DOCSLIB.ORG

The Fish Pathogen Vibrio Ordalii Under Iron Deprivation Produces the Siderophore Piscibactin

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Fish Pathogen Vibrio Ordalii Under Iron Deprivation Produces the Siderophore Piscibactin microorganisms Article The Fish Pathogen Vibrio ordalii Under Iron Deprivation Produces the Siderophore Piscibactin Pamela Ruiz 1,2, Miguel Balado 3, Juan Carlos Fuentes-Monteverde 4 , Alicia E. Toranzo 3, Jaime Rodríguez 4 , Carlos Jiménez 4 , Ruben Avendaño-Herrera 1,2,* and Manuel L. Lemos 3,* 1 Laboratorio de Patología de Organismos Acuáticos y Biotecnología Acuícola, Facultad de Ciencias de la Vida, Universidad Andrés Bello, 2531015 Viña del Mar, Chile 2 Interdisciplinary Center for Aquaculture Research (INCAR), 2531015 Viña del Mar, Chile 3 Departamento de Microbiología y Parasitología, CIBUS-Facultad de Biología and Instituto de Acuicultura, Universidade de Santiago de Compostela, 15782 Santiago de Compostela, Spain 4 Centro de Investigacións Científicas Avanzadas (CICA), Departamento de Química, Facultade de Ciencias, Universidade da Coruña, 15071 A Coruña, Spain * Correspondence: [email protected] (R.A.-H.); [email protected] (M.L.L.) Received: 31 July 2019; Accepted: 31 August 2019; Published: 3 September 2019 Abstract: Vibrio ordalii is the causative agent of vibriosis, mainly in salmonid fishes, and its virulence mechanisms are still not completely understood. In previous works we demonstrated that V. ordalii possess several iron uptake mechanisms based on heme utilization and siderophore production. The aim of the present work was to confirm the production and utilization of piscibactin as a siderophore by V. ordalii. Using genetic analysis, identification by peptide mass fingerprinting (PMF) of iron-regulated membrane proteins and chemical identification by LC-HRMS, we were able to clearly demonstrate that V. ordalii produces piscibactin under iron limitation. The synthesis and transport of this siderophore is encoded by a chromosomal gene cluster homologous to another one described in V. anguillarum, which also encodes the synthesis of piscibactin. Using β-galactosidase assays we were able to show that two potential promoters regulated by iron control the transcription of this gene cluster in V. ordalii. Moreover, biosynthetic and transport proteins corresponding to piscibactin synthesis and uptake could be identified in membrane fractions of V. ordalii cells grown under iron limitation. The synthesis of piscibactin was previously reported in other fish pathogens like Photobacterium damselae subsp. piscicida and V. anguillarum, which highlights the importance of this siderophore as a key virulence factor in Vibrionaceae bacteria infecting poikilothermic animals. Keywords: Vibrio ordalii; fish pathogens; iron uptake; siderophores; piscibactin; vanchrobactin 1. Introduction Vibrio ordalii is a γ-proteobacterium which causes vibriosis, a hemorrhagic septicemia, in several species of aquacultured fish, mainly salmonids [1]. Although vibriosis outbreaks due to V. ordalii have been reported around the globe, in the last 15 years they reached an important impact in Chile, where they cause significant economic losses in salmonids aquaculture [2,3]. Besides its genetic similarity to V. anguillarum [4,5], another important fish pathogen with worldwide distribution, many aspects of the virulence mechanisms of V. ordalii still remain unknown. While its pathogenicity is not correlated to erythrocytes hemagglutination capacity or biofilm formation in Atlantic salmon (Salmo salar), the hydrophobic properties of V. ordalii cells could play a role in virulence. Moreover, V. ordalii can evade the host immune system and can survive within Atlantic salmon mucus, which likely facilitates colonization [3,6]. However, many aspects of its ability to colonize and multiply within the fish hosts