sign in sign up
<<
Home , Aristolochene synthase, Hydroperoxide lyase, Photosystem I, Photosystem II

[RESEARCH ARTICLE] pH Gradient Mitigation in the Leaf Cell Secretory Pathway Alters the Defense Response of Nicotiana benthamiana to Agroinfiltration

Philippe V. Jutras, Frank Sainsbury, Marie-Claire Goulet, Pierre-Olivier Lavoie, Rachel Tardif, Louis-Philippe Hamel, Marc-André D’Aoust, and Dominique Michaud*

* Corresponding author ([email protected])

SUPPLEMENTAL TABLES 1–9

PAGE 1

Supplemental Table S1 | Complete list of confidently identified following iTRAQ analysis

The complete list of proteins includes more than a thousand entries (see manuscript’s main text for more information on identification and selection in main dataset). Details for each entry are provided in Microsoft Excel document available online.

PAGE 2

Supplemental Table S2 | The 60 most upregulated proteins in empty vector (EV)-infiltrated leaves relative to non-infiltrated leaves

Accession Protein name Ratio

P23432 Glucan endo-1,3-beta-glucosidase 21.52

J9XUY3 Kunitz-type protease inhibitor (Fragment) 15.24 K4B8W8 Phospholipase A1-IIgamma-like 9.57 Q50LG4 Suberization-associated anionic peroxidase-like 8.87 D4IHB9 Kunitz-type trypsin inhibitor alpha chain-like 8.15 Q84LQ7 29 kDa chitinase-like thermal hysteresis protein 7.37 A0A0B5GNH2 Endoplasmic reticulum chaperone binding protein 6.66 Q43584 Probable carboxylesterase 15 6.15 K4C2W4 Protein - 6.08 P08252 Endochitinase 4 6.02 P07052 Pathogenesis-related R major form 5.96 M1BBJ6 Probable mannitol 5.60 Q9FR00 -binding CAST-like 5.47 Q9LW96 Inositol-3-phosphate synthase 5.07 Q2QFR3 proteinase aleuran 4.96 Q70G33 Hydroxycinnamoyl quinate 4.94 A0A059XN47 Polygalacturonase inhibitor protein 4.89 M1B584 DNA damage-inducible 1 4.88 Q9SSV1 Intracellular ribonuclease LX-like 4.64 K4B7Q7 Probable cinnamyl alcohol dehydrogenase 6 4.57 M1A9W5 Phosphoglycerate mutase family 4.51 U3PWQ0 Pathogen-related -like 4.36 A0A075EYT4 Peroxisomal acyl- oxidase 1A 4.29 F2VJF4 Miraculin-like protein 4.22 K4BRF6 Methyltransferase DDB_G0268948 4.19 Q6L5N5 Heat shock 70 kDa 17 4.15 M1AWJ2 Heat shock 70 (Hsp 70) family 4.10 Q03685 Luminal-binding protein 5 3.97 Q02200 Lignin-forming anionic peroxidase-like 3.94

PAGE 3

K4BF11 Peroxidase P7-like 3.91

C9DFB7 Protein disulfide isomerase 3.90 K4AR66 Peroxidase 2-like 3.86 V9TLJ9 12-oxophytodienoate reductase 1-like isoform X1 3.79 P80969 Tyramine N-feruloyltransferase 4 11-like 3.76 K4D1Z3 Pyruvate decarboxylase 1-like 3.69 K4CZD5 coatomer subunit delta-like 3.68 Q94KK8 Glutamate decarboxylase 4 3.67 P15797 Glucan endo-1,3-beta-glucosidase 3.60 Q03198 Proteinase inhibitor I-A 3.50 P14170 Osmotin 3.50 Q5NTA8 Putative 5-epi- 3.49 K4CGM9 Persulfide dioxygenase ETHE1 homolog, mitochondrial-like 3.49 K4BA67 Vacuolar-sorting receptor 6-like 3.33 Q43799 Apoplastic invertase 3.30 Q9XIY9 p27 precursor 3.24 M1CA03 psbP 1, chloroplastic 3.22 U3RJ91 Gamma aminobutyrate transaminase 3, chloroplastic 3.20 K4C735 2-alkenal reductase (NADP(+)-dependent) 3.11 K4C0M5 Carboxymethylenebutenolidase homolog 3.10 A0A0F6P9E3 Aldehyde dehydrogenase family 2 member C4 3.08 K4BT18 Uncharacterized protein 3.01 Q9SYX6 Glucan endo-1,3-beta-glucosidase 3.00 K4D5D7 LETM1 and EF-hand domain-containing 1, mitochondrial 2.99 M1CBR7 coatomer subunit delta-like 2.91 A0A068JKR2 Pathogenesis-related protein PR-10 2.90 M0ZX98 Subtilisin-like protease 2.89

K4C284 Glutamate decarboxylase-like 2.85 M1CL86 Dihydrolipoamide dehydrogenase precursor 2.84 P93344 Aldehyde dehydrogenase family 2 member B7-like 2.84

Q42964 Lignin-forming anionic peroxidase 2.81

PAGE 4

Supplemental Table S3 | The 60 most downregulated proteins in EV-infiltrated leaves relative to non-infiltrated leaves

Accession Protein name Ratio

K4CCP7 Elongation factor Ts 0.082 Q0PWS6 a-b binding CP24 10A, chloroplastic 0.093

