Contribution of HOXD10, HOXD11 and HOXD13 to Malignancy Of

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Technische Universität München Fakultät für Medizin Contribution of HOXD10, HOXD11 and HOXD13 to malignancy of Ewing sarcoma Laura Roth Vollständiger Abdruck der von der Fakultät für Medizin der Technischen Universität München zur Erlangung des akademischen Grades eines Doktors der Medizin genehmigten Dissertation. Vorsitzender: Prof. Dr. Ernst J. Rummeny Prüfer der Dissertation: 1. Prof. Dr. Stefan Burdach 2. Prof. Dr. Uta Behrends Die Dissertation wurde am 23.05.2019 bei der Technischen Universität München eingereicht und durch die Fakultät für Medizin am 04.12.2019 angenommen. Table of contents Table of contents List of abbreviations ............................................................................................. 8 1. Introduction .................................................................................................. 14 1.1 Ewing sarcoma..................................................................................................... 14 1.2 Genes of the posterior HOXD locus ..................................................................... 19 1.2.1 General information on HOX genes .............................................................. 19 1.2.2 Current knowledge on HOXD10 ................................................................... 24 1.2.3 Current knowledge on HOXD11 ................................................................... 24 1.2.4 Current knowledge on HOXD13 ................................................................... 25 1.3 Aim of this study and overview of the experimental approach .............................. 26 2. Material ......................................................................................................... 28 2.1 List of manufacturers ............................................................................................ 28 2.2 General material ................................................................................................... 30 2.3 Instruments and equipment .................................................................................. 31 2.4 Chemical and biological reagents ......................................................................... 32 2.5 Commercial reagent kits ....................................................................................... 33 2.6 Media and solutions ............................................................................................. 34 2.7 Antibodies for immunofluorescence ...................................................................... 34 2.8 Small interfering RNAs ......................................................................................... 35 2.9 Oligonucleotides for retroviral gene transfer ......................................................... 35 2.10 Primers for PCR and qRT-PCR ............................................................................ 36 2.11 Gene expression assays for qRT-PCR ................................................................. 36 2.12 Human cell lines and mouse strain ....................................................................... 38 2.12.1 Human cell lines ........................................................................................... 38 2.12.2 Mouse strain ................................................................................................. 38 3. Methods ........................................................................................................ 39 3.1 Cell culture ........................................................................................................... 39 3.2 RNA isolation ....................................................................................................... 39 3.3 cDNA synthesis .................................................................................................... 40 3.4 Quantitative Real-Time PCR (qRT- PCR) ............................................................. 41 3.4.1 Standard qRT-PCR ...................................................................................... 41 3.4.2 Detection of EWS-FLI1 ................................................................................. 42 Table of contents 3.5 Transient RNA interference (RNAi) ...................................................................... 43 3.6 Retrovirus-mediated stable RNA interference ...................................................... 44 3.7 In vitro assays ..................................................................................................... 44 3.7.1 xCELLigence proliferation assay .................................................................. 44 3.7.2 Colony forming assay .................................................................................. 44 3.7.3 Invasion assay ............................................................................................. 45 3.7.4 Neuronal differentiation assay ...................................................................... 46 3.8 In vivo experiments.............................................................................................. 47 3.8.1 Investigation of local tumor growth ............................................................... 47 3.8.2 Investigation of invasive tumor growth ......................................................... 47 3.9 Immunohistochemistry of murine samples ........................................................... 48 3.10 Statistical analysis ............................................................................................... 48 4. Results .......................................................................................................... 49 4.1 Over-expression of posterior HOXD genes in ES ................................................ 49 4.2 Potential regulatory mechanisms of posterior HOXD genes in ES ....................... 51 4.2.1 No Regulation via EWS-FLI1 ....................................................................... 51 4.2.2 No Regulation via EZH2 .............................................................................. 52 4.2.3 Regulation via DKK2 .................................................................................... 53 4.3 Down-regulation of posterior HOXD genes via RNA interference ........................ 54 4.3.1 Transient RNA interference of single HOXD genes ...................................... 54 4.3.2 Triple HOXD gene knock down via transient RNA interference .................... 56 4.3.3 Constitutive HOXD gene knock down via RNA interference ......................... 57 4.4 Contribution of posterior HOXD genes to neuronal differentiation ability of ES cell lines ..................................................................................................................... 58 4.5 Influence of posterior HOXD genes on bone-associated genes and osteotropic tumor growth of ES .............................................................................................. 61 4.5.1 Suppressed expression of RUNX2 after triple HOXD knock down ............... 61 4.5.2 Influence of posterior HOXD genes on other bone-associated genes .......... 63 4.5.3 Contribution of posterior HOXD genes to osteolytic tumor growth in vivo ..... 67 4.6 Influence of HOXD10, HOXD11 and HOXD13 on ES growth and invasiveness .. 69 4.6.1 Inhibition of proliferation after HOXD10 and HOXD13 knock down in vitro ... 69 4.6.2 Reduction of colony formation after HOXD11 and HOXD13 knock down in vitro .......................................................................................................... 70 4.6.3 Decrease of invasiveness after HOXD10 and HOXD13 knock down in vitro 71 Table of contents 4.6.4 Suppressed expression of MMP1 after HOXD11, HOXD13 and triple HOXD knock down .................................................................................................. 73 4.6.5 Minor influence of posterior HOXD genes on other MMPs ............................ 75 4.6.6 Reduction of metastatic spread after HOXD11 and HOXD13 knock down in vivo ........................................................................................................... 77 5. Discussion.................................................................................................... 79 5.1 Over-expression of posterior HOXD genes in ES ................................................. 79 5.2 Regulatory mechanisms of posterior HOXD genes .............................................. 80 5.2.1 Absent regulation via EWS-FLI1 and EZH2 .................................................. 80 5.2.2 Regulation via DKK2 .................................................................................... 81 5.3 Diverse impact of posterior HOXD genes on neuronal differentiation ability of ES cell lines ............................................................................................................... 83 5.4 Role of HOXD10, HOXD11 and HOXD13 in ES pathology ................................... 85 5.4.1 Influence of posterior HOXD genes on bone-associated genes and osteotropic tumor growth .............................................................................. 85 5.4.1.1 Enhancement of osteotropic tumor growth mediated by RUNX2 ........... 86 5.4.1.2 Promotion of bone marrow invasiveness and osteolysis in tumor tissue in vivo ................................................................................................... 89 5.4.2 Influence of posterior HOXD genes on ES growth and invasiveness in vitro 91 5.4.3 MMP1 as posterior HOXD downstream target and key player
Recommended publications
  • (2017) Emerging Significance of Bile Acids