remain unclear. Microorganisms 2019, 7, 313; doi:10.3390/microorganisms7090313 www.mdpi.com/journal/microorganisms Microorganisms 2019, 7, 313 2 of 16 For most bacteria iron uptake ability during the naturally iron-limited conditions of an infection is a key virulence factor essential for multiplication within the host [7–9]. Besides the importance of iron for the cell metabolism, this element is an important signal that regulates expression of many other metabolic and virulence functions in bacterial cells [10]. This regulation is usually mediated by the transcriptional regulator Fur which needs Fe2+ as cofactor to bind to the promoter region of genes controlled by iron levels and prevent the binding of RNA polymerase to DNA [11]. The main mechanisms described in Gram-negative bacteria to get iron from the cell surroundings are the direct use of heme groups as a source of iron [12] and the synthesis of siderophores, which can efficiently sequester the iron bound by transferrins and other iron-holding proteins within the host [9,13,14]. The ferri-siderophore is then internalized through specific TonB-dependent outer membrane protein receptors that are energized through the TonB system [15–17]. Bacterial fish pathogens are not an exception for iron requirements and several mechanisms of iron uptake, including the use of heme and the synthesis of siderophores, have been reported in many of these bacteria [18–25]. We have previously demonstrated that V. ordalii can also use heme and hemoglobin as iron sources and that it has the ability to produce siderophores [26]. However, despite the clear relationship between V. ordalii iron uptake ability and pathogenicity, the precise nature of the iron assimilation mechanisms remains unclear. In this previous work, from genetic and genomic analysis, the results of cross-feeding assays, and from some other data in the literature [4], we suggested that V. ordalii could likely produce piscibactin as a siderophore. Piscibactin was isolated and characterized from the fish pathogen Photobacterium damselae subsp. piscicida [23]. In this bacterium piscibactin synthesis is encoded in a pathogenicity island harbored in the pPHDP70 virulence plasmid [27]. Recent in silico genomic studies in the Vibrionaceae family showed that the gene cluster encoding piscibactin synthesis and transport is really widespread in many species of Vibrio and Photobacterium [28]. In fact, we have recently demonstrated that some strains of V. anguillarum, a bacterium closely related to V. ordalii, produces piscibactin in a temperature-dependent fashion, being preferentially expressed at low temperatures. In these conditions piscibactin synthesis is a key virulence factor for V. anguillarum [29]. In the present work, we have characterized the gene cluster encoding the biosynthesis and transport of piscibactin and demonstrated, by genetic, proteomic and chemical analysis, that piscibactin is indeed produced as siderophore by V. ordalii. 2. Materials and Methods 2.1. Bacterial Strains and Growth Conditions Three V. ordalii strains were used: The type strain ATCC 33509T and two strains, Vo-LM-13 and Vo-LM-18, previously isolated from vibriosis outbreaks in Atlantic salmon cultured in Chile [3,6]. All were confirmed as V. ordalii according to the PCR protocol previously described [30]. All strains were routinely cultivated on Trypticase Soy Agar or Trypticase Soy Broth supplemented with 1% (w/v) NaCl (TSA-1 and TSB-1, respectively). For some experiments the CM9 minimal medium was also used [31]. Stock cultures were kept frozen at 80 C in Criobilles tubes (AES Laboratories, Combourg, France) or − ◦ in TSB-1 with 15% (v/v) glycerol. 