INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UMI filTTiR the text directfy from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be firom any type of computer printer.
H ie quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and inq)roper alignment can adversefy afiect reproduction.
In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing fiom left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book.
Photogr^hs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6" x 9" black and white photographic prints are available for aiy photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order.
UMI A Bell & Howell information Company 300 North Zeeb Road. Ann Arbor. Ml 48106-1346 USA 3l3.'761-4700 800/521-0600
PHYLOGENY AND BIOGEOGRAPHY OF PAEONIA (PAEONIACEAE)
DISSERTATION
Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University
By Tao Sang, B.S., M.S.
*****
The Ohio State University
1995
Dissertation Committee: Approved b; Daniel J. Crawford
Keith R. Davis Tod F. Stuessy Advlso: Department of Plant Biology DMI Number: 9544679
UMI Microform 9544679 Copyright 1995, by DMI Company. All rights reserved.
This microform edition is protected against unauthorized copying under Title 17, United States Code. UMI 300 North Zeeb Road Ann Arbor, MI 48103 To My Father and Wanxiao
11 ACKNOWLEDGEMENTS
The completion of this project would not have been possible without the generous assistance of numerous people. I wish to express my sincere appreciation to my major professor, Tod F. Stuessy, for his invaluable advice, constant encouragement, and continuous support throughout all phases of my graduate study. Sincere appreciation is also expressed to Dr. Daniel J. Crawford for his generous help and invaluable guidance in all aspects of my research and study at OSU. I am deeply indebted to Dr. G. Ledyard Stebbins for his support and encouragement of the project as well as helpful discussions. I thank Professor De-yuan Hong for his continuous support, stimulating suggestions, and generous help in many aspects of this project. I thank Dr. Keith
Davis for serving in my advisory, general exam, and dissertation committee, and for his valuable comments on my dissertation draft.
Numerous friends and colleagues provided help and assistance during my field trips to California, Bulgaria, China, Greece, and Spain. Special thanks go to Abdeslam E.
Aallali, David J. Keil, Xue-yi Li, Joaguin M. Mesa, Kaiyu Pan, Yianlong Pei, D. Petkova, Tim S. Ross, Dagui Tang, Dimitris Tzandoudakis, and Dessi Usunov. I thank Bruce
iii Bartholomew, G. L. Osti, Loren H. Rieseberg, and Nigel Rowland for providing plant materials; and the Royal Botanic Gardens, Kew, for allowing collection of leaf materials. Thanks also go to my colleagues and friends, Jorge Arriagada, Erica Armstrong, Marybeth Cosner, Melanie Devore, Betsy Esselman, Karla Gengler, Seung-Chul Kim, Hongqi Li, Ming Yang, Xuanli Yao, James Zech, and Liming Zhao for their help and useful discussions. I am grateful to Mr. Roy Klehm (Klehm Nursery, South
Barrington, Illinois) for his generous financial support of the field work. This research was also supported by a National Science Foundation Doctoral Dissertation Improvement Grant DEB-9321616 to T.F.S. and T.S., a Sigma Xi Grant-in-Aid of Research, a Graduate Student Research Grant from American Society of Plant Taxonomists, two Janice Beatley Herbarium (OS) Awards, and a Graduate Student Alumni Research Award from the Ohio State University. The curators of the following herbaria are acknowledged for allowing study of specimens, either through loans or during visits: ATM, GH, GRA, K, KUN, NY, PE, SO, SOM, SZ. UC, UFA, US, and WUK. Finally, I give my most special thanks to my wife, Wanxiao, for her love, support, understanding, and help during four years of my graduate study.
IV VITA
January 19, 1966 ...... Born - Sichuan, P. R. China 1986 ...... B.S., Botany, Fudan University, Shanghai, P. R. China 1989 ...... M.S., Botany, Fudan University, Shanghai, P. R. China 1990-91 ...... Teaching Assistant, Department of Botany, Ohio University, Athens, Ohio 1991-94 ...... Graduate Teaching/Research Associate, Department of Plant Biology, The Ohio State University, Columbus, Ohio
1994-95 ...... Presidential Fellow, The Ohio State University, Columbus, Ohio
PUBLICATIONS
Yu, C. -Y., M. Zhang, P. -S. Hsu, and T. Sang. 1990. Cladistic analysis of Populus. Bulletin of Botanical Research 10; 69-76. Abu-Asab, M, S., P. D. Cantino, J. W. Nowiche, and T. Sang. 1993. Systematic implications of pollen morphology in Caryopteris (Labiatae). Systematic Botany 18: 502-515. Sang, T., D. J. Crawford, S. -C. Kim, and T. F. Stuessy. 1994. Radiation of the endemic genus Dendroseris (Asteraceae) on the Juan Fernandez Island: evidence from sequence of the ITS regions of nuclear ribosomal DNA. American Journal of Botany 81: 1494-1501. Sang, T. 1995. New measurements of distribution of homoplasy and reliability of parsimonious cladograms. Taxon 44: 77-82.
v Sang, T., D. J. Crawford, and T. F. Stuessy. 1995. Documentation of reticulate evolution in peonies (Paeonia) using internal transcribed spacers sequences of nuclear ribosomal DNA: implications for biogeography and concerted evolution. Proceeding of National Academy of Sciences, USA 92: 6813-6817. Sang, T., D. J. Crawford, T. F. Stuessy, and M. S. Silva O. 1995. ITS sequences and the origin and evolution of the genus Robinsonia (Asteraceae) on the Juan Fernandez Island. Systematic Botany 20: 55-64. Abstracts Presented To Meetings Hsu, P. -S. and T. Sang. 1988. What is the exact meaning of species? In "Abstract of International Symposium on Botanical Gardens", pp.10. Nanjing: Nanjing Botanical Garden. Sang, T. 1992. Cytology, cytogenetics, and phylogeny of Paeonia (Paeoniaceae): A preliminary report. The Ohio Journal of Science 92: 13. Abstract. Sang, T. 1993. Homoplasy distribution ratio: A new measurement of reliability of parsimonious cladograms based on levels and distribution of homoplasy. American Journal of Botany 80: 174-175. Abstract. Stuessy, T. F. and T. Sang. 1993. Phylogeny of Barnadesioideae and early evolution of Compositae. The Ohio Journal of Science 93: 41. Abstract.
Crawford, D. J., T. Sang, S. -C. Kim, and T. F. Stuessy. 1994. Evolution and origin of the endemic genus Dendroseris (Asteraceae) on the Juan Fernandez Islands: evidence from nuclear and chloroplast DNA. International Compositae Conference, Royal Botanic Gardens, Kew: 18. Abstract. Lee, N. S., T. Sang, and D. J. Crawford. 1994. ITS sequences divergence between disjunct taxa in eastern Asia and North America. American Journal of Botany 81: 167. Abstract.
Sang, T. 1994. A field study of peony species in western China. The Ohio Journal of Science 94: 21. Abstract. Sang, T., D. J. Crawford, S. -C. Kim, and T. F. Stuessy. 1994. Radiation of the endemic genus Dendroseris (Asteraceae) on the Juan Fernandez Islands: evidence from sequence of the internal transcribed spacer (ITS) region of the nuclear ribosomal DNA (nrDNA). American Journal of Botany 81: 184. Abstract. vi Sang, T., D. J. Crawford, and T. F. Stuessy. 1994. Phylogeny of Paeonia (Paeoniaceae) inferred from ITS sequences and biogeographic implication. American Journal of Botany 81: 183. Abstract. Sang, T., D. J. Crawford, T. F. Stuessy, and M. S. Silva O. 1994. ITS sequences and the origin and evolution of the genus Robinsonia (Asteraceae) on the Juan Fernandez Island. American Journal of Botany 81: 183-184. Abstract. Stuessy, T. F., D. J. Crawford, T. Sang, and R. Rodriguez. 1994. Morphological and molecular divergence between the two species of Rhaphithamnus (Verbenaceae). American Journal of Botany 81: 190. Abstract. J Stuessy, T. F., T. Sang, and M. DeVore. 1994. Phylogeny and Biogeography of Barnadesioideae (Compositae). American Journal of Botany 81: 190-191. Abstract. Stuessy, T. F., T. Sang, and M. DeVore. 1994. The Phylogeny and Biogeography of Barnadesioideae (Compositae). International Compositae Conference, Royal Botanic Gardens, Kew: 25. Abstract.
Sang, T. 1995. Evolution of peonie (Paeonia) in the Mediterranean region. The Ohio Journal of Science 95: 38. Abstract. Sang, T., D. J. Crawford, and T. F. Stuessy. 1995. Documentation of reticulate evolution in Paeonia (Paeoniaceae): implications for concerted evolution and biogeography. American Journal of Botany 82: 159- 160. Abstract. Sang, T., D. J. Crawford, and T. F. Stuessy. 1995. Comparison of chloroplast matK gene and nrDNA ITS region provides new insights into the phylogeny of Paeonia section Paeonia and molecular evolution. American Journal of Botany 82: 159.
FIELDS OF STUDY Major field: Plant Biology
Studies in Plant Evolution and Systematics with Professor Tod F. Stuessy
Vll TABLE OF CONTENTS
DEDICATION ...... ii ACKNOWLEDGEMENTS ...... iii
VITA ...... V LIST OF TABLES ...... X LIST OF FIGURES ...... xi INTRODUCTION ...... 1
CHAPTER PAGE I. DOCUMENTATION OF RETICULATE EVOLUTION IN PEONIES (PAEONIA) USING ITS SEQUENCES OF NRDNA: IMPLICATIONS FOR BIOGEOGRAPHY AND CONCERTED EVOLUTION ...... 5 Abstract ...... 5 Introduction ...... 6 Materials and methods ...... 8 Results ...... 13 Discussion ...... 23 Literature Cited ...... 30 II. COMPLEX RETICULATE EVOLUTION IN PEONIES REVEALED BY NUCLEAR AND CHLOROPLAST DNA SEQUENCES ...... 34
Abstract ...... 34 Introduction ...... 34 Materials and Methods ...... 36 Results and Discussion ...... 37 Literature Cited ...... 46 III. EVOLUTION OF CHLOROPLAST DNA INTERGENIC SPACERS AND PHYLOGENETIC IMPLICATIONS IN PEONIES (PAEONIA. PAEONIACEAE) ...... 49 Abstract ...... 49 Introduction ...... 50 Materials and Methods ...... 53 Results ...... 56 Discussion ...... 65 Literature Cited ...... 81
viii IV. EVOLUTION, CLASSIFICATION AND BIOGEOGRAPHY OF PAEONIA (PAEONIACEAE) ...... 87 Abstract ...... 87 Introduction ...... 88 Materials and Methods ...... 92 Results ...... 94 Discussion ...... 97 Literature Cited ...... 122 LIST OF REFERENCES ...... 13 0
IX LIST OF TABLES
TABLE PAGE 1. Accessions of Paeonia species studied for DNA sequences ...... 9 2. Mutations in trnL-trnF intergenic spacer ...... 66
3. Comparison of sequence divergence and phylogenetic information from variable sites among two intergenic spacers and matK coding region ...... 68 4. Comparison of phylogenetic information of indels and number of indels versus number of variable sites in two intergenic spacers ...... 69 5. Average percent sequence divergence of ITS, matK. and psbA-trnH intergenic spacer within and among sections of Paeonia ...... 98
X LIST OF FIGURES
FIGURES PAGE 1. Selected nucleotide sites that are variable between ITS sequences of mairei and P. humilis and show additivity in the sequences of ^P_«_ ^3a^ia^2i^3^i •••••••••••••••••••••••••••••••• 14 2. All variable nucleotide sites among ITS sequences of taxa of Paeonia section Paeonia ... 16 3. Phylogeny of Paeonia section Paeonia based on ITS sequences ...... 19
4. Distribution of species of Paeonia section Paeonia in Eurasia ...... 25 5. Phylogenetic tree of Paeonia section Paeonia generated from sequences of matK coding region of cpDNA ...... 38 6. Phylogeny of Paeonia section Paeonia reconstructed from a synthesis of ITS and matK Phylogenies ...... 40
7. Aligned sequences of psbA-trnH intergenic spacer of cpDNA in Paeonia ...... 57 8. Strict consensus tree of nine equally most parsimonious trees of Paeonia obtained from sequences of psbA-trnH intergenic spacer of cpDNA ...... 63 9. Strict consensus tree of five most parsimonious trees of Paeonia generated from sequences of matK coding region of cpDNA ...... 70
10. Three types of sequences and secondary structure of region between nucleotide sites 40 and 117 of psbA-trnH intergenic spacer ...... 73 11. Strict consensus tree of two equally most parsimonious trees of species of presumably divergent origin in Paeonia generated from variable sites of ITSsequences ...... 95 12. All variable nucleotide sites found in ITS sequences among P^ lactiflora. P. mairei. and Pj. obovata ...... 110 xi INTRODUCTION
Peonies (Paeonia, Paeoniaceae) , with great ornamental and medicinal value, have been known as "king of flowers" in China and "queen of herbs" in Greece for more than one thousand years. Beyond ornament and medicine, peonies have
offered many intriguing problems for plant systematists. The genus Paeonia. comprising approximately 35 diploid (2n = 10) and tetraploid species of shrubs and perennial herbs, occurs widely in five disjunct areas of the norther hemisphere, eastern Asia, central Asia, the western Himalayas, the Mediterranean region, and pacific North America. Paeonia has long been a taxonomically difficult group, presumably because it hasundergone extensive reticulate evolution, i.e., spéciation via hybridization.
Reticulate evolution, particularly when combined with polyploidization, is an important evolutionary mechanism in plants. Reconstructing reticulate evolution, however, has been a remarkably challenging task. Although the application of molecular markers has greatly facilitated the detection of hybridization and the recognition of allopolyploids in many plant groups, difficulties remain, largely due to lack of understanding the complex dynamic of molecular evolution. In this study, reticulate evolution was documented in Paeonia 2 section Paeonia based on nucleotide additivity detected by directly sequencing PCR products of internal transcribed spacers (ITS) of nuclear ribosomal DNA. The study, thus, provides an example of successfully using ITS sequences to reconstruct reticulate evolution in plants, and further demonstrates that sequence data can be highly informative and accurate for detecting hybridization. The maintenance of parental sequences in the species of hybrid origin is likely due to the slowing of concerted evolution caused by the long generation time of peonies. The partial and uneven homogenization of parental sequences displayed in nine species of hybrid origin may have resulted from gradients of gene conversion. To understand further these complex reticulate evolutionary patterns and their molecular consequences in section Paeonia. the rapidly evolving chloroplast gene, matK. was sequenced. A comparison of phylogenetic reconstructions based on nuclear (ITS) and chloroplast (matK) DNA sequences revealed an even more complex pattern of reticulate evolution in this section. Besides hybrid species detected by ITS sequence additivity, additional hybrids are identified by comparing their different positions on ITS and matK phylogenies which result from inheritance of maternal chloroplast DNA and fixation for paternal ITS sequences. The study, therefore, demonstrates that reticulate evolution has played a primary role in spéciation in peonies and can be 3 reconstructed by careful interpretation of independent gene phylogenies. Phylogenetic information is also examined from two intergenic spacers of chloroplast DNA (cpDNA), psbA-trnH and trnL-trnF. Since noncoding intergenic spacers of cpDNA are presumably under less functional constraint and thus may evolve more rapidly, they are considered to be potentially useful sources of phylogenetic information at low taxonomic
level. It was found, in peonies, that the intergenic spacer psbA-trnH evolves more rapidly and less homoplasiously than the matK coding region, and may serve as a new phylogenetic marker at the intrageneric level. However, the phylogenetic value of the frequently used intergenic spacer trnL-trnF is questionable because it evolves more slow and more homoplasious than the matK coding region in peonies. Nonetheless, the study suggests that a short cpDNA intergenic spacer alone may not provide enough synapomorphic characters to group closely related species whose relationships may be assessed by rapidly evolving sequences of multiple coding and noncoding regions of cpDNA. Based on molecular evolutionary studies, classification, evolution of morphology and cytology, and biogeography of Paeonia are discussed. Phylogenetic reconstructions support previous recognition of three sections, Oneapia. Moutan. and Paeonia. within the genus, and two subsections within section Moutan. In section Paeonia. however, two taxonomic 4 subsections are not in agreement with phylogenetic relationships. Taxonomic difficulties within this section are attributed to complex reticulate evolution. In comparison with DNA sequence divergence, section Oneapia evolved very slowly in morphology, whereas morphology of
subsection Vaainatae of section Moutan diverged more rapidly. Among species of hybrid origin in section Paeonia. the proportion of diploids is surprisingly high, suggesting that hybrid spéciation at the diploidy level is quite frequent in peonies. Biogeographically, the Eurasian and western North
American disjunction between section Oneapia and the rest of the genus may have resulted from interruption of continuous distribution of peonies in eastern Asia and western North America through the Bering land bridge during middle Miocene. Pleistocene glaciation may have served as a primary factor triggerring extensive reticulate evolution within section Paeonia and that also drastically shifted distributional ranges of both parental and hybrid species. CHAPTER I
DOCUMENTATION OF RETICULATE EVOLUTION IN PEONIES (PAEONIA) USING ITS SEQUENCES OF NRDNA; IMPLICATIONS FOR BIOGEOGRAPHY AND CONCERTED EVOLUTION
ABSTRACT. The internal transcribed spacers (ITS) of nrDNA of 32 species of genus Paeonia (Paeoniaceae) were sequenced. In section Paeonia. different patterns of nucleotide additivity were detected in 13 diploid and tetraploid species at sites that are variable in the other 12 species of the section, suggesting that reticulate evolution has occurred. Phylogenetic relationships of species which do not show additivity, and thus ostensibly were not derived through hybridization, were reconstructed using parsimony analysis. The taxa presumably derived through reticulate evolution were then added to the phylogenetic tree according to additivity from putative parents. The study provides an example of successfully using ITS sequences to reconstruct reticulate evolution in plants, and further demonstrates that the sequence data could be highly informative and accurate for detecting hybridization. The maintenance of parental sequences in the species of hybrid origin is likely due to the slowing of concerted evolution caused by the long 6 generation time of peonies. The partial and uneven homogenization of parental sequences displayed in nine species of putative hybrid origin may have resulted from gradients of gene conversion. The documented hybridizations may have occurred since the Pleistocene glaciations. The species of hybrid origin and their putative parents are now distantly allopatric. Reconstruction of reticulate evolution with sequence data, therefore, provides gene records for distributional histories of some of the parental species.
INTRODUCTION
Spéciation via hybridization, particularly when combined with polyploidization, is an important evolutionary mechanism in plants (1). Reconstructing reticulate evolution, however,
has been a remarkably challenging task. Although the application of molecular markers has greatly facilitated the detection of hybridization and the recognition of allopolyploids in many plant groups, difficulties remain, largely due to lack of understanding the complex dynamic of molecular evolution (2-5). Despite very few applications of sequences of the internal transcribed spacers (ITS) of nrDNA to studies of allopolyploid taxa, strikingly contrasting results have been reported. While in Kriaia it was shown that both parental sequences of the ITS region have been 7 maintained in an allopolyploid species (6) , in cotton the sequences of allotetraploids have been homogenized to that of either parental diploid species due to concerted evolution (7) . Further investigations, therefore, are needed to understand evolution of the ITS region following hybridization and polyploidization. Such understanding is particularly important because ITS sequences are becoming a widely used tool for phylogenetic reconstruction in plants
(8 ) . The peonies (Paeonia) represent a group which appear to have undergone extensive reticulate evolution (9-11). The genus, comprising three sections and approximately 35 diploid (2n = 10) and tetraploid species of shrubs and perennial herbs, occurs widely in disjunct areas of the northern temperate region (11-13). All the tetraploid species belong to herbaceous section Paeonia. The majority of the tetraploids occurring in the Mediterranean region has been suggested to be allopolyploids (9, 10) . The origins of the putative allotetraploids, however, remain unknown. The diploid species of this section have never been considered to be of hybrid origin. In the present study, ITS sequences were used to reconstruct the phylogeny of Paeonia. The sequence data indicate that multiple hybridization events have led to spéciation at both diploid and tetraploid levels in section Paeonia. The results provide an example of using ITS 8 sequences to detect relatively ancient reticulate evolution in plants. Reconstruction of reticulate evolution in peonies yields significant insights into their distributional histories. The possible mechanisms responsible for maintenance of complete or partial parental sequences in the
species of hybrid origin are discussed.
MATERIALS AND METHODS
Forty five accessions of 32 Paeonia species, including all the well recognized ones in section Paeonia. were sequenced. For most species, fresh leaves used as sources of DNA were collected from natural populations in Bulgaria, China, Greece, and Spain. The remaining species were collected from The Royal Botanic Garden, Kew (Table 1) . Total DNA was isolated from leaf tissues using the CTAB method (14), and purified in CsCl/ethidium bromide gradients. Double-stranded DNA of the complete ITS region was amplified by 3 0 cycles of symmetric PCR using primers ITS 4 and ITS 5
of White et al. (15), but ITS 5 was modified to match sequences the of IBs gene in seed plants (ITS 5m: GGAAGGAGAAGTCGTAACAAGG). The amplification products were purified by electrophoresis through 1.0% agarose gel followed by use of Bioclean (U. S. Biochemical) (16). Purified double-stranded DNAs were used for sequencing reactions Table 1. Accessions studies for DNA sequences. Classification of Paeonia is based on Stern (1946) and later alterations (Fang, 1958; Pan, 1979; Tzanoudakis, 1983; Stearn and Davis, 1984; Pei, 1993). *, tetraploid; #, both diploid and tetraploid populations known; ?, ploidy level unknown. *Leaf samples were obtained from field, the Roy Botanic Gardens, Kew, or Beijing Botanic Garden (BBG). ‘'For taxa obtained from botanical gardens, localities indicate from where the plants were introduced based on records of the gardens.
