Planta (2000) 210: 644±651

Expression pattern of (+)-d-cadinene synthase genes and biosynthesis of sesquiterpene aldehydes in plants of Gossypium arboreum L.

Xiao-Ping Tan1, Wan-Qi Liang1, Chang-Jun Liu1, Ping Luo1, Peter Heinstein2, Xiao-Ya Chen1 1National Laboratory of Plant Molecular Genetics, Institute of Plant Physiology of Shanghai Institutes for Biological Science, The Chinese Academy of Sciences, 300 Fenglin Road, Shanghai 200032, P. R. China 2Department of Medicinal Chemistry and Molecular Pharmacology, Purdue University, West Lafayette, IN 47907, USA

Received: 17 August 1999 / Accepted: 1 October 1999

Abstract. The cotton (+)-d-cadinene synthase, a of sesquiterpene biosynthesis, constitute a chemical sesquiterpene cyclase, is encoded by a complex gene defense machinery in cotton plants. family which, based on homology, can be divided into two subfamilies: cad1-A and cad1-C. Southern blots Key words: Cadinene ± Gossypium ± Gossypol ± revealed several members of the cad1-C subfamily, and a Phytoalexin ± Sesquiterpene cyclase single member of the cad1-A subfamily, in the diploid Gossypium arboreum genome. One of the cad1-C genes, cad1-C3, was isolated from this species. According to reverse transcriptase-polymerase chain reaction, tran- scripts of both cad1-C and cad1-A genes appeared in Introduction roots from the second day post germination and in 1-d- old cotyledons, whereas the transcription levels were too Sesquiterpenoids are one of the major groups of low to be detected in the hypocotyls. Initially, sesquiter- isoprenoids widely distributed in plants. Many plant pene cyclase activities were found to be high in the species accumulate sesquiterpenes in specialized secre- seedlings, then dropped in aerial organs but increased in tary structures, such as resin ducts, subepidermal glands roots during development. Sesquiterpene aldehyde con- and glandular trichomes (McGarvey and Croteau 1995, tents followed the same pattern. In fully developed and references therein), building a constitutive chemical plants, the transcripts of cad1-C were detected in stems, barrier to most microorganisms. In response to phyto- leaves and pericarps, as well as in the sepals and petals pathogenic microorganisms, insect attack or wounding, 3 d before anthesis, but not at the day of anthesis. plants may alter their cellular metabolism to produce an In contrast, cad1-A transcripts were not detected in any array of antimicrobial secondary metabolites (phytoa- of these aerial organs. The sesquiterpene aldehyde lexins) (Lawton and Lamb 1987; Dixon and Harrison contents increased in petals but decreased in sepals after 1990; Dixon and Paiva 1995; Somssich and Hahlbrock anthesis. Treatment of G. arboreum stems with a 1998). The phytoalexin status of sesquiterpenes in the Verticillium dahliae elicitor-preparation activated cad1- family Solanaceae has been well documented (Chappell A transcription, but a signi®cant level of cad1-C tran- 1995; Ku'c 1995). The bicyclic sesquiterpene capsidiol, scripts was detected both before and after elicitation. In for example, accumulated rapidly only in tissues or cell G. hirsutum cv. GL-5, a glandless cultivar, the cad1-C cultures of Nicotiana tabacum and Capsicum annum gene was activated by the same fungal elicitor, followed challenged with elicitors (Brooks et al. 1986; VoÈ geli and by the synthesis of the sesquiterpene cyclase, and Chappell 1988). Induced accumulation of diterpene accumulation of sesquiterpene aldehydes. The cad1 gene phytoalexins by elicitation has also been detected in expression during development and in response to Oryza sativa (Ren and West 1992) and Ricinus communis elicitation, as well as the spatial and temporal pattern (Dudley et al. 1986). In Abies grandis, increased forma- tion of oleoresin monoterpenes, sesquiterpenes and diterpenes was induced by wounding (Vogel et al. 1996; Bohlmann et al. 1997; Steele et al. 1998b). The gene reported here has the EMBL accession number AF174294 Sesquiterpene cyclases catalyze the formation of Abbreviations: CAD = (+)-d-cadinene synthase; dd = double- cyclic sesquiterpene hydrocarbon intermediates from a distilled; EAS = 5-epi-aristolochene synthase; FPP = farnesyl diphosphate; PCR = polymerase chain reaction; RT = reverse linear 15-carbon farnesyl diphosphate (FPP), directing transcriptase the isoprenoid carbon ¯ow into complex sesquiterpe- Correspondence to: X.-Y. Chen; E-mail: [email protected]; noids. Because of this central function, this enzyme Fax: +86-21-64042385 is highly regulated (Chappell 1995; McGarvey and X.-P. Tan et al.: Sesquiterpene biosynthesis in cotton plants 645

