DOCSLIB.ORG

Large Scale Transgenic and Cluster Deletion Analysis of the Hoxd Complex Separate an Ancestral Regulatory Module from Evolutionary Innovations

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Large Scale Transgenic and Cluster Deletion Analysis of the Hoxd Complex Separate an Ancestral Regulatory Module from Evolutionary Innovations Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION where groups of genes acquired shared enhancer se- Large scale transgenic and quences acting independently of colinearity. For in- cluster deletion analysis of the stance, the early phase of Hoxd gene expression in limb buds is regulated in a colinear fashion, whereas expres- HoxD complexseparate an sion of the same genes in digits is concurrent, rather than ancestral regulatory module colinear (Nelson et al. 1996). In the HoxD complex, gene recruitment involved in from evolutionary innovations many instances the design of potent enhancer sequences, which regulate several genes at once. We proposed ear- François Spitz,1 Federico Gonzalez,1 lier that expression of four genes in developing digits was Catherine Peichel,2,3 Thomas F. Vogt,2,4 controlled by a unique enhancer that displays poor pro- Denis Duboule,1,5 and József Zákány1 moter specificity as it influenced foreign promoters when targeted to the locus (van der Hoeven et al. 1996; 1Department of Zoology and Animal Biology, University Hérault et al. 1999). Targeted deletions in the posterior of Geneva, Sciences III, 1211 Geneva 4, Switzerland; HoxD complex placed this enhancer somewhere up- 2Department of Molecular Biology, Princeton University, stream of Evx2, outside the cluster (Kondo and Duboule Princeton, New Jersey 08544, USA 1999). Likewise, several genes respond to a gut enhancer sequence that is required to form the ileo-coecal sphinc- The ancestral role of the Hox gene family is specifying ter (Zakany and Duboule 1999) and is localized either in morphogenetic differences along the main body axis. In the first 30 kb of the complex (around Hoxd1) or outside vertebrates, HoxD genes were also co-opted along with of the complex (Kmita et al. 2000b). the emergence of novel structures such as limbs and Regulation inside Hox clusters is complex because of a genitalia. We propose that these functional recruitments high density of genes with embedded and shared regula- tory elements, making it difficult to assign a control se- relied on the appearance, or implementation, of regula- quence to one individual gene, rather than to a series of tory sequences outside of the complex. Whereas trans- genes (Gérard et al. 1996;Hérault et al. 1998;Sharpe et genic human and murine HOXD clusters could function al. 1998). To assess which features of Hoxd gene regula- during axial patterning, in mice they were not expressed tion are intrinsic to the complex and which are located at outside the trunk. Accordingly, deletion of the entire a distance (i.e., act in a global scale over the locus) we cluster abolished axial expression, whereas recently ac- produced transgenic mice carrying additional HoxD loci. quired regulatory controls were preserved. We used a human PAC extending from HOXD3 to 30 kb upstream EVX2 and a mouse BAC containing a tagged Received April 12, 2001;revised version accepted July 2, 2001. HoxD. We compared the regulatory potentials of these transgenic clusters with that of targeted deletions of the During vertebrate development, Hox genes are activated mouse HoxD complex, including a knock-in replace- in a spatio-temporal sequence that leads to partially ment of the cluster. We show that both approaches overlapping transcript domains along the trunk axis. mapped regulatory elements responsible for colinear ex- These expression domains generate various combina- pression within the cluster or close to it, whereas non- tions of HOX proteins at different anterior–posterior po- colinear expression in appendicular structures is dictated sitions, instructing cohorts of cells about their fate (e.g. by regulatory elements located at remote positions. We Krumlauf 1994). In most cases, there exists a correspon- also show that the presence of the complex is required dence between the order of the genes in the genome and for the maintenance of Hox gene expression profiles their domains of expression, a phenomenon referred to as throughout development. colinearity. This feature is very ancient, as it seems to operate in all animals with a bilateral body plan;hence, Results it is likely that colinearity relies on a conserved mecha- Rescue of Hoxd mutations by a human HOXD complex nism. In addition to this function, Hox genes were recruited To study the regulatory potential of a Hox complex, we during evolution to carry out a number of other tasks. produced transgenic mice carrying a 120 kb large human For example, a given subset of vertebrate Hox genes is PAC (Fig. 1A) extending from the HOXD3–HOXD1 re- required for limb development (Davis and Capecchi gion to ∼30 kb 5Ј upstream of EVX2. Five founder ani- 1996;Rijli and Chambon 1997;Zakany et al. 1997), gut mals were recovered. One carried a