Taxon Collection number' Locality" Abbreviat ion
Section Moutan DC.
subsection Vaainatae Stern
P. rockii (Haw et Lauener) Hong et Li Sang 104 Mt. Taibei, Shanxi Prov., China ROKl
Pei 915006 Tiansui Co., Gansu Prov., China ROK2
Pei 913001 Shenglongjia, Hubei Prov., China R0K3
P. suffruticosa ssp. spontanea Rehd. Pei 9201001 Mt. Ji, Shanxi prov., China SPO
P. szechuanica Fang Sang 225 Marekang Co., Sichuna Prov., China ZSE
subsection Delavavanae Stern
P. delavavi Franch. Sang 186 Lijiang Co., Yunnan Prov., China DEL
P. lutea Delavay ex Franch. Sang 125 Mt. Xi, Yunnan Prov., China LUTl
Sang 272 Bomi Co., Tibet, China LÜT2
V) Table 1. Continued
Section Onaepia Lindley
P. brownii Dougl. ex Hook. Bartholomew 6708 Modoc Co., California, USA BRW
P. californica Nutt. ex Torr. et Gray Sang 583 Los Angeles Co., California, USA CALI
Sang 581 San Luis Obispo, California, USA CAL2 Section Paeonia
subsection Foliolatae Stern
*P. arietina Andr. Kew 1968-19121 Turkey ARI
*P. banatica Rochel Kew 1947-48101 Banati, Bazsarozsa, Hungary BAN
P. catnbessedesii Willk. Kew 69-17456 Balearic Islands, Spain CAM
P. iaponica (Makino) Miyabe & Takeda BBG Japan JAP
#P. mairei Levelle Sang 351 Mt. Taibei, Shanxi Prov., China MAI
*P. mascula ssp. hellenica Tzanoud. Tzanoudakis Holkis, Greece MASH
ssp. mascula (Mill.) Tzanoud. Tzanoudakis Greece MASM
P. mlokosewitschi Lomak. Kew 579-56.57915 Caucasus MLO
#P. obovata Maxim. Sang 352 Mt. Taibei, Shanxi Prov., China OBOl
Hong 85008-4 Chicheng Co., Hebei Prov., China 0B02
*P. parnassica Tzanoud. Sang 684 Mt. Panassos, Greece
P. rhodia Stern Sang 688 Island Rhodes, Greece RHO
*P. russi Bivona Kew 1974-4075 Islands of western Mediterranean RUS
*P . wittmanniana Hartwiss ex Lind. Kew 69-18448 Caucasus WIT H O Table 1. Continued
subsection Paeonia
P. anomala L. Sang 414 Yiling Co., Xinjiang Prov., China ANOl
Sang 460 Aletai Co., Xinjiang Prov., China AN02
P. broteri Boiss. et Reut. Sang 704 sierra Nevada, Granada, Spain BRT
#P. clusii Stern Sang 661 Island Crete, Greece CLU
*P. coriacea Boiss. Sang 701 Sierra Nevada, Granada, Spain COR
P. emodi Wall, ex Royle Kew 1966-7902 India EMC
?P. humilis Retzius Aallali Seno de Los Carceles, Granada, Spain HUM
P. lactiflora Pallas Hong 85006 Chicheng Co., Hebei Prov. China LAC
*P. officinalis L. Kew 481-617-48101 Europe OFFl
Rowland 0FF2
*P. peregrina Miller Sang 636 Sofia, Bulgaria PERI
Sang 642 Lefkas, Greece PER2
?P. sterniana Fletche Kew 1962-37101 Southeastern Tibet STE
P. tenuifolia L. Sang 610 Sofia, Bulgaria TEN
P. veitchii Lynch Sang 101 Mt. Taibei, Shanxi Prov., China VEI
Sang 224 Miyalo Co., Sichuan Prov., China
BBG Mongda Co., Qinghai Prov., China
P. xiniianqensis Pan Sang 462 Aletai Co., Xinjiang Prov., China XIN
H H 12
employing Sequenase Version 2.0 (U. S. Biochemical), deoxyadenosine 5'-[a-[35S]thio]triphosphate, and two forward (ITS 3 and ITS 5m) and two reverse (ITS 2 and ITS 4) primers (15, 16) . The sequencing reaction products were separated electrophoretically in 6% acrylamide gel with wedge spacers for 3 hr at 1500 V. After fixation, gels were dried and exposed to Kodak XAR x-ray film for 24-48 hr. DNA sequences were aligned manually and read for both strands.
Variable nucleotide sites were analyzed by unweighted Wagner parsimony using PAUP version 3.1.1 (17). The shortest trees were searched with the Branch-and Bound method, and character changes were interpreted with the ACCTRAN optimization. Bootstrap analyses were carried out with 1000 replications using TBR Branch Swapping of the Heuristic search (18). Section Oneania of Paeonia was chosen as the outgroup for the cladistic analysis of the genus for the following reasons: (1) Paeonia is so isolated systematically that choice of a proper outgroup from outside of the genus is not feasible for polarizing ITS variation within it; and (2) evidence from morphology, biogeography, ITS sequences and chloroplast DNA divergence suggests that the earliest evolutionary split probably occurred between section Oneapia and the rest of the genus (ref. 19, 2 0 and TS unpublished data). 13 RESULTS
Variation in ITS sequences and phylogenetic reconstruction. ITS 1 of all species sequenced is 267 bp in length. There are a 1-bp and a 3-bp insertion/deletions in ITS 2 between P. californica of section Oneapia and the rest of the species, and thus ITS 2 is 220 bp for the former and 222 for the latter. Sequences of the 5.8S rRNA gene are identical for species sampled from the three sections, and are 164 bp in length. Percentage G + C content ranges from 54.3% to 56.6% in ITS 1, from 57.2% to 59.5% in ITS 2, and 53.7% for 5.8S rDNA. The number of nucleotide sites showing fixed differences among all species is 29 in ITS 1, and 20 in ITS 2. No nucleotide substitutions were found among different populations of a species. Of 27 species and subspecies sequenced in section Paeonia. fifteen of them show nucleotide additivity at the variable sites within the section, suggesting that they may have originated via hybridization (Fig. 1, 2, ref. 6, 8). Besides these clearly additive sites, very few ambiguous ones were found in all the sequences.
Since reticulate evolution cannot be reconstructed directly by parsimony analysis, only those species showing no additivity at the variable sites in their ITS sequences were included in the analysis. Two equally most parsimonious trees (a consistency index of 0.927, and a retention index of Fig. 1. Selected nucleotide sites that are variable between ITS sequences of P. mairei and P. humilis and show additivities in the sequence of P. banatica. Arrows indicate the variable sites, and numbers indicate positions of the sites in ITS 1 and ITS 2. Nucleotide sites in ITS 1 and ITS 2 are numbered separately from 5' to 3'. A, in ITS 1; B and C, in ITS 2.
14 15
P . maire! P. banatica P. bumilia
ACGT ACGT ACGT
5' à
C (169)
B c T (38) c A (36) T (31)
5
G (179)
Fig. 1 Fig. 2. All variable nucleotide sites among ITS sequences of taxa of Paeonia section Paeonia. Paeonia brownii and P. lutea representing section Oneapis and section Moutan. respectively, are employed as outgroups for comparison. Dots (.) indicate sequences matches to the first taxon and bars (-) indicate gaps. The site numbers (1 - 24)
corresponding to the actual sites: ITS 1 — 34, 49, 74, 97, 108, 131, 138, 139, 169, 202, 226, 227, 231; ITS 2 — 31, 36, 38, 82, 99, 179, 189, 190, and 207, respectively. d = diploid; t = tetraploid; b = both diploid and tetraploid populations known; ? = ploidy level unknown. Symbols at the right side of the figure represent genotypes of parental species and their combinations in the species of hybrid origin. Abbreviations of species are the same as in Table 1.
16 17
ITS 1 ITS 2
1 1 1 1 1 1 1 1 1 1 2 2 2 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2
BRWd G A T G G AA GA G G AT G CCC C T A A C LUTd . C
ANOd r C T • TT • G • * □ LACd ••• T -• c • AG • T • TT • G •• B VEId C . T ... c . T . T . TT TG T . 1 o XIN? • • C • T ••• c • T • T • TT T G • T T
MAIb . G r • JAPd . G c T C J dn> OBOb . G • •• c T c
ARIc T .. TT c . GC T A T T GG HUM? TTT c G c T A TT GG OFFt T T T c G c T A T T GG g PARC T T T c G c T A T T GG TENd • T • • TT c A • G c T AT T • GG • • -
BANt . R • K • M W K M •• R YK M YY • K R • • • + I RUSt . R •• K M •• M • R •• K • Y Y • K • • • B4-e
EMOd • • Y • K • • • C • R K • T • TT Y G • W . B + O
STE? . R Y • K M -• M • R D • K • Y YYK • W . ^ + o + #
PERt • K •• TK C •• R YT A T TY G R • • □ + i BRTd . M K H S CORt K H S CLUb . R K M W S R RHOd . R K M W S R MAS He A G K M W S MASMc . R K M W S R B -f' MLOd . G C W S WITc . G • • K M w S CAMd . R . KM
D = A, G & T; H A, C, & T; K = G & T; M = A & C R = A & G ; S C & G; W = A & T; Y = C & T
Fig. 2 18 0.967 were obtained based on 47 variable sites found in these species, and a strict consensus tree (a consistency index of 0.911, and a retention index 0.959) was generated. For the purpose of this chapter, only relationships within section Paeonia are shown (Fig. 3).
Additivity of nucleotides and reticulate evolution. Five species, Paeonia banatica. P. russi. P. emodi. P.
sterniana. and P. pereqrina show perfect or almost perfect additivity at all sites that are variable between two or three other species or species groups (Fig. 1, 2) , suggesting strongly that these five species were derived through
hybridization (6, 8) . Paeonia banatica. a tetraploid, may have originated from hybridization between P. mairei and ARI-TEN (P. arietina. P. humilis. P. officinalis, or P. tenuifolia. or their common ancestor) because it combines different nucleotides at all sites that are variable between the putative parents (Fig. 2). At each of the additive sites 4, 7, 8, 9, 12, 13, 14, 15, 16, 17, 19, and 20 of P. banatica. one of the two nucleotides is a synapomorphy of ARI-TEN, which clearly indicates ARI-TEN to be a parent of P. banatica. At each of the remaining additive sites 2 and 6, one of the nucleotides is a synapomorphy for P. mairei and JAP & OBO (P. iaponica or P. obovata or their common ancestor), suggesting that either of them may be the other parent of P. banatica. The possibility of JAP & OBO being the parent can be ruled out. Fig. 3. Phylogeny of Paeonia section Paeonia based on ITS sequences. The left portion of the figure represents the strict consensus tree of two equally most parsimonious trees of species of divergent origin in Paeonia generated from variable sites of ITS sequences, and only interspecific relationships of section Paeonia are shown. Numbers above lines are the number of nucleotide substitutions for a branch followed by the number of transitions and transversions in parentheses. Numbers below branches give percent occurrence of a group in 1000 bootstrap replications. Reticulate evolution is demonstrated by dashed lines in the right portion of the figure. Solid circles indicate connection between two lines. Empty circles indicate that two lines cross but do not connect. Abbreviations of species in section Paeonia are the same as in Table 1.
19 Section Oneapia
5(4,1) 99 4(3,1) Section Moutan 98
1(1.0) ANO
4(2,2) VEI -5 j i"4 98 2(1,1) XIN -j ! EMO 1(1.0) 7(4,3) 68 LAC 99 1(1,0) ARI PERI HUM 5(1,4) STE 1(0,1) RUS 100 OFF 65 PAR BAN TEN ■■ 1(1.0) MAI I 2(1.1) T 83 2(2,0) JAP BRT COR CAM 87 CLU MASH MASM OBO RHO MLO WIT Fig. 3 to o 21 because at sites 7 and 8, their synapomorphies do not contribute to the additivity. Likewise, Paeonia russi. also a tetraploid, shows additivity at all sites but site 12 that are variable between P. lactiflora and P. mairei. and thus may have been derived through hybridization between these two species. The ITS sequence of the diploid P. emodi shows
additivity at sites that are variable between P. lactiflora and VEI & XIN (P. veitchii or P. xiniianaensis. or their
common ancestor). At site 5, however, P. emodi combines G and T, but its putative parents, P. lactif lora and VEI & XIN, have the same nucleotide, T. This may imply that the T is not the synapomorphy for P. lactiflora and VEI & XIN, but a parallelism. Hybridization between them may have occurred before the substitution from G to T occurred in one of the parents. Paeonia sterniana appears to combine the ITS sequences of P. lactif lora. VEI & XIN, and P. mairei ; at site 12, P. sterniana has nucleotides G, T, and A which apparently came from each of these three parental sequences, respectively. At the remaining sites, additivity is seen for only two different nucleotides because two of the three putative parental sequences have the same nucleotides at these sites. This suggests that P. sterniana may have been derived from hybridization either between P. emodi and P. mairei or among the three putative parents in other orders of occurrence. It 22 is, however, difficult to assess the mechanism of maintaining three different sequences in P. sterniana because its
chromosome number is unknown. Compared with the above four species, the tetraploid Paeonia pereqrina combines less perfectly two types of sequences. At all the variable sites, P. pereqrina contains the sequence of ARI-TEN, suggesting that ARI-TEN is one of the parents. The other parent of P. pereqrina is less clear, although the most likely candidate is P. anomala because it could have contributed to additivity at sites 4, 8, 12, and 20 of P. pereqrina. At additive site 13 of P. pereqrina. the same nucleotide C found in P. anomala and ARI-TEN must be the result of a homoplasious substitution, as judged from the phylogeny (Fig. 3) , and thus it does not conflict with the hypothesis. One apparent conflict comes from the additivity of C and T at site 18 where the plesiomorphy C exists in the two putative parents. Unlike the five species above, the last ninespecies and subspecies in Fig. 2 (denoted as BRT-WIT) , show a similar type of nucleotide additivity and only in ITS 1. Their sequences, however, cannot be interpreted directly as a combination between any two extant species in the section.
Nevertheless, the additivity appears to be a partial combination between sequences of P. lactiflora and JAP & OBO in ITS 1. A possible process producing such a pattern of additivity in this group of species will be discussed later. 23 The species presumably derived through reticulate evolution were added to the cladogram according to the combinations of putative parental sequences (Fig. 3).
DISCUSSION
Paeonia section Paeonia has long been a taxonomically difficult group, presumably because reticulate evolution has obscured morphological distinctions among divergent species (10) . Although it has been suggested that the majority of tetraploid species in the Mediterranean region are allotetraploids, their origins have not been resolved from morphological and cytogenetic data (9, 11). The present study, using ITS sequences, documents a number of spéciations via hybridization at both diploid and tetraploid levels. The parentage of five hybrid species P. banatica. P. russi. P. emodi. P. sterniana. and P. perearain. was effectively identified. The results clearly show that sequence data can be highly informative in detecting the origin of hybrids. Although alltetraploidy is common in flowering plants (1, 2), the evolutionary significance of diploid hybrid spéciation has remained unanswered and recent molecular studies have both confirmed and refuted earlier reports of stabilized diploid hybrid species (21-24). Thus, the documentation of a stabilized diploid hybrid species, P. 24 emodi. which is now allopatric with its parents is particularly noteworthy. Biogeographical implications. The current disjunct distributions between the species of hybrid origin and their putative parents is intriguing (Fig. 4) . This is particularly true for those species which now occur only in eastern Asia but are the parents of hybrid species in the Mediterranean region. Such disjunct patterns suggest that hybridization may be relatively ancient. Stebbins (10) hypothesized that the hybridization events that gave rise to the allotetraploids in the Mediterranean region began at the middle or end of the Pliocene and continued during the
Pleistocene glaciations. This hypothesis is plausible because the parental species were likely sympatric when they occupied réfugia in the Mediterranean region during Pleistocene glaciation (25, 26) . Furthermore, documentation in this study of multiple hybridizations in the Mediterranean region also suggests that the hybridization events may have occurred during different glaciations. Another significant biogeograph'c implication of detecting hybridization in section Paeonia is that the eastern Asiatic species, such as P. lactiflora. P. mairei. P. iaponica. and P. obovata. must have had much broader distribution ranges, including the Mediterranean region where they hybridized. Their distributional ranges probably began to shrink as they were replaced by their hybrids in the Fig. 4. Distribution of species of Paeonia section Paeonia in Eurasia.
25 -p. humilis^ P. coriacea ^ P. officinalis P. cambessedesii «0 P. russi banatica P. peregrina P. clusii P. rhodia P. turcica— P, arietina P. tenuifolia P. mascula
/ rnlokosewitschi P. wittmanniana P. anomala
H-
P- emodi
P. xinjingensis
P^ sterniana
r. ^'eitchii
mairei
p. obovàta W loctiflora
P. japonka
9Z 27 Mediterranean region during Pleistocene climatic changes in Europe (26-28). During the reduction of distributional
ranges, P. lactif lora. VEI & XIN, and P. mairei may have become sympatric in the Himalayas and hybridized to produce
P. emodi and P. sterniana (Fig. 4) . Therefore,
reconstruction of reticulate evolution in section Paeonia provides possible gene records for the historical
distributional ranges of these eastern Asiatic species. This could be an effective approach for studying historical plant biogeography, especially in those groups, such as Paeonia.
where hybridization occurred but no fossil record is available.
Concerted evolution. Documentation of Pleistocene hybridization in peonies using ITS sequences obviously raises the question of whether concerted evolution has operated in this group. Concerted evolution, via gene conversion or
unequal crossing-over, can homogenize different parental genomes in a hybrid so that only one parental genome type may be seen in the hybrid (7, 29, 30). In peonies, concerted evolution apparently is operating given the high homogeneity
of ITS sequences within a species, i.e., very few ambiguous nucleotide sites (except additivity resulting from hybridization) were found in the sequences obtained directly from a PGR pool, and no nucleotide substitutions were detected among populations of a species (31, 32). However, concerted evolution clearly has not homogenized the parental 28 ITS sequences in the five species of hybrid origin discussed above. Several factors may be responsible for changing the tempo of concerted evolution (32). Vegetative reproduction is likely to be a reason for maintenance of parental ITS sequences in the hybrids (8) . Frequent reproduction via rhizomes in peonies may prolong generation time significantly, which, in turn, could slow rates of concerted evolution (33-36) . If this were the case, it might be expected that the long generation time would also slow the rate of nucleotide substitution (37-39). This is most likely to be true because no novel substitutions were found in all the five species of clear hybrid origin (Fig. 2), despite the fact that they may be one million years old (40). The other factors which may affect the tempo of concerted evolution, however, cannot be assessed here because we do not know the number, chromosomal localities, or genetic interaction of nrDNA arrays in peonies (27, 28, 41).
The unusual pattern of nucleotide additivity displayed in the ITS sequences of the species group, BRT-WIT, make it less straightforward to interpret the origins of these species. They apparently combine nucleotides, to different degrees, at six of eight sites in ITS 1 that are variable between P. lactif lora and JAP & OBO. In ITS 2, however, they have the same sequence as JAP & OBO. One possible explanation for this pattern of additivity is that these species originated through hybridization between JAP & OBO 29 and an extinct species with ITS 1 sequences similar to that of P. lactif lora and with ITS 2 sequences identical to JAP & OBO. It is very unlikely, however, that such a species ever existed according to phylogenetic reconstruction and the corresponding patterns of nucleotide substitutions in section Paeonia (Fig.2, 3). We, thus, propose the alternative hypothesis that the species group, BRT-WIT, was derived through hybridization between P. lactiflora and JAP & OBO (Fig. 3) , and some of the additive sites, including all in ITS 2 and two (sites 9 and 12) near the 3' end of ITS 1, have been homogenized by concerted evolution. The pattern of uneven occurrence of homogenization fits with the model of gradients of gene conversion (42, 43). According to this model, certain regions within a gene are more likely to undergo gene conversion than others. The suggested mechanism is that gene conversion is initiated by formation of heteroduplexes which can move in either direction and be terminated randomly (43). In the present case, there may be hot spots for the initiation of heteroduplex formation somewhere in the 26S rRNA gene, and from these spots gene conversion starts and migrates into the ITS region. Based on this hypothesis, the observed pattern of homogenization in
ITS 2 and near the 3' end of ITS 1 is predicted. The question of whether this process is common for ITS regions in flowering plants is subject to further investigation, and could be addressed by the accumulation of similar 30 observations in more plant groups. In conclusion, this study provides an example of the
successful use of ITS sequence data to reconstruct reticulate evolution in plants, and demonstrates that sequence data can be highly informative and accurate for detecting hybridization. On the other hand, concerted evolution may lead to obscured patterns of nucleotide additivity in the ITS sequences of hybrids, and thus caution should be exercised when applying these data to phylogenetic studies.
LITERATURE CITED
Grant, V. 1981. Plant Spéciation, 2nd ed. (Columbia Univ., New York), pp.191-353. Soltis, P. S., Doyle, J. J. & Soltis, D. E. (1992) in Molecular Systematics of Plants, eds. Soltis, P. S.,
Soltis, D. E., & Doyle, J. J. (Chapman and Hall, New York), pp.177-201. Whitkus, R., Doebley, J., & Wendel, J. F. (1994) in DNA-based Markers in Plants, eds. Phillips, R. L. & Vasil, I. K., (Kluwer Academic, Netherlands), pp.116- 141.
Rieseberg, L. H. & Soltis, D. E. (1991) Evol. Trends Plant 5, 65-84.