Croteau 1995; Starks et al. 1997; Bohlmann et al. biosynthesis of sesquiterpenoids in cotton plants is also 1998b). Investigations of plant terpene cyclases have related to the formation of pigmented glands and is drawn much attention recently, and cDNAs encoding independent of environmental stimuli (Bell 1984). In various sesquiterpene cyclases have been isolated from a addition to induction as an activated defense response, number of plant species (Facchini and Chappell 1992; the secondary sesquiterpene metabolism of cotton is Back and Chappell 1995; Back et al. 1998; Bohlmann most likely developmentally regulated as well. Thus et al. 1998a; Colby et al. 1998; Steele et al. 1998a), investigation of a glanded G. hirsutum cultivar has including two (+)-d-cadinene synthases (CADs) from demonstrated an active biosynthesis of sesquiterpenoids Gossypium arboreum L. (Chen et al. 1995, 1996). How- in developing seeds, starting at an early cotyledon stage ever, up to now only a few studies have been conducted (Meng et al. 1999). However, little is known about the on plant cyclase genes and their expression patterns. The regulation and kinetics of sesquiterpene biosynthesis in tobacco 5-epi-aristolochene synthase (EAS) has been cotton seedlings and plants. Here, we report isolation of investigated at both the mRNA and gene levels. The a G. arboreum cad1-C gene, cad1-C3, the di€erential tobacco genome has been found to contain 1215 copies expression patterns of the cad1-A and cad1-C genes, of eas genes (Facchini and Chappell 1992). Yin et al. sesquiterpenoid accumulation in the healthy G. arbor- (1997) analyzed the eas4 promoter, and found that it eum seedlings and plants, and induction by elicitation of directed an induced expression only. cad1 expression in cotton stem tissue. In cotton, (+)-d-cadinene is a biosynthetic precursor of the cyclic secondary sesquiterpene aldehydes, includ- ing gossypol (Davila-Huerta et al. 1995). As in tobacco, Materials and methods the cotton sesquiterpene cyclase is encoded by a multi- gene family. From an elicitor-induced cDNA library of Plant material. Seeds of Gossypium arboreum L. cv. Nanking and G. arboreum, a diploid A-genome species, four di€erent G. hirsutum L. cv. GL-5 were sown in pots and the plants were clones have been isolated. On the basis of sequence grown in a greenhouse, at 28 °C. For seedlings the seeds were similarities, these cDNAs can be grouped into two germinated in 0.7% agar containing 3% sucrose, at 28 °C. subfamilies: cad1-C and cad1-A. The cad1-C is plural, of Genomic library screening. Genomic DNA was isolated from cell- the four cDNAs characterized three belong to this suspension cultures of G. arboreum L. cv. Nanking, as described by subfamily: cad1-C1, cad1-C14 (Chen et al. 1995), and Chen et al. (1995). The DNA was partially digested with EcoRI cad1-C2 (Meng et al. 1999), whereas only one member and ligated with the k-ZAP vector (Stratagene, La Jolla, Calif., of cad1-A has been isolated (Chen et al. 1996). The three USA). A PCR-96 well plate method (Alfandari and Darribere cad1-C members are closely related based on an over 1994) was used to screen the library. Brie¯y, the library of about 7 95% amino acid sequence identity among each other, 10 plaque-forming units was spread into the 96 wells. Following overnight incubation with Escherichia coli strain XL1-Blue at whereas cad1-A is only distantly related to members of 37 °C, aliquots from each well were checked by polymerase chain the cad1-C subfamily (80% identity). A cDNA recently reactions (PCRs), using a forward primer 97400 (CA- isolated from G. hirsutum (Davis et al. 1998) is also a CATCCCTTCGATTCCGAC) and a reverse primer 97T580 member of cad1-C. (AGGCTTAAATGGTGGGTGGT) that are speci®c for cad1- Gossypol and related sesquiterpene aldehydes posses C1. The PCRs were carried out at 94 °C for 30 s, 51 °C for 30 s fungistatic properties, insecticidal activities and are toxic and 72 °C for 1 min, 35 cycles. Positive wells were then subjected to subsequent-round selection. After seven rounds a positive clone to monogastric animals (Bell and Stipanovic 1977). was isolated and the plasmid excised. The DNA sequences were Formation of these secondary sesquiterpenes may be determined with a Dye Terminator Cycle Sequencing FS Ready induced by elicitation, thus they behave as phytoalexins Reaction Kit (PE-ABI, Warrington, UK). (Bell 1984; Heinstein 1985; Essenberg et al. 1990). Increased steady-state levels of cad1-C and cad1-A Southern blotting. Genomic DNA was digested with EcoRIor mRNAs, the cyclase proteins, and subsequent produc- Hind III, separated on a 0.7% agarose gel, and transferred onto a tion of sesquiterpene aldehydes have been detected in nitrocellulose membrane. Polymerase chain reaction was perform- ed on the genomic clone of cad1-C3 with primers Sou1 G. arboreum cell-suspension cultures treated with a (TGACTTCAAATATCACCAC) and Sou2 (CTTGTCGGGA- fungal elicitor from Verticillium dahliae (Heinstein CAATTGAGGA) and 97400 and 97T1200 (CATCTATAC 1985; Chen et al. 1995, 1996). In G. hirsutum foliar ATTTGATATC). For cad1-A, primers 98A1 (ATTGCA- tissues inoculated with a phytopathogenic bacterium CACATCGTCTCA) and 98T280 (AATTCAGTTGCAGCATCG) were used for PCR ampli®cation of the genomic clone. The Xanthomonas campestris, an elevated d-cadinene syn- 32 thase activity was observed (Davis et al. 1996). Similar products were P-labeled with a Prim-a-Gene Labeling System (Promega, Madison, Wis., USA). A standard protocol was then activation of sesquiterpene cyclase genes by elicitation used for DNA hybridization (FuÈ tterer et al. 1995). has been reported for tobacco and Hyoscyamus muticus (Facchini and Chappell 1992; Back and Chappell 1995). Isolation and