2.2. RNA Extraction and RT-PCR To analyze the transcriptional regulation of the gene cluster involved in the biosynthesis and transport of the siderophore piscibactin, a RT-PCR was performed with the primers listed in Table1. For this assay, V. ordalii Vo-LM-18 was grown in iron-limited (TSB-1 plus 2,20-dipyridyl), iron-excess (TSB-1 plus FeCl3 10 µM) and standard conditions (TSB-1). Total RNA was prepared from cultures after 48 h post-incubation using TRIzol® reagent (Ambion-ThermoFisher, Waltham, MS, USA) according to the manufacturer’s instructions. Each RNA sample was subjected to treatment with DNase I RNase free. To obtain the cDNA, 5 µg total RNA and reverse transcriptase enzyme M-MLV (Invitrogen-ThermoFisher, Waltham, MS, USA) was used following the manufacturer’s instructions for each reverse transcription Microorganisms 2019, 7, 313 3 of 16 reaction. The PCR reaction was prepared with the cDNA, 1 U of BioTaq DNA polymerase (Bioline, Memphis, TN, USA), 200 µM of each dNTP and 2 mM MgCl2, final concentration. Depending on the melting temperature (Tm) of each pair of primers, annealing temperatures ranged from 55 to 60 C. Times of elongation were selected based on the expected size of amplification (1 min kb 1). In all ◦ · − cases, the same reaction mixture, but without reverse transcriptase, was used as negative control, and chromosomal DNA of the Vo-LM-18 strain was used as positive control. Table 1. Primers used in this work. Primers Sequence (50-30) * Amplified Fragment (bp) Amplification of potential promoters P1 Promoter 1_F GCGTCTAGACACTTTGCCACCCACCATTA 879 Promoter 1_R GCGGGATCCACGAATCGTCGTGTTGGCAT P2 Promoter 2_F GCGTCTAGACCGCTTAGAGAAACCAACGT 1165 Promoter 2_R GCGGGATCCACGTTTCGGTAAGCGTATGG Transcriptional regulation of irp gene cluster RT TTTGGAGATGAGTGCGACAC PCR1 ARC1ordalii_F GATATGCGCTTTGACTGCCA 196 ARC1ordalii_R CTGTGAGACGGCATACAAGC PCR2 FrpA_ordalii_F CGGTGGTAATGCTCAAGGTG 204 FrpA_ordalii_R TGGCTCGGTAGGTGTTCAAT PCR3 Irp2_ordalii_F AGCAGGCAACAAAGAGTGAG 413 Irp1_ordalii_R GGGCGAATAACCAAACAAGC * Recognition sequences for restriction enzymes are underlined. 2.3. Construction of lacZ Transcriptional Fusions and β-Galactosidase Assays The presence of potential gene promoters within the piscibactin gene cluster of V.
Load more

Recommended publications
  • Vibrio Diseases of Marine Fish Populations
    HELGOL~NDER MEERESUNTERSUCHUNGEN Helgolander Meeresunters. 37, 265-287 (1984) Vibrio diseases of marine fish populations R. R. Colwell & D. J. Grimes Department of Microbiology, University of Maryland; College Park, MD 20742 USA ABSTRACT: Several Vibrio spp. cause disease in marine fish populations, both wild and cultured. The most common disease, vibriosis, is caused by V. anguillarum. However, increase in the intensity of mariculture, combined with continuing improvements in bacterial systematics, expands the list of Vibrio spp. that cause fish disease. The bacterial pathogens, species of fish affected, virulence mechanisms, and disease treatment and prevention are included as topics of emphasis in this review, INTRODUCTION It is most appropriate that the introductory paper at this Symposium on Diseases of Marine Organisms should be about vibrios. The disease syndrome termed vibriosis was one of the first diseases of marine fish to be described (Sindermann, 1970; Home, 1982). Called "red sore", "red pest", "red spot" and "red disease" because of characteristic hemorrhagic skin lesions, this disease was recognized and described as early as 1718 in Italy, with numerous epizootics being documented throughout the 19th century (Crosa et al., 1977; Sindermann, 1970). Today, while "red sore" is, without doubt, the best understood of the marine bacterial fish diseases, new diseases have been added to the list of those caused by Vibrio spp. The more recently published work describing Vibrio disease, primarily that appear- ing in the literature since 1977, will be the focus of this paper. Bacterial pathogens, the species of fish affected, virulence mechanisms, and disease treatment and prevention are included as topics of emphasis.