Rieseberg, L. H. & Ellstrand, N. C. (1993) Crit. Rev. 31 Plant Sci. 12, 213-241, 6. Kim, K.-J. & Jansen (1994) PI. Syst. Evol. 190, 157- 185. 7. Wendel, J. F., Schnabel, A. & Seelanan, T. (1995) Proc. Natl. Acad. Sci. USA 92, 280-284. 8. Baldwin, B. G., Sanderson, M. J., Porter, J. M., Wojciechowski, M. F., Campbell, C. S., & Donoghue, M.
J. (in press) Ann. Missouri. Bot. Gard. 9. Stebbins, G. L . , Jr. (1938) Univ. Calif. Pupl. Bot. 19, 245-266. 10. Stebbins, G. L . , Jr. (1948) Madrono 9, 193-199. 11. Tzandoudakis, D. (1983) Nord. J. Bot. 3, 307-318.
12. Stern, F. C. (1946) A Study of The Genus Paeonia (Royal Hort. Society, London). 13. Pan, K. Y. (1977) in Flora Reipublicae Popularis Sinicae, V27 (Science Press, Beijing), pp.37-59. 14. Doyle, J. J. & Doyle, J. L. (1987) Phytochem. Bull.
19, 11-15. 15. White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990) in PCR Protocols: A Guide to Methods and Applications,
eds. Innis, M. Gelfand, D., Sninshy, J. & White, T.
(Academic Press, San Diego), pp.315-322. 16. Sang, T., Crawford, D. J., S.-C. Kim, & Stuessy, T. F. (1994) Amer. J. Bot. 81, 1494-1501. 17. Swofford, D. L. (1991) PAUP, Phylogenetic Analysis Using Parsimony (111. Nat. Hist. Surv. Champaign, XL), 32 Version 3.1.1. 18. Felsenstein, J. (1985) Evolution 39, 783-791. 19. Watrous, L. E. & Wheeler, Q. D. (1981) Syst. Zool. 30,
1-1 1 . 20. Maddison, W. P., Donoghue, M. J., & Maddison, D. R. (1984) Syst. Zool. 33, 83-103. 21. Rieseberg, L. H., Carter, R., & Zona, S. (1990) Evolution 44, 1498-1511.
22. Rieseberg, L. H. (1991) Amer. J. Bot. 78, 1218-1237.
23. Wendel, J. F., Stewart, J. McD., & Rettig, J. H. (1991) Evolution 45, 694-711. 24. Wolfe, A. D. & Elisens, W. J. (1994) Amer. J. Bot. 81,
1627-1635.
25. Hewitt, G. M. (1993) in Hybrid Zones and the
Evolutionary Process, eds Harrison, R. G. (Oxford
Univ., New York), pp.140-164. 26. West, R. G. (1977) Pleistocene Geology and Biology,
2nd ed. (Longman Group, London). 27. Zagwijn, W. H. (1992) Quatern. Sci. Rev. 11, 583-591. 28. Guiot, J., Pons, A, Beaulieu, J. L. & Reille, M. (1989) Nature, 338, 309-313. 29. Hillis, D. M. & Dixon, M. T. (1991) Quart. Rev. Biol. 66, 411-453. 30. Hillis, D. M., Moritz, C. Porter, C. A. & Baker, R. J.
(1991) Science 251, 308-310.
31. Arnheim, N. (1983) in Evolution of Gene and Protein, 33 eds. Nei, M. & Koehn, R. K. (Sinnauer, Sunderland, MA), pp.38—61. 32. Dover, G. (1982) Nature 299, 111-117. 33. Dover, G. A., Brown, S. D. M . . Coen. E. S. Dallas, J. , Strachan, T. & Trick, M. (1982) in Genome Evolution, eds. Dover, G. A. & Flavell, R. B. (Academic Press, London), pp.343-374. 34. Coen, E. S., Strachan, T. & Dover, G. A. (1982) J. Molec. Biol. 158, 17-35. 35. Nagylaki, T. & Petes, T. D. (1982) Genetics 100, 315- 337. 36. Ohta, T. (1983) Genet. Res. 41, 47-55. 37. Li, W.-H, M. Tanimura, & Sharp, P. M. (1987) J. Mol. Evol. 25, 330-342.
38. Gaut, B. S., Muse, S. V., Clark, W. D. & Clegg, M. T. (1992) J. Mol. Evol. 35, 292-303. 39. Suh, Y., Thueh, L. B. , Reeve, H. E., & Zimmer, E. A. (1993) Amer. J. Bot. 80, 1042-1055.
40. Sang, T., Crawford, D. J., Stuessy, T. F., & Silva O . , M. (in press) Syst. Bot. 41. Ohta, T. & Dover, G. A. (1983) Proc. Natl. Acad. Sci. USA 80, 4079-4083. 42. Hess, J. F., Schmid, C. W . , & Shen, C.-K. (1984) Science 226, 67-70. 43. Eickbush, T. H. & Burke W. D. (1986) J. Mol. Biol.
190, 357-366. CHAPTER II
COMPLEX RETICULATE EVOLUTION IN PEONIES REVEALED BY NUCLEAR AND CHLOROPLAST DNA SEQUENCES
ABSTRACT. Although spéciation via hybridization is an important evolutionary mechanism in plants, accurate reconstruction of reticulate evolution has been remarkably challenging. Here complex reticulate evolution in peonies is reconstructed based on seguences of the internal transcribed spacers (ITS) of nuclear ribosomal DNA and the chloroplast matK gene. In addition to the hybrid species detected by ITS sequence additivity, those ones that have fixed the paternal type of ITS sequences were identified by comparing their different positions on the ITS and matK phylogenies. The study reveals surprising complexity of reticulation in plant evolution that requires careful interpretation with independent gene phylogenies.
INTRODUCTION
Phylogenetic reconstructions are accumulating rapidly for all types of organisms due to developments in
34 35 evolutionary theory, new sources of molecular data, and sophisticated algorithms for data analysis (1) .
Reconstructing reticulate evolution, however, remains remarkably challenging (2,3). Although application of molecular data has provided significant insights into this problem, our ability to reconstruct accurately reticulate evolution is still limited by a lack of explicit methods and an understanding of the complex dynamic of molecular evolution (3). Because spéciation via hybridization, particularly when associated with polyploidy, is an important evolutionary mechanism in plants (4), effective approaches for reconstructing reticulate evolution need further exploration. The common garden peonies (Paeonia, Paeoniaceae), provide a favorable system for studying reticulate evolution. This genus comprises approximately 3 5 species of shrubs and perennial herbs in three taxonomic sections occurring widely in several disjunct areas of the Northern Hemisphere (5). A number of hybridization events have been documented recently in the largest section, Paeonia. using ITS sequences (Fig. 3)
(6) . Full or partial nucleotide additivity from different parental sequences is found to have been maintained in the hybrid species. Partial additivity was considered to be a result of gradients of gene conversion following hybridization (6, 7) . To understand further these complex reticulate evolutionary patterns and their molecular 36 consequences in section Paeonia. the coding region of the rapidly evolving chloroplast gene, matK. has been sequenced for 32 peony species (8).
MATERIALS AND METHODS
For most species, fresh leaves used as sources of DNA were collected from natural populations in California,
Bulgaria, China, Greece, and Spain. The voucher specimens are deposited in OS. The remaining species were collected from The Royal Botanic Gardens, Kew (Table 1). Methods of DNA extraction, amplification, and sequencing have been described (6) . PCR and sequencing primers are: three forward primers, (matKlF 5'-ACTGTATCGCACTATGTATCA-3'), (matK2F 5'-GTTCACTAATTGTGAAACGT-3'), (matK3F 5'- AAGATGCCTCTTCTTTGCAT-3'); three reverse primers, (matK2R 5'- GATCCGCTGTGATAATGAGA-3'), (matKlR5'-TTCATGATTGGCCAGATCA-3'), (trnK3R 5'-GAACTAGTCGGATGGAGTAG-3'). The matK sequences of peonies were aligned with those of tobacco and mustard (9). Variable nucleotide sites were analyzed by unweighted Wagner parsimony using PAUP version 3.1.1 (10). The shortest trees were searched with the Heuristic method, and character changes were interpreted with the ACCTRAN optimization. The section Oneapia is used as the outgroup for cladistic analysis (6, 11). Bootstrap analyses were carried out with 37 1000 replications using TBR Branch Swapping of the Heuristic search (12).
RESULTS AND DISCUSSION
The matK coding region of all peony species is 1491 bp long with 53 variable nucleotide sites found among them. Five equally most parsimonious trees, with length of 59, Cl of 0.914, and RI of 0.972, were obtained. The strict consensus tree of these five trees has a length of 62, Cl of 0.903, and RI of 0.945 (Fig. 5). Phylogenies of section Paeonia obtained from ITS and matK sequences are concordant in certain respects and discrepant in others. A synthesis of both gene phylogenies leads to a more accurate species phylogeny that reflects both divergent and reticulate evolution (Fig. 6). Hybridization events in addition to those detected from ITS sequence additivity are suggested to account for discrepancy between the nuclear and organelle gene phylogenies (13). One difference between the two phylogenies is the absence in the matK phylogeny of the two major basal clades of the ITS phylogeny (Figs. 3, 5). We suggest that hybridization occurred between the ancestor of the smaller clade (including MAI, JAP, and OBO) and an early evolutionary lineage of the larger clade on the ITS phylogeny, with the Fig. 5. Phylogenetic tree of Paeonia section Paeonia generated from sequences of matK coding region of cpDNA. Numbers above branches represent nucleotide substitutions; below branches, bootstrap values.
38 39
Section Oneapia 100
Section Moutan 100
ANO 2 STE 1 EMO 57 VEI LAC 63 XIN ARI HDM OFF 68 PAR BAN 87 WIT JAP 100 030 MAI — t e n PER 1 iR U S i70 ô \ I CAM BRT "62 à I f COR 2 RHO CLU MASH MASM MLO
Fig. 5 Fig. 6. Phylogeny of Paeonia section Paeonia reconstructed from a synthesis of the ITS and matK phylogenies. Solid lines represent divergent and patristic evolution, but length of lines is not proportional to amount of patristic change. Dashed lines represent reticulate evolution. Solid circles, maternal parents; open circles, paternal parents; shaded circles, parents with uncertain maternity or paternity; shaded squares, hybrids; open square, a hybrid with fixed ITS sequences similar to its paternal parent; open ellipse, hybrid species with fixed paternal ITS sequences; shaded ellipse, hybrid species with fully additive ITS sequences from their parents; striped ellipse, hybrid species with partially additive ITS sequences from their
parents. An attempt is made to indicate the relative order of occurrence of hybridizations, but it may not be totally accurate. Hybrid species completely fixed for one parental type ITS sequence or with partially additive ITS sequences are considered to have a more ancient origin than species with full ITS additivity if we assume that gene conversion operated at a relatively constant rate over all hybrids.
Hybrid species identified by ITS additivity but without maternal parents identified by matK sequences are considered to have a more ancient origin than those sharing matK mutations with their maternal parents if we assume that lack of shared matK mutations is due to occurrence of hybridization prior to accumulation of mutations in the
40 maternal parents. Species abbreviations as in Fig. 1. d = diploid; t = tetraploid; b = both diploid and tetraploid populations known; u = ploidy level unknown.
41 ANOd
VEId
O XINu
^ EMOd
LACd
® PERt
^ STEu
® BANt
MAIb
Fig. 6 to 43
latter serving as the maternal parent. The hybrid obtained the maternally heredited chloroplast genome (from the larger clade) , and fixed the paternal type of ITS sequences (of the smaller clade) through gene conversion (6, 14, 15).
Determination of the maternal parent in this hybridization event relies on comparison of the number of nucleotide substitutions supporting the major clades on the ITS and matK phylogenies. A comparable number of substitutions in ITS and matK are found to support section Oneapia and section Moutan. respectively, and thus would be expected to also support the same major clade of section Paeonia. Seven substitutions supporting the larger ITS clade of this section is the same as the number of substitutions supporting the entire section on the matK phylogeny, suggesting that the larger ITS clade served as the maternal parent in this hybridization. The same explanation for fixing paternal ITS sequences following hybridization can account for the origin of hybrid species, P. xiniianaensis. P. iaponica. P. obovata. P. wittmanniana. and P. tenuifolia. which also have different positions between the two gene phylogenies (Figs. 3, 5, 6). Paeonia xiniiangensis forms a strongly supported sister group with P. veitchii on the ITS phylogeny, but its sister group relationship switches to P. lactiflora on the matK phylogeny, suggesting that P. xini ianaensis is a hybrid with P. veitchii as the paternal parent and P. lactiflora as the maternal 44 parent. Likewise, P. iaponica and P. obovata that are separated from four species (ARI, HUM, OFF, PAR) on the ITS phylogeny become the sister groups to these species on the matK phylogeny, indicating that P. iaponica and P. obovata were derived from hybridization between the lineage containing these four species as the maternal parent and a paternal lineage that maintained the type of ITS sequences of the smaller clade in the ITS phylogeny (Fig. 6) . By the same reasoning, the hybrid origin and parentage of P. wittmanniana is also postulated. Paeonia tenuifolia is placed with other four species
(ARI, HUM, OFF, and PAR) in a strongly supported clade (100% bootstrap value) on the ITS phylogeny, but forms its own lineage on the matK phylogeny. Since the species does not form a sister group with any other species on the matK phylogeny, its maternal parent may be an extinct basal lineage on the matK phylogeny.
While contrasting the discrepancies of the nuclear and organelle gene phylogenies identified a number of hybrid species which no longer maintain additivity in their ITS sequences, a comparison of the concordant portions of the gene phylogenies also provides additional insights into the species phylogeny. The matk phylogeny helps identify the maternal parents of P. emodi. P. sterniana. and P. banatica. species detected as hybrids by ITS sequence additivity (Fig. 5). The remaining hybrid species identified by ITS sequence 45 additivity, however, do not share nucleotide substitutions with either putative parents in the matK phylogeny. This may be due to the occurrence of hybridization prior to the accumulation of novel substitutions in maternal parents. This phylogenetic study demonstrates that reticulate evolution has played an essential role in enhancing species diversity in peonies. Extensive hybridization is likely to have been triggered by drastic climatic changes in Europe during Pleistocene glaciation (6, 16). The analysis of both nuclear and chloroplast DNA sequences helped reconstruct the complex reticulate patterns within section Paeonia. However, this reconstruction (Fig. 6) may still be an underestimate of reticulate evolution in this group. If a hybrid species fixes the maternal parental ITS sequences, it will form the sister group to its maternal parent in both ITS and matK phylogenies and the hybridization will not be detected by this comparison. The ultimate solution of this problem may come from sequencing multiple nuclear genes and generating their phylogenies independently. If either maternal or paternal sequences of the genes are fixed in a hybrid species, comparisons of the multiple nuclear gene phylogenies as well as the organelle phylogeny should identify the hybrid species and its parentage. 46
LITERATURE CITED
1. M. J. Donoghue, Ann. Mo. Bot. Gard. 8 1 , 405 (1994) ; M. J. Sanderson, B. G. Baldwin, G. Bharathan, C. S. Campbell, C. Von Dohlen, D. Ferguson, J. M. Porter, M.
F. Wojciechowski, M. J. Donoghue, Svst. Biol. 42, 562 (1993) .
2. K. Bremer and H.-E. Wanntorp, Svst. Zool. 2 8 , 624
(1979); V. Funk, Ann. Mo. Bot. Gard. 7 2 , 681 (1985);
L. McDade, Evolution 44, 1685 (1990), Evolution 46,
1329 (1992); J. J. Doyle, Svst. Bot. 17, 144 (1992); J. C. Avise, Molecular Markers. Natural Historv and Evolution (Chapman & Hall, New York, 1994), pp.252- 359. 3. L. H. Rieseberg and N. C. Ellstrand, Crit. Rev. Plant
Sci 12, 213 (1993). 4. V. Grant, Plant Spéciation. 2nd ed. (Columbia Univ., New York, 1981),pp.191-353; L. H. Rieseberg and J. F. Wendel, in Hvbrid Zone and The Evolutionarv Process. R. G. Harrison (Oxford Univ., New York, 1993),pp.70- 109. 5. F. C. Stern, A Studv of The Genus Paeonia (Royal Hort. Society, London, 1946); K. Y. Pan, in Flora Reipublicae Popularis Sinicae. V27 (Science Press, Beijing, 1979), pp.37-59; D. Tzandoudakis, Nord. J. Bot. 3, 307 (1983). 47
6. T. Sang, D. J. Crawford, T. F. Stuessy, Proc. Natl. Acad. Sci. USA (in press). 7. J. F. Hess, C. W. Schmid, C.-K. Shen, Science 226, 67 (1984); T. H. Eickbush and W. D. Burke J. Mol. Biol.
190, 357 (1986).
8. J. A. Johnson and D. E. Soltis, Svst. Bot. 19, 143
(1994); K. P. Steele and R. Vilgalys, Svst. Bot. 19 , 126 (1994); R. G. OInstead and J. D. Palmer, Ml» J-
Bot. 8 1 , 1205 (1994).
9. H. Neuhaus and G. Link, Cur. Genet. 1 1 , 251 (1987). 10. D. L. Swofford, PAUP. Phvloaenetic Analvsis Usina Parsimony, Version 3.1.1 (111. Nat. Hist. Surv.
Champaign, IL, 1991).
11. L. E. Watrous and Q. D. Wheeler, Svst. Zool. 30 , 1 (1981) ; W. P. Maddison, M. J. Donoghue, D. R. Maddison, Svst. Zool. 33, 83 (1984). 12. J. Felsenstein, Evolution 39, 783 (1985) 13. J. D. Palmer, C. R. Shields, D. B. Cohen, T. J. Orten,
Théo. Ap p I. Gen. 65, 181 (1983); J. F. Doebley, Evolution 43, 1555 (1989); B. G. Baldwin, D. W. Kyhos,
J. Dvorak, Ann. Mo. Bot. Gard. 77, 96 (1990); R. L.
Smith and K. J. Sytsma, Ml* J. Bot. 77 , 1176 (1990);
L. H. Rieseberg, Mï« J. Bot. 78, 1218 (1991); L. H. Rieseberg and D. E. Soltis, Evol. Trends Plant 5, 65 (1991) ; D. E. Soltis, P. S. Soltis, T. G. Collies, M. L. Edgerton, Ml- J- Bot. 78, 1091 (1991); J. F. 48 Wendel, J. McD Stewart, L. H. Rettig, Evolution 45, 694 (1991); A. T. Whittemore, B. A. Schaal, Proc. Natl. Acad. Sci. USA 88, 2540 (1991). 14. D. M. Hillis, C. Moritz, C. A. Porter, R. J. Baker,
Science 251, 308 (1991). 15. J. F. Wendel, A. Schnabel, T. Seelanan, Proc. Natl.
Acad. Sci. USA 92, 280 (1995).
16. G. L. Stebbins, Madrono 9 , 193 (1948); W. H. Zagwijn, Quartern. Sci. Rev. 11, 583 (1992). CHAPTER III
EVOLUTION OF CHLOROPLAST DNA INTERGENIC SPACERS AND PHYLOGENETIC IMPLICATIONS IN PEONIES (PAEONIA. PAEONIACEAE)
ABSTRACT. Efforts have been recently undertaken to search and sequence rapidly evolving regions in the chloroplast genome for phylogenetic information at lower
taxonomic levels. The psbA-trnH and trnL fUAA)-trnF (GAA) intergenic spacers of chloroplast DNA have been sequenced for 32 species of Paeonia (Paeoniaceae). Patterns, rates, and phylogenetic information of mutations in the two intergenic spacers are compared with the rapidly evolving matK coding region. Nucleotide substitutions occur slowly and homoplasiously in the trnL-trnF intergenic spacer, but rapidly and least homoplasiously in the psbA-trnH intergenic spacer, suggesting that the latter may serve as a new and better phylogenetic marker at the intrageneric level.
Insertions and deletions, which occur less frequently than nucleotide substitutions in both intergenic spacers, provide reliable phylogenetic information. In the psbA-trnH intergenic spacer, short sequences bordered by long inverted repeats can frequently undergo inversions that are often homoplasious mutations and thus are not useful in
49 50
phylogenetic analysis. Understanding the nature of mutations in DNA sequences, therefore, is critical for interpreting them appropriately in phylogenetic reconstructions. A short cpDNA intergenic - spacer alone may not provide enough synapomorphic characters to group closely related species whose relationships may be assessed by rapidly evolving sequences of multiple coding and noncoding regions of cpDNA.
INTRODUCTION
Restriction site variation of chloroplast DNA has served as a major source of evidence for plant phylogenetic reconstructions at lower taxonomic levels, particularly the intrageneric level, over the past ten years (Sytsma and Gottlieb, 1986; Palmer et al., 1988; Wendel and Albert, 1992; Olmstead and Palmer, 1994). Recently, efforts have been undertaken to search and sequence rapidly evolving regions in the chloroplast genome for phylogenetic uses at lower taxonomic levels (Johnson and Soltis, 1994; Steele
and Holsinger, 1994; Gielly and Taberlet, 1994). Noncoding regions, including introns and intergenic spacers, are potentially good candidates because they are under less functional constrain and thus evolve more rapidly (Clegg et al., 1994; Gielly and Taberlet, 1994). A few noncoding regions have been examined to assess intrafamilial and 51 intrageneric relationships, including intergenic spacers of atpB-rbcL , rbcL-psal, trnT (UGU)-trnL (UAA) and trnL (UAA)- trnF(GAA), and the trnLfUAA) intron (Taberlet et al., 1991; GoLenberg et al., 1993; Morton and Clegg, 1993; Bohle et el., 1994; Ham et al., 1994; Manen et al., 1994; Mes and Hart, 1994). These noncoding regions provided relatively good resolution for intergeneric relationships in a variety of plant families, but their applications at the intrageneric level seem to be less effective (Bohle et al.,
1994). Therefore, the question of whether sequences of cpDNA noncoding regions can serve as significant sources of evidence for phylogenetic reconstructions at the intrageneric level needs to be addressed further.