analysis of RNA. Total RNAs were isolated from However, in contrast to tobacco plants that accumulate various tissues of seedlings or plants by the method of Hughes and secondary sesquiterpenes only after induction (VoÈ geli Galau (1988). Reverse transcriptase (RT)-PCR was performed as and Chappell 1990; Yin et al. 1997), cotton plants described by Meng et al. (1999). The primers used were 93160 constitutively accumulate sesquiterpenoids in their pig- (CACCACTGCTCAACTTACA) and 96T1098 (ATTCGGGA- GTTGGTTCATG) for cad1-A, and 97400 and 97T580 for cad1- mented glands. These glands are spread throughout the C1 and cad1-C3. The latter two primers might also work with other plant, except seed coat and xylem (Stanford and members of the cad1-C subfamily, due to a high sequence identity Viehoever 1918; Bell and Stipanovic 1977). Thus, (over 95%) among cad1-C members. As an internal standard, the 646 X.-P. Tan et al.: Sesquiterpene biosynthesis in cotton plants endogenous histone-3 mRNA (EMBL accession number 1995). Thus, this gene appears to be a new member of AF024716) was analyzed in a separate tube, with a forward primer the cad1-C subfamily of G. arboreum, and is assigned H3F (GAAGCCTCATCGATACCGTC) and a reverse primer cad1-C3. H3R (CTACCACTACCATCATGGC). When G. arboreum genomic DNA was hybridized For further identi®cation, the RT-PCR products ampli®ed by 32 26 cycles were separated on a 2% agarose gel, and transferred to with P-labeled DNA fragments ¯anking the )151- to nitrocellulose membranes. The PCR products obtained with the 125-bp and 437- to 1650-bp regions of the cad1-C3 gene, same primers, using cDNA clones as templates, were then 32P- eight EcoR I bands and four Hind III bands appeared labeled, and used for DNA hybridization. (Fig. 1). Since the probing region in the cad1-C3 clone contained no EcoR I sites, eight copies of the cad1-C Elicitation and tissue printing. The Verticillium dahliae elicitor was were assumed to exist in the diploid genome of prepared as described by Heinstein (1985), and the elicitor concentration was adjusted to 50 lg sucrose equivalent/100 lL. G. arboreum. It is also possible that there are fewer The stems of G. arboreum L. cv. Qingyangxiaozi and G. hirsutum than eight copies, especially since some of the bands are L. cv. GL-5 (a glandless cultivar) were elicited by injecting 200 lL smaller than 5 kb (full length of the insert in the genomic of the elicitor-preparation, or an equal amount of sterile double- clone of cad1-C3), indicating the presence of at least one distilled (dd) H2O, into the stem of cotton plants, about 5 cm below EcoR I site within or between the regions recognized by the stem apex. The stems were then collected 2 d post treatment for the probes of one or more cad1-C members. As RNA analysis, or 8 d post treatment for tissue printing and chemical analysis. For tissue printing (Cappadocia 1993; Varner mentioned above, three di€erent cDNAs of cad1-C have and Ye 1994), the stem fragment was cut into two halves, one half been already isolated from G. arboreum. Hybridization was placed on a nitrocellulose membrane saturated with phos- with a cad1-A probe revealed two Hind III bands and phate-bu€ered saline (10 mM K-phosphate, 150 mM NaCl, one EcoR I band (Fig. 1), and since there was a Hind III pH 7.4) for 1 h in a vacuum, then dried at 80 °C overnight. The site but no EcoR I sites in this probe, a single cad1-A nitrocellulose membrane was stained with Ponceau S for 5 min to copy was assumed to be present in G. arboreum. check total proteins transferred, followed by destaining with ddH2O for 10 min. Then the membrane was incubated in the blocking Up to now three G. arboreum genes of (+)-d- bu€er [10% nonfat dry milk in Tris-bu€ered saline (TBS = 20 mM cadinene synthase have been isolated, they are cad1-C3 Tris-HCl, 500 mM NaCl, pH 8.0) containing 0.05% Tween-20 reported here, cad1-A (EMBL accession number (TBST)] for at least 2 h at 25 °C, followed by two brief washes in Y18484) and a putative cad1-B (EMBL accession TBST, and two washes in TBS, 10 min each. The blot was number X95323). Although amino acid sequences challenged ®rst with the rabbit antiserum raised against the deduced from the three genes have over 73% identities, bacterially expressed cad1-C1, then with alkaline-phosphatase- conjugated anti-rabbit IgG (Sigma, St. Louis, Mo., USA). The the promoter and introns of cad1-C3 show little homol- signals were developed by incubating the blot with nitro-blue ogy with those of the other two genes. A putative tetrazolium and 5-bromo-4-chloro-3-indolyl-1-phosphate. TATA-box is located at a position 119 bp upstream to the translation start codon, and a 20-bp domain Assay of sesquiterpene cyclase. Proteins were isolated from the spanning the TATA-box is completely conserved among seedlings with a bu€er containing 50 mM Tris-HCl, 10 mM EDTA the three G. arboreum cad1 genes. All plant terpene (pH 8.0), 1% b-mercaptoethanol, and 20% glycerol. Activities of cyclase genes reported so far have a similar overall sesquiterpene cyclase were assayed as described by VoÈ geli and Chappell (1990) and Meng et al. (1999). Brie¯y, 15 lg of proteins structure with six positionally conserved introns (Chap- was added to each reaction mixture of 200 ll, containing 3.5 nmol pell 1995; Bohlmann et al. 1998b), this too is the case for 3 FPP and 5.55 kB2 [ H]FPP (Sigma). Protein concentrations were the three cotton genes. determined with the Bio-Rad Protein Assay kit (Bio-Rad, Hercules, Calif., USA). For quantitative estimation throughout this investi- Kinetic analysis of seedlings. Transcription of the CAD gation, experiments were carried out in triplicate and mean values genes in G. arboreum seedlings was investigated by RT- were taken.