Q0PWS5 -b binding CP26, chloroplastic 0.095 Q43797 Pyrophosphate-energized vacuolar membrane proton pump 0.098 P59702 II alpha subunit 0.098 A0A0A8WK76 Probable aquaporin PIP2-1 0.106 K4BKH7 Uncharacterized protein 0.106 Q40425 Glycine-rich RNA-binding -like 0.115 M1A0N1 Uncharacterized protein 0.118 K4C841 ACT domain-containing DS12, chloroplastic-like 0.123 K7WJR7 Chlorophyll a/b-binding protein 0.126 K4C4W2 Remorin a4-e8 0.127 P06290 ATP synthase CF0 subunit I () 0.128 I6N953 Photosystem II CP43 chlorophyll apo (chloroplast) 0.135 K4C7M7 ATP synthase subunit b , chloroplastic-like 0.141 P29302 reaction center subunit II, chloroplastic 0.143 M1DBW2 Ribosomal S12 (chloroplast) 0.144 M1A511 Photosystem I reaction center subunit N, chloroplastic 0.148 A0A075VUZ8 Photosystem II D2 (chloroplast) 0.151 Q84UU0 Photosystem I reaction center subunit XI, chloroplastic-like 0.152 K4CYL4 Cysteine synthase 1, mitochondrial 0.161 M1BRE6 rhodanese-like domain-containing 4, chloroplastic 0.165 A0A076L2F1 remorin 1 0.166 M1BAI7 Short-chain dehydrogenase TIC 32, chloroplastic-like 0.169 A8Y6H4 ATP synthase subunit beta (Fragment) 0.172 K4B0Q1 UPF0603 At1g54780, chloroplastic 0.175 K4AZT2 Curvature 1A, chloroplastic 0.176 Q9XEX8 remorin 1 0.179 A7XZB8 Thylakoid formation 1, chloroplastic 0.180

PAGE 5

K4CRS9 Chlorophyll a-b binding , chloroplastic 0.184

G9BRR3 oxygenase 1 0.196 Q84QE4 Thiamine thiazole synthase, chloroplastic 0.202 B5LAV6 Long chain acyl- synthetase 4-like 0.203 M1CRT2 Uncharacterized protein 0.205 A0A0C5B729 30S ribosomal protein S4, chloroplastic 0.208 P32980 ATP synthase delta chain, chloroplastic 0.209 K4B7F9 Uncharacterized protein 0.209 M1CCH8 Probable inactive serine threonine- kinase slob2 0.211 A0A0A1E5J9 Calcineurin B 3 0.218 A0A0C5AT01 Photosystem II protein D1 0.219 K4CHX2 Porphobilinogen deaminase, chloroplastic 0.220 A0A060B909 Cytochrome b6 0.221 A0A059Q6D7 Photosystem I apo A2 (chloroplast) 0.232 M0ZH09 rhodanese-like domain-containing 4, chloroplastic 0.235 A0A060BCE9 Photosystem I P700 apo A1 (chloroplast) 0.239 M1DZ44 Photosystem II CP47 chlorophyll apo (chloroplast) 0.241 K4C390 Phosphomethylpyrimidine synthase, chloroplastic 0.241 K4ASB8 Uncharacterized protein 0.244 M1BIE3 Uncharacterized protein 0.249 Q08935 29 kDa ribonucleo A, chloroplastic 0.252 K4C994 beta-glucosidase 3B-like 0.252 M0ZU44 Elongation factor Ts isoform 2 0.259 K4BLP5 COBW domain-containing 1 0.260 K4BML2 30S ribosomal S17, chloroplastic 0.263 H1AD87 ADP-ribosylation factor 8A 0.268 B3F8G9 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 0.270

K4BPJ2 Actin-depolymerizing factor 2 0.270 K4CXU8 Chlorophyll a-b binding 8, chloroplastic-like 0.273 H9CCH7 3-oxoacyl-[acyl-carrier- ] reductase 4-like 0.275

K4BXD1 30S ribosomal 3, chloroplastic-like 0.278

PAGE 6

Supplemental Table S4 | The 60 most upregulated proteins in M2-expressing leaves relative to EV-infiltrated leaves

Accession Protein name Ratio

M1DBW2 Ribosomal S12 (chloroplast) 2.58 M1A0N1 Uncharacterized protein 2.34 K4BLP5 COBW domain-containing 1 2.31 Q40425 Glycine-rich RNA-binding-like 2.28 K4CCP7 Elongation factor Ts 2.27 H2ESL0 Pathogenesis-related protein PR10 2.23 A0A088DBC4 Copper transport ATX1-like 2.16 K4CYL4 Cysteine synthase 1 2.11 A0A0C5B729 30S ribosomal protein S4 2.08 M1B359 Probable NAD(P)H dehydrogenase (quinone) FQR1-like 1 2.04 K4C4W2 Remorin 1 1.98 Q36570 Ribosomal S19 (chloroplast) 1.94 K4BF11 Peroxidase P7-like 1.93 A0A068JKR2 Pathogenesis-related protein PR-10 1.91 Q84QE4 Thiamine thiazole synthase, chloroplastic 1.89 M1D6E8 Ribulose bisphosphate carboxylase oxygenase large subunit 1.87 K4CHX2 Porphobilinogen deaminase, chloroplastic 1.85 Q2EZ42 Ribulose bisphosphate carboxylase/oxygenase large subunit 1.83 K4C390 Phosphomethylpyrimidine synthase, chloroplastic 1.82 P30155 50S ribosomal L27, chloroplastic 1.82 A0A076FNJ9 Delta-aminolevulinic acid , chloroplastic 1.75 M1A047 Huntingtin-interacting K 1.74 K4BV58 30S ribosomal S9, chloroplastic 1.74 K4C841 ACT domain-containing DS12, chloroplastic-like isoform X1 1.73 K4BML2 30S ribosomal S17, chloroplastic 1.72 K4DI37 50S ribosomal L6, chloroplastic 1.71 Q7YM65 Ribulose bisphosphate carboxylase large chain (Fragment) 1.71 E5FE88 Ribulose bisphosphate/carboxylase large subunit (Fragment) 1.69 K4DHX8 Heat shock factor-binding 1-like 1.68