    [Show full text]
  • Handbook Version 12
    A handbook of diseases of importance to aquaculture in New Zealand B. K. Diggles P. M. Hine S. Handley N. C. Boustead NIWA Science and Technology Series No. 49 2002 Published by NIWA Wellington 2002 Edited and produced by Science Communication, NIWA, PO Box 14-901, Wellington, New Zealand ISSN 1173-0382 ISBN 0-478-23248-9 © NIWA 2002 Citation: Diggles, B.K.; Hine, P.M.; Handley, S.; Boustead, N.C. (2002). A handbook of diseases of importance to aquaculture in New Zealand. NIWA Science and Technology Series No. 49. 200 p. Cover: Eggs of the monogenean ectoparasite Zeuxapta seriolae (see p. 102) from the gills of kingfish. Photo by Ben Diggles. The National Institute of Water and Atmospheric Research is New Zealand’s leading provider of atmospheric, marine, and freshwater science Visit NIWA’s website at http://www.niwa.co.nz 2 Contents Introduction 6 Disclaimer 7 Disease and stress in the aquatic environment 8 Who to contact when disease is suspected 10 Submitting a sample for diagnosis 11 Basic anatomy of fish and shellfish 12 Quick help guide 14 This symbol in the text denotes a disease is exotic to New Zealand Contents colour key: Black font denotes disease present in New Zealand Blue font denotes disease exotic to New Zealand Red font denotes an internationally notifiable disease exotic to New Zealand Diseases of Fishes Freshwater fishes 17 Viral diseases Epizootic haematopoietic necrosis (EHN) 18 Infectious haematopoietic necrosis (IHN) 20 Infectious pancreatic necrosis (IPN)* 22 Infectious salmon anaemia (ISA) 24 Oncorhynchus masou
    [Show full text]
  • Vibrio Anguillarum As a Fish Pathogen: Virulence Factors, Diagnosis And
    Journal of Fish Diseases 2011, 34, 643–661 doi:10.1111/j.1365-2761.2011.01279.x Review Vibrio anguillarum as a fish pathogen: virulence factors, diagnosis and prevention I Frans1,2,3,4, C W Michiels3, P Bossier4, K A Willems1,2, B Lievens1,2 and H Rediers1,2 1 Laboratory for Process Microbial Ecology and Bioinspirational Management (PME & BIM), Consortium for Industrial Microbiology and Biotechnology (CIMB), Department of Microbial and Molecular Systems (M2S), K.U. Leuven Association, Lessius Mechelen, Sint-Katelijne-Waver, Belgium 2 Scientia Terrae Research Institute, Sint-Katelijne-Waver, Belgium 3 Department of Microbial and Molecular Systems (M2S), Centre for Food and Microbial Technology, K.U. Leuven, Leuven, Belgium 4 Laboratory of Aquaculture & Artemia Reference Centre, Faculty of Bioscience Engineering, Ghent University, Gent, Belgium Bacterium anguillarum (Canestrini 1893). A few Abstract years later, Bergman proposed the name Vibrio Vibrio anguillarum, also known as Listonella anguillarum for the aetiological agent of the Ôred anguillarum, is the causative agent of vibriosis, a pest of eelsÕ in the Baltic Sea (Bergman 1909). deadly haemorrhagic septicaemic disease affecting Because of the high similarity of the disease signs various marine and fresh/brackish water fish, biv- and characteristics of the causal bacterium described alves and crustaceans. In both aquaculture and lar- in both reports, it was suggested that it concerned viculture, this disease is responsible for severe the same causative agent. economic losses worldwide. Because of its high Currently, V. anguillarum is widely found in morbidity and mortality rates, substantial research various cultured and wild fish as well as in bivalves has been carried out to elucidate the virulence and crustaceans in salt or brackish water causing a fatal mechanisms of this pathogen and to develop rapid haemorrhagic septicaemic disease, called vibriosis detection techniques and effective disease-preven- (Aguirre-Guzma´n, Ruı´z & Ascencio 2004; Paillard, tion strategies.
    [Show full text]
  • CGM-18-001 Perseus Report Update Bacterial Taxonomy Final Errata
    report Update of the bacterial taxonomy in the classification lists of COGEM July 2018 COGEM Report CGM 2018-04 Patrick L.J. RÜDELSHEIM & Pascale VAN ROOIJ PERSEUS BVBA Ordering information COGEM report No CGM 2018-04 E-mail: [email protected] Phone: +31-30-274 2777 Postal address: Netherlands Commission on Genetic Modification (COGEM), P.O. Box 578, 3720 AN Bilthoven, The Netherlands Internet Download as pdf-file: http://www.cogem.net → publications → research reports When ordering this report (free of charge), please mention title and number. Advisory Committee The authors gratefully acknowledge the members of the Advisory Committee for the valuable discussions and patience. Chair: Prof. dr. J.P.M. van Putten (Chair of the Medical Veterinary subcommittee of COGEM, Utrecht University) Members: Prof. dr. J.E. Degener (Member of the Medical Veterinary subcommittee of COGEM, University Medical Centre Groningen) Prof. dr. ir. J.D. van Elsas (Member of the Agriculture subcommittee of COGEM, University of Groningen) Dr. Lisette van der Knaap (COGEM-secretariat) Astrid Schulting (COGEM-secretariat) Disclaimer This report was commissioned by COGEM. The contents of this publication are the sole responsibility of the authors and may in no way be taken to represent the views of COGEM. Dit rapport is samengesteld in opdracht van de COGEM. De meningen die in het rapport worden weergegeven, zijn die van de auteurs en weerspiegelen niet noodzakelijkerwijs de mening van de COGEM. 2 | 24 Foreword COGEM advises the Dutch government on classifications of bacteria, and publishes listings of pathogenic and non-pathogenic bacteria that are updated regularly. These lists of bacteria originate from 2011, when COGEM petitioned a research project to evaluate the classifications of bacteria in the former GMO regulation and to supplement this list with bacteria that have been classified by other governmental organizations.