Quanti®cation of sesquiterpene aldehyde. Total sesquiterpene alde- hydes were extracted from the seedlings with 95% ethanol, and quanti®ed using a phloroglucinol assay, as described by Meng et al. (1999). Standard curves were made with gossypol (Sigma).

Results

Isolation of the cad1-C3 gene. A clone was isolated from a G. arboreum genomic library using the 96-well PCR method, with primers speci®c for the cDNA of cad1-C1. Restriction analysis revealed an insert of approximately 5 kb. Nucleotide sequencing showed that the clone contains a fragment of about 710 bp upstream to the translation start codon. Alignment of nucleotide se- quences of the genomic insert with the previously Fig. 1A,B. Southern blots of G. arboreum genomic DNA hybridized with probes of cad1-C3 (A)andcad1-A (B). The genomic DNA was isolated cDNAs showed an identity of 97% with cad1- digested with restriction enzymes as indicated. As a positive control C1 (Chen et al. 1995) and cad1-C2 (Meng et al. 1999), (+), genomic clones of cad1-C3 and cad1-A, respectively, were and an identity of 95.5% with cad1-C14 (Chen et al. digested with EcoRI X.-P. Tan et al.: Sesquiterpene biosynthesis in cotton plants 647

Fig. 2. Analysis by RT-PCR of cad1-A and cad1-C transcripts of G. arboreum seedlings. For negative controls ()), no template DNA was added; for positive controls (+), the cDNA clones of either cad1- C1 or cad1-A (10 ng of plasmid DNA) were used as the template. The cad1-A product is 488 bp, and the cad1-C1 product 222 bp. The histone-3 mRNA was analyzed as an internal standard. The PCR was performed by 28 cycles of ampli®cation, with speci®c primers (see Materials and methods)

PCR, with primers speci®c either for cad1-A or for cad1- C (including at least at cad1-C1 and cad1-C3). Tran- scripts of neither cad1-A nor cad1-C were detectable in roots of 1-d-old seedlings, but the mRNAs appeared on the second day post germination, and steady-state levels Fig. 3A,B. Speci®c activities of the sesquiterpene cyclase (A)and were then maintained relatively stable throughout the accumulation of sesquiterpene aldehydes (B)inG. arboreum seedlings. investigation period of 7 d (Fig. 2). Ampli®cation by The amount of sesquiterpene aldehydes is given as gossypol equivalent PCR revealed a clear cad1-C band and a weak cas1-A band, indicating a lower level of cad1-A transcripts than cad1-C transcripts. Analysis of cotyledons showed an aldehydes accumulated rapidly after 5 d post germina- opposite pattern: transcripts of both the cad1-A and tion. In cotyledons, the level was found to be largely cad1-C were detected in 1-d-old seedlings; thereafter, the stable, whereas in hypocotyls, a slow accumulation of transcripts decreased to undetectable levels (Fig. 2). It is sesquiterpene aldehydes was found up to 5 d post not clear whether these transcripts resulted from gene germination, then the level decreased (Fig. 3B). transcription during seed germination, or were remnants in the seeds. The transcripts were not detected in Analysis of aerial organs of plants. The expression of hypocotyls, possibly due to the low level of cad1 cad1-C and cad1-A in ¯owers, pericarps (bolls), stems transcription. However, because of the diculty of and leaves were also analyzed by RT-PCR. A signi®cant obtaining a good quality RNA from the hypocotyl, low level of cad1-C mRNA was found in sepals and petals levels of transcripts cannot be excluded, as, with histone- collected 3 d before anthesis, but not at the day of 3 primers, only weak RT-PCR bands were obtained anthesis (Fig. 4), nor afterwards (data not shown). The (data not shown). cad1-C transcripts were also detected in pericarps 4 d Speci®c activities of sesquiterpene cyclases were after anthesis, as well as in young stems and leaves. To detectable in 1-d-old seedlings. In roots, the activity the contrary, the cad1-A transcripts were not detected in clearly increased on the 7th day post germination. In these organs, although the gene was found to be cotyledons and hypocotyls, although variation during expressed in developing seeds (Meng et al. 1999), the ®rst 2 d post germination was insigni®cant, the elicitor-treated suspension cells (Chen et al. 1996) and activity decreased to almost undetectable levels on the roots of seedlings as described above. The cad1-C 7th day (Fig. 3A). Total sesquiterpene aldehydes in mRNA levels were found to be higher in pericarps and seedlings were then quantitatively analyzed with the petals than in sepals, leaves and stems. Consistently, the phloroglucinol/HCl reagent. In roots, sesquiterpene sesquiterpene aldehyde contents in sepals and pericarps 648 X.-P. Tan et al.: Sesquiterpene biosynthesis in cotton plants