PAGE 7

Q40893 Ribulose 1,5-bisphosphate carboxylase small subunit mRNA 1.67

M1A989 50S ribosomal L1, chloroplastic 1.66 M0ZY56 Plasma membrane ATPase 4 1.64 K4B9S5 ATP synthase gamma chain, chloroplastic 1.63 Q8S8W8 ATP synthase CF1 beta subunit (chloroplast) 1.63 A8Y6H4 ATP synthase subunit beta (Fragment) 1.61 M1BZW7 transketolase, chloroplastic 1.61 K4C7M7 ATP synthase subunit b , chloroplastic 1.60 K4C261 Serine hydroxymethyltransferase 4 1.59 A5A5A1 50S ribosomal L25 1.59 Q0PWS6 Chlorophyll a-b binding CP24 10A, chloroplastic 1.58 K4BG20 60S ribosomal L26-1 1.57 A0A076KWG9 Sedoheptulose-1,7-bisphosphatase, chloroplastic 1.54 K4BKH7 Uncharacterized protein 1.54 K4CNG0 50S ribosomal L19-2, chloroplastic-like 1.54 M1C888 Thioredoxin Y1, chloroplastic 1.53 M1C9L0 HIPL1 -like 1.52 K4BVS6 Thioredoxin CDSP32, chloroplastic 1.52 K4D5C2 Phosphoglycolate phosphatase 1B, chloroplastic-like 1.52 C3RXI5 Plastid transketolase 1.51 M0ZH09 Rhodanese-like domain-containing 4, chloroplastic 1.51 M1B9T8 Aspartate aminotransferase, cytoplasmic 1.51 K4BIC8 Probable calcium-binding CML13 1.51 K4BXD1 30S ribosomal 3, chloroplastic-like 1.50 S5ZIN5 Cysteine synthase 1.49 K4CR71 Actin-depolymerizing factor 1 1.48 M1BQT9 DJ-1 homolog D 1.48

M1BTP6 14-3-3 9 1.48 A0A059Q659 Ribosomal protein S8 1.48 M1CGN3 50S ribosomal L21, chloroplastic 1.48

A2IBL2 Core histone H2A H2B H3 H4 1.46

PAGE 8

Supplemental Table S5 | The 60 most downregulated proteins in M2-expressing leaves relative to ER-infiltrated leaves

Accession Protein name Ratio

J9XUY3 Kunitz-type protease inhibitor (Fragment) 0.088 Q50LG4 Suberization-associated anionic peroxidase-like 0.224 K4B8W8 Phospholipase A1-IIgamma-like 0.229 D4IHB9 kunitz-type trypsin inhibitor alpha chain-like 0.235 P07052 Pathogenesis-related R major form 0.276 P23432 Glucan endo-1,3-beta-glucosidase 0.324 Q02200 Lignin-forming anionic peroxidase-like 0.327 A0A077DCL8 Phosphoenolpyruvate carboxykinase [ATP]-like 0.343 K4B7Q7 Probable cinnamyl alcohol dehydrogenase 6 0.355 P93344 Aldehyde dehydrogenase family 2 member B7 0.368 Q84LQ7 29 kDa chitinase-like thermal hysteresis protein (Fragment) 0.375 Q03198 Proteinase inhibitor I-A 0.400 P08252 Endochitinase 4 0.407 Q02214 Trypsin inhibitor 1-like 0.425 K4CZD5 coatomer subunit delta-like 0.462 Q43584 Probable carboxylesterase 15 0.464 J9Y6P6 Salicylic acid-binding 2 0.470 Q70G33 Hydroxycinnamoyl quinate transferase 0.476 Q43799 Apoplastic invertase 0.482 M1B584 DNA damage-inducible 1 0.508 K4DBX2 ss-galactosidase precursor 0.512 O23792 Aspartic protease in guard cell 2-like 0.514 M1CV01 Far upstream element-binding 2-like 0.514 M1DAI9 Peroxidase 43-like 0.515 A0A077DBL0 Xyloglucan-specific fungal endoglucanase inhibitor 0.518 K4B139 Topless-related 3 isoform X2 0.518 F2VJF4 Miraculin-like protein 0.524 M1CA03 psbP 1, chloroplastic 0.525 Q6XP48 Bifunctional UDP-glucose 4-epimerase 0.527

PAGE 9

A0A0F7JLU6 Glyceraldehyde-3-phosphate dehydrogenase, cytosolic 0.531

M1BZ89 Dentin sialophospho 0.532 K4CXV5 Ribose-phosphate pyrophosphokinase 4 0.534 M0ZSU7 Probable splicing factor 3A subunit 1 0.536 M1A2M6 Patellin-3-like 0.543 D3TI69 Beta-hexosaminidase 2 0.552 B6EWX2 UDP-glycosyltransferase 73C1-like 0.553 K4BA67 Vacuolar-sorting receptor 6-like 0.568 U3RJ91 Gamma aminobutyrate transaminase 3, chloroplastic 0.575 W6JLY5 Nuclear-pore anchor 0.581 D2CFQ1 Phenylalanine ammonia- 0.586 K4CLS9 Galactose-binding domain 0.587 A0A0B5GNH2 Endoplasmic reticulum chaperone binding protein 0.598 Q42961 Phosphoglycerate kinase, chloroplastic 0.609 Q9LW96 Inositol-3-phosphate synthase 0.611 M0ZSK0 ATP-dependent Clp protease proteolytic subunit 5 0.612 Q8GUA3 Vacuolar invertase 0.612 A0A075EYT4 Peroxisomal acyl- oxidase 1A 0.619 Q5UNS2 Arginase 1, mitochondrial 0.619 Q9SSV1 Intracellular ribonuclease LX-like 0.620 K4D5D7 LETM1 and EF-hand domain-containing 1, mitochondrial 0.626 M1BAU4 Alpha-xylosidase 1-like 0.629 O24109 1-aminocyclopropane-1-carboxylate oxidase 0.632 B7U9Z3 ER luminal-binding protein 0.634 U3MXK9 Auxin-repressed kDa -like 0.634 M1CBR7 coatomer subunit delta-like 0.637 P14170 Osmotin 0.637

K4CLG9 Vacuolar sorting-associated 32 homolog 2-like 0.640 H1ZXA9 Heat shock cognate 70 kDa 2-like 0.642 K4B2H7 psbP domain-containing 1, chloroplastic 0.643

M0ZX98 Subtilisin-like protease 0.645

PAGE 10

Supplemental Table S6 | The 100 most abundant proteins in non-infiltrated (n.i.) leaves