partial PAC and thus morphogenesis (Zakany and Duboule 1999), or hair fol- was not studied further. Among the others, three lines licle development (Godwin et al. 1998). In some cases, with either one or two copies of the transgene were es- the colinear process was also recruited, whereas else- tablished (TgN[HOXD]1–3). One high-copy number ani- mal was recovered but the line could not be established due to perinatal lethality. [Key Words: Hox cluster;colinearity;BAC;remote enhancers] Present addresses: 3Department of Developmental Biology, Stanford Uni- Mice with the human PAC showed abnormal vertebral versity, Stanford, CA 94305, USA; 4Department of Pharmacology, Merck formulae with a high penetrance of five lumbar vertebrae Research Laboratories, Merck & Co., West Point, PA 19486, USA. (L5) instead of the normal L6 (Fig. 2, top). Besides this 5 Corresponding author. anteriorization, no alteration was observed, suggesting E-MAIL [email protected]; FAX 41-22-702-6795. Article and publication are at http://www.genesdev.org/cgi/doi/10.1101/ that the human genes were expressed during mouse gad.205701. trunk development with the appropriate specificity. This GENES & DEVELOPMENT 15:2209–2214 © 2001 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/01 $5.00; www.genesdev.org 2209 Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Spitz et al. mouse counterparts. Analysis of human transgene ex- pression revealed that the HOXD genes were regulated correctly during trunk development, as expression boundaries were similar to those of the corresponding resident mouse genes (Fig. 3A, top, arrows). Human HOXD13 was weakly expressed posteriorly, starting caudal to the hindlimb bud, whereas expression of HOXD11 was at the level of pv25, around the lumbo– sacral transition. As expected, HOXD4 was expressed up to the hindbrain and in somites, similar to the mouse gene. These results indicated that the rescue observed in the vertebrae derived from a faithful expression of the transgenes. In contrast, expression of human genes in developing limbs was deficient. Early on, weak expression of both HOXD13 and HOXD11 was detected in the posterior limb bud (Fig. 3A, top, arrows). At this stage, transcript distribution differed from that of the corresponding mouse genes, which gave stronger signals over a wider domain including distal parts, in addition to the poste- rior half (Fig. 3A, top). Subsequently (Fig. 3A, bottom), the difference accentuated with an almost complete dis- appearance of all transcripts from the limbs for both HOXD13 and HOXD11, whereas endogenous genes de- veloped their robust expression patterns in both pre- sumptive digits (Hoxd13 and Hoxd11) and forearms (Hoxd11). Expression of human posterior genes was also absent from the developing genitalia, whereas a strong Figure 1. The mouse HoxD cluster, the human PAC, and signal was detected for mouse Hoxd10, Hoxd11, nested deletions. (A)TheHoxD complex (top) with genes as Hoxd12, and Hoxd13. Likewise, expression of the mouse black boxes (red for human). Below is the human PAC 78j1, Hoxd4 and Hoxd11 genes in part of the intestinal hernia with the human HOXD3 to EVX2 genes and 30 kb of DNA (Fig. 3A, bottom, arrows) was not recapitulated by the upstream, and the mouse BAC 400h17, with the murine cluster PAC transgene. and 100 kb of DNA upstream. (B) Scheme of nested deletions. These observations implied that enhancers regulating (Top)TheHoxD complex with a Hoxd11/lacZ reporter trans- Hoxd genes in limbs, genitalia, and intestinal hernia gene inserted upstream of Hoxd13. After recombination of a were absent from the 120-kb human PAC. This was fur- loxP site within Hoxd1 (arrowhead), Cre-mediated deletion re- ther investigated with transgenic mice carrying a 215-kb moved the cluster leaving the reporter gene construct TgHd11/ lacDel9 (below). The bottom lines are intermediate configura- tions obtained by using other loxP sites within the cluster. After recombination, partial deletions of either three (Del3) or seven (Del7) genes are obtained, with the reporter transgene at the same position. was verified further when the transgene was combined with a triple inactivation in cis of Hoxd13, Hoxd12, and Hoxd11 (Zakany and Duboule 1996). Mice (16 out of 18) lacking these functions (HoxDDel3/Del3) displayed an L7 formula (a supernumerary lumbar vertebra;Fig. 2, top). The introduction of the human PAC into this back- ground reinstated the predominant L6 formula (Fig. 2, top) with a substantial incidence of L5 animals. This showed a robust rescue of the mouse defect by the hu- man proteins. Nevertheless, rescue was not detected in the limb skeleton and no difference was scored between wild-type and transgenic hand skeletons (Fig. 2, bottom). Because human HOXD proteins could functionally rescue verte- bral alterations, lack of rescue in limbs was likely due to Figure 2. Vertebral and limb phenotypes. (Top) Skeletal prepa- abnormal expression of the transgenes in these struc- rations of lumbo–sacral transitions. Wild-type mice have six tures. Thus, we analyzed the expression of human lumbar vertebrae (L6).