    (2017) Emerging Significance of Bile Acids

    Texas Medical Center Digestive Diseases Center 8th Annual Frontiers in Digestive Diseases Symposium: Emerging Significance of Bile Acids in Digestive & Liver Diseases Saturday, February 11, 2017 Onstead Auditorium, Houston, Texas 77030 Table of Contents ....................................................................................................................................................................... 1 Agenda .......................................................................................................................................................................................... 2 CME Activity............................................................................................................................................................................... 3 List of Abstracts .................................................................................................................................................................... 4 - 6 Abstracts............................................................................................................................................................................... 7 - 41 TMC DDC Leadership ............................................................................................................................................................ 42 List of Participants ............................................................................................................................................................ 43 - 46 Acknowledgements
  • Detailed Review Paper on Retinoid Pathway Signalling

    Detailed Review Paper on Retinoid Pathway Signalling

    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
  • New York State Thoroughbred Breeding and Development Fund Corporation

    New York State Thoroughbred Breeding and Development Fund Corporation

    NEW YORK STATE THOROUGHBRED BREEDING AND DEVELOPMENT FUND CORPORATION Report for the Year 2008 NEW YORK STATE THOROUGHBRED BREEDING AND DEVELOPMENT FUND CORPORATION SARATOGA SPA STATE PARK 19 ROOSEVELT DRIVE-SUITE 250 SARATOGA SPRINGS, NY 12866 Since 1973 PHONE (518) 580-0100 FAX (518) 580-0500 WEB SITE http://www.nybreds.com DIRECTORS EXECUTIVE DIRECTOR John D. Sabini, Chairman Martin G. Kinsella and Chairman of the NYS Racing & Wagering Board Patrick Hooker, Commissioner NYS Dept. Of Agriculture and Markets COMPTROLLER John A. Tesiero, Jr., Chairman William D. McCabe, Jr. NYS Racing Commission Harry D. Snyder, Commissioner REGISTRAR NYS Racing Commission Joseph G. McMahon, Member Barbara C. Devine Phillip Trowbridge, Member William B. Wilmot, DVM, Member Howard C. Nolan, Jr., Member WEBSITE & ADVERTISING Edward F. Kelly, Member COORDINATOR James Zito June 2009 To: The Honorable David A. Paterson and Members of the New York State Legislature As I present this annual report for 2008 on behalf of the New York State Thoroughbred Breeding and Development Fund Board of Directors, having just been installed as Chairman in the past month, I wish to reflect on the profound loss the New York racing community experienced in October 2008 with the passing of Lorraine Power Tharp, who so ably served the Fund as its Chairwoman. Her dedication to the Fund was consistent with her lifetime of tireless commitment to a variety of civic and professional organizations here in New York. She will long be remembered not only as a role model for women involved in the practice of law but also as a forceful advocate for the humane treatment of all animals.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • 1 Single-Cell Mrna Profiling Reveals Heterogeneous Combinatorial Expression of Hoxd Genes During Limb Development Short Title