Fig. 5A,B. Tissue printing analysis of the CAD1 proteins (A)and accumulation of sesquiterpene aldehydes (B)instemsofG. hirsutum L. cv. GL-5, a glandless cultivar. For treatments see Fig. 6.

signi®cantly, due to a high basal level in untreated stems (Fig. 6); similarly, the sesquiterpene aldehyde contents were increased only slightly after elicitation. The RT- Fig. 4A,B. Analysis by RT-PCR of cad1 gene transcription (A)and PCR analysis demonstrated that the cad1-C genes were accumulation of sesquiterpene aldehydes (B)inG. arboreum aerial organs. In negative controls ()), the cDNA clone of cad1-A, or transcribed at a similar level in G. arboreum stems both cad1-C1 (10 ng plasmid DNA each), was used as the template in before and after elicitor-treatment, but the cad1-A the PCR ampli®cation using primers speci®c for cad1-C (including mRNA appeared only after elicitation (Fig. 6). A low cad1-C1 and cad1-C3), or cad1-A, respectively. The same positive control (+) as in Fig. 2 was used. Total RNAs, or sesquiterpene aldehydes, were isolated from pericarps 4 d post anthesis (1); stems 5 cm below the stem apex (2); leaves 3 d post sprouting (3); sepals 3 d before anthesis (3dba)(4); petals 3 d before anthesis (5 ); sepals at the day of anthesis (0 dpa)(6); and petals at the day of anthesis (7 ) were also the highest (Fig. 4). In petals the relative level of sesquiterpene aldehydes dropped to a lower level (about half) at the day of anthesis, whereas in sepals the level slightly increased. These results indicate that the cad1-C genes (including at least cad1-C1 and cad1-C3), but not the cad1-A, are expressed in stems, leaves and corollas, and the expression in corollas is highly regulated by development.

Induced expression in stems. In stems of G. hirsutum L. cv. GL-5, a glandless cotton cultivar, neither the cad1 transcripts, nor sesquiterpene aldehydes, were detected. When stems of this cultivar were treated with a V. dahliae elicitor preparation, transcription of cad1-C was activated. Tissue-printing analysis showed a de- novo formation of the CAD proteins in the treated region, followed by induced accumulation of sesquiter- Fig. 6A,B. Tissue printing analysis of the CAD1 proteins (A)and accumulation of sesquiterpene aldehydes (B)inG. arboreum stems. pene aldehydes (Fig. 5). However, when stems of The stems (5 cm below the stem apex) were treated by injecting 200 ll G. arboreum were treated with the same elicitor, the of a V. dahliae elicitor-preparation, or 200 ll of ddH2O, and collected amount of cadinene synthase proteins did not increase 8 d post treatment X.-P. Tan et al.: Sesquiterpene biosynthesis in cotton plants 649