    [Show full text]
  • Cell-To-Cell Communication and Virulence in Vibrio Anguillarum
    Cell-to-cell communication and virulence in Vibrio anguillarum Kristoffer Lindell Department of Molecular Biology Umeå Center for Microbial Research UCMR Umeå University, Sweden Umeå 2012 Copyright © Kristoffer Lindell ISBN: 978-91-7459-427-0 Printed by: Print & media Umeå, Sweden 2012 "Logic will get you from A to B. Imagination will take you everywhere." Albert Einstein Jonna, Jonatan och Lovisa - Låt fantasin flöda Till min familj Table of Contents Table of Contents i Abstract iii Abbreviations iv Papers in this thesis v Introduction 1 Vibrios in the environment 1 Vibrios and Vibriosis 2 Vibriosis in humans 2 Vibriosis in corals 3 Vibriosis in fish and shellfish 4 Treatment and control of vibriosis due to V. anguillarum 4 Virulence factors of V. anguillarum 5 Iron sequestering system 5 Extracellular products 6 Chemotaxis and motility 6 The role of LPS in serum resistance 6 The role of exopolysaccharides in survival and virulence 7 Virulence factors required for colonization of the fish skin 7 Outer membrane porins and bile resistance 8 Fish immune defence mechanisms against bacteria 8 Fish skin defense against bacteria 8 The humoral non-specific defense 9 The humoral specific defense 10 The cell mediated non-specific and specific host defense 11 Quorum sensing in vibrios 12 The acyl homoserine lactone molecule 12 Paradigm of quorum-sensing systems in Gram-negative bacteria 13 Quorum sensing in Gram-positive bacteria 14 Hybrid two-component signalling systems 14 Quorum sensing in V. harveyi 15 Quorum sensing in V. fischeri 16 Quorum sensing in V. cholerae 19 Quorum sensing in V. anguillarum 20 Stress response mechanisms 23 Heat shock response 23 Cold shock response 24 Prokaryotic SOS response and DNA damage 24 Stress alarmone ppGpp and the stringent response 25 Universal stress protein A superfamily 26 Small RNA chaperone Hfq and small RNAs 26 i Aims of this thesis 28 Key findings and relevance 29 Paper I.
    [Show full text]
  • Microbiology Letters
    RESEARCH LETTER Analysis of16S^23S rRNA gene internal transcribed spacer of Vibrio anguillarum and Vibrio ordalii strains isolated from ¢sh Jorge Fernandez´ & Ruben Avendano-Herrera˜ Laboratorio de Veterquımica,´ Camino a Melipilla, Cerrillos, Santiago, Chile Downloaded from https://academic.oup.com/femsle/article/299/2/184/647810 by guest on 30 September 2021 Correspondence: Ruben Avendano-Herrera,˜ Abstract Laboratorio de Veterquımica,´ Camino a Melipilla 5641, Cerrillos, Santiago, Chile. The 16S-23S rRNA intergenic spacer (ITS) of Vibrio anguillarum and Vibrio ordalii Tel.: 156 2 384 4109; fax: 156 2 384 4021; were PCR amplified and cloned with TA vector pCR2.1. PCR amplification e-mail: [email protected] obtained five products ranging from 917 to 437 bp. Three clones were obtained and analysed from all fragments with the exception of 437 bp. These products Present address: Ruben Avendano-Herrera,˜ were designated ITS-1, ITS-2, ITS-3 and ITS-4. ITS-1 contained genes for Universidad Andres´ Bello, Facultad de tRNAGlu(TTC), tRNALys(TTT), tRNAAla(TGC) and tRNAVal(TAC), while ITS-2 was Ciencias Basicas,´ Departamento de Ciencias almost the same as the ITS-1 sequence, but without tRNAVal(TAC). ITS-3 contained Basicas.´ Repu´ blica 217, Santiago, Chile. tRNAAla(TGC) and tRNAIle (GAT) and ITS-4, tRNAAla (GGC) or tRNAGlu(TTC). The Received 30 January 2009; accepted 24 July number of copies of the ribosomal operon (rrn)inV. ordalii chromosome ranged 2009. from at least six to seven and V. anguillarum had at least seven rrn. The sequences Final version published online 1 September ITS-1, ITS-2 and ITS-3 showed a high similarity among the V.