# Accession Description Abundance Abundance Abundance n.i. EV M2

1 Q9XEX8 Remorin 226.1 40.5 54.0 2 P29302 Photosystem I reaction center subunit II, chloroplastic 224.8 32.2 35.6 3 A0A076L2F1 Remorin 1 223.1 37.0 48.4 4 M1A0N1 Uncharacterized protein 219.8 25.9 60.5 5 P59702 Cytochrome b559 subunit alpha 214.1 20.9 27.9 6 Q84QE4 Putative chloroplast thiazole biosynthetic protein 213.3 43.2 81.7 7 K4C841 Uncharacterized protein 211.8 26.0 45.2 8 Q84UU0 Photosystem I subunit XI 211.5 32.2 41.4 9 I6N953 Photosystem II CP43 reaction center protein 211.4 28.5 34.9 10 A8Y6H4 ATP synthase subunit beta (Fragment) 210.4 36.2 58.2 11 A0A075VUZ8 Photosystem II D2 protein 209.0 31.5 35.3 12 M1DBW2 Uncharacterized protein 205.9 29.7 76.6 13 Q43797 Inorganic pyrophosphatase 205.5 20.2 26.2 14 K4CCP7 Elongation factor Ts 205.3 16.9 38.2 15 P06290 ATP synthase subunit b, chloroplastic 204.9 26.1 34.4 16 Q0PWS5 Chloroplast pigment-binding protein CP26 201.6 19.1 22.8 17 A0A0A8WK76 Aquaporin PIP2 9b 200.2 21.3 27.4 18 K4C7M7 ATP synthase subunit b', chloroplastic-like 199.4 28.2 45.0 19 M1CRT2 Uncharacterized protein 197.2 40.4 49.9 20 A0A0C5AT01 Photosystem II protein D1 196.8 43.1 46.4

PAGE 11

21 Q0PWS6 Chloroplast pigment-binding protein CP24 196.1 18.2 28.7 22 K4C390 Thiamine biosynthesis protein ThiC-like 195.1 47.0 85.5 23 M1DZ44 Photosystem II CP47 reaction center protein 194.9 46.9 45.6 24 M0ZU44 Elongation factor Ts 194.0 50.3 61.2 25 A0A059Q6D7 Photosystem I P700 chlorophyll a apoprotein A2 193.7 44.9 54.8 26 A0A060BCE9 Photosystem I P700 chlorophyll a apoprotein A1 193.6 46.3 51.4 27 K4C4W2 remorin-like 193.2 24.6 48.9 28 M1BRE6 Chitinase-like 193.2 31.9 42.1 29 K4CIH7 tubulin alpha chain-like 193.0 56.7 59.7 30 K4CHX2 delta-aminolevulinic acid dehydratase, chloroplastic-like 191.8 42.2 78.1 31 K4CRS9 chlorophyll a-b binding protein CP29.2, chloroplastic-like 191.0 35.2 35.2 32 A7XZB8 Chloroplast-localized protein 190.7 34.3 45.9 33 K7WJR7 Chlorophyll a/b-binding protein 190.3 23.9 27.9 34 A0A0C5B729 30S ribosomal protein S4, chloroplastic 189.5 39.4 81.8 35 B3F8G9 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase 188.9 50.9 57.8 36 K4CNS6 elongation factor G, chloroplastic-like 187.9 59.7 59.2 37 Q08935 29 kDa ribonucleoprotein A, chloroplastic 186.6 47.1 62.7 38 K4C994 lysosomal beta glucosidase-like 186.6 46.9 42.2 39 K4AZT2 Uncharacterized protein 186.4 32.7 42.0 40 M1A511 Photosystem I reaction center subunit-like 185.9 27.5 37.2 41 A0A067YEL0 Zeta-carotene desaturase 185.7 57.8 56.5 42 M1CCH8 Chloroplast one-helix protein 2-like 185.0 39.1 53.0 43 O22436 -chelatase subunit ChlI, chloroplastic 183.5 66.1 66.4 44 E5L8B6 Plastid thioredoxin F 183.5 62.4 71.3

PAGE 12

45 K4BML2 30S ribosomal protein S17, chloroplastic-like 182.5 47.9 82.7 46 Q08937 29 kDa ribonucleoprotein B, chloroplastic 181.4 55.0 61.7 47 G9BRR3 Heme oxygenase 1 179.9 35.2 46.1 48 K4BKH7 Uncharacterized protein 179.5 18.9 29.2 49 P32980 ATP synthase delta chain, chloroplastic 179.2 37.5 44.5 50 K4B0Q1 UPF0603 protein At1g54780, chloroplastic-like 179.1 31.3 41.8 51 K4B7F9 Uncharacterized protein 179.0 37.3 47.9 52 K4ASB8 Uncharacterized protein 177.9 43.4 52.3 53 K4C5D0 em protein H5-like 176.4 88.0 62.9 54 A0A076L1Z5 Remorin 2 175.1 49.9 53.4 55 M1BAI7 Short-chain dehydrogenase TIC 32, chloroplastic-like 173.7 29.3 35.6 56 M1BIE3 -like 173.6 43.2 48.4 57 I0B7J8 Chloroplast PsbP4 172.9 63.5 63.9 58 A0A075F1U5 Protein phosphatase 171.2 71.4 63.7 59 K4D2P9 Thioredoxin reductase 171.0 68.3 66.8 60 M1BQ10 Ribulose-phosphate 3-epimerase, chloroplastic-like 170.8 52.9 54.8 61 K4B5N7 aspartic proteinase A1-like 170.6 95.9 73.5 62 Q40425 RNA-binding gricine-rich protein-1c 169.8 19.5 44.5 63 A7U629 Chloroplast methionine sulfoxide reductase B2 169.5 53.0 76.7 64 A0A076KWG9 Chloroplast sedoheptulose-1,7-bisphosphatase 168.1 63.3 97.7 65 M0ZH09 Chitinase-like 168.0 39.5 59.6 66 P30155 50S ribosomal protein L27, chloroplastic 167.9 50.8 92.5 67 K4AVZ4 30S ribosomal protein S1, chloroplastic-like 167.7 47.2 60.3 68 A0A0A1E5J9 CBL3 protein 167.7 36.5 49.4