Understanding of evolutionary mode and tempo of cpDNA noncoding regions is essential to their appropriate phylogenetic applications. Rates of nucleotide substitutions appear to vary considerably among different noncoding regions as well as among different plant groups. Substitution rates in the trnL(UAA) intron and the trnL(UAA)-trnF(GAA) intergenic spacer were found to be more than three times faster than the rbcL coding region (Gielly and Taberlet, 1994), whereas rates in the rbcL-psal intergenic spacer are not greater than the synonymous rate of the rbcL (Morton and Clegg, 1993). Sequence divergence in the trnL intron vary from 0 to 6% among different plant genera (Gielly and Taberlet, 1994). Insertions/deletions 52 (indels) occur frequently in noncoding regions (Clegg et al., 1994), but their phylogenetic values are unclear. It has been suggested that they are primarily synapomorphic characters in certain groups but homoplasious in others
(Golenberg et al., 1993; Morton and Clegg, 1993; Ham et al., 1994; Mes and Hart, 1994). In the present study, two intergenic spacers, trnL (UAA)- trnF(GAA) and psbA-trnH . in the large single copy region of cpDNA have been sequenced for 32 species of Paeonia. The trnL-trnF intergenic spacer is probably the most frequently used noncoding region of cpDNA in phylogenetic studies (Bohle et al., 1994; Gielly and Taberlet, 1994; Ham et al., 1994; Mes and Hart, 1994). The psbA-trnH intergenic spacer was chosen as a phylogenetic marker in this study because it was suggested to be an evolutionarily plastic region that could tolerate many indels (Aldrich et al., 1988). Higher rates of mutations have been detected in the psbA-trnH intergenic spacer among species of peonies than
in the trnL-trnF intergenic spacer, suggesting that the former should be more useful than the latter for phylogenetic studies at the intrageneric level.
Phylogenetic reconstruction from mutations in the psbA-trnH spacer is compared with the phylogeny recently generated from the matK coding region, the most rapidly evolving coding regions found so far in the chloroplast genome 53 (Olmstead and Palmer, 1994; Sang et al., in prep.). Phylogenetic information yielded by the two intergenic spacers and the matK coding region is also compared to assess phylogenetic potential of rapidly evolving regions in the chloroplast genome. Paeonia (Paeoniaceae, Paeoniales), occurring in several disjunct areas of the Northern Hemisphere, contains approximately 35 species of shrubs and perennial herbs in
three taxonomic sections, Paeonia. Moutan. and Oneapia (Stern, 1946; Pan, 1979; Tzanoudakis, 1983). As described in the previous chapters, studies using sequences of internal transcribed spacers (ITS) of nuclear ribosomal DNA and the matK gene revealed complex reticulate evolution in section Paeonia (Sang et al., 1995a, in prep.). Therefore, phylogenies based on cpDNA, which is usually maternally inherited in angiosperms, do not represent the species phylogeny of Paeonia.
MATERIALS AND METHODS
Forty accessions of 32 Paeonia species were sequenced. For most species, fresh leaves used as sources of DNA were collected from natural populations in Bulgaria, China, Greece, and Spain. The remaining species were collected from
The Royal Botanic Gardens, Kew (Table 1). Total DNA was 54 isolated from leaf tissues using the CTAB method (Doyle and Doyle, 1987), and purified in CsCl/ethidium bromide gradients. Double-stranded DNAs of the trnL-trnF and psbA- trnH intergenic spacers were amplified by 30 cycles of symmetric PCR (Sang, 1995b).
The primers designed for amplifying the trnL-trnF intergenic spacer are: the forward primer (trnLf), 5'- AAAATCGTGAGGGTTCAAGTC-3' ; and the reverse primer (trnFr), 5'- GATTTGAACTGGTGACACGAG-3'. The reverse primer (trnFr) is almost the same as the primer f of Taberlet et al. (1991) except for one more nucleotide at the 5' end of the trnFr. The forward primer (trnLf) is designed 10 nucleotides further away from the 3 ' end of the trnL 3 ' exon than the primer e of Taberlet et al. (1991) in order to read sequences closer to the 5' end of the intergenic spacer when it is also used as a sequencing primer. The primers designed to amplify the psbA-trnH intergenic spacer are: the forward primer (psbAf), 5'-GTTATGCATGAACGTAATGCTC-3' complementing nucleotide 608-587 of the B strand of the tobacco cpDNA sequence (Shinozaki et al., 1986); and the reverse primer (trnHr), 5'- CGCGCATGGTGGATTCACAATC-3', corresponding to nucleotide 28-49 of the B strand of the tobacco cpDNA sequence (Shinozaki et al., 1986). The primers are designed in conserved regions of psbA and trnH genes among different dicot families. Sequences of psbA gene are compared between tobacco (Shinozaki et al., 1986) and Brassica napus of Brassicaceae 55
(Genebank No. M36720) . Sequences of trnH gene are compared among tobacco, Helianthus annus of Asteraceae (Genebank No. X60428), and Arabidopsis thaliana of Brassicaceae (Genebank
No. X79898). The amplification products were purified by electrophoresis through 1.0% agarose gel followed by use of
Bioclean (U. S. Biochemical). Purified double-stranded DNAs were used for sequencing reactions employing Sequenase Version 2.0 (U. S. Biochemical), deoxyadenosine 5'-[a- [35S]thio]triphosphate, and the same primers used in PCR (Sang et al., 1995b). The sequencing reaction products were separated electrophoretically in 6% acrylamide gel with wedge spacers for 3 hr at 1500 V. After fixation, gels were dried and exposed to Kodak XAR x-ray film for 18-48 hr. DNA sequences were aligned manually. Sequence divergence between species for each cpDNA region was calculated using DNADIST program of PHYLIP version 3.5c (Felsenstein, 1994). The Jukes-Cantor model was used for correcting possible multiple hits of nucleotide substitutions (Jukes and Cantor, 1969). Mutations, including nucleotide substitutions and indels, were analyzed by unweighted Wagner parsimony using PAUP version 3.1.1 (Swofford, 1993). Indels were coded as binary characters in the analysis. The shortest trees were searched with TBR Branch Swapping of the heuristic method, and character changes were interpreted with the ACCTRAN 56 optimization. Bootstrap analyses were carried out with 100 replications using TBR Branch Swapping of the Heuristic search (Felsenstein, 1985). Section Oneapia of Paeonia was chosen as the outgroup for the cladistic analysis of the genus (Watrous and Wheeler, 1981; Maddison et al., 1984; Sang et al., 1995a).
RESULTS
The psbA-trnH intergenic spacer. Aligned sequences of the psbA-trnH intergenic spacer of Paeonia species are shown in Fig. 7. The sequences of two populations of P. lutea differ by one nucleotide substitution. For the remaining species, different accessions of each species have identical sequences. According to this straightforward alignment, the length of the intergenic spacer varies from 27 6 bp (P. mairei) to 318 bp (P. spotanae and P. szechanica). A total of thirty-one variable sites (nucleotide substitutions) and thirteen indels are found among these species. However, two indels and several substitutions located in the regions between site 58 and 97 (Fig. 7) actually result from aligning inversions (see Discussion) . Since the inversions seem to occur quite frequently and can easily introduce homoplasy, they are not included in the phylogenetic analysis. Further, three substitutions in this region whose occurrence is Fig. 7. Aligned sequences of the psbA-trnH intergenic spacer of chloroplast DNA in Paeonia. Dots indicate the same nucleotide as in P. californica; dashes indicate gaps. Asterisks and numbers indicate positions of nucleotides that are numbered consecutively from the 5' to 3'. Italic numbers indicate insertions/deletions numbered consecutively from 5' to 3'.
57 50 100 1 2 3 * 4 5 6 * CAL TCGGTTTTAGTCTT— -AATGTGTAGGAGTTAAAATGAAAGGAGCAATACC— -AACCCCTTGATAGAACAAGGAATTTG BRW DEL AATG.A. LUTl AATG.A. ——— ——— —— —————. GGG. . . LUT2 AATG.A. ROC AATG•A . .C...... AATTT...... T...... SPC AATG.A. .C...... AATTT.... SZE AATG.A. ANO AATT... .T. .0...... T.CT.T....GGG-. . VEI AATT... .T. • C...... GGG".. XIN AATT... .T. C...... GGG".. LAC AATT.., .T. .C...... GGG-. . OBO AATT... .T. .C...... GGG-. . JAP AATT... .T. .C...... GGG-. . MAI AATT... .T. .C...... T.CT.T.... GGG-. . EMO AATT.., .T. .C...... T.CT.T.... GGG-. . STE AATT... .T. .C...... GGG".. CLU AATT.., .T. .C...... T.CT.T.... GGG-.. RHO AATT.., .T. .C...... GGG-.. MASH AATT.. .T. .C...... GGG~.. MASM AATT.., .T. .C...... T.CT.T.... GGG-. . BRT AATT.. .T. .C...... GGG-. . COR AATT.. .T. .C...... T.CT.T.... GGG-. . CAM AATT.. .T. .C...... GGG-. . RUS AATT.. .T. .C...... G6G~.. MLO AATT.. .T. • C ...... T.CT.T.... GGG-. . WIT AATT.. .T. .C...... T.CT.T.... GGG-. . PER AATT.. .T. .C...... GGG-. . BAN AATT.. .T. .C...... T.CT.T.... GGG-.. ARI AATT.. .T. .C...... T.CT.T.... GGG-. . HUM AATT.. .T. .C...... T.CT.T.... GGG-. . OFF AATT.. .T. .C...... T.CT.T.... GGG-. . PAR AATT.. .T. .C...... T.CT.T.... GGG-. . TEN AATT.. .T. .C...... GGG"..
o i œ 150 200 8 * 9 10 * CAL GTATTGCTCCTTTCATTATTTAGTCGTTTTTTT----- ATT-- CTTTTTTT -AACCAAAAGTAGTTTTATGGGTTGGTTTATGGTTGA BRW ...... G ...... C ...... DEL LUTl LUT2 .TTTT...... C. ROC .TTTTTT.T...... C. SPC .TTTTTTTT...... C. SZE •TTTTTTTT•• C AND ...... ATT VEI ...... XIN ...... LAC ...... ATT OBO ...... ATT JAP ...... MAI ...... EMO ...... STE ...... CLU ...... RHO ...... ATT MASH ...... MASM ...... BRT ...... ATT COR ...... CAM ...... ATT RUS ...... MLO ...... ATT WIT ...... PER ...... ATT BAN ...... ATT ARI ...... • ATT HUM ...... ATT OFF ...... PAR ...... ATT TEN ...... ATT....
ü i KD 250 300 11 12 * 13 * CAL GTATCCTATATTCTGTTCTGTACTAATTTGGAATTTATATATATGTATGATGCCCTTCTTATTGGAAAAATGAAGAAAAGAAAGAACTAATGATGAATGG BRW T.C..... T ...... C ...... - ..... DEL ...... LUTl ...... LUT2 ...... ROC ...... G ...... — ...... SPC SZE ...... — ...... ANO ...... G ...... VEI ...... G ...... XIN ...... G ...... LAC ...... G ...... OBO ...... G ...... JAP ...... G ......
EMO ...... G ...... STE ...... G ...... CLU ...... G ...... RHO ...... G ...... MASH ...... G ...... MASM ...... G ...... BRT ...... G ...... COR ...... G ...... CAM ...... G ...... RUS ...... G ...... MLO ...... G ...... WIT ...... G ...... PER ...... G ...... BAN ...... G ...... ARI ...... G ...... HUM ...... G ...... OFF ...... G ...... PAR ...... G ...... TEN ...... G ......
o\ o 350 * CAL TTGAAATAGAATCTTTTCCCATTTTTAACCTAGTATCTAAGTTAAATATTTTAAGG BRW ...... DEL ...... LUTl ...... LUT2 ...... A ...... ROC ...... G ...... SPC ...... A ...... SZE ...... A ...... ANO ...... A....G G ...... A. VEI ...... A ---- G ...... A. XIN ...... A ---- G ...... A. LAC ...... A ---- G ...... A. OBO ...... A. ...G...... A. JAP ...... A ---- G ...... A. MAI ...... A ---- G ...... A. EMO ...... A ---- G ...... A. STE ...... A....G...... A. CLU ...... A ---- G ...... A. RHO ...... A ---- G ...... A. MASH ...... A ---- G ...... A. MASM ...... A ---- G ...... A. BRT ...... A ....G ...... A. COR ...... A .... G ...... A. CAM ...... A ----G ...... A. RUS ...... A ---- G ...... A. MLO ...... A ---- G ...... A. WIT ...... A ----G ...... A. PER ...... A .... G ...... A. BAN ...... A .... G ...... A. ARI ...... A ----G ...... A. HUM ...... A ....G ...... A. OFF ...... A ....G ...... A. PAR ...... A ....G ...... A. TEN ...... A ....G ...... A.
o\ H 62 facilitated by a special molecular structure are not included in calculating sequence divergence and reconstructing phylogeny (see Discussion). Consequently, a total of twenty- four variable sites and eleven indels are retained for estimating sequence divergence and reconstructing phylogeny. Unweighted parsimony analysis of these mutations produced nine equally most parsimonious trees. Length, consistency index (Cl) , and retention index (RI) of each of the nine trees are 36, 0.946 (0.913 excluding autapomorphies), and 0.981, respectively. A strict consensus tree is calculated from these equally most parsimonious trees (Fig. 8). Length, Cl, and RI of the consensus tree are 37, 0.921 (0.875 excluding autapomorphies), and 0.971, respectively. The trnL-trnF intergenic spacer. Because the forward primer is still very close to the 3' end of the trnL 3' exon, about 10 nucleotides at the 5' end of this intergenic spacer could not be read. Sequences of different accessions of the same species are identical. Length of the aligned sequences vary from 372 bp (P. obovata) to 404 bp (P. sterniana) for the species sequenced. Among all species, only nine variable sites and five indels were detected. Therefore, only descriptions of mutations instead of full sequences are given in Table 2. Because this spacer provides so little phylogenetic information, phylogenetic reconstruction was not performed. Fig. 8. Strict consensus tree of nine equally most parsimonious trees obtained from sequences of psbA-trnH intergenic spacer of cpDNA. Tree length = 38, Cl = 0.921 (0.875 excluding autapomorphies), RI = 0.971. Above branches, bold numbers represent nucleotide substitutions, numbers in parentheses represent number of indels; below branches, bootstrap values.
63 64
CAL BRW 96 DEL LUTl LUT2 79 ROC 1 (2 ) SPC 89 SZE ANC XIN LAC VEI OBO JAP WIT BAN ARI HÜM OFF PARI MAI RHO BRT COR CAM RUS 100 MLO PER TEN EMO STE CLÜ MASM MASH6
Fig. 8 65
Comparisons of sequence divergence and phylogenetic information from variable sites among the two intergenic spacers and the matK coding region are given in Table 3. Comparisons of phylogenetic information from indels and relative frequency of indels versus nucleotide substitutions between the two intergenic spacers are given in Table 4.
DISCUSSION
Inversions in the psbA-trnH intergenic spacer. Mutations in the region between nucleotide site 57 and 97 of
the psbA-trnH intergenic spacer appear to be highly homoplasious. Based on the present alignment, P. rockii in subsection Vaainatae shares three substitutions at sites 95-
97, and two indels(4 and 5) with subsection Delavavanae. In section Paeonia. four substitutions at sties 84, 86, 87, and 89 are also homoplasious according to the matK and ITS phylogenies (Fig. 9; Sang et al., 1995a, in prep.). Basically, three types of sequences in this region and surrounding regions can be recognized: type I occurs in section Oneapia. and P. spotanae and P. szechuanica of subsection Vaainatae; type II occurs in subsection Delavavanae and P. rockii ; and type III found in section Paeonia which further includes two sub-types i and ii (Fig. 66
Table 2. Mutations in trnL-trnF Intergenic Spacer.
Taxa® Mutation** Sequence Position®
Sect. Paeonia Insertion TTTT 38-41 STE Insertion TT 42-43 OBO Deletion 32 bps'* 62-93 Sect. Oneaoia Indel TATACC 199-204 MAI Deletion 26 bps® 249-274 sect. Oneaoia Indel TT 253-254
OBO, STE, WIT Transversion G - T 44 BAN, ARI, HUM OFF, PAR COR Transversion A - C 119
Sect. Paeonia Transition A - G 136 CIU, MASH, MASM Transversion T - G 153 CAL, ROC Transition C - T 191
XIN, LAC Transition T - C 218 CAL Transition T - C 245 ROC, SPO, SZE Transition G - A 276 CAL Transition C - T 294
PER Transition G - A 374
“Species names are abbreviated as in Table 1. 67 ‘’Polarity of mutations is determined based on a sister group relationship between section Oneaoia and the other two sections. “Nucleotide sites in aligned sequences are numbered consecutively from 5' to 3'.
‘‘attcattatgtttatcatttattctactcttt
eTTTTTTGAAGATCCAAGAAATTCCAG Table 3. Comparisons of Sequence Divergence and Phylogenetic Information from Variable Sites among Two Intergenic Spacers and matK Coding Region.
CpDNA Percent Number of Number of Percent Number of Number of Percent regions sequence variable informative informative homoplasious synapomorphic synapomorphic divergence* sites sites* sites« sites'^ sites® sitesf psbA-tmH 1.29 24 13 54.2 1 12 92.3 tmL-tmF 0.39 10 6 60.0 2 4 66.7 matK 0.58 53 30 56.6 3 27 90.0
«Average of percent species pairwise sequence divergences estimated using the Jukes-Cantor model. The same species were sequenced for these three regions, bAt a phylogenetically informative site, a nucleotide substitution is shared by two or more species. ^Percentage of phylogenetically informative sites among the total number of variable sites. «homoplasious sites of a region are those where nucleotide substitutions phylogenetically conflict with other substitutions in this region, and also the ones that conflict with phylogenies obtained from other DNA regions (e.g., matK and ITS), i.e., site 44 of tmL-tmF intergenic spacer. «Difference between number of informative sites and number of homoplasious sites. /Percentage of synapomorphic sites among informative sites.
00 Table 4. Comparisons of Phylogenetic Information of Indels and Number of Indels versus Number of Variable Sites in Two Intergenic Spacers^.
Intergenic Number of Number of Percent Number of Number of Ratio of Ratio of syn. spacers indels informative informative homoplasious synapomorphic indels to indels to indels indels indels* indels variable sites^ syn. sites<( psbA-tmH 11 9 81.8 1 8 0.46 0.67 tmL-tmF 6 3 50.0 0 3 0.60 0.75
^here is no indel in matK coding region of Paeonia. For definitions of columns see also Table 3. ("Indel 8 of psbA-tmH intergenic spacer conflicts with matK and ITS phylogenies. cRatio of number of indels to number of variable sites found in each intergenic spacer (Table 3). ((Ratio of number of synapomorphic indels to number of synapomorphic sites in each intergenic spacer (Table 3)
o\ VO Fig. 9. Strict consensus tree of five equally most parsimonious trees of Paeonia generated from sequences of matK coding region of cpDNA. Tree length =62, Cl = 0.903 (0.842 excluding autapomorphies), RI = 0.945. Numbers above branches represent nucleotide substitutions; below branches, bootstrap values.
70 71
BRW CAL 100 LUT 88 DEL 100 ROC 2 66 SPO SZE 2 ANO XIN 63 LAC VEI 1 57 EMO STE OBO JA P W IT 87 BAN A R I 68 HUM O FF 100 ' PAR MAI CLÜ 2 RHO 3 LIJ- BRT 621 COR MASH MASM 1 I CAM ^ RUS MLO PER — TEN
Fig. 9 72 lOA) . A close examination of this region reveals a pair of long inverted repeats (Fig. lOA). Type I and II sequences can be converted into each other once the sequence bordered by the inverted repeats undergoes inversions. In type III sequence, an inversion of the sequence bordered by the inverted repeats in one sub-type sequence can give rise to the other sub-type. The homoplasious occurrence of the inversions suggests that inversions of short sequences bordered by inverted repeats can occur quite frequently. In contrast to some large inversions in cpDNA that provided reliable phylogenetic information at the higher taxonomic levels (Jansen and Palmer, 1987/ Doyle et al., 1992; Raubeson and Jansen, 1992), short inversions in the intergenic spacer easily yield homoplasious information even at the interspecific level and thus should not be included in phylogenetic analyses. The mechanism responsible for change between the type III sequence and the other two types is more complex. In the type I sequence, there is another pair of short inverted repeats in the region between the long inverted repeats (Fig. lOB) . Therefore, a stem-loop structure with two stems and two loops can be formed (Fig. lOB). The evolutionary changes that are likely to have occurred in the small loop between the two stems include deletion of the T and two transitions of A to G to match the two Cs so that a single longer stem of Fig. 10. A. Three types of sequences of region between nucleotide sites 40 and 117 of psbA-trnH intergenic spacer (Fig. 1; also see text). Lines and arrows below sequences indicate inverted repeats. Nucleotides (bold letters) that are bordered by inverted repeats have undergone inversions.
B. a. Type I sequence containing another short inverted repeats between the long inverted repeats; b. The stem-loop structure of type I sequence; c. Stem-loop structure of type III (i) sequence.