    [Show full text]
  • Taxonomy of Bacterial Fish Pathogens Brian Austin
    Austin Veterinary Research 2011, 42:20 http://www.veterinaryresearch.org/content/42/1/20 VETERINARY RESEARCH REVIEW Open Access Taxonomy of bacterial fish pathogens Brian Austin Abstract Bacterial taxonomy has progressed from reliance on highly artificial culture-dependent techniques involving the study of phenotype (including morphological, biochemical and physiological data) to the modern applications of molecular biology, most recently 16S rRNA gene sequencing, which gives an insight into evolutionary pathways (= phylogenetics). The latter is applicable to culture-independent approaches, and has led directly to the recognition of new uncultured bacterial groups, i.e. “Candidatus“, which have been associated as the cause of some fish diseases, including rainbow trout summer enteritic syndrome. One immediate benefit is that 16S rRNA gene sequencing has led to increased confidence in the accuracy of names allocated to bacterial pathogens. This is in marked contrast to the previous dominance of phenotyping, and identifications, which have been subsequently challenged in the light of 16S rRNA gene sequencing. To date, there has been some fluidity over the names of bacterial fish pathogens, with some, for example Vibrio anguillarum, being divided into two separate entities (V. anguillarum and V. ordalii). Others have been combined, for example V. carchariae, V. harveyi and V. trachuri as V. harveyi. Confusion may result with some organisms recognized by more than one name; V. anguillarum was reclassified as Beneckea and Listonella, with Vibrio and Listonella persisting in the scientific literature. Notwithstanding, modern methods have permitted real progress in the understanding of the taxonomic relationships of many bacterial fish pathogens. Table of contents 6. Taxonomic developments associated with specific 1.
    [Show full text]
  • Archives Mar 2 3 2010 Libraries
    ECOLOGY AND POPULATION STRUCTURE OF VIBRIONACEAE IN THE COASTAL OCEAN By Sarah Pacocha Preheim B.S., Carnegie Mellon University, 1997 Submitted to the Department of Civil and Environmental Engineering, Massachusetts Institute of Technology and the Woods Hole Oceanographic Institution in Partial Fulfillment of the Requirements for the Degree of ARCHIVES Doctor of Philosophy in the Field of Biological Oceanography MASSACHUSETTS INSTfTE OF TECHNOLOGY at the MASSACHUSETTS INSTITUTE OF TECHNOLOGY MAR 2 3 2010 and the WOODS HOLE OCEANOGRAPHIC INSTITUTION LIBRARIES February 2010 © 2010 Massachusetts Institute of Technology and Woods Hole Oceanographic Institution All rights reserved Signature of Author ' Joitfr'ogram in Oceanography Departm t of Civil and Environmental Engineering Massachusetts Institute of Technology and Woods Hole Oceanographic Institution January 12 th2010 Certified by Martin F. Polz Professor of Civil and Environmental Engineering Massachusetts Institute of Technology Thesis Supervisor Accepted by Simon Thorrold Chair, Joint Committee for Biological Oceanography Woods Hole Oceanographic Institution Accepted by Daniele Veneziano Chairman, Departmental Committee for Graduate Students Massachusetts Institute of Technology 2 ECOLOGY AND POPULATION STRUCTURE OF VIBRIONACEAE IN THE COASTAL OCEAN by Sarah P. Preheim Submitted to the Department of Civil and Environmental Engineering, Massachusetts Institute of Technology and the Woods Hole Oceanographic Institution on Jan. 12th 2010 in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in the Field of Biological Oceanography Abstract Extensive genetic diversity has been discovered in the microbial world, yet mechanisms that shape and maintain this diversity remain poorly understood. This thesis investigates to what extent populations of the gamma-proteobacterial family, Vibrionaceae, are ecologically specialized by investigating the distribution across a wide range of environmental categories, such as marine invertebrates or particles in the water column.