PAGE 13

69 K4BM77 histidine--tRNA -like 167.7 59.3 68.3 70 Q93YF8 167.4 55.9 63.1 71 H9CCH7 Beta-keto-ACP reductase 166.1 45.7 46.3 72 Q9M7J4 MAR-binding filament-like protein 1-1 165.8 63.9 58.8 73 K4BXD1 30S ribosomal protein 3-1, chloroplastic-like 165.8 46.0 68.9 74 A4D0J8 (Fragment) 165.6 93.3 84.8 75 K4B6T0 CBS domain-containing protein CBSX1, chloroplastic-like 164.6 47.6 58.1 76 M1BLY4 High mobility group protein 2 HMG2-like 164.4 58.7 70.8 77 Q42967 Uroporphyrinogen decarboxylase, chloroplastic 164.2 64.8 83.1 78 K4CXU8 Chlorophyll a-b binding protein 8, chloroplastic-like 164.0 44.8 51.1 79 O80362 50S ribosomal protein L10, chloroplastic 163.6 58.3 59.2 80 M0ZND0 50S ribosomal protein L5-like 163.5 61.2 89.0 81 J7HAR8 ATP synthase epsilon chain, chloroplastic 163.1 52.9 70.9 82 K4CYL4 Cysteine synthase 162.5 26.2 55.4 83 A0A059Q659 Ribosomal protein S8 161.8 58.9 87.2 84 K4CBJ8 Uncharacterized protein 161.2 69.3 91.0 85 M1BB01 Aldo/keto reductase-like 160.5 66.3 79.1 86 K4BPJ2 actin-depolymerizing factor 2-like 160.3 43.3 62.4 87 H1AD87 ADP-ribosylation factor-like 8a 159.7 42.8 52.7 88 M1A587 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase-like 159.1 71.6 69.4 89 M1B588 Fasciclin-like arabinogalactan protein 10-like 158.7 65.2 78.0 90 S6A7M4 Cysteine synthase 158.1 61.7 83.2 91 I0B7J9 Chloroplast PsbQ1 157.2 61.1 56.0 92 K4BK33 Uncharacterized protein 157.2 52.2 72.3

PAGE 14

93 Q08948 33 kd chloroplast ribonucleoprotein 157.1 69.6 86.2 94 Q7XZV3 24K germin like protein 157.0 77.5 89.0 95 K4BM64 Peptidyl-prolyl cis-trans isomerase 156.8 51.4 58.8 96 J7EYL4 GRX1 155.2 55.8 59.2 97 K4DI37 50S ribosomal protein L6, chloroplastic-like 155.1 48.1 82.3 98 A5A5A1 Ribosomal protein L25 154.9 54.8 87.0 99 Q94IK1 Subunit A of -thioredoxin-reductase 154.8 70.9 71.0 100 B2LT58 Elongation factor 1 gamma-like protein 154.7 55.3 51.7

PAGE 15

Supplemental Table S7 | The 100 most abundant proteins in EV-infiltrated leaves

# Accession Description Abundance Abundance EV Abundance n.i. M2

1 J9XUY3 Kunitz-type protease inhibitor (Fragment) 18.8 286.2 25.1 2 K4B8W8 phospholipase A1-II 1-like 28.0 267.9 61.3 3 P23432 Glucan endo-1,3-beta-glucosidase 12.3 263.6 85.3 4 P07052 Pathogenesis-related protein R minor form 41.3 245.9 67.8 5 Q50LG4 Peroxidase 25.0 222.2 49.8 6 K4B7Q7 probable cinnamyl alcohol dehydrogenase 6-like 46.1 210.9 74.9 7 Q9LW96 Inositol-3-phosphate synthase 39.7 200.9 122.7 8 Q70G33 Hydroxycinnamoyl CoA quinate transferase 40.5 200.1 95.2 9 M1CA03 Thylakoid lumenal 25.6 kDa protein, chloroplast-like 59.9 192.9 101.2 10 Q84LQ7 29 kDa chitinase-like thermal hysteresis protein (Fragment) 26.2 192.7 72.2 11 M1B584 DNA damage-inducible protein 1-like 39.3 191.6 97.3 12 Q43584 HSR203J 31.1 191.0 88.7 13 D4IHB9 Nb cell deth marker 23.3 190.3 44.8 14 K4CZD5 coatomer subunit delta-2-like 51.4 189.2 87.3 15 P08252 Endochitinase A 31.4 189.1 77.0 16 A0A0B5GNH2 Endoplasmic reticulum chaperone binding protein 28.3 188.3 112.6 17 J9Y6P6 Salicylic acid-binding protein 2 65.9 179.2 84.3 18 O23792 CND41, chloroplast nucleoid DNA binding protein 75.6 179.1 92.0 19 D3TI69 Beta-hexosaminidase 74.5 173.0 95.5 20 A0A075EYT4 Acyl-coenzyme A oxidase 40.1 172.0 106.4