Load more

Recommended publications
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • UNIVERSITY of CALIFORNIA, IRVINE Combinatorial Regulation By
    UNIVERSITY OF CALIFORNIA, IRVINE Combinatorial regulation by maternal transcription factors during activation of the endoderm gene regulatory network DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biological Sciences by Kitt D. Paraiso Dissertation Committee: Professor Ken W.Y. Cho, Chair Associate Professor Olivier Cinquin Professor Thomas Schilling 2018 Chapter 4 © 2017 Elsevier Ltd. © 2018 Kitt D. Paraiso DEDICATION To the incredibly intelligent and talented people, who in one way or another, helped complete this thesis. ii TABLE OF CONTENTS Page LIST OF FIGURES vii LIST OF TABLES ix LIST OF ABBREVIATIONS X ACKNOWLEDGEMENTS xi CURRICULUM VITAE xii ABSTRACT OF THE DISSERTATION xiv CHAPTER 1: Maternal transcription factors during early endoderm formation in 1 Xenopus Transcription factors co-regulate in a cell type-specific manner 2 Otx1 is expressed in a variety of cell lineages 4 Maternal otx1 in the endodermal conteXt 5 Establishment of enhancers by maternal transcription factors 9 Uncovering the endodermal gene regulatory network 12 Zygotic genome activation and temporal control of gene eXpression 14 The role of maternal transcription factors in early development 18 References 19 CHAPTER 2: Assembly of maternal transcription factors initiates the emergence 26 of tissue-specific zygotic cis-regulatory regions Introduction 28 Identification of maternal vegetally-localized transcription factors 31 Vegt and OtX1 combinatorially regulate the endodermal 33 transcriptome iii
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Homeobox Genes D11–D13 and A13 Control Mouse Autopod Cortical
    Research article Homeobox genes d11–d13 and a13 control mouse autopod cortical bone and joint formation Pablo Villavicencio-Lorini,1,2 Pia Kuss,1,2 Julia Friedrich,1,2 Julia Haupt,1,2 Muhammed Farooq,3 Seval Türkmen,2 Denis Duboule,4 Jochen Hecht,1,5 and Stefan Mundlos1,2,5 1Max Planck Institute for Molecular Genetics, Berlin, Germany. 2Institute for Medical Genetics, Charité, Universitätsmedizin Berlin, Berlin, Germany. 3Human Molecular Genetics Laboratory, National Institute for Biotechnology & Genetic Engineering (NIBGE), Faisalabad, Pakistan. 4National Research Centre Frontiers in Genetics, Department of Zoology and Animal Biology, University of Geneva, Geneva, Switzerland. 5Berlin-Brandenburg Center for Regenerative Therapies (BCRT), Charité, Universitätsmedizin Berlin, Berlin, Germany. The molecular mechanisms that govern bone and joint formation are complex, involving an integrated network of signaling pathways and gene regulators. We investigated the role of Hox genes, which are known to specify individual segments of the skeleton, in the formation of autopod limb bones (i.e., the hands and feet) using the mouse mutant synpolydactyly homolog (spdh), which encodes a polyalanine expansion in Hoxd13. We found that no cortical bone was formed in the autopod in spdh/spdh mice; instead, these bones underwent trabecular ossification after birth. Spdh/spdh metacarpals acquired an ovoid shape and developed ectopic joints, indicating a loss of long bone characteristics and thus a transformation of metacarpals into carpal bones. The perichon- drium of spdh/spdh mice showed abnormal morphology and decreased expression of Runt-related transcription factor 2 (Runx2), which was identified as a direct Hoxd13 transcriptional target. Hoxd11–/–Hoxd12–/–Hoxd13–/– tri- ple-knockout mice and Hoxd13–/–Hoxa13+/– mice exhibited similar but less severe defects, suggesting that these Hox genes have similar and complementary functions and that the spdh allele acts as a dominant negative.