73 A I AATGAAAGGAGCAATACC^CCCCTTGATAGAACAAGGT^TTTGGTATTGCTCCTTTCATT
II AATGAAAGGAGCAATACC^AATTCCTTGTTCTATCAAGGGGTyGGTATTGCTCCTTTCATT III i AATGAAAGGAGCAATACCACCCCCTTGATAGAACAAGGGGGTGGTATTGCTCCTTTCATT
11 AATGAAAGGAGCAATACCACCCCCTTGTTCTATCAAGGGGGTGGTATTGCTCCTTTCATT
B a AATGAAAGGAGCAATACC^CCCCTTCATAGAAC^GGAATTyGGTATTGCTCCTTTCATT
b AATGAAAGGAGCAATACCAA ^ ^ CCTTG& a TTACTTTCCTCGTTATGGTTrp ^GGAAC^^ ^G
^ AATGAAAGGAGC AATACC ACCCCCTTG ^ a TTACTTTCCTCGTTATGGTGGGGGAAC^ ^G
Fig. 10
vj 75 the type III sequence could be formed. The two substitutions in this small loop are facilitated by this particular stem- loop structure, and thus should not be treated as regular substitutions in calculating sequence divergence in order to avoid overestimating rates of sequence divergence. Therefore, they were not taken into account in calculating sequence divergence or reconstructing phylogeny. Likewise, the two substitutions, A to C at site 76 and T to G at site
97, are at the corresponding positions of the inverted repeats, and should be considered as only one substitution for sequence divergence estimation and phylogenetic reconstruction. Nucleotide substitutions. A comparison of average species pairwise sequence divergence in the two intergenic spacers and matK coding region (Table 2) indicates that the psbA-trnH intergenic spacer has much higher rates of nucleotide substitutions than the other two regions. The trnL-trnF intergenic spacer has lower substitution rates than the matK coding region, suggesting that higher substitution rates are not always expected in noncoding regions than in coding regions of cpDNA. Distinguishing autapomorphic, synapomorphic, and homoplasious substitutions in the intergenic spacers and the matK coding region should enable comparisons of the quality of phylogenetic information yielded from these regions (Table 3). The percentage of phylogenetically informative sites 76 (the sites where substitutions are shared by two or more taxa) among the variable sites is similar for the three regions. The percentage of synapomorphic sites among informative sites is highest in the psbA-trnH intergenic spacer (92.3%), and lowest in the trnL-trnF intergenic spacer (66.7%). Therefore, the psbA-trnH spacer, which evolves most rapidly among the three regions and provides best synapomorphic information, should be a useful region for phylogenetic studies at the intrageneric level. The matK coding region, although evolving about twice as slowly as the psbA-trnH spacer, has over twice more synapomorphic sites than the intergenic spacer because it is about four times longer and contains fewer homoplasious sites. The matK coding region, therefore, may also be a good marker for phylogenetic studies at the intrageneric level. The most frequently used intergenic spacer, trnL-trnF. however, evolves most slowly and provides the most homoplasious phylogenetic information among these three regions, and thus its phylogenetic utility at the intrageneric level is questionable. Insertions/deletions. Of eleven indels in the psbA-trnH intergenic spacer, four are perfect (indels 8 and 11) or imperfect (indels 2 and 3) duplications or deletions of prior duplications of adjacent sequences (Fig. 7). Slipped-strand mispairing is most likely the mechanism responsible for this type of indels. Indels 7, 9, and 10, which are duplications 77 or deletions of a portion of poly(T) tracks, may also result from slipped-strand mispairing. Since the probability of occurrence of further insertions or deletions increases as the track of repetitive nucleotide sequences gets longer (Streisinger and Owen, 1985; Golenberg et al., 1993), multiple indels must have occurred at indels 7 and 9 to create the pattern of differential lengths of poly(T) tracks. In the trnL-trnF intergenic spacer, three of six indels are also portions of poly(T) tracks. Indels in both intergenic spacers provide relatively reliable phylogenetic information (Table 4) . The percentages of phylogenetically informative indels are 81.8% and 50% in the psbA-trnH and trnL-trnF intergenic spacers, respectively. As phylogenetic characters, indels do not conflict with each other or with nucleotide substitutions in either of the two intergenic spacers. Only indel 8 of the psbA-trnH intergenic spacer appears to be conflict with relationships in matK and ITS phylogenies (Figs., 7-9). Apparently indels in these two intergenic spacers occur less frequently than nucleotide substitutions (Table 4). The ratios of indels to variable sites are 0.46 and 0.60 in the psbA-trnH and trnL-trnF intergenic spacers, respectively. The ratios of synapomorphic indels to synapomorphic sites are higher, i.e., 0.67 and 0.75 for the psbA-trnH and trnL-trnF intergenic spacers, respectively. The indels tend to be stabilized at the sectional and subsectional levels. 78 Therefore, indels in the intergenic spacers are likely to be reliable phylogenetic characters at the intrageneric level (Ham et al., 1994; Mes and Hart, 1994). However, they may not be reliable phylogenetic characters at higher taxonomic levels because the chance of superimposition of indels increases as divergence time increases (Morton and Clegg, 1993; Golenberg et al., 1993). Phylogenetic reconstruction. On the phylogenetic tree obtained from sequences of the psbA-trnH intergenic spacer, each of the three sections of Paeonia forms a strongly supported monophyletic group (Fig. 9) . The species in subsection Vaainatae of section Moutan are grouped monophyletically. In section Paeonia. although two taxonomic subsections are recognized, it is not expected that species in each subsection would form a monophyletic group on any gene phylogeny because the section has undergone extensive reticulate evolution which made classification based on morphology very difficult (Stebbins, 1948; Sang et al., 1995a). The phylogenetic analysis of the psbA-trnH intergenic spacer resolved only two clades within section Paeonia. The clade containing 22 species supported only by indel 8 conflicts with relationships on the matK phylogeny. It is very unlikely that this clade reflects the species phylogeny, but just random deletions of the ATT duplication in P. emodi. P. sterniana. P. clussi. and two subspecies of P. mascula (Figs. 7-9). Yet, because P. clussi and the two 79 P. mascula subspecies share a nucleotide substitution in the trnL-trnF intergenic spacer (Table 2), and P. emodi is most closely related to P. sterniana in matK phylogenies (Fig. 9), the deletion may have occurred independently, once in the common ancestor of P. clussi and two subspecies of P. mascula. and once in P. emodi and P. sterniana. The other
clade containing P. lactiflora and P. xiniianaensis is concordant with the matK phylogeny. Resolution of relationships within section Paeonia is poor in the psbA-trnH spacer phylogeny because the intergenic spacer is too short to yield sufficient phylogenetic information for very closely related species. The trnL-trnF intergenic spacer provides very limited phylogenetic information (Table 2). Two indels distinguish section oneapia from the other two sections. One indel and one nucleotide substitution serve as synapomorphies for section Paeonia. One substitution defines subsection Vaqinatae. One substitution supports the sister relationship of P. lactif lora and P. xini ianoensis. as on the psbA-trnH spacer and matK phylogenies. One shared substitution by P. californien and P. rockii. however, is clearly homoplasious. Another apparent homoplasious substitution shared by eight species (OBO, STE, WIT, BAN, ARI, HUM, OFF, and PAR) may result from a synapomorphic substitution that defines the monophyletic group on the matK phylogeny (JAP, OBO, WIT, BAN, ARI, HUM, OFF, AND PAR) followed by two independent reversal 80 substitutions in P. ~iaponica and P. sterniana (Table 2, Fig. 9) This explanation is in agreement with the matK and ITS phylogenies where P. iaponica is a sister group of P. obovata. and P. sterniana has the closest relationship to P. emodi. Therefore, both intergenic spacers provide reliable phylogenetic information at the sectional and subsectional levels, but little resolution within section Paeonia. The matK coding region, however, serves as a better phylogenetic marker for resolving close intrasectional relationships within this section (Fig. 9) . The only additional resolution obtained from the intergenic spacers is possibly the monophyletic group consisting of P. clusii and two subspecies of P. mascula. Therefore, it seems necessary to sequence multiple rapidly evolving coding and noncoding regions to resolve very close interspecific relationships using cpDNA sequences. In conclusion, the rapidly evolving psbA-trnH intergenic spacer with few homoplasious mutations can be a useful phylogenetic marker for assessing intrageneric relationships in plants. The frequently used trnL-trnF intergenic spacer, which evolves at on forth the rate of psbA-trnH spacer, yet has a higher percentage of homoplasy, may not be a good phylogenetic marker at the intrageneric level. A clear understanding of the nature of mutations in DNA sequences, such as inversions and substitutions facilitated by the stem- 81 loop structure in the psbA-trnH intergenic spacer, is critical to appropriate interpretation of the mutations for phylogenetic reconstructions. A short cpDNA intergenic spacer alone may not provide enough synapomorphic mutations to resolve close interspecific relationships which may be assessed by sequencing multiple rapidly evolving coding and noncoding regions in the chloroplast genome.
LITERATUER CITED
Aldrich, J., Cherney, B. W., Merlin, E., and Christopherson, L. (1988). The role of insertions/deletions in the evolution of the intergenic region between psbA and trnH in the chloroplast genome. Curr. Genet. 14: 137-146.
Bohle, U.-R., Hilger, H., Cerff, R., and Martin, W. F. (1994). Non-coding chloroplast DNA for plant molecular systematics at the infrageneric level. In "Molecular
Ecology and Evolution: Approaches and Applications" (B. Schierwater, B. Streit, G. P. Wagner, and R. DeSalle, Eds.), pp.391-403. Clegg, M. T., Gaut, B. S., Learn, G. H. Jr., and Morton, B.
R. (1994) . Rates and patterns of chloroplast DNA
evolution. Proc. Natl. Acad. Sci. USA 91: 6795-6801. Doyle, J. J . , Davis, J. I., Soreng, R. J., Garvin, D . , 82 Anderson, M. J. (1992) . Chloroplast DNA inversions and the origin of the grass family (Poaceae). Proc. Natl. Acad. Sci. USA 89: 7722-7726. Doyle, J. J. and Doyle, J. L. (1987). A rapid DNA isolation procedure for small quantities of fresh leaf material.
Phytochem. Bull. 19: 11-15. Felsenstein, J. (1985). Confidence limits on phylogenetics:
an approach using the bootstrap. Evolution 39: 783-791. Felsenstein, J. (1994). "PHYLIP: Phylogenetic Inference Package, Version 3.5c". The University of Washington: Seattle. Gielly, L. and Taberlet, P. (1994). The use of chloroplast
DNA to resolve plant phylogenies: Noncoding versus rbcL sequences. Mol. Biol. Evol. 11: 769-777. Golenberg, E. M . , Clegg, M. T., Durbin, M. L. , Doebley, J., and Ma, D. P. (1993). Evolution of a noncoding region
of the chloroplast genome. Mol. Phylogent. Evol. 2 : 52- 64.
Ham, R. C. H. J., Hart, H. 't. Mes, T. H. M . , Sandbrink, J. M. (1994). Molecular evolution of noncoding regions of the chloroplast genome in the Crassulaceae and related species. Curr. Genet. 25: 558-566. Jansen, R. K. and Palmer, J. D. (1987). A chloroplast DNA inversion marks an ancient evolutionary split in the sunflower family (Asteraceae). Proc. Natl. Acad. Sci.
USA 84: 5818-5822. 83 Johnson, L. A. and Soltis, D. E. (1994) matK DNA sequences and phylogenetic reconstruction in Saxifragaceae sensu
stricto. Syst. Bot. 19: 143-156. Jukes, T. H. and Cantor, C. R: (1969) . Evolution of protein molecules. In "Mannamlian protein metabolism" (H. N. Munro, Eds.), pp21-132, Academic Press, New York. Levinson, G. and Gutman, G. A. (1987) . Slipped-strand mispairing: A major mechanism for DNA sequence
evolution. Mol. Biol. Evol. 4 : 203-221. Maddison, W. P., Donoghue, M. J., and Maddison, D. R. (1984). Outgroup analysis and parsimony. Syst. Zool.
33: 83-103. Maner, J.-F., Natali, A., and Ehrendorfer, F. (1994). Phologeny of Rubiaceae-Rubieae inferred from the sequence of a cpDNA intergene region. PI. Syst. Evol.
190: 195-212. Mes, T. H. M. and Hart H. 't. (1994). Sedum surculosum and S. iaccardianum (Crassulaceae) share a unique 70 bp deletion in the chloroplast DNA trnL(UAA)-trnF(GAA)
intergenic spacer. PI. Syst. Evol. 193: 213-221. Morton, B. R. and Clegg, M. T. (1993). A chloroplast DNA mutational hotspot and gene conversion in a noncoding region near rbcL in the grass family (Poaceae). Curr. Genet. 24; 357-365.
Olmstead, R. G. and Palmer, J. D. (1994). Chloroplast DNA systematics: A review of methods and data analysis. 84 Amer. J. Bot. 81; 1205-1224. Palmer, J. D., Jansen, R. K. , Michaels, H. J. , Chase, M. W., and Manhart, J. W. (1988). Chloroplast DNA variation-and plant phylogeny. Ann. Missouri Bot. Gard. 75: 1180-1206.
Pan, K. (1979). Paeonia. In "Flora Reipublicae Siniccae Vol. 27", pp. 37-59, Science Press, Beijing. Rauberson, L. A. and Jansen, R. K. (1992) . Chloroplast DNA
evidence on the Ancient Evolutionary split in vascular land plants. Science 255: 1697-1699. Sang, T., Crawford, D. J., and Stuessy, T. F. (1995a). Documentation of reticulate evolution in peonies (Paeonia) using sequences of internal transcribed spacer of nuclear ribosomal DNA: implications for
biogeography and concerted evolution. Proc. Natl. Acad. Sci. USA 92, in press. Sang, T. Crawford, D. J., and Stuessy, T. F. in prep. Complex reticulate evolution in peonies revealed by nuclear and chloroplast DNA sequences. Sang, T., Crawford, D. J., Stuessy, T. P., and Silva 0., M. (1995b) . ITS sequences and the phylogeny of the genus Robinsonia (Asteraceae). Syst. Bot. 20: 55-64. Shinozaki, K. , Ohme, M., Tanaka, M. , Wakasugi, T.,
Hayashida, N. , Matsubayashi, T., Zaita, N. , Chunwongse, J., obokata, J. Yamaguchi-Sinozaki, K., Ohto, C., Torazawa, K . , Meng B. Y. , Sugita, M. , Deno, H. , 85 Kamogashira, T., Yamada, K., Kusuda, J. , Takaiwa, F., Kato, A., Tohdoh, N. , Shimada, H., Sugiura, m. (1986). The complete nucleotide sequence of the tobacco
chloroplast genome. Plant Mol. Biol. Rep. 4 : 110-147. Stebbins, G. L. , Jr. (1948). Review of "A study of The
Genus Paeonia by F. C. Stern". Madrono 9 : 193-199. Steele, K. P. and Vilgalys, R. (1994). Phylogenetic analyses of Polemoniaceae using nucleotide sequences of
the plastid gene matK. Syst. Bot. 19; 126-142. Streisinger, G. and Owen, J. (1995). Mechamisms of spontaneous and induced frameshift mutation in
bacteriophage T4. Genetics 109: 633-659.
Swofford, D. L. (1993). "PAUP: Phylogenetic Analysis Using Parsimony, Version 3.1.1." Illinois Natural History Survey, Champaign.
Systma, K. J. and Gottlieb, L. D. (1986) . Chloroplast DNA evolution and phylogenetic relationships in Clarkia
sect. Peripetasma (Onagraceae). Evolution 40 : 1248- 1262.
Taberlet, P., Gielly, L., Pautou, G., and Bouvet J. (1991). Universal primers for amplification of three non-coding
regions of chloroplast DNA. Plant Mol. Biol. 17: 1105- 1109.
Tzanoudakis, D. (1983). Karyotypes of four wild Paeonia
species from Greece. Nord. J. Bot. 3 : 307-318. Watrous, L. E. and Wheeler, Q. D. (1981) . The out-group 86 comparison method of character analysis. Syst. Zool. 30: 1-11.
Wendel, J. F. and Albert, V. A. (1992). Phylogenetics of the cotton genus fGossvpium^: character-stated weighted parsimony analysis of chloroplast-DNA restriction site data and its systematic and biogeographic implications. Syst. Bot. 17: 115-143. CHAPTER IV
EVOLUTION, CLASSIFICATION, AND BIOGEOGRAPHY OF PAEONIA (PAEONIACEAE)
ABSTRACT. Phylogenetic reconstructions using sequences of internal transcribed spacers (ITS) of nuclear ribosomal
DNA and chloroplast DNA reveal monophyly of each of three sections of the genus Paeonia. Within section Moutan. two subsections, Delavavanae and Vaainatae. are monophyletic groups in molecular phylogenies. In section Paeonia. however, two taxonomic subsections are not in agreement with phylogenetic relationships. Taxonomic difficulties within this section are attributable to complex reticulate evolution. Evolution of major taxonomic characters are examined based on phylogenetic reconstructions and previous results of artificial hybridizations. Sequence divergences of ITS, matK gene, and psbA-trnH intergenic spacers of cpDNA are compared within and among sections of Paeonia. Sequences of ITS evolve slightly more rapidly than the psbA-trnH intergenic spacer, and over three times more rapidly than the matk coding region. DNA sequence divergences suggest that the earliest evolutionary split might have occurred between section Oneapia and the other two sections. Morphologically,
87 88
section Oneapia evolved very slowly, whereas subsection Vaainatae diverged rapidly. Among species of hybrid origin in section Paeonia. the proportion of diploids is surprisingly high, suggesting that hybrid spéciation at the diploid level is quite frequent in peonies. The Eurasian and western North American disjunction between section Oneapia and the rest the genus may have resulted from interruption of a continuous distribution of peonies across the Bering land
bridge during middle Miocene. Pleistocene glaciation may have been a primary factor in triggering extensive reticulate evolution within section Paeonia and may have also drastically shifted distributional ranges of species of the section.
INTRODUCTION
Paeonia comprises approximately 35 species of shrubs and perennial herbs distributed widely in five disjunct areas in the northern hemisphere: eastern Asia, central Asia, the western Himalayas, the Mediterranean region, and Pacific North America (Stern, 1946; Pan, 1979; Tzanoudakis, 1983; Pei, 1993). The genus is systematically isolated, having been placed in the unigeneric family Paeoniaceae which has either been placed by itself or together with Glaucidiaceae in order Paeoniales (Takhtajan, 1969, 1987; Thorne, 1992). 89
Because of their great ornamental and medicinal value, peonies have been known as "king of flowers" in China and "queen of herbs" in Greece for more than one thousand years (Gambrill, 1988). Paeonia was divided by Lynch (1890) into three subgenera, Moutan. Oneapia. and Paeon. In the latest and most widely recognized monograph of Paeonia (Stern,1946), these same subdivisions were maintained, but as sections. Section Oneapia. endemic to Pacific North America, comprises
two herbaceous species with conspicuous staminodial disks and small fleshy concave petals. Section Moutan with six species, occurring in central and western China, is divided into two subsections, Delavavanae and Vaainatae. They are
shrubs with conspicuous staminodial disks and large spreading petals. Section Paeonia ("Paeon") , which includes the type species P^ officinalis. is also divided into two subsections, Foliolatae and Paeonia f " Dissectifoliae"), distributed disjunctly in eastern Asia, central Asia, the western Himalayas, and the Mediterranean region. This section consists of approximately 27 herbaceous species with inconspicuous or no staminodial disks and large petals that are either spreading or cup-shaped. Sections Oneapia and Moutan contain only diploid species (2n = 10), while one third of the species in section Paeonia are tetraploids (Stern, 1946; Tzanoudakis, 1977; Hong et al., 1988) (Table
1) • 90 Paeonia is a phylogenetically and taxonomically complex group (Stebbins, 1938a; Hong et al., 1988). Particularly, section Paeonia may have undergone reticulate evolution which makes classification even more difficult. Regarding origins of tetraploid species in this section. Barber (1941) and Stern (1946) considered that they were autotetraploids derived from certain extant diploid ancestors. In contrast, Stebbins (1948) argued that the majority of tetraploid species are allotetraploids based on observations of bivalents in meiosis of most tetraploid species that he studied (e.g., P^ officinalis. P. nereorina. and P. wittmanniana). He further indicated that certain tetraploid species appeared to link gaps of morphological variation among some diploid species, which also suggested hybrid origins of the tetraploids. Later cytogenetic studies supported allotetraploid origin of P^ officinalis and P.
perearina. and also revealed P_^ parnassica as an allotetraploid (Tzanoudakis, 1977; Schwarzacher-Robinson, 1986). Recent molecular phylogenetic studies using both nuclear and chloroplast DNA sequences revealed extremely complex reticulate evolution in section Paeonia (Sang et al, in press; in prep.). The majority of tetraploid species as well as some diploid species are derived from one or more hybridization events. Molecular makers that have been used for phylogenetic studies include internal transcribed spacers (ITS) of nuclear 91 ribosomal DNA, matK gene coding region of cpDNA, and cpDNA intergenic spacers psbA-trnH and trnL-trnF (Sang et al., in press, in prep.; Sang, in prep.). Results described in the previous chapters include the -ITS phylogeny of section Paeonia. matK phylogeny of the genus, osbA-trnH spacer phylogeny of the genus, and comparison of the average rates of sequence divergence in the genus among matK. psbA-trnH intergenic spacer, and trnL-trnF intergenic spacer (Sang et
al., in press, in prep; Sang, in prep.). In the present chapter, the ITS phylogeny of the entire genus is presented and compared with cpDNA phylogenies. Sequence divergences of ITS, matK. psbA-trnH intergenic spacer are calculated within and among sections. Based on molecular phylogenies and DNA sequence divergences, patterns and rates of morphological evolution through divergent and reticulate spéciation in Paeonia are examined. Taxonomic problems of the genus,
especially involving reticulate evolution in section Paeonia. are discussed. Modes of spéciation, rates of DNA sequence divergence, and concerted evolution of ITS sequences are compared at diploid and tetraploid levels. Paeonia. with widely disjunct distributions and rich endemism, provides a favorable system for studying historical biogeography of the northern hemisphere. Historical biogeography of this region has been strongly impacted by Pleistocene glaciation, which drastically altered distributions of organisms and caused significant extinction 92
(Noonan, 1988; Potts and Behrensmeyer, 1992). Pleistocene glaciation has been suggested as a primary factor triggering extensive hybridization in Paeonia (Sang et al., in press). Rapid spéciation via hybridization and drastic changes of distributional ranges of peony species since Pleistocene glaciation are examined more carefully for biogeographic implications. Intercontinental disjunct distribution between section Oneapia (western North America) and the other two
sections (Eurasia) is also discussed based on phylogenetic reconstructions and the molecular clock hypothesis.