PAGE 16

21 K4C2W4 Protein disulfide-isomerase 28.2 171.5 121.2 22 Q2QFR3 Cysteine proteinase aleuran type 34.3 169.8 122.3 23 U3RJ91 Mitochondrial gamma aminobutyrate transaminase 1 52.3 167.3 96.3 24 K4B139 topless-related protein 3-like 59.9 165.6 85.9 25 Q02200 Lignin-forming anionic peroxidase 42.0 165.3 54.0 26 Q5UNS2 Arginase 1 65.7 165.2 102.2 27 K4D5D7 LETM1 and EF-hand domain-containing protein 1 55.1 165.0 103.3 28 K4CXV5 ribose-phosphate pyrophosphokinase 4-like 59.6 164.2 87.7 29 K4BA67 vacuolar-sorting receptor 6-like 48.9 163.1 92.7 30 M0ZX98 P69F protein-like 56.2 162.7 105.0 31 Q03685 Luminal-binding protein 5 40.9 162.2 116.3 32 M1A9W5 PRIB5 protein-like 35.8 161.5 110.5 33 M1CBR7 Coatomer delta subunit-like 55.5 161.2 102.7 34 D2CFQ1 Phenylalanine ammonia-lyase 68.7 160.9 94.3 35 Q9FR00 Avr9/Cf-9 rapidly elicited protein 31 29.4 160.8 121.2 36 A0A059XN47 Polygalacturonase inhibitor protein 32.7 159.7 107.0 37 B7U9Z3 ER luminal-binding protein 58.6 159.5 101.0 38 W6JLY5 Nuclear pore complex protein TPRa 73.0 157.5 91.5 39 M1AWJ2 Heat shock protein 70-like 38.2 156.6 123.0 40 K4C735 NADP-dependent alkenal double bond reductase P1-like 50.2 156.3 103.7 41 C9DFB7 Protein disulfide isomerase (Fragment) 40.1 156.0 117.4 42 K4B2H7 psbP domain-containing protein 1, chloroplastic-like 79.1 155.5 99.9 43 M1AP43 Pyrroline-5-carboxylate reductase 64.3 154.4 129.3 44 Q6L5N5 Heat shock protein 70 (Fragment) 37.2 154.3 122.4

PAGE 17

45 A0A077DCL8 Phosphoenolpyruvate carboxykinase 76.1 153.0 52.5 46 K4CGM9 hydroxyacylglutathione 3, mitochondrial-like 43.5 151.8 114.8 47 Q8GUA3 Vacuolar invertase 77.7 151.6 92.8 48 V9TLJ9 12-oxophytodienoate reductase 1 39.9 151.5 114.2 49 C9DFB6 Uncharacterized protein 67.9 150.6 123.1 50 A9YTW5 Putative red chlorophyll catabolite reductase 60.6 150.5 118.6 51 C5IJ81 Calmodulin isoform 1 66.3 150.2 100.0 52 K4BUA0 E3 ubiquitin-protein ligase UPL2-like 72.0 150.0 105.2 53 A0A075F2G1 Gamma-glutamylhydrolase 2 69.3 149.8 115.1 54 K4AR66 Peroxidase 38.7 149.4 106.8 55 M1BZ89 Hypothetical salt-inducible protein 79.1 149.4 79.5 56 K4CDS7 Uncharacterized protein 70.3 149.1 115.8 57 K4B985 splicing factor 3B subunit 2-like 76.0 148.8 96.7 58 Q9SQI4 Centrin 63.8 148.7 101.6 59 K4BIU3 89.8 148.4 99.1 60 Q67C43 Glutamate dehydrogenase alpha subunit (Fragment) 58.8 148.3 111.6 61 M1BBJ6 10-hydroxygeraniol oxidoreductase-like 26.4 148.0 104.5 62 M1A0K5 Signal recognition particle 9 kDa protein 60.7 147.9 115.3 63 E0X585 Mitochondrial glycine decarboxylase complex P-protein-like 75.3 147.7 109.3 64 K4BNN0 IST1 homolog-like 60.1 147.6 116.0 65 Q42964 Peroxidase 52.1 146.6 130.6 66 Q43799 Beta-fructosidase (Beta-fructofuranosidase) 44.3 146.5 70.6 67 B6EWX2 Glycosyltransferase 68.0 146.5 80.9 68 M0ZHY6 Serine carboxypeptidase-like 51-like 82.9 146.4 108.7

PAGE 18

69 U3PWQ0 EF2 protein 33.6 146.3 116.6 70 M0ZKF0 H+-transporting two-sector ATPase-like 85.6 145.6 101.1 71 Q94KK8 Glutamate decarboxylase 39.7 145.5 135.5 72 Q42896 Fructokinase-2 63.3 145.5 109.6 73 K4BT18 TOM1-like protein 2-like 48.0 144.8 100.5 74 M0ZSU7 Spliceosome associated protein 83.1 144.6 77.6 75 W6JPQ8 Nuclear pore complex protein Nup50d 73.5 144.0 103.2 76 K4BLV4 glutamyl-tRNA(Gln) amidotransferase subunit A-like 71.5 143.8 104.2 77 K4D1Z3 pyruvate decarboxylase isozyme 2-like 39.0 143.8 131.9 78 K4C2H1 nitrilase homolog 1-like 69.8 143.7 105.4 79 M1BAA1 Copine I-like 57.1 143.6 104.7 80 K4C247 60S ribosomal protein L13a-4-like 73.6 143.3 113.5 81 Q6XP48 UDP-Glc-4-epimerase 69.6 143.2 75.4 82 M0ZSX2 Purple acid phosphatase 58.9 143.1 119.2 83 K4CLG9 vacuolar protein sorting-associated protein 32 homolog 62.7 142.7 91.3 84 W6JJ80 Nuclear pore complex protein Nup50c 81.3 142.7 94.1 85 H1ZXA9 Heat shock protein 70 isoform 3 70.2 142.7 91.6 86 Q41229 Photosystem I reaction center subunit IV B, chloroplastic 94.2 142.1 93.4 87 Q40473 PS60 protein 94.7 141.9 95.5 88 K4BZ96 3-hydroxyisobutyryl-CoA hydrolase-like protein 3 70.8 141.8 107.1 89 M1BAU4 Alpha-glucosidase 110.6 141.7 89.1 90 Q6QD77 Glutathione reductase (Fragment) 65.4 141.4 112.4 91 K4CEA5 peroxiredoxin Q, chloroplastic-like 72.5 141.1 110.7 92 K4BAN9 26S proteasome non-ATPase regulatory subunit 4-like 70.6 141.0 101.3

PAGE 19

93 K4DBX2 Beta-galactosidase 61.1 140.6 71.9 94 P25872 Phenylalanine ammonia-lyase 66.9 140.6 107.2 95 C3VP56 SnRK2 calcium sensor 87.2 140.5 101.4 96 Q42961 Phosphoglycerate kinase, chloroplastic 84.2 140.5 85.6 97 K4CLR1 Lactoylglutathione lyase 92.6 140.5 98.0 98 B5LAW1 Putative aminotransferase 61.4 140.5 116.3 99 K4C284 Glutamate decarboxylase 49.3 140.5 133.9 100 K4DF79 Cytochrome c oxidase subunit 5b-2, mitochondrial-like 67.8 140.5 108.4