Alchanati et al. (1998) reported an apparently induced transcription of the CAD genes in cotton stele tissues infected by V. dahliae. Similar results were obtained here by RT-PCR analysis of G. hirsutum cv. GL-5, but the cad1-A transcripts were not detected in this glandless cultivar even after elicitor-treatment. Di€erent kinetics were observed for the steady-state levels of cad1 transcripts, sesquiterpene cyclase activities, and sesquiterpene aldehyde contents in G. arboreum seedlings. This may be explained by the fact that active transcription of cad1 genes and biosynthesis of the Fig. 7. Analysis by RT-PCR of the induced transcription of cad1 cyclase proteins take place during seed development, genes in the stems of G. arboreum and G. hirsutum L. cv. GL-5. The resulting in a high concentration of sesquiterpene PCR was performed through 26 cycles of ampli®cation, and the aldehydes accumulating in pigmented glands of mature products were hybridized with 32P-labeled cad1-C1 or cad1-A probes, seeds (Meng et al. 1999). The enzyme appears to remain respectively. Total RNAs were isolated from untreated G. arboreum active only for a short period after seed germination. In stems (1); ddH2O-treated G. arboreum stems (2); elicitor-treated G. arboreum stems (3); untreated G. hirsutum L. cv. GL-5 stems (4); cotyledons, pigmented glands and sesquiterpene alde- hydes are formed during seed maturation (Meng et al. ddH2O-treated G. hirsutum L. cv. GL-5 stems (5); and elicitor-treated G. hirsutum L. cv. GL-5 stems (6). The stems were collected 2 d post 1999). In the hypocotyl there is only a temporal treatment. For controls see Fig. 4 formation of sesquiterpenoids. However, for roots, activation of cad1 genes shortly after seed germination and a continuous formation of sesquiterpene aldehydes level of cad1-A transcripts was also detected in G. ar- correlate well with rapid growth and expansion of the boreum stems treated with distilled water, and this may root system. The higher mRNA level of cad1-C than be ascribed to wounding-induction, but infection by cad1-A detected in roots may be partially due to the fact other pathogens during injection could not be fully that there are several members of cad1-C, but only one excluded. copy of cad1-A, and the cad1-C-speci®c primers might When the PCRs were performed by 26 cycles of also work with other members of the subfamily, in ampli®cation and the products were hybridized with the addition to cad1-C1 and cad1-C3, because of their high probes prepared from cDNAs of cad1-C1 or cad1-A, sequence identities. respectively, speci®c hybridizing bands con®rmed pre- The present investigation found that there was a high vious RT-PCR analysis (Fig. 7). Thus, these results level of cad1-C mRNAs in sepals and petals before indicate that the expression of speci®c members of the anthesis, and that the transcription ceased after anthesis. sesquiterpene cyclase genes can be induced by fungal The monoterpene synthase, S-linalool synthase (LIS), elicitation at the transcriptional level. The cad1-C genes showed a similar developmentally regulated expression were constitutively expressed in the stem of G. arboreum in petals of Clarkia breweri (Dudareva et al. 1996). The and expression was induced in the glandless cultivar LIS mRNA levels peaked 1 d before anthesis, and G. hirsutum L. cv. GL-5, whereas cad1-A gene expres- dropped to an undetectable level after day 2 post sion was induced in the G. arboreum stems, but not in anthesis. The physiological relevance of this down- stems of G. hirsutum L. cv. GL-5, even after elicitation. regulation of biosynthesis of secondary terpenoids, Whether transcription of cad1-A can be activated by particularly in relation to anthocynin biosynthesis in other elicitors, or in other glanded or glandless cotton developing petals, needs further investigation. cultivars, requires further investigation. Although, a developmentally regulated expression of the tobacco sesquiterpene cyclase gene has not been reported, the eas4 promoter showed a strong induction Discussion in root and stem subepidermal cells and in the cells surrounding the vascular tissues, a pattern consistent In many plants the enzymes regulating plant secondary with antimicrobial responses (Yin et al. 1997). The sesquiterpene biosynthesis are encoded by a complex pattern of cad1 gene expression and sesquiterpene gene family, such as the sesquiterpene cyclase EAS of distribution in cotton seedlings similarly points to the tobacco (Facchini and Chappell 1992). Di€erent mem- plant need to generate a defense barrier. For cotton bers of the cotton cad1 family appear to be di€erentially plants, accumulation of sesquiterpenoids in lysigenous regulated. In G. arboreum, genes of the cad1-C subfam- glands of the aerial organs provides an e€ective protec- ily, such as cad1-C3, were found widely expressed in tion against insects and pests. In roots, the active tissues where there was an accumulation of sesquiter- transcription of cad1-C and cad1-A genes, and accumu- pene aldehydes, whereas the cad1-A transcripts were not lation of sesquiterpene aldehydes concomitant with root found in aerial parts of the plant except for developing development, form a continuous chemical barrier seeds, thus showing a much limited expression. How- against invading microorganisms. In Abies grandis, two ever, the cad1-A gene was activated in G. arboreum classes of sesquiterpene cyclases have been identi®ed. stems by elicitation with the V. dahliae elicitor. On the One class, represented by d-selinene synthase and basis of a Northern analysis using a cad1-C probe, c-humulene synthase, seems to be constitutive and 650 X.