    1 Single-Cell Mrna Profiling Reveals Heterogeneous Combinatorial Expression of Hoxd Genes During Limb Development Short Title

    bioRxiv preprint doi: https://doi.org/10.1101/327619; this version posted May 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Single-cell mRNA profiling reveals heterogeneous combinatorial expression of Hoxd genes during limb development Short title: Single-cell Hox combinations in developing limbs Authors : P. J. Fabre1,4,*, M. Leleu1, B. Mascrez2, Q. Lo Giudice4, J. Cobb3 and D. Duboule1,2,* Affiliations: 1School of Life Sciences, Ecole Polytechnique Fédérale, Lausanne, 1015 Lausanne, Switzerland. 2Department of Genetics and Evolution, University of Geneva, 1211 Geneva 4, Switzerland. 3Department of Biological Sciences, University of Calgary, Calgary, Canada. 4Department of Basic Neurosciences, University of Geneva, 1205 Geneva, Switzerland. KEYWORDS: Hox genes, digits, limb, development, enhancers, single-cell, transcriptome, differentiation, gene expression. *Corresponding authors: Pierre Fabre ([email protected]) and Denis Duboule ([email protected]) HIGHLIGHTS • Collinear expression of Hox genes is only weaved at the tissue scale • Enhancer-sharing to specific target genes is reduced at the single-cell level • Hoxd gene combinatorial expression is linked to distinct transcriptional signatures • In presumptive digits, Hoxd combinations follow a pseudotime trajectory 1 bioRxiv preprint doi: https://doi.org/10.1101/327619; this version posted May 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming

    Supplemental Materials ZNF281 Enhances Cardiac Reprogramming

    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K

    Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K

    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
  • Supplemental Information

    Supplemental Information

    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
  • HOX D13 Expression Across 79 Tumor Tissue Types

    HOX D13 Expression Across 79 Tumor Tissue Types

    Int. J. Cancer: 125, 1532–1541 (2009) ' 2009 UICC HOX D13 expression across 79 tumor tissue types Monica Cantile1,3, Renato Franco3, Adrienne Tschan2, Daniel Baumhoer2, Inti Zlobec2, Giulia Schiavo2, Iris Forte3, Michel Bihl2, Giuseppina Liguori3, Gerardo Botti3, Luigi Tornillo2, Eva Karamitopoulou-Diamantis4, Luigi Terracciano2,5 and Clemente Cillo1,2* 1Department of Clinical & Experimental Medicine, Federico II University Medical School, Naples, Italy 2Molecular Pathology Department, Institute of Pathology, University of Basel, Basel, Switzerland 3Surgical Pathology Department, National Cancer Institute ‘‘G.Pascale,’’ Naples, Italy 4Second Department of Pathology, University of Athens, Athens, Greece 5Health Science Department, University of Molise, Italy HOX genes control normal development, primary cellular proc- (CREB1, CREB2, Neuro D1) lying several hundred kilobases from esses and are characterized by a unique genomic network organi- one another.18 zation. Locus D HOX genes play an important role in limb genera- The most posterior located HOXD gene, HOXD13, was the first tion and mesenchymal condensation. Dysregulated HOXD13 19 expression has been detected in breast cancer, melanoma, cervical HOX gene to be described as mutated in human synpolidactyly. During normal morphogenesis, HOXD13 is involved in the deter- cancer and astrocytomas. We have investigated the epidemiology 20–22 of HOXD13 expression in human tissues and its potential deregu- mination of the terminal digestive and urogenital tracts. lation in the carcinogenesis of specific tumors. HOXD13 homeo- HOXD13 deregulation has been further detected in different tumor protein expression has been detected using microarray technology types, such as breast cancer, melanoma, cervical cancer and atroc- comprising more than 4,000 normal and neoplastic tissue samples ytomas,23–26 and in the neuro-endocrine differentiation of human including 79 different tumor categories.
  • Large Scale Transgenic and Cluster Deletion Analysis of the Hoxd Complex Separate an Ancestral Regulatory Module from Evolutionary Innovations