PAGE 20

Supplemental Table S8 | The 100 most abundant proteins in M2-expressing leaves

# Accession Description Abundance Abundance EV Abundance n.i. M2

1 K4BF11 Peroxidase 24.6 96.2 185.6 2 H2ESL0 Pathogenesis-related protein PR10 29.3 79.3 176.6 3 A0A068JKR2 Pathogenesis-related protein PR-10 31.4 91.1 173.9 4 K4C261 Serine hydroxymethyltransferase 44.7 107.1 170.9 5 Q5NTA8 Putative 5-epi-aristolochene synthase (Fragment) 33.6 117.2 156.7 6 A1BQW9 Transketolase (Fragment) 66.9 111.5 156.5 7 C3RXI5 Plastid transketolase 78.2 100.2 151.6 8 Q42962 Phosphoglycerate kinase, cytosolic 64.9 99.0 144.8 9 Q68HC9 Glucose-6-phosphate isomerase 53.8 117.9 144.3 10 A0A0F6P9E3 Aldehyde dehydrogenase 1 37.5 115.5 143.4 11 A0A076FN11 Glucose-6-phosphate isomerase 52.0 123.8 143.1 12 M1CRA7 Alpha-1,4 glucan phosphorylase 64.0 113.3 140.7 13 P80969 Tyramine N-feruloyltransferase 10/30 25.6 96.3 139.9 14 Q2V9C6 Phosphoglycerate kinase 69.5 104.7 137.4 15 J7ERA8 Hydroxycinnamoyl transferase (Fragment) 42.4 105.7 136.3 16 Q94KK8 Glutamate decarboxylase 39.7 145.5 135.5 17 Q5M9V4 ATP synthase subunit alpha 51.0 110.7 135.0 18 K4C0M5 protein usf-like 45.0 139.6 134.6 19 K4BHG4 Alpha-1,4 glucan phosphorylase 64.9 122.2 134.3 20 K4C284 Glutamate decarboxylase 49.3 140.5 133.9

PAGE 21

21 Q84KK7 Respiratory burst oxidase homolog 45.3 103.2 133.6 22 O81101 Glutamate decarboxylase 60.5 136.7 132.8 23 K4BCV4 Serine hydroxymethyltransferase 79.1 105.1 132.8 24 K4D1Z3 pyruvate decarboxylase isozyme 2-like 39.0 143.8 131.9 25 K4BRF6 putative methyltransferase DDB_G0268948-like 31.3 131.0 130.8 26 Q42964 Peroxidase 52.1 146.6 130.6 27 A0A077D830 Superoxide dismutase copper chaperone isoform 1 57.3 98.1 129.4 28 M1AP43 Pyrroline-5-carboxylate reductase 64.3 154.4 129.3 29 K4BMT2 60S ribosomal protein L28-1-like 89.6 107.4 129.2 30 K4CPW9 probable inactive purple acid phosphatase 27-like 40.1 105.4 129.1 31 K4DHU7 ATP-citrate synthase beta chain protein 1-like 47.9 125.7 128.8 32 M0ZKA6 Aspartate carbamoyltransferase-like 91.3 96.0 128.6 33 M1B9T8 Aspartate aminotransferase 88.6 85.2 128.5 34 K4BKV2 1, chloroplastic-like 64.7 114.7 126.1 35 A0A076KWG3 Transaldolase 52.7 125.0 126.1 36 Q9SYX6 Beta-1,3-glucanase 45.2 135.6 126.0 37 A0A088DBC4 Copper chaperone 93.8 58.2 125.6 38 M1A7X7 Ribosomal protein L28-like 80.5 111.7 125.5 39 M1BE70 short chain alcohol dehydrogenase-like 73.4 119.5 125.1 40 K4C945 chloroplast stem-loop binding protein, chloroplastic-like 105.9 96.3 125.0 41 M1C9L0 HIPL1 protein-like 41.5 81.6 124.3 42 B3F8G6 2-C-methyl-D-erythritol 4-phosphate cytidyltransferase 78.1 136.8 124.0 43 Q006Q0 Malic 38.6 89.6 123.5 44 K4BUB7 Serine hydroxymethyltransferase 76.4 110.9 123.1

PAGE 22

45 C9DFB6 Putative uncharacterized protein (Fragment) 67.9 150.6 123.1 46 M1D0I5 Oligopeptidase A-like 56.4 115.3 123.1 47 M1AWJ2 Heat shock protein 70-like 38.2 156.6 123.0 48 M1BAZ0 Heat shock 70 kDa protein-like 49.9 139.6 123.0 49 Q9LW96 Inositol-3-phosphate synthase 39.7 200.9 122.7 50 M1CAU6 60S ribosomal protein L22-like 92.8 104.6 122.7 51 Q6L5N5 Heat shock protein 70 (Fragment) 37.2 154.3 122.4 52 Q2QFR3 Cysteine proteinase aleuran type 34.3 169.8 122.3 53 Q9AXU4 Threonine dehydratase 66.5 129.7 122.0 54 Q07761 60S ribosomal protein L23a 99.7 102.7 121.4 55 K4C8G1 protein SET-like 72.5 124.8 121.4 56 Q9FR00 Avr9/Cf-9 rapidly elicited protein 31 29.4 160.8 121.2 57 K4C2W4 Protein disulfide-isomerase 28.2 171.5 121.2 58 M1B4H5 Calnexin-like 60.8 98.7 121.2 59 K4ATQ3 probable peptidyl-prolyl cis-trans isomerase-like 61.8 124.4 121.1 60 Q84LF0 5-epi-aristolochene synthase 2 72.7 113.5 120.8 61 A0A060Q2U8 Aminoacylase-1 54.0 133.6 120.8 62 K4AT98 Cystatin-like 87.6 88.7 120.5 63 K4CLC9 Serine hydroxymethyltransferase 87.1 105.0 120.3 64 K4CJ96 6,7-dimethyl-8-ribityllumazine synthase 111.0 103.9 120.2 65 M1CXI6 Aspartate aminotransferase 109.2 97.2 119.8 66 K4B1S7 60S ribosomal protein L3-like 69.1 137.0 119.8 67 Q9FSF0 Malate dehydrogenase 80.8 105.9 119.7 68 M0ZY56 Plasma membrane H+-ATPase-like 78.4 72.7 119.3