-P. Tan et al.: Sesquiterpene biosynthesis in cotton plants multi-product enzymes. A second class, including Bhattacharyya MK, Paiva NL, Dixon RA, Korth KL, Stermer BA d-cadinene synthase and a-bisabolene synthase, is char- (1995) Features of the hmg 1 subfamily of genes encoding acterized by a single dominant product and is induced by HMG-CoA reductase in potato. Plant Mol Biol 28: 1±15 Bell AA (1984) Morphology, chemistry and genetics of Gossypium stem-wounding (Steele et al. 1998b; Bohlmann et al. adaptations to pests. In: Timmermann BN, Steelink C, Loewus 1998a). In G. arboreum, however, it appears to be the FA (eds) Recent advances in phytochemistry, vol 18, Phyto- same sesquiterpene cyclase genes that are responsible for chemical adaptations to stress. Plenum Press, New York, pp both constitutive and induced formation of sesquiter- 197±232 pene aldehydes. Previous RT-PCR experiments showed Bell AA, Stipanovic RD (1977) The chemical composition, an activation of cad1-A transcription in developing biological activity, and genetics of pigment glands in cotton. Proceedings of the Beltwide Cotton Production Research cotton seeds (Meng et al. 1999), while the present study Conference. Atlanta, Georgia, Jan 10±12, pp 244±258 found that the same species of mRNA accumulated in Bohlmann J, Steele CL, Croteau R (1997) Monoterpene synthases seedling roots without any environmental stimulation, from grand ®r (Abies grandis): cDNA isolation, characteriza- and in stems only after elicitation. Since Southern tion, and functional expression of myrcene synthase, ())-(4S )- blotting identi®ed only one copy of the cad1-A subfam- limonene synthase, and ())-(1S,5S)-pinene synthase. J Biol ily in the G. arboreum genome (Fig. 1), it is clear that the Chem 272: 21784±21792 Bohlmann J, Crock J, Reinhard J, Croteau R (1998a) Terpenoid- same gene is regulated by both developmental and based defenses in conifers: cDNA cloning, characterization, and stress-responsible signals. Such complex expression pat- functional expression of wound-inducible (E)-a-bisabolene terns have also been reported for genes encoding synthase from grand ®r (Abies grandis). Proc Natl Acad Sci enzymes of the general phenylpropanoid pathway, such USA 95: 6756±6761 as phenylalanine ammonia-lyase and 4-coumarate:coA Bohlmann J, Meyer-Gauen G, Croteau R (1998b) Plant terpenoid ligase (Liang et al. 1989; Hau€e et al. 1991). synthases: molecular biology and phylogenetic analysis. Proc Natl Acad Sci USA 95: 4126±4133 Activation of genes in the sesquiterpenoid pathway is Brooks CJW, Watson DG, Freer IM (1986) Elicitation of capsidiol not limited to the cyclase only. In G. arboreum suspen- accumulation in suspended callus cultures of Capsicum annum. sion-cultured cells treated with fungal elicitors, tran- Phytochemistry 25: 1089±1092 scription levels of the FPP synthase and the Cappadocia M, Heizmann P, Dumas C (1993) Tissue printing and sesquiterpene cyclase were concomitantly increased, its applications in self-incompatibility studies. Plant Mol Biol along with induced sesquiterpene accumulation (Liu 23: 1079±1085 Chappell J (1995) Biochemistry and molecular biology of the et al. 1999). Transcriptional induction of 3-hydroxy-3- isoprenoid biosynthetic pathway in plants. Annu Rev Plant methyl-glutaryl CoA reductase (HMGR), an enzyme in Physiol Plant Mol Biol 46: 521±547 the core cytosolic isoprenoid pathway, has been reported Chen XY, Chen Y, Heinstein P, Davisson VJ (1995) Cloning, for plants of G. barbadence and G. hirsutum infected expression, and characterization of (+)-d-cadinene synthase: a with V. dahliae (Joost et al. 1995). The potato HMGR is catalyst for cotton phytoalexin biosynthesis. Arch Biochem also encoded by a complex gene family, and di€erential Biophys 324: 255±266 Chen XY, Wang MS, Chen Y, Davisson VJ, Heinstein P (1996) expression and induction of di€erent members has been Cloning and heterologous expression of a second cotton (+)-d- reported (Choi et al. 1992; Bhattacharyya et al. 1995). cadinene synthase. J Nat Prod 59: 944±951 These data indicate that a complex set of developmental Choi D, Ward BL, Bostock RM (1992) Di€erential induction and and environmental cues is transduced into an integrated suppression of potato 3-hydroxy-3-methyl-glutaryl coenzyme A spatial and temporal program for expression of genes reductase genes in response to Phytophthora infestans and to its encoding enzymes to regulate the synthesis of secondary elicitor arachidonic acid. Plant Cell 4: 1333±1344 Colby SM, Crock J, Dowdle-Rizzo B, Lemaux PG, Croteau R sesquiterpenes, participating in the multiple defense (1998) Germacrene C synthase from Lycopersicon esculentum responses of plants. cv. Vent Cherry tomato: cDNA isolation, characterization, and bacterial expression of the multiple product sesquiterpene This research was supported by the National Natural Science cyclase. Proc Natl Acad Sci USA 95: 2216±2221 Foundation of China (grants 39670473 and 39570460), the Davila-Huerta G, Hamada H, Davis GD, Stipanovic RD, Adams National Biotech Program of China (grant Z-17-02-04), and CM, Essenberg M (1995) Cadinane-type sesquiterpenes induced Shanghai Research Center of Life Science. in Gossypium cotyledons by bacterial inoculation. Phytochem- istry 39: 531±536 Davis EM, Chen Y-S, Essenberg M, Pierce ML (1998) cDNA References sequence of a (+)-delta-cadinene synthase gene (accession No. U88318) induced in Gossypium hirsutum L. by bacterial Alchanati I, Patel J, Liu J, Benedict CR, Stipanovic R, Bell A, Cui infection. Plant Physiol 116: 1192 Y, Magill CW (1998) The enzymatic cyclization of nerolidyl Davis EM, Tsuji J, Davis GD, Pierce ML, Essenberg M (1996) diphosphate by d-cadinene synthase from cotton stele tissue Puri®cation of (+)-d-cadinene synthase, a sesquiterpene cyclase infected with Verticillium dahliae. Phytochemistry 47: 961±967 from bacteria-inoculated cotton foliar tissue. Phytochemistry Alfandari D, Darribere T (1994) A simple PCR method for 41: 1047±1055 screening cDNA libraries. PCR Method Appl 4: 46±49 Dixon RA, Harrison MJ (1990) Activation, structure, and orga- Back K, Chappell J (1995) Cloning and bacterial expression of a nization of genes involved in microbial defense in plants. Adv sesquiterpene cyclase from Hyoscyamus muticus and its molec- Genet 28: 165±234 ular comparison to related cyclases. J Biol Chem 270: 7375±7381 Dixon RA, Paiva NL (1995) Stress-induced phenylpropanoid Back K, He S, Kim KU, Shin DH (1998) Cloning and bacterial metabolism. Plant Cell 7: 1085±1097 expression of sesquiterpene cyclase, a key branch point enzyme Dudareva N, Cseke L, Blanc VM, Pichersky E (1996) Evolution for the synthesis of sesquiterpenoid phytoalexin capsidiol in of ¯oral scent in Clarkia: novel patterns of S-linalool UV-challenged leaves of Capsicum annuum. Plant Cell Physiol synthase gene expression in the C. breweri ¯ower. Plant Cell 39: 899±904 7: 1137±1148 X.-P. Tan et al.: Sesquiterpene biosynthesis in cotton plants 651