    Large Scale Transgenic and Cluster Deletion Analysis of the Hoxd Complex Separate an Ancestral Regulatory Module from Evolutionary Innovations

    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION where groups of genes acquired shared enhancer se- Large scale transgenic and quences acting independently of colinearity. For in- cluster deletion analysis of the stance, the early phase of Hoxd gene expression in limb buds is regulated in a colinear fashion, whereas expres- HoxD complexseparate an sion of the same genes in digits is concurrent, rather than ancestral regulatory module colinear (Nelson et al. 1996). In the HoxD complex, gene recruitment involved in from evolutionary innovations many instances the design of potent enhancer sequences, which regulate several genes at once. We proposed ear- François Spitz,1 Federico Gonzalez,1 lier that expression of four genes in developing digits was Catherine Peichel,2,3 Thomas F. Vogt,2,4 controlled by a unique enhancer that displays poor pro- Denis Duboule,1,5 and József Zákány1 moter specificity as it influenced foreign promoters when targeted to the locus (van der Hoeven et al. 1996; 1Department of Zoology and Animal Biology, University Hérault et al. 1999). Targeted deletions in the posterior of Geneva, Sciences III, 1211 Geneva 4, Switzerland; HoxD complex placed this enhancer somewhere up- 2Department of Molecular Biology, Princeton University, stream of Evx2, outside the cluster (Kondo and Duboule Princeton, New Jersey 08544, USA 1999). Likewise, several genes respond to a gut enhancer sequence that is required to form the ileo-coecal sphinc- The ancestral role of the Hox gene family is specifying ter (Zakany and Duboule 1999) and is localized either in morphogenetic differences along the main body axis.
  • THE ROLE of HOXD10 in the DEVELOPMENT of MOTONEURONS in the POSTERIOR SPINAL CORD by Veeral Shailesh Shah B.S., University of Pi

    THE ROLE of HOXD10 in the DEVELOPMENT of MOTONEURONS in the POSTERIOR SPINAL CORD by Veeral Shailesh Shah B.S., University of Pi

    THE ROLE OF HOXD10 IN THE DEVELOPMENT OF MOTONEURONS IN THE POSTERIOR SPINAL CORD by Veeral Shailesh Shah B.S., University of Pittsburgh, 2000 Submitted to the Graduate Faculty of University of Pittsburgh School of Medicine Department of Neurobiology in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2006 UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE DEPARTMENT OF NEUROBIOLOGY This thesis was presented by Veeral Shailesh Shah It was defended on January 17, 2006 and approved by Paula Monaghan-Nichols, Ph. D, CNUP, Neurobiology Debbie Chapman, Ph. D, Biological Sciences Willi Halfter, Ph. D, CNUP, Neurobiology Carl Lagenaur, Ph. D, CNUP, Neurobiology Cynthia Forehand, Ph. D, University of Vermont, Anatomy and Neurobiology Dissertation Advisor: Cynthia Lance-Jones, Ph. D, CNUP, Neurobiology ii Copyright © by Veeral Shailesh Shah 2007 iii THE ROLE OF HOXD10 IN THE DEVELOPMENT OF MOTONEURONS IN THE POSTERIOR SPINAL CORD Veeral Shah University of Pittsburgh, 2007 Hox genes encode anterior-posterior identity during central nervous system development. Few studies have examined Hox gene function at lumbosacral (LS) levels of the spinal cord, where there is extensive information on normal development. Hoxd10 is expressed at high levels in the embryonic LS spinal cord, but not the thoracic (T) spinal cord. To test the hypothesis that restricted expression of Hoxd10 contributes to the attainment of an LS identity, and specifically an LS motoneuron identity, Hoxd10 was ectopically expressed in T segments in chick embryos via in ovo electroporation. Electroporations were carried out at early neural tube stages (stages 13-15) and at the onset of motoneuron differentiation (stages 17-18).