    [Show full text]
  • HOXA10 Controls Osteoblastogenesis by Directly Activating Bone Regulatory and Phenotypic Genes
    University of Massachusetts Medical School eScholarship@UMMS Open Access Articles Open Access Publications by UMMS Authors 2007-02-28 HOXA10 controls osteoblastogenesis by directly activating bone regulatory and phenotypic genes Mohammad Q. Hassan University of Massachusetts Medical School Et al. Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/oapubs Part of the Life Sciences Commons, and the Medicine and Health Sciences Commons Repository Citation Hassan MQ, Tare RS, Lee SH, Mandeville M, Weiner B, Montecino MA, Van Wijnen AJ, Stein JL, Stein GS, Lian JB. (2007). HOXA10 controls osteoblastogenesis by directly activating bone regulatory and phenotypic genes. Open Access Articles. https://doi.org/10.1128/MCB.01544-06. Retrieved from https://escholarship.umassmed.edu/oapubs/1334 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in Open Access Articles by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. MOLECULAR AND CELLULAR BIOLOGY, May 2007, p. 3337–3352 Vol. 27, No. 9 0270-7306/07/$08.00ϩ0 doi:10.1128/MCB.01544-06 Copyright © 2007, American Society for Microbiology. All Rights Reserved. HOXA10 Controls Osteoblastogenesis by Directly Activating Bone Regulatory and Phenotypic Genesᰔ Mohammad Q. Hassan,1 Rahul Tare,1† Suk Hee Lee,1 Matthew Mandeville,1 Brian Weiner,1 Martin Montecino,2 Andre J. van Wijnen,1 Janet L. Stein,1 Gary S. Stein,1 and Jane B. Lian1* Department of Cell Biology and Cancer Center, University of Massachusetts Medical School, Worcester, Massachusetts 01655,1 and Departamento de Bioquimica y Biologia Molecular, Facultad de Ciencias Biologicas, Universidad de Concepcion, Concepcion, Chile2 Received 18 August 2006/Returned for modification 4 October 2006/Accepted 9 February 2007 HOXA10 is necessary for embryonic patterning of skeletal elements, but its function in bone formation beyond this early developmental stage is unknown.