Dudley MW, Dueber MT, West CA (1986) Biosynthesis of Meng YL, Jia JW, Liu CJ, Liang WQ, Heinstein P, Chen XY macrocyclic diterpene casbene in castor bean (Ricinus communis (1999) Coordinated accumulation of (+)-d-cadinene synthase L.) seedlings, changes in enzyme levels induced by fungal mRNAs and gossypol in developing seeds of Gossypium infection, and intracellular localization of the pathway. Plant hirsutum and a new member of the cad1 family from Physiol 81: 335±342 G. arboreum. J Nat Prod 62: 248±252 Essenberg M, Grover Jr PB, Cover EC (1990) Accumulation of Ren YY, West CA (1992) Elicitation of diterpene biosynthesis in antibacterial sesquiterpenoids in bacterially inoculated Go- rice (Oryza sativa) by chitin. Plant Physiol 99: 1169±1178 ssypium leaves and cotyledons. Phytochemistry 29: 3107±3113 Somssich IE, Hahlbrock K (1998) Pathogen defense in plants ± Facchini PJ, Chappell J (1992) Gene family for an elicitor-induced a paradigm of biological complexity. Trends Plant Sci 3: sesquiterpene cyclase in tobacco. Proc Natl Acad Sci USA 89: 86±90 11088±11092 Stanford EE, Viehoever A (1918) Chemistry and histology of the FuÈ tterer J, Gisel A, Iglesias V, KloÈ ti A, Kost B, Scheid MO, glands of the cotton plant, with notes on the occurrence of Neuhaus-Url G, Schrott M, Schillito R, Spangenberg G, Wang similar glands in related plants. J Agri Res Washington DC 13: ZY (1995) Standard molecular techniques for the analysis of 419±435 transgenic plants. In: Potrykus I, Spangenberg G (eds) Gene Starks CM, Back K, Chappell J, Noel JP (1997) Structural basis for transfer to plants. Springer, Berlin, pp 215±263 cyclic terpene biosynthesis by tobacco 5-epi-aristolochene Heinstein P (1985) Stimulation of sesquiterpene aldehyde forma- synthase. Science 277: 1815±1820 tion in Gossypium arboreum cell suspension cultures by conidia Steele CL, Crock J, Bohlmann J, Croteau R (1998a) Sesquiterpene of Verticillium dahliae. J Nat Prod 48: 907±915 synthases from grand ®r (Abies grandis): comparison of Hau€e KD, Paszkowski U, Schulze-Lefert P, Hahlbrock K, Dangl constitutive and wound-induced activities, and cDNA isolation, JL, Douglas CJA (1991) Parsley 4CL-1 promoter fragment characterization, and bacterial expression of d-selinene synthase speci®es complex expression patterns in transgenic tobacco. and c-humulene synthase. J Biol Chem 273: 2078±2089 Plant Cell 3: 435±443 Steele CL, Katoh S, Bohlmann J, Croteau R (1998b) Regulation of Hughes DW, Galau G (1988) Preparation of RNA from cotton oleoresinosis in grand ®r (Abies grandis): di€erential transcrip- leaves and pollen. Plant Mol Biol Rep 6: 253±257 tional control of monoterpene, sesquiterpene, and diterpene Joost O, Bianchini G, Bell AA, Benedict CR, Magill CW (1995) synthase genes in response to wounding. Plant Physiol 116: Di€erential induction of 3-hydroxy-3-methylglutaryl CoA re- 1497±1504 ductase in two cotton species following inoculation with Varner JE, Ye Z (1994) Tissue printing. FASEB J 8: 378±384 Verticillium. Mol Plant-Microbe Interact 8: 880±885 Vogel SB, Wildung M, Vogel G, Croteau R (1996) Abietadiene Ku'c J (1995) Phytoalexins, stress metabolism, and disease resis- synthase from grand ®r (Abies grandis) ± cDNA isolation, tance in plants. Annu Rev Phytopathol 33: 275±297 characterization, and bacterial expression of a bifunctional Lawton MA, Lamb CJ (1987) Transcriptional activation of plant diterpene cyclase involved in resin acid biosynthesis. J Biol defense genes by fungal elicitor, wounding and infection. Mol Chem 271: 23262±23268 Cell Biol 7: 335±341 VoÈ geli U, Chappell J (1988) Induction of sesquiterpene cyclase and Liang X, Dron M, Schmid J, Dixon RA, Lamb CJ (1989) suppression of squalene synthase activities in plant cell cultures Developmental and environmental regulation of a phenylala- treated with fungal elicitor. Plant Physiol 88: 1292±1296 nine ammonia-lyase-b-glucuronidase gene fusion in transgenic VoÈ geli U, Chappell J (1990) Regulation of sesquiterpene cyclase in tobacco plants. Proc Natl Acad Sci USA 86: 9284±9288 cellulase-treated tobacco cell suspension cultures. Plant Physiol Liu CJ, Heinstein P, Chen XY (1999) Expression pattern of genes 94: 1860±1866 encoding farnesyl diphosphate synthase and sesquiterpene Yin S, Mei L, Newman J, Back K, Chappell J (1997) Regulation of cyclase in cotton suspension-cultured cells treated with fungal sesquiterpene cyclase gene expression: characterization of an elicitor. Mol Plant-Microbe Interact 12: 1095±1104 elicitor- and pathogen-inducible promoter. Plant Physiol 115: McGarvey DJ, Croteau R (1995) Terpenoid metabolism. Plant Cell 437±451 7: 1015±1026