    [Show full text]
  • Biochemical and Serological Comparison of Selected Vibrio Spp. Isolated from Fish
    AN ABSTRACT OF TEE ThESIS OF Somsak PipoDtinvo for the degree of Master of Science in Fisheries Presented on Sentember 15.. 1987 Title: BIOCHEMICAL AN]) SEROLOGICAL COMPARISON OF SELECTED VIBRIO SPP. ISOLATED FROM FISH Abstract approved: Redacted for Privacy I Dr. James R. Winton Nine isolates of bacteria recovered from fish dying at marine facilities were collected from different geographic areas. The strains included: an isolate from chinook salmon (Oncorhvn- chus tsbavvtscha) reared in net pens in New Zealand, an isolate from chum salmon (Oncorhvnchus keta) held at a laboratory in Oregon, USA., and seven strains recovered from tilapia (Oreochro- sDilurus), silvery black porgy (Acanthoagrus cuvieri), and greasy grouper (Eninenhelus tauvina) cultured in Kuwait. All isolates were characterized by examination of morphological and biochemical properties and were confirmed to be members of the genus Vibrio. All, isolates differed phenotypically from each other, from vibrios known to be pathogenic for fish, and from other named Vibrio species.Analysis of key phenotypic characteristics used to establish existing species suggested that the isolates tested were new Vibrio species. Four of the isolates (two from coldwater fish and two from warmwater fish) were selected for further study. This included determination of percent guanine plus cytosine (%G+C), comparison of growth characteristics, analysis of major 0 antigens and testing of pathogenicity. The four isolates examined had an absolute requirement for NaCl. Optimum growth temperatures varied among the isolates and were consistent with the temperature optima of the hostsfrom which the isolates were obtained. Serological analysis using slide agglutination, microtiter agglutination, and Ouchterlony double diffusion tests detected specific thermostable (0) antigens unique for each of the four isolates.A coon minor antigen was observed between two of the other isolates from Kuwait.
    [Show full text]
  • Coastal Microbiomes Reveal Associations Between Pathogenic Vibrio Species
    1 Coastal microbiomes reveal associations between pathogenic Vibrio species, 2 environmental factors, and planktonic communities 3 Running title: metabarcoding reveals vibrio-plankton associations 4 5 Rachel E. Diner1,2, Drishti Kaul2, Ariel Rabines1,2, Hong Zheng2, Joshua A. Steele3, John F. 6 Griffith3, Andrew E. Allen1,2* 7 8 1 Scripps Institution of Oceanography, University of California San Diego, La Jolla, California 9 92037, USA 10 11 2 Microbial and Environmental Genomics Group, J. Craig Venter Institute, La Jolla, California 12 92037, USA 13 14 3 Southern California Coastal Water Research Project, Costa Mesa, CA 92626, USA 15 16 * Correspondence: [email protected] 17 18 Author Emails: Rachel E. Diner: [email protected], Drishti Kaul: [email protected], Ariel 19 Rabines: [email protected], Hong Zheng: [email protected], Joshua A. Steele: 20 [email protected], John F. Griffith: [email protected], Andrew Allen: [email protected] 21 22 23 1 24 Abstract 25 Background 26 Many species of coastal Vibrio spp. bacteria can infect humans, representing an emerging 27 health threat linked to increasing seawater temperatures. Vibrio interactions with the planktonic 28 community impact coastal ecology and human infection potential. In particular, interactions with 29 eukaryotic and photosynthetic organism may provide attachment substrate and critical nutrients 30 (e.g. chitin, phytoplankton exudates) that facilitate the persistence, diversification, and spread of 31 pathogenic Vibrio spp.. Vibrio interactions with these organisms in an environmental context are, 32 however, poorly understood. 33 34 Results 35 After quantifying pathogenic Vibrio species, including V. cholerae, V. parahaemolyticus, 36 and V. vulnificus, over one year at 5 sites, we found that all three species reached high abundances, 37 particularly during Summer months, and exhibited species-specific temperature and salinity 38 distributions.