MATERIALS AND METHODS
Accessions of Paeonia species sequenced for ITS, matK, psbA-trnH intergenic spacer, and trnL-trnH intergenic spacer are given in Table 1. For most species, fresh leaves used as sources of DNA were collected from natural populations in Bulgaria, China, Greece, and Spain. The remaining species were collected from The Royal Botanic Garden, Kew (Table 1). Total DNA was isolated from leaf tissues using the CTAB method (Doyle and Doyle, 1987), and purified in CsCl/ethidium bromide gradients. Double-stranded DNAs were amplified by 3 0 cycles of symmetric PGR. Details regarding PGR and primers are described in the previous chapters. The amplification products were purified by 93 electrophoresis through 1.0% agarose gel followed by use of Bioclean (U. S. Biochemical) . Purified double-stranded DNAs were used for sequencing reactions employing Sequenase Version 2.0 (U. S. Biochemical), deoxyadenosine 5'-[a- [35S]thio]triphosphate, and the same primers used in PCR (Sang et at., 1995). The sequencing reaction products were separated electrophoretically in 6% acrylamide gel with wedge spacers for 3 hr at 1500 V. After fixation, gels were dried and exposed to Kodak XAR x-ray film for 18-48 hr. DNA sequences were aligned manually. Sequence divergence between species for each DNA region was calculated using DNADIST program of PHYLIP version 3.5c (Felsenstein, 1994). The Jukes-Cantor model was used as the method of correcting possible multiple hits of nucleotide
substitutions (Jukes and Cantor, 1969). Mutations including nucleotide substitutions and indels were analyzed by unweighted Wagner parsimony using PAUP version 3.1.1 (Swofford, 1993). Indels are coded as binary characters in the analysis. The shortest trees were searched with TBR Branch Swapping of the heuristic method, and character changes were interpreted with the ACCTRAN optimization. Bootstrap analyses were carried out with 1000 replications using TBR Branch Swapping of the Heuristic search (Felsenstein, 1985). Section Oneapia of Paeonia was chosen as the outgroup for the cladistic analysis of the genus (Sang et al., in press; also see discussion). 94 Morphological characters were examined from literature (Stebbins, 1938a; Stern, 1946; Fang, 1958; Pan, 1979), field collections, and herbarium specimens during visits to or on loan from ATH, GRA, GH, K, KUN, NY, PE, SO, SOM, SZ, UC, UPA, US, and WUK.
RESULTS
Phylogenetic relationships of Paeonia species not showing ITS sequence additivity, and thus ostensibly not derived through hybridization, were reconstructed using parsimony analysis of 47 variable sites of the ITS sequences. The strict consensus tree (Cl = 0.911, RI = 0.959) was generated from two equally most parsimonious trees (Cl = 0.927, RI = 0.967) (Fig. 11). Species of section Paeonia that show ITS sequence additivity, and thus presumably were derived through reticulate evolution, were not included in this phylogenetic tree. A more comprehensive reconstruction of reticulate evolution in section Paeonia was obtained by comparing ITS and matK phylogenies (Fig. 6). Sequence divergences of ITS, matK. and psbA-trnH intergenic spacer were calculated. Average percent sequence divergences of these three DNA regions were compared within and among sections (Table 5). Sequence divergence of trnL- trnF intergenic spacer that evolves very slowly is not Fig. 11. Strict consensus tree of two equally most parsimonious trees of species of presumably divergent origin in Paeonia generated from variable sites of ITS sequences.
Tree length = 54, Cl = 0.911, RI = 0.959. Numbers above lines are the number of nucleotide substitutions for a branch followed by the number of transitions and transversions in parentheses. Numbers below branches give percent occurrence of a group in 1000 bootstrap replications.
95 96
BRW jsect. I Oneapia CAL 5 99 LUT jsu b sect. I Delavayanae DEL sect. ROC Moutan jsu b sect. SPC I Vaginatae I SZE ANC VEI
98 XIN 68 LAC 99 subsect. ARI Paeonia
HUM sect. Paeonia OFF 100 PAR TEN MAI jsubsect. 83 JAP I Foliolatae I 87 OBO
Fig. 11 97 presented here. Comparisons of sequence divergences indicate that ITS sequences evolve slightly more rapidly than psbA- trnH intergenic spacer, and over three times more rapidly than the matK coding region.
DISCUSSION
Classification. Molecular phylogenies support recognition of three sections within Paeonia and two subsections in section Moutan. Separation of section Oneapia and the other two sections is strongly supported by both ITS (99% bootstrap value) and cpDNA (100% bootstrap value) phylogenies (Figs. 9, 11). Monophyly of section Moutan is also strongly supported by high bootstrap values on ITS and cpDNA phylogenies. Within this section, monophyly of each of two subsections is relatively strongly supported on the ITS and matK phylogenies (Figs. 9, 11), whereas no mutations were found in either cpDNA intergenic spacer to support subsection Delavavanae (Sang, in prep.). This is apparently due to insufficient time for the accumulation of mutations in the two short intergenic spacers in the common ancestor of this subsection (Sang, in prep.). Recognition of the two subsections, therefore, is still supported by overall phylogenetic information. Support for monophyly of section Paeonia is very strong Table 5. Average percent sequence divergences of ITS, matK. and psbA-trnH intergenic spacer within and among sections of Paeonia. Letters, M, 0, and P, represent sections
Moutan. Oneapia. and Paeonia. respectively.
within within within between between between between between between Oneapia Moutan Paeonia 0 - M O - P M - P 0 - M&P M - O&P P - O&M
ITS 2.94 0.83 2.10 4.03 4.62 3.64 4.38 3.69 3.89 psbA-trnH 2.30 0.59 0.64 2.59 3.67 2.87 3.47 2.85 3.07 matK 0.74 0.25 0.27 1.18 1.35 1.11 1.33 1.12 1.18
VO 00 99 on the cpDNA phylogenies (100% bootstrap value, Fig. 9), but
rather weak on the ITS phylogeny (only one nucleotide substitution, and 65% bootstrap value. Fig. 11) . Hybridization between an early evolutionary lineage in the larger ITS clade (as the maternal parent) and the ancestor of the smaller ITS clade (as the paternal) has been suggested to account for this difference (Sang et al., in prep.). Subsequent to this hybridization, hybrids fixed the ITS sequences of the smaller clade type received cpDNA from the larger clade. Therefore, two basal clade are still seen on the ITS phylogeny, but there is only one basal clade on the cpDNA phylogeny. The two ITS clades appear to have diverged soon after the ancestor of section Paeonia separated from that of section Moutan. because there is only one substitution supporting this section on the ITS phylogeny (Fig. 11). Hybridization between these two early divergent
groups within section Paeonia may have mixed morphological distinctions between them and thus led to easier taxonomical recognition of this section.
Within section Paeonia. complex reticulate evolution has occurred, which makes natural classification difficult. In this regard, two questions should be addressed: (1) to what extent does the previous classification, based on morphology, cytology, and distribution, reflect the phylogeny of the section; and (2) how should species within section Paeonia. which has undergone extensive reticulate evolution, be 100 treated taxonomically at the subsectional level. Stern (1946) recognized two subsections, Paeonia and Foliolatae. based on number and degree of dissection of leaflets. According to Stern (1946), leaves of subsection Paeonia are very dissected and cut into usually 25 or more lobed or/and toothed leaflets, while leaves of subsection Foliolatae are divided into usually 9-16 (sometimes up to 23) entire leaflets. This classification of section Paeonia was criticized by Stebbins (1948) and Tzanoudakis (1977) . Stebbins (1948) argued that this classification ignores that many of Mediterranean tetraploid species, such as P. arietina and Pj. officinalis. may be allotetraploids with similar origins, and thus separation of them into different subsections is artificial. Tzanoudakis (1977), in his studies of Greek peony species, indicated that clussi of subsection Paeonia is the closest relative to P^ rhodia of subsection Foliolatae. and he further reduced the former to a subspecies of the latter based on more detailed morphological cytological data.
Interestingly, in the divergent portion of the ITS phylogeny, each of the two major clades of section Paeonia includes species of each of the currently recognized two subsections (Fig. 11). Although extant species on the smaller ITS clade are derived through hybridization, the ancestor of this smaller clade may have had less dissected leaves. Further, different degrees of dissection of leaves 101 may have occurred in certain species through later hybridization between lineages of these two ITS clades. Most species of subsection Foliolatae are hybrid species derived through hybridization involving directly or indirectly the lineages of the smaller ITS clade (Figs. 6, 11). Hybrid species in these lineages involved directly include; P . obovata. P. iaponica. P. banatica. P. cambessedesii. P. russi. P. clusii. P. rhodia. P. broteri. P. coriacea. P. mlokosewitschi. P. mascula ssp. hellenica. P. mascula ssp. mascula. and P^ sterniana. Paeonia wittmanniana is derived indirectly. Of these species, P^ sterniana and P^ clusii are placed in section Paeonia. We may conclude, therefore, that section Foliolatae accommodates species possessing the genotype of the smaller ITS clade which are characterized by less dissected leaves. Segregation after hybridization, however, created wide variation in this character, such that P . clusii has the most dissected leaves and is now placed in subsection Paeonia. Paeonia arietina is the only species that apparently does not have the genotype of the smaller ITS clade, but it is placed in subsection Foliolatae. This species and officinalis and P^ parnassica. having meiotic behavior typical of allotetraploids (Stebbins, 1938b), may also be of hybrid origin even though molecular evidence is still lacking. Therefore, the possibility of involvement of the smaller ITS clade in the origin of P^ arietina cannot be ruled out. 102 The complex reticulate evolution in section Paeonia poses a challenging problem for developing an appropriate system to classify these species satisfactorily. If Stern's (1946) classification is followed, it is phylogenetically misleading to place P^, clusii and P^ sterniana in subsection Paeonia. and to place P^ arietina and P^ officinalis in two separate subsections (Fig. 6) . Also, P_^ parnassica described by Tzanoudakis (1983) has leaf morphology of subsection Foliolatae. but its ITS and cpDNA sequences are identical to P. humilis and P^. officinalis of subsection Paeonia. If P. clusii. P. sterniana. P. humilis. and P_^ officinalis are transferred from subsection Paeonia to subsection Foliolatae to maintain consistency between classification and phylogeny, degree of leaf dissection loses its taxonomic importance.
Previous cytogenetic data (Stebbins, 1938b; Tzanoudakis, 1977, 1983) and new molecular phylogenetic data (Sang et al., in press, in prep.; Sang, in prep.) suggest modifications in the classification of section Paeonia. Three subsections may be designed to accommodate morphological and molecular phylogenetic information. One subsection would include Asian species with dissected leaves that were derived through strict divergent evolution and the hybrid species derived among them (i.e., anomala. P. veitchii. P. lactiflora. P . emodi. P. sterniana. and P^ xiniiangensis). The second subsection would contain eastern Asian species with fewer and broader leaflets belonging to the smaller ITS clade (i.e., P^ 103 mairei. P. obovata. and P_^ iaponica) . The third subsection would include all the Mediterranean species that may have been derived through hybridization between the first two subsections. This subsection would accommodate a wide range of morphological variation (see later discussion), and thus may be subject to further subdivision for a maximally predictive classification. Paeonia tenuifolia with extremely dissected leaves, does not appears to fall clearly in this subsection. Further investigations are needed to clarify the maternal parent of this species, which was assumed to be an extinct lineage (Fig. 6) . Likewise, more detailed molecular phylogenetic studies should be done to verify possible hybrid origins for P^ arietina. P. humilis. P. officinalis. and P. parnassica. Final decisions on major changes in the current classification of section Paeonia. therefore, might be held until these studies are completed and correlated with ongoing taxonomic revisionary studies by D. Hong (Institute of Botany, Beijing; pers. comm.) and N. Rowland (University of
Reading, London; pers. comm.). Morphological evolution. Based on molecular phylogenies, evolution of some major taxonomic characters in Paeonia can be examined. The shrubby habit delimiting section Moutan was previously considered to be primitive (Stebbins, 1938a). Phylogenetic reconstruction using DNA sequence data, however, reveals that the herbaceous habit is more primitive and the shrubby habit is a synapomorphy of 104 section Moutan (Figs. 6, 11).
Length of staminodial disk is also regarded as a taxonomically important character (Stebbins, 193 8a). Sections Oneapia and- Moutan have very conspicuous staminodial disks that are over 3 mm long. The staminodial disk of section Oneapia is fleshy and lobed and 1/3 to 1/2 as long as carpels. In section Moutan. subsection Delavavanae has a lobed disk that is usually less than 1/3 length of the carpels, whereas subsection Vaginatae has a more specialized disk that envelopes from 1/2 to the entire length of the carpels (Pei, 1993). The staminodial disk is much shorter in section Paeonia. The disk is relatively conspicuous (1-2 mm long) in P^ lactif lora and P^. veitchii. and their hybrid species P^ emodi. It is much less conspicuous, however, in P. xini iangensis. an older hybrid between Pj^ lactif lora and
P. veitchii. The staminodial disk is very inconspicuous or absent in P^ obovata and P^ mairei. Variation of this character among the remaining hybrid species seems to be unpredictable. Disks are relatively conspicuous (ca. 1 mm) in coriacea. P. mlokosewischi. and P^ peregrina. Particularly, P^ peregrina has a more conspicuous disk than either of its putative parents.
Sepal morphology was considered to be a very important phylogenetic character by Stebbins (1938a). He suggested that innermost sepals with conspicuous terminal appendages were primitive. Species with this characteristic include P_^ 105 anomala. P. lactiflora. P. emodi. and P^ veitchii which were
thus considered to be more primitive species (Stebbins, 1938a). Paeonia xini iangensis. described by Pan (1979), also has long terminal appendages. Therefore, this characteristic may represent the genotype of divergent species on the larger
ITS clade and their direct hybrids. On the other hand, sepals of P^ obovata do not have terminal appendages, and only one or two sepals of P^ mairei have very small appendages. The remaining species of hybrid origin have variable intermediate conditions, of which sepals of P. perearina and P_^ sterniana have relatively conspicuous appendages. Saunders and Stebbins (1938) observed that sepals of artificial F, hybrids were more nearly like their more primitive parents, and suggested that genes for the more primitive type of sepals are partially dominant. Conspicuous sepal appendages found in P^ perearina and P^ sterniana appear to support this hypothesis. However, more complex variation found in other hybrid species implies that segregation of these genes may have occurred during hybrid spéciation. Number of flowers per stem is another significant taxonomic character which has also been studied by artificial hybridization (Saunders and Stebbins, 1938). Species in section Oneapia and subsection Delavavanae of section Moutan have more than one flower per stem. In section Paeonia. P. lactif lora. P. veitchii. and P^ emodi have more than one 106 flower per stem, while veitchii has sometimes one terminal flower and weakly developed flower buds on side branches. All the other species have only one flower per stem. Saunders and Stebbins (1938) suggested that the state of more than one flower per stem is primitive and appeared to be
partially dominant in F, hybrids. Distribution of this character state on the phylogeny, i.e., occurring in section Oneapia. subsection Delavavanae of section Moutan. and
divergent species of section Paeonia. supports the primitive nature of having of more than one flower per stem (Figs. 9, 11) . Unlike results of artificial hybridization, however, genes for one flower per stem are more likely to be dominant because a hybrid species with parents having the two different character states always has one flower per stem (Fig. 6) . Degree of dissection of leaves, as discussed earlier, is a distinguishing feature between two basal ITS clades of section Paeonia. A high degree of dissection of leaves appears primitive because it is also found in section Oneapia and subsection Delavavanae of section Moutan. Hybridization studies revealed that this character tended to be intermediate in F^ hybrids (Saunders and Stebbins, 1938). Such intermediate conditions can be observed clearly in P. xini iangensis. P. perearina. and P^ sterniana. Paeonia cambessedesii and P^ russi have entire and broad leaflets which resemble those of their parent, P^ mairei. Paeonia 107 clusii has highly lobed leaves, distinguishing it from other species of the same hybrid origin. Within the same population of broteri found in Granada, Spain, individuals were found with highly dissected leaves resembling those of P. clusii. and individuals with broad leaflets similar to those of P^ coriacea. Therefore, there is no clear tendency
for dominance of either character state in species of hybrid origin, and segregation is likely to have occurred making this character even more taxonomically confusing. Spéciation at different ploidy levels. Allopolyploidy has been considered a primary mode for formation of fertile and stable hybrid species (Grant, 1981). Frequency of natural hybrid spéciation at the diploid level, however, has been controversial (Rieseberg et al., 1990; Reiseberg, 1991; Wendel et al., 1991; Wolfe and Elisens, 1994). According to the phylogenetic reconstruction (Fig. 6), species that are not derived from hybridization include P_^ anomala. P. veitchii. P. lactiflora. P. arietina. P. humilis. P. officinalis, and P^ parnassica. of which only the first three species are diploids. As discussed earlier, the remaining four species that have identical ITS and cpDNA sequences may have been derived through hybridization. The species of hybrid origin identified by ITS and cpDNA sequences include seven diploid and six tetraploid species, and three species with both diploid and tetraploid populations (Fig. 6). The proportion of diploids among the hybrids species is 108 surprisingly high, suggesting that hybrid spéciation at the diploid level has been quite successful in peonies. An even more striking phenomenon is the co-existence of diploids and tetraploids in the same species or a group of species with the same origin (Fig. 6) . It is noteworthy that at least some diploid species seem to be as fertile as their sister tetraploid species based on DNA sequence data. For example, Paeonia broteri (diploid) and coriacea (tetraploid) may have the same origin because they share a substitution in matK phylogeny (Fig. 9). Paeonia broteri has three autapomorphic substitutions in matK sequences while P. coriacea has none, suggesting that the diploid hybrid species may have a shorter generation time than its sister tetraploid species. Studies of reproductive biology and application of more sensitive molecular markers at the populational level are necessary for understanding relative fertility of the diploid and tetraploid species of hybrid origin in Paeonia. Extensive vegetative reproduction by rhizomes in peonies may have facilitated survival of initial diploid populations of hybrids until they became fertile or polyploidized. Regardless of mechanisms responsible for maintenance of both diploid and tetraploid populations, existence of different ploidy levels in the same or very closely related species may eventually result in reproductive isolation and further spéciation.
Molecular evolution in P_^ cambessedesii and P_^ russi. 109 two endemic species in the western Mediterranean islands, is of interest. ITS sequences of russi show nucleotide additivity at all sites that are variable between P. lactif lora and P^ mairei. strongly suggesting that P^. russi is derived via hybridization between these two species (Fig. 12) . The origin of P^ cambessedesii. whose ITS sequences show partial additivity (only at site 1, 2, and 3; Fig. 12), is not so clear because of two possible alternatives: (1) P. lactiflora and P^ mairei are the parents, and additivity at sites 6-12 has been homogenized by gene conversion; or (2) instead of P^ mairei. P. obovata is one of the parents, and the additivity at sites 4 and 5 has also been homogenized by gene conversion. The matK phylogeny supports the sister group relationship of P^ russi and P^ cambessedesii. and thus suggests the same origin for both species. This result further confirms that gradients of gene conversion is the mechanism responsible for partial homogenization of ITS sequence additivity in hybrid species. More interestingly, gene conversion has operated more rapidly in diploid P . cambessedesii than in tetraploid P_^ russi. This is reasonable because in diploids, loci of nrDNA are more easily brought together during meiosis, which allows more effective interaction among these loci and thus more rapid gene conversion (Arnheim, 1983). However, this hypothesis does not apply to a group of diploid and tetraploid species, P. clusii. P. rhodia. P. broteri. P. coriacea. P. mlokosewischi. Fig. 12. All variable nucleotide sites found in ITS sequences among P. lactiflora. P. mairei. and P. obovata. Paeonia russi shows additivity at all the sites except site 8 that are variable between P. lactiflora and P. mairei. suggesting that P. russi is derived via hybridization between these two species. Paeonia cambessedesii has only partial additivity, and its origin is discussed in the text. The site numbers (1-12) corresponding to the sites numbered separately for ITS 1 and ITS 2 from 5' to 3'; ITS 1: 49, 108, 131, 137, 138, 169, 226, 227; ITS2: 31, 38, 82, 179.