    [Show full text]
  • 1 Single-Cell Mrna Profiling Reveals Heterogeneous
    bioRxiv preprint doi: https://doi.org/10.1101/327619; this version posted May 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Single-cell mRNA profiling reveals heterogeneous combinatorial expression of Hoxd genes during limb development Short title: Single-cell Hox combinations in developing limbs Authors : P. J. Fabre1,4,*, M. Leleu1, B. Mascrez2, Q. Lo Giudice4, J. Cobb3 and D. Duboule1,2,* Affiliations: 1School of Life Sciences, Ecole Polytechnique Fédérale, Lausanne, 1015 Lausanne, Switzerland. 2Department of Genetics and Evolution, University of Geneva, 1211 Geneva 4, Switzerland. 3Department of Biological Sciences, University of Calgary, Calgary, Canada. 4Department of Basic Neurosciences, University of Geneva, 1205 Geneva, Switzerland. KEYWORDS: Hox genes, digits, limb, development, enhancers, single-cell, transcriptome, differentiation, gene expression. *Corresponding authors: Pierre Fabre ([email protected]) and Denis Duboule ([email protected]) HIGHLIGHTS • Collinear expression of Hox genes is only weaved at the tissue scale • Enhancer-sharing to specific target genes is reduced at the single-cell level • Hoxd gene combinatorial expression is linked to distinct transcriptional signatures • In presumptive digits, Hoxd combinations follow a pseudotime trajectory 1 bioRxiv preprint doi: https://doi.org/10.1101/327619; this version posted May 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
    [Show full text]
  • Role of HOX Genes in Stem Cell Differentiation and Cancer
    Thomas Jefferson University Jefferson Digital Commons Kimmel Cancer Center Papers, Presentations, and Grand Rounds Kimmel Cancer Center 7-22-2018 Role of HOX Genes in Stem Cell Differentiation and Cancer. Seema Bhatlekar Helen F. Graham Cancer Center and Research Institute; University of Delaware Jeremy Z Fields CATX Inc. Bruce M. Boman Thomas Jefferson University; Helen F. Graham Cancer Center and Research Institute; University of Delaware; CATX Inc. Follow this and additional works at: https://jdc.jefferson.edu/kimmelgrandrounds Part of the Oncology Commons Let us know how access to this document benefits ouy Recommended Citation Bhatlekar, Seema; Fields, Jeremy Z; and Boman, Bruce M., "Role of HOX Genes in Stem Cell Differentiation and Cancer." (2018). Kimmel Cancer Center Papers, Presentations, and Grand Rounds. Paper 62. https://jdc.jefferson.edu/kimmelgrandrounds/62 This Article is brought to you for free and open access by the Jefferson Digital Commons. The Jefferson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The Commons is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The Jefferson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Kimmel Cancer Center Papers, Presentations, and Grand Rounds by an authorized administrator of the Jefferson Digital Commons. For more information, please contact: [email protected]. Hindawi Stem Cells International Volume 2018, Article ID 3569493, 15 pages https://doi.org/10.1155/2018/3569493 Review Article Role of HOX Genes in Stem Cell Differentiation and Cancer 1,2 3 1,2,3,4 Seema Bhatlekar , Jeremy Z.
    [Show full text]
  • Gene Networks Activated by Specific Patterns of Action Potentials in Dorsal Root Ganglia Neurons Received: 10 August 2016 Philip R
    www.nature.com/scientificreports OPEN Gene networks activated by specific patterns of action potentials in dorsal root ganglia neurons Received: 10 August 2016 Philip R. Lee1,*, Jonathan E. Cohen1,*, Dumitru A. Iacobas2,3, Sanda Iacobas2 & Accepted: 23 January 2017 R. Douglas Fields1 Published: 03 March 2017 Gene regulatory networks underlie the long-term changes in cell specification, growth of synaptic connections, and adaptation that occur throughout neonatal and postnatal life. Here we show that the transcriptional response in neurons is exquisitely sensitive to the temporal nature of action potential firing patterns. Neurons were electrically stimulated with the same number of action potentials, but with different inter-burst intervals. We found that these subtle alterations in the timing of action potential firing differentially regulates hundreds of genes, across many functional categories, through the activation or repression of distinct transcriptional networks. Our results demonstrate that the transcriptional response in neurons to environmental stimuli, coded in the pattern of action potential firing, can be very sensitive to the temporal nature of action potential delivery rather than the intensity of stimulation or the total number of action potentials delivered. These data identify temporal kinetics of action potential firing as critical components regulating intracellular signalling pathways and gene expression in neurons to extracellular cues during early development and throughout life. Adaptation in the nervous system in response to external stimuli requires synthesis of new gene products in order to elicit long lasting changes in processes such as development, response to injury, learning, and memory1. Information in the environment is coded in the pattern of action-potential firing, therefore gene transcription must be regulated by the pattern of neuronal firing.
