are likely the greatest as water use efficiency increases per gallon as well as the reduction of nutrient loading into surrounding water sheds as plants have the ability to assimilate a large percentage of the nutrients contained in the fish culture water. Fish culture water in intensive systems can reach nitrate concentrations greater than 400 mg/l (4). Several small experiments have evaluated multiple plant species to determine the effects of fish effluent from an intensive system when used as a fertilizer source. Table 1 shows summaries of several experiments conducted at the Auburn University Integrated Aquaculture Research Facility at the E.W. Shell North Auburn Fisheries Station, Auburn, Alabama where fish effluent is directly compared to what was considered conventional fertilizer rates.
Discussion: These experiments demonstrate the potential use of fish culture effluent as a fertilizer source and adaptability over a wide array of crops. It has been observed through other experiments (data not shown) how stocking densities and feeding rates largely influence the concentrations of nutrients contained within the culture water. Water exchange also plays a significant role in the concentration of nutrients. The more frequent water is exchanged or the greater the percentage of exchange the less concentrated nutrients become. The rate of exchange will dictate its use and the scale of the integration. A system that utilizes lower exchange rates will be better able to utilize nutrient laden waters as a fertilizer source but will only be able to use it on a small area of plant production due to the lower volume of water available. Higher exchange rates in turn lend themselves to larger areas, but in this situation nutrient recapture is not of primary concern since nutrients are likely to be at minimal concentrations.
Container nurseries are reported to use as much as 13,577 gallons of water per acre daily (0.5 inch of water per acre) during peak production times (1). This is a considerable amount of water when considering the vast acreage in production today (6). Double cropping water, with fish culture as the first use and plant production as the second use increases the use efficiency of water on a per gallon basis. Most intensive fish production tanks are about 4 feet deep (equivalent to 30 gallons per ft2). Using 30 gallons per ft2 with a liberal 100% exchange daily, the water requirements for one acre of nursery production could require 450 ft2of fish production. Using these rough figures would present a ratio of a 100:1 nursery area: fish production area at a 100% exchange. In this case a 30 x 96 ft fish production greenhouse (2880 ft2) could water 6.36 acres of nursery daily at a 100% exchange. Logistically, to water direct from a fish production tank using overhead irrigation would require two pumps, pumping equal volumes: one pumping water out of the tank and one pumping water back into the tank from a well or
Engineering, Structures and Innovations 430
SNA Research Conference Vol. 56 2011
reservoir. In this case a cool water species such as trout could be grown. A less complicated approach is to pump water into a production tank and let the overflow be used to make up the water in the reservoir that is used for runoff and irrigation. This method could be used with a variety of fish species including tilapia and yellow perch. Using runoff from container nurseries in fish production would be limited due to aquatic species sensitivity to most pesticides. More work is needed to evaluate integration of intensive aquaculture with container nurseries in regards to water budgeting, effects of fish waste as a fertilizer source, and economic cost analysis. There is also potential to integrate other intensive animal production facilities that utilize lagoon technology such as swine, dairy and in some cases poultry.
Literature Cited 1. Best Management Practices: Guide for Producing Nursery Crops. 2007. 2nd Edition. Southern Nursery Association, Atlanta, GA. p.11. 2. Brune, D.E., Schwartz, G., Eversole, A.G., Collier, J.A., and Schwedler, T.E. 2004. Partitioned Aquaculture Systems. SRAC Publication No. 4500. 3. FAO, 2007. The state of the world fisheries and aquaculture 2006. Food and Agriculture Organization of the United Nations. http://www.fao.org/docrep/009/A0699e/A0699e00.htm 4. Otte, G, Rosenthal, H., 1979. Management of closed brackish-water systems for high density fish culture biological and chemical water treatment. Aquaculture. 18: 169- 181. 5. Rakocy, J. 2002. An integrated fish and field crop system for arid areas. p.263-285. In: Ecological aquaculture: Evolution of the blue revolution. Blackwell Science. Costs- Pierce, B.A. (Ed.), Oxford. 382. 6. USDA-ERS. Alberto Jerardo. Floriculture and Nursery Crops Yearbook. FLO-2007. September 2007.
Engineering, Structures and Innovations 431
SNA Research Conference Vol. 56 2011
Engineering, Structures and Innovations 432