110 111
1 1 1 1 2 3 4 5 6 7 8 9 0 1 2 LAC A T AA G C A G TTT G MAI GGCA G A G A GCC T RÜS R K M A GMRAKYYK CAM RKMA GA G AG CC T OBO GG C T C A 6 A G C C T
R = A & G , K = G& T M = A & C , Y = C& T
Fig. 12 112 and two P^. mascula subspecies, with the same origin and almost identical ITS sequences. Particularly, diploid P. broteri and tetraploid P^ coriacea. whose common origin is supported by one substitution in matK (Fig. 9), have the same pattern of partial additivity of ITS sequences. DNA sequence and morphological divergence. A comparison of sequence divergence between any one section and the other two indicates that section Oneapia is the most divergent group within the genus, because it has the highest percent sequence divergence values of ITS (4.38), psbA-trnH intergenic spacer (3.74), and matK (1.33) (Table 5), suggesting that the earliest evolutionary split in Paeonia might have occurred between section Oneapia and the rest of the genus. Morphologically, section Oneapia is very distinct from the other sections by its small flowers (2-3 cm in diameter versus larger than 5 cm in sections Moutan and Paeonia) with fleshy and strongly concave petals. Sequence divergence within sections is also highest in Oneapia. 2.94 for ITS, 2.30 for psbA-trnH intergenic spacer, and 0.74 for matK. supporting an oldest age of this section (Table 5). However, there are only very minor morphological differences between the two species of this section, P . brownii and P_^ californica. Since its recognition, P. californica had been treated as a synonym or variety of P . brownii until detailed morphological, ecological, and cytological studies (Stebbins, 1938c; Stebbins and Ellerton, 113 1939). They suggested that the two species were likely to have differentiated genetically rather than to have undergone morphological modification due to different environmental stimuli. The two species are distributed allopatrically, i.e., californica is endemic to southern California from San Diego to Monterrey, whereas brownii is found from Santa Clara of California to British Columbia. Paeonia californica flowers from February to April, but P_^ brownii flowers during June and July. Paeonia californica is adapted to warmer and wetter climates, whereas Pjj. brownii is semi- xerophytic able to grow up through banks of snow and complete the latter part of growth during the dry season (Stebbins, 1938c). The exact morphological differences between the two species, however, are not easily defined because variation between them is overlapping (Stebbins, 1938c). DNA sequence data support Stebbins' hypothesis that the two species have undergone considerable genetic divergence. Morphological evolution in section Oneapia. therefore, has been remarkably slow compared with such high level of sequence divergence
(see Sytsma and Smith, 1992 for other examples). Another major evolutionary split within Paeonia is separation of sections Moutan and Paeonia. Sequence divergence values between these two sections are not much higher than within section Oneapia. but morphological differences between them are pronounced. Within section Moutan. two distinct subsections are recognized in spite of 114 quite low sequence divergence values. In subsection Delavavanae. P. lutae was also treated as a variety of P. delavavi because they differ only by flower color and slightly different sizes of leaflets (Finet and Gagnepain, 1904) . This taxonomic treatment was supported by Stebbins (1938a) because these two taxa could be artificially hybridized easily to produce intermediate forms. He also suggested that some herbarium specimens have intermediate
flower color and may be natural hybrids between the two taxa. For each of the three DNA regions sequenced here, the two taxa differ by one nucleotide substitution. Species-level problems of this group obviously require more careful field and population-level investigations. Within subsection Vaainatae. three species studied by DNA sequences are morphologically distinct and allopatrically distributed. However, there is no nucleotide substitution among them in ITS sequences, Pj^ spontanea and P_^ szechanica have identical sequences of psbA-trnH intergenic spacer, and P. rockii and P^ szechanica have identical matK sequences.
Morphological divergence in this case obviously exceeds DNA sequence divergence. Within section Paeonia. ITS sequence divergence is much higher than cpDNA divergence because one type of cpDNA has been lost after hybridization between two basal ITS clades (Sang et al., in prep.). Species in this section derived through divergent evolution are quite distinct 115 morphologically from each other. Species of hybrid origin apparently have not accumulated novel nucleotide substitutions subsequent to hybridization. Only mascula ssp. hellenica has one autopomorphic substitution in ITS relative to its parental species (Sang et al., in press). The hybrid species, therefore, are not distinguished primarily by divergent evolution, but by different combinations or differentiated segregation of parental features after hybridizations. Biogeography. Paeonia occurs widely in five disjunct areas in the northern hemisphere. The endemic section Oneapia in western North America and the other two sections found in Eurasia form an intercontinental disjunction. Phylogenetically, separation of these two disjunct groups possibly represents the earliest evolutionary split within the genus. The biogeographical implication of this phylogenetic information is that the first major geographic isolation between ancestral populations of Paeonia occurred between Eurasia and western North America. The isolation may have resulted either from a vicariance event disrupting continuous distribution of the ancestral populations between Eurasia and western North America, or a long distance dispersal from one region to the other. The vicariance explanation is favored here because Paeonia. with follicle fruits and seeds having smooth surfaces and diameters of 7-13 mm, does not appear to have great dispersal ability. 116 Continuous distribution of ancestral populations of Paeonia between Eurasia and western North America is likely to have occurred through the Bering land bridge which allowed exchange of temperate plants between eastern Asia and western North America until late Tertiary or Quaternary (Wolfe, 1975, 1980; Tiffney, 1985). Disruption of this continuous distribution may have been due to climatic cooling at high latitudes and/or submergence of the Bering land bridge (Tiffney, 1985). The time of such a vicariance event can be estimated using a molecular clock. Time of divergence may be calculated as the value of DNA sequence divergence divided by twice the sequence divergence rate. For peonies, sequence divergence rates of the sequenced DNA regions are unknown, and cannot be estimated by either fossil records or biogeographic events. We can only use rates estimated in other plant groups. Divergence rates of ITS sequences have been calculated in several plant groups, but vary considerably among them (Suh et al., 1993; Sang et al., 1995) . Further, ITS sequences are very short and may be subject to large statistical errors when used to calculate divergence times. ITS sequences, therefore, are probably not a good choice for use as a molecular clock. Divergence rates of matK sequences, which have not yet been estimated directly, have been suggested as being about twice as fast as that of rbcL sequences (Steele and Vilgalys, 1994). If a 117 divergence rate of 1 X 10'® per site per year is used for rbcL sequences (Zurawski et al., 1984; Zurawski and Clegg, 1987; Parks and Wendel, 1990), a rate of 5 X 10"’° per site per year can be used for matK sequences. The divergence time between section Oneapia and the rest of the genus, therefore, is estimated to be 13.3 million year ago (Ma). This estimate, however, is subject to several sources of errors. First, the divergence rate of rbcL may not apply to peonies, because it can vary in different groups with different generation times
(Li et al., 1987; Clegg, 1990; Gaut et al., 1992). Vegetative reproduction by rhizomes is very common in peonies, which may significantly prolong generation time, and consequently yield slower rates of DNA divergence. In this context, the divergence time may be estimated as more recent than it really is. Second, the estimation that matK evolves twice as fast as rbcL is very rough and may actually be different in peonies. Nevertheless, although estimation of divergence rates or times using the molecular clock hypothesis has largely been based on uncertain assumptions and roughly approximate values, it continues to be useful in helping understand tempos of evolution and historical biogeography (Parks and Wendel, 1990; Crawford et al., 1992; Wendel and Albert, 1992). The estimated time for formation of the intercontinental disjunction in peonies, 13.3 Ma, is middle Miocene. Tiffney (1985) suggested that during the Miocene, temperatures at 118 higher latitude allowed exchange of deciduous temperate
plants via the Bering land bridge. Further, many herbaceous angiosperm groups evolved during the Miocene and exhibited an eastern Asian and eastern North American disjunct
distribution (Tiffney, 1985). Formation of intercontinental disjunction in peonies, therefore, may well be a result of disruption of continuous distribution through the Bering land bridge during Miocene time. For greater accuracy, additional calculations from other DNA regions are needed. Addressing the question of whether this time indicates occurrence of a common vicariance event at the Bering land bridge awaits similar studies of additional taxa with eastern Asia-western America disjunctions. Possible existence of ancestral populations of Paeonia in high latitudes around the Bering land bridge in the Miocene is concordant with warm climate during this period
(Potts and Behrensmeyer, 1992). But did Paeonia originate in this area in the Miocene? Because of lack of fossil record, one way to determine the age of peonies is by estimating divergence time between Paeonia and its sister group using the molecular clock. Unfortunately, the systematic position of Paeonia is problematical. A variety of families including Ranunculaceae, Berberidaceae, Magnoliaceae, Dilleniaceae, and Glaucidiaceae have been suggested as close relatives to Paeoniaceae (Hallier, 1905; Kumzawa, 1935; Corner, 1946; Sawada, 1971; Keefe and Moseley, 1978; Dahlgren, 1983; 119 Melville, 1983). Recent phylogenetic analysis of rbcL sequences, however, places Paeonia as a sister group of Crassulaceae (Chase et al., 1993). Uncertain systematic relationships of Paeonia may imply that Paeonia did not share a long evolutionary history with any existing related family, suggesting further that the time of its origin could be quite ancient and much earlier than Miocene. If this were the case, then ancestral populations of Paeonia might have been rather homogeneous until the first evolutionary split in Miocene, or alternatively the ancestral populations might represent the only lineage that survived through evolution of this plant group. In this instance, ancestral populations of Paeonia may have originated somewhere else and migrated to the area near the Bering land bridge during the warm period in Miocene. In any event, even though the actual time and place of origin of the genus are unknown, we assume that populations ancestral to extant species of Paeonia were in the Bering land bridge area in Miocene. After intercontinental separation of ancestral populations of Paeonia. those taxa in eastern Asia underwent another major divergent event, i.e., isolation between ancestral populations of sections Moutan and Paeonia. This event is likely to have taken place in eastern Asia where both sections currently occur. The shrubby section Moutan. endemic to high mountains in southwestern and central China, probably was never dispersed into Europe after its origin in 120 eastern Asia. The largest section Paeonia. however, has been dispersed most widely and thus has undergone the highest
level of spéciation (Fig. 4) . A marked difficulty in understanding historical biogeography of the northern hemisphere is that shifts of distributional ranges and extinction of taxa have been caused by Pleistocene glaciation (Noonan, 1988). Fossil records seem to be the only source of evidence for detection of such historical processes. Lack of a fossil record, therefore, may seriously hinder development of biogeographic hypotheses. Recent molecular phylogenetic and biogeographic studies in peonies have suggested a possible new avenue for solving this problem (Sang et al., in press). Documentation of reticulate evolution in section Paeonia reveals that most hybrid species
are found in the Mediterranean region, whereas their parental species are restricted to Asia. Detection of parental type of DNA sequences in species of hybrid origin, therefore, provides gene records for suggesting historical Mediterranean distributions of the Asian peony species. It has also been suggested that the extensive reticulate evolution may have been triggered by Pleistocene glaciation when parental species were forced into réfugia in the Mediterranean region where they became sympatric and hybridized (Stebbins, 1948; Sang et al., in press).
Based on phylogenetic reconstructions (Figs. 6), a group of Mediterranean species, P^ clusii. P . rhodia. P . broteri. 121 P. coriacea. P. mlokosewischi. and P..mascula ssp. hellenica and ssp. mascula. apparently has the same hybrid origin. However, they are endemic to widely different areas in the Caucasus and throughout the southern Mediterranean (Fig. 4). If this group of species had a single hybrid origin, then it seems unlikely that the hybrid populations would have been dispersed so widely in the southern Mediterranean region. It seems more likely that the ancestral hybrid populations migrated northward and extended their distributional ranges both eastward and westward during a glacial interval. During a subsequent glaciation, these populations might have been forced into isolated areas in the southern Mediterranean region. Geographic isolation consequently led to spéciation among these populations and created the complex diversity now seen for this group of species.
Another group of Mediterranean species, P^ arietina. P. humilis. P. officinalis. and P^ parnassica. which have the same ITS and cpDNA sequences, are also distributed in widely disjunct areas (Fig. 4) . As discussed earlier, they are also possibly of hybrid origin based on meiotic behavior of their chromosomes (Stebbins, 1938b; Tzanoudakis, 1977), although molecular data so far provide no support. If they had the same hybrid origin, their distributional patterns may have been reached in the same way as suggested above. If this group of species is also considered to be of hybrid origin, then all the Mediterranean species within the genus are of 122 hybrid origin. Their direct or indirect parental species are
all found currently in eastern Asia or central Asia (only P. angmala). It is striking that after hybridization, European
populations of the present Asian species were completely replaced by their hybrids. Extensive hybridization of peony species must have produced a wide spectrum of different genome combinations upon which natural selection could act. Hybrids that adapted to drastic climatic changes during Pleistocene in Europe are currently distributed in the Mediterranean region. Asian species did not survive such changes in Europe, and their distributions became more restricted. Hybrid species, P_^ xini ianaensis. P. emodi. and P. sterniana. may represent footprints of the eastern Asian species, P_^ lactiflora. P. veitchii. and P^ mairei. when
their distributional ranges became reduced to only eastern Asia. Eastern Asia was much less seriously affected by Pleistocene glaciation and may have provided réfugia for these peony species (Potts and Behrensmeyer, 1992; Tao, 1992).
LITERATURE CITED
Arnheim, N. 1983. Concerted evolution of multigene families. Pp.38-61 in Evolution of Gene and Protein, 123 eds. M. Nei and R. K. Koehn. Sunderland; Sinnauer. Barber, H. N. 1941. Evolution in the genus Paeonia. Nature 148: 227-228. Clegg, M. T. 1990. Dating the nonocot-dicot divergence. TREE 5 : 1-2. Chase et al. 1993. Phylogenetics of seed plants: an analysis of nucleotide sequences from the plastid gene rbcL. Ann. Missouri Hot. Gard. 80: 528-580. Corner, E. J. H. 19 46. Centrifugal stamens. J. Arn. Arb. 27: 423-437.
Crawford, D. J., N. W. Lee and T. F. Stuessy. 1992. Plant species disjunctions: perspectives from molecular data. Aliso 13: 395-409. Cronquist, A. 1988. The Evolution and Classification of
Flowering Plants, Ed. 2. pp.325. Lawrence: Allen Press. Dahlgren, R. 1983. General aspects of angiosperm evolution and macrosystematics. Nord. J. Hot. 3: 119-149.
Doyle, J. J. and J. L. Doyle. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19; 11-15.
Fang, W. 1958. Notes on Chinese peonies. Acta Phytotax. Sin. 7: 288-323. Felsenstein, J. 1985. Confidence limits on phylogenetics: an approach using the bootstrap. Evolution 39: 783- 124
791. . 1994. PHYLIP: Phylogenetic Inference Package, Version 3.5c. Seattle: The University of Washington. Finet, A. E. and F. Gagnepain. 1905. Contribution a la Flore de l'Asie orientale. Bull. Soc. Bot. France 51: 523-527. Gambrill, K. W. 1988. King of flowers, queen of herbs: the peony. Pac. Hortic. 49:26-32.
Gaut, B. S., S. V. Muse, W. D. Clark and M. T. Clegg. 1992. Relative rates of nucleotide substitution at the rbcL locus of monocotyledonous plants. J. Mol. Evol. 35: 292- 303. Grant, V. 1981. Plant Spéciation, Ed. 2. Pp.191-353. New York: Columbia Univ. Press.
Hallier, H. 1905. Provisional scheme of the natural (phylogenetic) system of flowering plants. New Phytol. 4: 151-162. Hong, D., Z. Zhang and X. Zhu. 1988. Studies on the genus Paeonia (1) Report of karyotypes of some wild species in China. Acta Phytotax. Sin. 26: 33-43. Jukes, T. H. and C. R. Cantor. 1969. Evolution of protein molecules. Pp. 21-132. in Mannamlian protein metabolism, ed, H. N. Munro. New York: Academic Press. Keefe, J. M. and M. F. Moseley, Jr. 1978. Wood anatomy and phylogeny of Paeonia section Moutan. J. Arn. Arb. 59: 274-297. 125 Kumazawa, M. 1935. The structureand affinities of Paeonia. Bot. Mag. Tokyo. 49: 306-315. Li, W.-H, M. Tanimura and P. M. Sharp. 1987. An evaluation of the molecular clock hypothesis using mammalian DNA sequences. J. Mol. Evol. 25: 330-342. Lynch, R. I. 1890. A new classification of the genus Paeonia. Jour. Roy. Bot. Soc. 12: 428-445. Melville, R. 1983. The affinity of Paeonia and a second genus of Paeoniaceae. Kew Bull. 38: 87-105. Noonan, G. R. 1988. Biogeography of North American and Mexican insects, and a critique of vicariance biogeography. Syst. Zool. 37: 366-384. Pan, K. 1979. Paeonia. In Flora Reipublicae Popularis Sinicae. 27: 37-59. Beijing: Science Press. Parks, C. R. and J. F. Wendel. 1990. Molecular divergence between Asian and North American species of Liriodendron (Magnoliaceae) with implications for interpretation of fossil floras. Amer. J. Bot. 77: 1243-1256.
Pei, Y.-L. 1993. Studies on the Paeonia suffruticosa
Andr. Complex (Ph. D. Dissertation). Beijing: Institute of Botany, Chinese Academy of Sciences. Potts, R. and A. K. Behrensmeyer. 1992. Late Cenozoic Terrestrial ecosystems. Pp.419-542. In Terrestrial Ecosystems through time, eds. A. K. Behrensmeyer, J. D. Damuth, W. A. Dimichele, R. Potts, H.-D. Sues and 126 S. L. Wing. Chicago: Univ. Chicago Press. Rieseberg, L. H. 1991. Homoploid reticulate evolution in Helianthus: evidence from ribosomal genes. Amer. J. Bot. 78: 1218-1237. , R. Carter, and S. Zona. 1990. Molecular testes of the hypothsized hybrid origin of two diploid Helianthus species (Asteraceae). Evolution 44: 1498-1511. Sang, T., Crawford, D. J., and Stuessy, T. F. (in press). Documentation of reticulate evolution in peonies (Paeonia) using sequences of internal transcribed
spacer of nuclear ribosomal DNA: implications for biogeography and concerted evolution. Proc. Natl. Acad. Sci. USA 92.
, --- , and M. 0. Silva. 1995. ITS sequences and the phylogeny of the genus Robinsonia (Asteraceae). Syst. Bot. 20: 55-64. Saunders, A. P. and G. L. Stebbins, Jr. 1938. Cytogenetic studies in Paeonia I. The compatibility of the species and the appearance of the hybrids. Genetics 23: 65-82. Sawada, M. 1971. Flora vascularization of Paeonia iaponica with some consideration on systematic
position of the Paeoniaceae. Bot. Mag. Tokyo 84: 51-60. Stebbins, G. L., Jr. 1938a. Notes on the systematic relationships of the Old World species and of some 127 horticultural forms of the genus Paeonia. Univ. Calif. Publ. Bot. 19; 245-266. . 1938b. Cytogenetic studies in Paeonia II. The cytology of the diploid species and hybrids. Genetics 23: 83-110. . 193 8c. The western American species of Paeonia. Madrono 4: 252-260. . 1948. Review of "A study of the genusPaeonia by F. C. Stern". Madrono 9: 193-199. and S. Ellerton. 193 9. Structural hybridity in Paeonia californica and P^ brownii. J. Genet. 38: 1-36. Steele, K. P. and R. Vilgalys. 1994. Phylogenetic analyses of Polemoniaceae using nucleotide sequences of the plastid gene matK. Syst. Bot. 19: 126-142. Stern, F. C. 1946. A study of the genus Paeonia. London: The Royal Horticultural Society.
Swofford, D. L. 1993. PAUP: Phylogenetic Analysis Using Parsimony, Version 3.1.1. Champaign: Illinois Natural History Survey.
Suh, Y., L. B. Thueh, H. E. Reeve, and E. A. Zimmer. 1993. Molecular evolution and phylogenetic implication of internal transcribed spacer sequences of ribosomal DNA in Winteraceae. Amer. J. Bot. 80: 1042-1055. Sytsma, K. J. and J. F. Smith. 1992. Molecular systematics of Onagracea: examples from Clarkia and Fuchia. pp. 295- 128 323. In Molecular Systematics of Plants, eds. P. S. Soltis, D. E. Soltis and J. J. Doyle. New York; Chapman and Hall. Takhtajan, A. 1969. Flowering Plants. Origin and Dispersal. Pp. 156. Edinburgh: Oliver & Boyd. 1987. Systema Magnoliophytorum. pp.54-55. Leninopoli: Officina Editoria "Nauka". Tao, J. 1992. The Tertiary vegetation and flora and floristic regions in China. Acta Phytotax. Sin. 30: 25-43. Thorne, R. F. 1992. Classification and geography of the
flowering plants. Bot. Rev. 58: 225-348. Tiffney, B. H. 1985. Perspectives on the origin of the floristic similarity between eastern Asia and eastern North America. J. Arn. Arb. 65: 73-94. Tzanoudakis, D. 1977. Cytotaxonomic study of the genus Paeonia in Greece (Ph.D. Dissertation). Patras: Botanical Inst., Univ. of Patras.
1983. Karyotypes of four wild Paeonia species from Greece. Nord. J. Bot. 3: 307-318. Wendel, J. F. and V. A. Albert. 1992. Phylogenetics of the cotton genus (Ggssypium): character-state weighted parsimony analysis of chloroplast-DNA restriction site data and its systematic and biogeographic implications. Syst. Bot. 17: 115-143. Wolfe, A. D. and W. J. Elisens. 1994. Nuclear ribosomal DNA 129 restriction-site variation in Penstemon section
Peltanthera (Scrophylariaceae) ; an evaluation of diploid hybrid spéciation and evidence for introgression. Amer. J. Bot. 81: 1627-1635.
Wolfe, J. A. 1975. Some aspects of plant geography of the Northern Hemisphere during the late Cretaceous anD Tertiary. Ann. Missouri Bot. Gard. 62: 264-279. , J. McD. Stewart, and J H. Rettig. 1991. Molecular evidence for homoploid reticulate evolution among Australian species in Gossypium. Evolution 45: 694-711. . 1980. Tertiary climatic and floristic relationships at high latitudes in the Northern Hemisphere. Paleogeogr., Paleoclimat., Paleoecol. 61: 33-77. Zurawski, G. , M. T. Clegg and A. H. D. Brown. 1984. The nature of nucleotide sequence divergence between barley and maize chloroplast DNA. Genetics 106: 735- 749.
and M. T. Clegg. 1987. Evolution of higher plant
chloroplast DNA-encoded genes: implications for structure-function and phylogenetic studies. Ann. Rev. Plant Physiol. 38: 391-418. LIST OF REFERENCES
Aldrich, J., Cherney, B. W., Merlin, E. , and Christopherson, L. (1988). The role of insertions/deletions in the evolution of the intergenic region between psbA and trnH in the chloroplast genome.