    [Show full text]
  • REVIEW ARTICLE Genetics of Renal Hypoplasia: Insights Into the Mechanisms Controlling Nephron Endowment
    0031-3998/10/6802-0091 Vol. 68, No. 2, 2010 PEDIATRIC RESEARCH Printed in U.S.A. Copyright © 2010 International Pediatric Research Foundation, Inc. REVIEW ARTICLE Genetics of Renal Hypoplasia: Insights Into the Mechanisms Controlling Nephron Endowment JASON E. CAIN, VALERIA DI GIOVANNI, JOANNA SMEETON, AND NORMAN D. ROSENBLUM Program in Developmental and Stem Cell Biology [J.E.C., V.D.G., J.S., N.D.R.], The Hospital for Sick Children, Toronto, Ontario M5G 1L7, Canada; Division of Nephrology [J.E.C., N.D.R.], The Hospital for Sick Children, Toronto, Ontario M5G 1X8, Canada; Departments of Laboratory Medicine and Pathobiology [V.D.G., J.S., N.D.R.], Paediatrics [N.D.R.], and Physiology [N.D.R.], University of Toronto, Toronto, Ontario M5S 1A8, Canada ABSTRACT: Renal hypoplasia, defined as abnormally small kid- hypoplasia. More subtle defects in nephron number, such as neys with normal morphology and reduced nephron number, is a those at the lower end of the normal range caused by mild common cause of pediatric renal failure and adult-onset disease. bilateral renal hypoplasia, have been associated with the devel- Genetic studies performed in humans and mutant mice have impli- opment of adult-onset hypertension and chronic renal failure cated a number of critical genes, in utero environmental factors and (2–6). Here, we focus on knowledge derived from the study of molecular mechanisms that regulate nephron endowment and kidney human syndromic forms of renal hypoplasia and mouse mutants size. Here, we review current knowledge regarding the genetic contributions to renal hypoplasia with particular emphasis on the that provide insights into the molecular mechanisms that mechanisms that control nephron endowment in humans and mice.
    [Show full text]
  • Comprehensive Epigenome Characterization Reveals Diverse Transcriptional Regulation Across Human Vascular Endothelial Cells
    Nakato et al. Epigenetics & Chromatin (2019) 12:77 https://doi.org/10.1186/s13072-019-0319-0 Epigenetics & Chromatin RESEARCH Open Access Comprehensive epigenome characterization reveals diverse transcriptional regulation across human vascular endothelial cells Ryuichiro Nakato1,2† , Youichiro Wada2,3*†, Ryo Nakaki4, Genta Nagae2,4, Yuki Katou5, Shuichi Tsutsumi4, Natsu Nakajima1, Hiroshi Fukuhara6, Atsushi Iguchi7, Takahide Kohro8, Yasuharu Kanki2,3, Yutaka Saito2,9,10, Mika Kobayashi3, Akashi Izumi‑Taguchi3, Naoki Osato2,4, Kenji Tatsuno4, Asuka Kamio4, Yoko Hayashi‑Takanaka2,11, Hiromi Wada3,12, Shinzo Ohta12, Masanori Aikawa13, Hiroyuki Nakajima7, Masaki Nakamura6, Rebecca C. McGee14, Kyle W. Heppner14, Tatsuo Kawakatsu15, Michiru Genno15, Hiroshi Yanase15, Haruki Kume6, Takaaki Senbonmatsu16, Yukio Homma6, Shigeyuki Nishimura16, Toutai Mitsuyama2,9, Hiroyuki Aburatani2,4, Hiroshi Kimura2,11,17* and Katsuhiko Shirahige2,5* Abstract Background: Endothelial cells (ECs) make up the innermost layer throughout the entire vasculature. Their phe‑ notypes and physiological functions are initially regulated by developmental signals and extracellular stimuli. The underlying molecular mechanisms responsible for the diverse phenotypes of ECs from diferent organs are not well understood. Results: To characterize the transcriptomic and epigenomic landscape in the vascular system, we cataloged gene expression and active histone marks in nine types of human ECs (generating 148 genome‑wide datasets) and carried out a comprehensive analysis with chromatin interaction data. We developed a robust procedure for comparative epigenome analysis that circumvents variations at the level of the individual and technical noise derived from sample preparation under various conditions. Through this approach, we identifed 3765 EC‑specifc enhancers, some of which were associated with disease‑associated genetic variations.
    [Show full text]