    [Show full text]
  • Comparative Genomics Analysis of Vibrio Anguillarum Isolated from Lumpfish (Cyclopterus Lumpus) in Newfoundland Reveal Novel Chromosomal Organizations
    microorganisms Article Comparative Genomics Analysis of Vibrio anguillarum Isolated from Lumpfish (Cyclopterus lumpus) in Newfoundland Reveal Novel Chromosomal Organizations Ignacio Vasquez 1, Trung Cao 1, Setu Chakraborty 1, Hajarooba Gnanagobal 1, Nicole O’Brien 2, Jennifer Monk 3, Danny Boyce 3, Jillian D. Westcott 4 and Javier Santander 1,* 1 Microbial Pathogenesis and Vaccinology Laboratory, Department of Ocean Sciences, Memorial University, Logy Bay, NL A1C 5S7, Canada; [email protected] (I.V.); [email protected] (T.C.); [email protected] (S.C.); [email protected] (H.G.) 2 Department of Fisheries and Land Resources, Aquatic Animal Health Division, Government of Newfoundland and Labrador, St. John’s, NL A1E 3Y5, Canada; [email protected] 3 Dr. Joe Brown Aquatic Research Building (JBARB), Department of Ocean Sciences, Memorial University of Newfoundland, Logy Bay, NL A1C 5S7, Canada; [email protected] (J.M.); [email protected] (D.B.) 4 Fisheries and Marine Institute, Memorial University of Newfoundland, St. John’s, NL A1C 5R3, Canada; [email protected] * Correspondence: [email protected]; Tel.: +1-709-864-3268 Received: 16 October 2020; Accepted: 23 October 2020; Published: 27 October 2020 Abstract: Vibrio anguillarum is a Gram-negative marine pathogen causative agent of vibriosis in a wide range of hosts, including invertebrates and teleosts. Lumpfish (Cyclopterus lumpus), a native fish of the North Atlantic Ocean, is utilized as cleaner fish to control sea lice (Lepeophtheirus salmonis) infestations in the Atlantic salmon (Salmo salar) aquaculture industry. V. anguillarum is one of the most frequent bacterial pathogens affecting lumpfish. Here, we described the phenotype and genomic characteristics of V.
    [Show full text]
  • Deep-Sea Hydrothermal Vent Bacteria Related to Human Pathogenic Vibrio
    Deep-sea hydrothermal vent bacteria related to human PNAS PLUS pathogenic Vibrio species Nur A. Hasana,b,c, Christopher J. Grima,c,1, Erin K. Lippd, Irma N. G. Riverae, Jongsik Chunf, Bradd J. Haleya, Elisa Taviania, Seon Young Choia,b, Mozammel Hoqg, A. Christine Munkh, Thomas S. Brettinh, David Bruceh, Jean F. Challacombeh, J. Chris Detterh, Cliff S. Hanh, Jonathan A. Eiseni, Anwar Huqa,j, and Rita R. Colwella,b,c,k,2 aMaryland Pathogen Research Institute, cUniversity of Maryland Institute for Advanced Computer Studies, and jInstitute for Applied Environmental Health, University of Maryland, College Park, MD 20742; bCosmosID, College Park, MD 20742; dEnvironmental Health Science, College of Public Health, University of Georgia, Athens, GA 30602; eDepartment of Microbiology, Institute of Biomedical Sciences, University of São Paulo, CEP 05508-900 São Paulo, Brazil; fSchool of Biological Sciences and Institute of Microbiology, Seoul National University, Seoul 151-742, Republic of Korea; gDepartment of Microbiology, University of Dhaka, Dhaka-1000, Bangladesh; hGenome Science Group, Bioscience Division, Los Alamos National Laboratory, Los Alamos, NM 87545; iUniversity of California Davis Genome Center, Davis, CA 95616; and kBloomberg School of Public Health, The Johns Hopkins University, Baltimore, MD 21205 Contributed by Rita R. Colwell, April 15, 2015 (sent for review September 5, 2014; reviewed by John Allen Baross, Richard E. Lenski, and Carla Pruzzo) Vibrio species are both ubiquitous and abundant in marine coastal of vibrios, and suggested Vibrio populations generally comprise waters, estuaries, ocean sediment, and aquaculture settings world- approximately 1% (by molecular techniques) of the total bac- wide. We report here the isolation, characterization, and genome terioplankton in estuaries (19), in contrast to culture-based studies sequence of a novel Vibrio species, Vibrio antiquarius, isolated from demonstrating that vibrios can comprise up to 10% of culturable a mesophilic bacterial community associated with hydrothermal marine bacteria (20).
    [Show full text]