Curr. Genet. 14: 137-146. Arnheim, N. 1983. Concerted evolution of multigene families. Pp.38-61 in Evolution of Gene and Protein, eds. M. Nei and R. K. Koehn. Sunderland: Sinnauer. Avise, J. C. 1994. Molecular Markers, Natural History and Evolution, Pp.252-359. New York: Chapman & Hall. Baldwin, B. G . , D. W. Kyhos, and J. Dvorak. 1990. Chloroplast DNA evolution and adaptive radiation in the Hawaiian silverword alliance (Madiinae, Asteraceae). Ann. Missouri Bot. Gard. 77: 96-109. , M. J. Sanderson, J. M. Porter, M. F. Wojciechowski, C. S. Campbell, and M. J. Donoghue. 1995. Ann. Missouri. Bot. Gard. Barber, H. N. 1941. Evolution in the genus Paeonia. Nature 148: 227-228.
Bohle, U.-R., Hilger, H., Cerff, R., and Martin, W. F. (1994) . Non-coding chloroplast DNA for plant molecular systematics at the infrageneric level. In "Molecular
130 131 Ecology and Evolution: Approaches and Applications" (B. Schierwater, B. Strait, G. P. Wagner, and R. DeSalle, Eds.), pp.391-403.
Bremer, K. and H.-E. Wanntorp. 1979. Hierarchy and reticulations in systematics. Syst. Zool. 28: 624-626. Chase et al. 1993. Phylogenetics of seed plants: an analysis of nucleotide sequences from the plastid gene rbcL. Ann. Missouri Bot. Gard. 80: 528-580. Clegg, M. T. 1990. Dating the monocot-dicot divergence. TREE 5: 1-2. , Gaut, B. S., Learn, G. H. Jr., and Morton, B. R. (1994). Rates and patterns of chloroplast DNA
evolution. Proc. Natl. Acad. Sci. USA 91: 6795-6801. Coen, E. S., T. Strachan, and G. A. Dover. 1982. The dynamics of concerted evolution of rDNA and histone gene families in the melanoqaster speceis subgroup of Drosophila. J. Molec. Biol. 158: 17-35. Corner, E. J. H. 1946. Centrifugal stamens. J. Arn. Arb. 27: 423-437.
Crawford, D. J., N. W. Lee and T. F. Stuessy. 1992. Plant species disjunctions: perspectives from molecular data. Aliso 13: 395-409. Cronquist, A. 1988. The Evolution and Classification of Flowering Plants, Ed. 2. pp.325. Lawrence: Allen Press. Dahlgren, R. 1983. General aspects of angiosperm 132 evolution and macrosystematics. Nord. J. Bot. 3: 119-149. Doebley, J. F. 1989. Molecular evidence for a missing wild relative of maize and the introgression of its chloroplast genome into Zea perennis. Evolution 43: 1555- 1558. Donoghue, M. J. 1994. Progress and prospects in reconstructing plant phylogeny. Ann. Missouri Bot. Gard. 81: 405-418. Dover, G. A. 1982. Molecular drive: a cohesive mode of species evolution. Nature 299: 111-117. , S. D. M. Brown, E. S. Coen, J. Dallas, T. Strachan and M. Trick. 1982. The dynamics of genome evolution and species differentiation. Pp.343-374 in Genome Evolution, eds. G. A. Dover and R. B. Flavell. London: Academic Press.
Doyle, J. J. 1992. Gene trees and species trees: molecular systematics as one-character taxonomy. Syst. Bot. 17: 144-163.
, J. I. Davis, R. J. Soreng, D. Garvin, and M. J. Anderson. 1992. Chloroplast DNA inversions and the origin of the grass family (Poaceae). Proc. Natl. Acad. Sci. USA 89: 7722-7726. and J. L. Doyle. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19: 11-15. 133 Eickbush, T. H. and W. D. Burke. 1986. The silkmoth late chorion locus II. Gradients of gene conversion in two paired multigene families. J. Mol. Biol. 190, 357-366. Fang, W. 1958. Notes on Chinese peonies. Acta Phytotax. Sin. 7: 288-323. Felsenstein, J. 1985. Confidence limits on phylogenetics: an approach using the bootstrap. Evolution 39: 783- 791.
. 1994. PHYLIP: Phylogenetic Inference Package, Version 3.5c. Seattle: The University of Washington. Finet, A. E. and F. Gagnepain. 1905. Contribution a la
Flore de l'Asie orientale. Bull. Soc. Bot. France 51: 523-527. Funk, V. A. 1985. Phylogenetic patterns and hybridization. Ann. Missouri Bot. Gard. 72: 681-715. Gambrill, K. W. 1988. King of flowers, queen of herbs: the peony. Pac. Hortic. 49:26-32. Gaut, B. S., S. V. Muse, W. D. Clark and M. T. Clegg. 1992. Relative rates of nucleotide substitution at the rbcL locus of monocotyledonous plants. J. Mol. Evol. 35: 292- 303. Gielly, L. and P. Taberlet. 1994. The use of chloroplast DNA to resolve plant phylogenies: Noncoding versus rbcL sequences. Mol. Biol. Evol. 11: 769-777. Golenberg, E. M., M. T. Clegg, M. L. Durbin, J. Doebley, and D. P. Ma. 1993. Evolution of a noncoding region of the 134 chloroplast genome. Mol. Phvloaent. Evol. 2: 52-64. Grant, V. 1981. Plant Spéciation, Ed. 2. Pp.191-353. New York: Columbia Univ. Press. Guiot, J . , A. Pons, J. L. Beaulieu and M.Reille. 1989. Nature 338: 309-313.
Hallier, H. 1905. Provisional scheme of the natural (phylogenetic) system of flowering plants. New Phytol. 4: 151-162. Ham, R. C. H. J., H. 't. Hart, T. H. M. Mes, and, J. M.
Sandbrink. 1994. Molecular evolution of noncoding regions of the chloroplast genome in the Crassulaceae and related species. Curr. Genet. 25: 558-566.
Hess, J. F . , C. W. Schmid, and C.-K. Shen. 1984. A gradient of sequence divergence in the human adult a-globin duplication units. Science 226: 67-70. Hewitt, G . M. 1993. in Hybrid Zones and the Evolutionary Process, eds Harrison, R. G. New York: Oxford Univ. Hillis, D. M. and M. T. Dixon. 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. Quart. Rev. Biol. 66: 411—453.
, C. Moritz, C. A. Porter and R. J. Baker. 1991. Evidence for biased gene conversion in concerted evolution of ribosomal DNA. Science 251: 308-310. Hong, D., Z. Zhang and X. Zhu. 1988. Studies on the genus Paeonia (1) Report of karyotypes of some wild species in China. Acta Phytotax. Sin. 26: 3 3-43. 135 Jansen, R. K. and J. D. Palmer. 1987. A chloroplast DNA inversion marks an ancient evolutionary split in the sunflower family (Asteraceae) . Proc. Natl. Acad. Sci.
USA 84: 5818-5822. Johnson, L. A. and D. E. Soltis. 1994. matK DNA sequences and phylogenetic reconstruction in Saxifragaceae sensu stricto. Syst. Bot. 19: 143-156. Jukes, T. H. and C. R. Cantor. 1969. Evolution of protein molecules. Pp. 21-132. in Mannamlian protein metabolism, ed, H. N. Munro. New York: Academic Press. Keefe, J. M. and M. F. Moseley, Jr. 1978. Wood anatomy and phylogeny of Paeonia section Moutan. J. Arn. Arb. 59: 274-297. Kim, K.-J. and R. K. Jansen. 1994. Comparisons of phylogenetic hypotheses among different data sets in
dwarf dandelions (Krigia) : additional information from internal transcribed spacer sequences of nuclear ribosomal DNA. PI. Syst. Evol. 190, 157-185.
Kumazawa, M. 1935. The structure and affinities of Paeonia. Bot. Mag. Tokyo. 49; 306-315. Levinson, G. and G. A. Gutman. 1987. Slipped-strand mispairing: A major mechanism for DNA sequence evolution. Mol. Biol. Evol. 4; 203-221. Li, W.-H, M. Tanimura and P. M. Sharp. 1987. An evaluation
of the molecular clock hypothesis using mammalian DNA sequences. J. Mol. Evol. 25: 330-342. 136 Lynch, R. I. 1890. A new classification of the genus Paeonia. Jour. Roy. Bot. Soc. 12; 428-445. Maddison, W. P., M. J. Donoghue and D. R. Maddison. 1984. Outgroup analysis and parsimony. Syst. Zool. 33: 83- 103.
Maner, J.-F., A. Natali, and F. Ehrendorfer. 1994. Phologeny of Rubiaceae-Rubieae inferred from the sequence of a cpDNA intergene region. PI. Syst. Evol. 190: 195-212. McDade, L. 1990. Hybrids and phylogenetic systematics. I. Patterns of character expression in hybrids and their implications for cladistic analysis. Evolution 44: 1685- 1700.
. 1992. Hybrid and phylogenetic systematics. II. The impact of hybrids on cladistic analysis. Evolution 46: 1329-1346.
Melville, R. 1983. The affinity of Paeonia and a second genus of Paeoniaceae. Kew Bull. 38: 87-105.
Mes, T. H. M. and H. 't. Hart. 1994. Sedum surculosum and S. iaccardianum (Crassulaceae) share a unique 70 bp deletion in the chloroplast DNA trnL(UAA)-trnF (GAA) intergenic spacer. PI. Syst. Evol. 193: 213-221. Morton, B. R. and M. T. Clegg. 1993. A chloroplast DNA mutational hotspot and gene conversion in a noncoding region near rbcL in the grass family (Poaceae). Curr. Genet. 24: 357-365. 137 Nagylaki, T. and T. D. Petes. 1982. Intrachromosomal gene conversion and the maintenance of sequence homogeneity among repeated gene. Genetics 100; 315-337. Neuhaus H. and G. Link. 1987. The chloroplast tRNA^^®(UUU) gene from mustard (Sinapsis alba) contains a class II intron potentially coding for a muturase-related polypeptide. Cur. Genet. 11: 251-257. Noonan, G. R. 1988. Biogeography of North American and Mexican insects, and a critique of vicariance biogeography. Syst. Zool. 37: 366-384.
Ohta, T. 1983. Time unit fixation of a mutant belonging to a multigene family. Genet. Res. 41: 47-55. and G. A. Dover. 1983. Population genetics of multigene families that are dispersed into two or more chromosomes. Proc. Natl. Acad. Sci. USA 80: 4079-4083. Olmstead, R. G. and J. D. Palmer. 1994. Chloroplast DNA systematics; A review of methods and data analysis. Amer. J. Hot. 81: 1205-1224. Palmer, J. D., R. K. Jansen, H. J. Michaels, M. W. Chase and
J. W. Manhart. 1988. Chloroplast DNA variation and plant phylogeny. Ann. Missouri Bot. Gard. 75: 1180-1206. , C. R. Shields, D. B. Cohen, T. J. Orten. 1983.
Chloroplast DNA evolution and the origin of amphidiploid Brassica species. Theo. Appl. Gen. 65: 181-189. Pan, K. 1979. Paeonia. In Flora Reipublicae Popularis Sinicae. 27: 37-59. Beijing: Science Press. 138 Parks, C. R. and J. F. Wendel. 1990. Molecular divergence between Asian and North American species of Liriodendron (Magnoliaceae) with implications for interpretation of fossil floras. Amer. J. Bot. 77; 1243-1256. Pei, Y.-L. 1993. Studies on the Paeonia suffruticosa Andr. Complex (Ph. D. Dissertation). Beijing: Institute of Botany, Chinese Academy of Sciences. Potts, R. and A. K. Behrensmeyer. 1992. Late Cenozoic Terrestrial ecosystems. Pp.419-542. In Terrestrial
Ecosystems through time, eds. A. K. Behrensmeyer, J. D. Damuth, W. A. Dimichele, R. Potts, H.-D. Sues and S. L. Wing. Chicago: Univ. Chicago Press. Rauberson, L. A. and R. K. Jansen. 1992. Chloroplast DNA evidence on the Ancient Evolutionary split in vascular land plants. Science 255: 1697-1699. Rieseberg, L. H. 1991. Homoploid reticulate evolution in Helianthus: evidence from ribosomal genes. Amer. J. Bot. 78: 1218-1237.
, R. Carter, and S. Zona. 1990. Molecular testes of the hypothsized hybrid origin of two diploid Helianthus species (Asteraceae). Evolution 44: 1498-1511.
and N. C. Ellstrand. 1993. What can molecular and morphological markers tell us about plant hybridization? Crit. Rev. Plant Sci. 12: 213-241. and D. E. Soltis. 1991. Phylogenetic consequences of 139 cytoplasmic gene flow in plants. Evol. Trends Plant 5: 65-84. and J. F. Wendel. 1993. Introgression and its consequences in plants, in Hybrid Zone and The Evolutionary Process, Pp. 70-109, ed. R. G. Harrison. New York: Oxford Univ. Sanderson, M. J., B. G. Baldwin, G. Bharathan, C. S. Campbell, C. Von Dohlen, D. Ferguson, J. M. Porter, M.
F. Wojciechowski, M. J. Donoghue. 1993. The growth of phylogenetic information and the need for a phylogenetic data base. Syst. Biol. 42: 562-568.
Sang, T., Crawford, D. J., and Stuessy, T. F. (in press). Documentation of reticulate evolution in peonies (Paeonia) using sequences of internal transcribed spacer of nuclear ribosomal DNA: implications for biogeography and concerted evolution. Proc. Natl. Acad. Sci. USA 92. , --- , S.-C. Kim, and T. F. Stuessy. 1994. Radiation of the endemic genus Dendroseris (Asteraceae) on the Juan Fernandez Islands: evidence from sequences of the ITS regions of nuclear ribosomal DNA. Amer. J. Bot. 81: 1494- 1501.
, --- , T. F. Stuessy, and M. O. Silva. 1995. ITS sequences and the phylogeny of the genus Robinsonia (Asteraceae). Syst. Bot. 20: 55-64. Saunders, A. P. and G. L. Stebbins, Jr. 1938. Cytogenetic 140 studies in Paeonia I. The compatibility of the species and the appearance of the hybrids. Genetics 23: 65-82. Sawada, M. 1971. Flora vascularization of Paeonia iaoonica with some consideration on systematic position of the Paeoniaceae. Bot. Mag. Tokyo 84: 51-60. Shinozaki, K., M. Ohme, M. Tanaka, T. Wakasugi, N. Hayashida, T. Matsubayashi, N. Zaita, J. Chunwongse, J. obokata, K. Yamaguchi-Sinozaki, C. Ohto, K. Torazawa, B. Y. Meng, M. Sugita, H. Deno, T. Kamogashira, K. Yamada, J. Kusuda, F. Takaiwa, A. Kato, N. Tohdoh, H. Shimada, M. Sugiura. 1986. The complete nucleotide sequence of the tobacco chloroplast genome. Plant Mol. Biol. Rep. 4: 110- 147. Smith, R. L. and K. J. Systma. 1990. Evolution of Populus nigra L. (sect. Aigeirps): introgressive hybridization and the chloroplast contribution of Populus alba L. (sect. Populus). Amer. J. Bot. 77: 1176-1187. Soltis, D. E., P. S. Soltis, T. G. Collies, M. L. Edgerton.
1991. Chloroplast DNA variation within and among genera of the Heuchera group (Saxifragaceae): evidence for chloroplast transfer and paraphyly. Amer. J. Bot. 78: 1150-1161. Soltis, P. S., J. J. Doyleand D. E. Soltis. 1992. Molecular and polyploid evolution in plants. Pp.177-201 in 141 Molecular Systematics of Plants, eds. P. S. Soltis, D. E. Soltis, and J. J. Doyle. New York; Chapman and Hall. Stebbins, G. L., Jr. 1938a. Notes on the systematic
relationships of the Old World species and of some horticultural forms of the genus Paeonia. Univ. Calif. Publ. Bot. 19: 245-266. . 1938b. Cytogenetic studies in Paeonia II. The cytology of the diploid species and hybrids. Genetics 23: 83-110. . 1938c. The western American species of Paeonia. Madrono 4: 252-260. . 1948. Review of "A study of the genus Paeonia by F.
C. Stern". Madrono 9: 193-199. and S. Ellerton. 1939. Structural hybridity in Paeonia californica and P^_ brownii. J. Genet. 38: 1-36. Steele, K. P. and R. Vilgalys. 1994. Phylogenetic analyses of Polemoniaceae using nucleotide sequences of the plastid gene matK. Syst. Bot. 19: 126-142. Stern, F. C. 1946. A study of the genus Paeonia. London: The Royal Horticultural Society. Streisinger, G. and J. Owen. 1995. Mechamisms of spontaneous and induced frameshift mutation in bacteriophage T4. Genetics 109: 633-659. Suh, Y., L. B. Thueh, H. E. Reeve, and E. A. Zimmer. 1993. Molecular evolution and phylogenetic implication of internal transcribed spacer sequences of ribosomal DNA in 142 Winteraceae. Amer. J. Bot. 80: 1042-1055. Swofford, D. L. 1993. PAUP: Phylogenetic Analysis Using Parsimony, Version 3.1.1. Champaign: Illinois Natural History Survey.
Systma, K. J. and L. D. Gottlieb. 1986. Chloroplast DNA evolution and phylogenetic relationships in Clarkia sect. Peripetasma (Onagraceae). Evolution 40: 1248- 1262. and J. F. Smith. 1992. Molecular systematics of Onagracea: examples from Clarkia and Fuchia. pp. 295- 323. In Molecular Systematics of Plants, eds. P. S. Soltis, D. E. Soltis and J. J. Doyle. New York: Chapman and Hall.
Taberlet, P. , L. Gielly, G. Pautou, and J. Bouvet. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 17: 1105- 1109. Takhtajan, A. 1969. Flowering Plants. Origin and Dispersal. Pp. 156. Edinburgh: Oliver & Boyd.
. 1987. Systema Magnoliophytorum. pp.54-55. Leninopoli: Officina Editoria "Nauka". Tao, J. 1992. The Tertiary vegetation and flora and floristic regions in China. Acta Phytotax. Sin. 30: 25-43. Thorne, R. F. 1992. Classification and geography of the flowering plants. Bot. Rev. 58: 225-348. 143 Tiffney, B. H. 1985. Perspectives on the origin of the floristic similarity between eastern Asia and eastern North America. J. Arn. Arb. 65: 73-94. Tzanoudakis, D. 1977. Cytotaxonomic study of the genus Paeonia in Greece (Ph.D. Dissertation). Patras: Botanical Inst., Univ. of Patras. . 1983. Karyotypes of four wild Paeonia species from Greece. Nord. J. Bot. 3: 307-318.
Watrous, L. E. and Q. D. Wheeler. 1981. The out-group comparison method of character analysis. Syst. Zool. 30: 1-11. Wendel, J. F. and V. A. Albert. 1992. Phylogenetics of the cotton genus CGossvpium): character-state weighted
parsimony analysis of chloroplast-DNA restriction site data and its systematic and biogeographic implications. Syst. Bot. 17: 115-143.
, A. Schnabel and T. Seelanan. 1995. Bi-directional interlocus concerted evolution following allopolyploid spéciation in cotton (Ggssypium). Proc. Natl. Acad. Sci.
USA 92, 280-284.
, J. McD. Stewart, and J H. Rettig. 1991. Molecular evidence for homoploid reticulate evolution among Australian species in Gossypium. Evolution 45: 694-711. West, R. G. 1977. Pleistocene Geology and Biology, Ed 2. London: Longman Group. White, T. J., T. Bruns, S. Lee, and J. Taylor. 1990. 144 Amplification direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp.315-322 in PCR Protocols: A Guide to Methods and Applications, eds. M. Innis, D. Gelfand, J. Sninshy, and T. White. San Diego: Academic Press. Whitkus, R. , J. Doebley, and J. F. Wendel. 1994. Pp.116- 141. in DNA-based Markers in Plants, eds. R. L. Phillips and I. K. Vasil. Netherlands: Kluwer Academic. Whittemore, A. T. and B. A. Schaal. 1991. Interspecies gene flow in oaks. Proc. Natl. Acad. Sci. USA 88: 2540-2544. Wolfe, A. D. and W. J. Elisens. 1994. Nuclear ribosomal DNA restriction-site variation in Penstemon section
Peltanthera (Scrophylariaceae): an evaluation of diploid hybrid spéciation and evidence for introgression. Amer. J. Bot. 81: 1627-1635. Wolfe, J. A. 1975. Some aspects of plant geography of the Northern Hemisphere during the late Cretaceous anD
Tertiary. Ann. Missouri Bot. Gard. 62: 264-279. . 198 0. Tertiary climatic and floristic relationships at high latitudes in the Northern Hemisphere. Paleogeogr., Paleoclimat., Paleoecol. 61: 33-77. Zagwijn, W. H. 1992. Quatern. Sci. Rev. 11: 583-591. Zurawski, G. , M. T. Clegg and A. H. D. Brown. 1984. The nature of nucleotide sequence divergence between barley and maize chloroplast DNA. Genetics 106: 735- 145
749. and M. T. Clegg. 1987. Evolution of higher plant chloroplast DNA-encoded genes: implications for structure-function and phylogenetic studies. Ann. Rev. Plant Physiol. 38: 391-418.