PAGE 23

69 M0ZSX2 Purple acid phosphatase 58.9 143.1 119.2 70 M0ZVS8 Alpha-mannosidase 72.6 118.5 118.7 71 M1BCZ9 Lactoylglutathione lyase 88.6 106.8 118.6 72 A9YTW5 Putative red chlorophyll catabolite reductase 60.6 150.5 118.6 73 K4BJK7 40S ribosomal protein S3a 89.9 106.5 118.6 74 K4CBV6 60S ribosomal protein L7-3-like 98.8 92.5 118.6 75 K4BIC0 glutamate synthase 1 [NADH], chloroplastic-like 75.0 94.6 118.5 76 P17614 ATP synthase subunit beta, mitochondrial 74.9 105.2 118.5 77 K4B2Y6 kynurenine formamidase-like 52.9 124.5 118.4 78 M0ZTU6 Double-stranded DNA-binding protein-like 83.1 100.4 118.1 79 E5FE88 Ribulose-1,5-bisphosphate/carboxylase large subunit 94.9 70.0 118.0 80 K4BBN0 ferredoxin-thioredoxin reductase catalytic chain 108.1 92.7 118.0 81 B1Q486 Aconitate hydratase 60.0 113.1 117.9 82 K4APY0 Eukaryotic translation initiation factor 6 75.8 108.8 117.8 83 M1AUG5 Ribosomal protein-like 91.7 113.0 117.7 84 K4CXX8 Proteasome subunit alpha type 69.0 127.6 117.6 85 K4CVC2 fumarate hydratase 1, mitochondrial-like 79.0 95.3 117.6 86 M1B9J5 Globulin-like 59.5 121.5 117.5 87 M1CRA9 drought-induced protein SDi-6-like 80.1 83.2 117.5 88 C9DFB7 Protein disulfide isomerase (Fragment) 40.1 156.0 117.4 89 Q6RYC4 Ribosomal protein L19 86.3 118.9 117.4 90 K4B7K2 14 kDa zinc-binding protein-like 73.8 134.3 117.4 91 B1Q484 Putative 4-methyl-5(B-hydroxyethyl)thiazol monophosphate 75.7 121.1 117.4 92 Q60CZ3 Ribulose-phosphate 3-epimerase, cytoplasmic isoform 76.7 111.3 117.4

PAGE 24

93 V9TI00 12-oxophytodienoate reductase 3 87.2 89.3 117.3 94 M1BNM8 Proteasome subunit alpha type 94.1 92.0 117.1 95 K4DHU5 huntingtin-interacting protein K-like 84.0 115.1 117.0 96 K4CQW8 Monodehydroascorbate reductase-like 60.4 105.2 116.9 97 M0ZN11 Aldo-keto reductase-like 76.9 123.8 116.9 98 K4B124 Uncharacterized protein 101.6 90.7 116.8 99 U3PWQ0 EF2 protein 33.6 146.3 116.6 100 P80461 Glutathione reductase, chloroplastic (Fragment) 96.0 98.1 116.6

PAGE 25

Supplemental Table S9 | DNA primers for the RT-qPCR amplifications

Amplicon Gene type Targeted gene Primer name Primer sequence (5' --- 3') Primer locat ion Tm (°C) size (bp) EF1for ACCAGATTAATGAGCCCAAGAG 662-683 60 NbEF1α 199 EF1rev AGAGCTTCGTGGTGCATCT 842-860 60 ACTfor1 TATGGAAACATTGTGCTCAGTGGT 886-909 61 NbACT 150 ACTrev1 TCCTCCAATCCAGACACTGTA 1015-1035 61 UBQfor CATCCAAATATCAACAGTAATGG 223-245 59 NbUBQ 108 UBQrev CAAAAGTGAGCAGATTGAAAGC 309-330 62 Reference genes SANDfor TCATCCGAGTTTTCCTCACC 1486-1505 63 NbSAND 161 SANDrev TGAGTAACCCAGCACAGCAG 1627-1646 63 VATPfor CTGGTGTTTTGGGTATTTATGG 185-206 61 NbVATP 130 VATPrev GCAAGACCACAAGCAAGACC 295-314 64 GAPDHfor GCAATCAAGGAGGAATCAGAG 796-816 62 NbGAPDH 202 GAPDHrev TCAAATCAATCACACGAGAGC 977-997 62 PDI713for GGTTGTTAGAGATACCCTCCAGG 1164-1186 62 NbPDI713 138 PDI713rev TCACTGTCAAACGATACGGC 1282-1301 62 ER stress BIP1for GAAACAGCCTGGAGACTTACG 1712-1732 61 NbBIP1 165 BIP1rev CATAATCCTCCTTCTCAGCG 1857-1876 60 PR3for GTTATTGCTGGCTTAGAGAACG 482-503 61 PR3 175 PR3rev TCAGGATTGTTTAGGAGGTCC 636-656 61 defense PR10for TCAACAGAGTACCACACAAAGG 352-373 60 PR10 122 PR10rev AGAGAAGGATTAGCGATGAGG 453-473 60 RbsLfor GGCTTTGTTGATTTACTGCG 1030-1049 61 RbsL 196 RbsLrev GTCCTAAAGTTCCTCCACCG 1206-1225 61 Chloroplast RbsSfor GCAGATACTGGACGATGTGG 365-384 62 RbsS 164 RbsSrev GTAGGCGATGAAACTGATGC 509-528 61

PAGE 26