Selection on Ancestral Genetic Variation Fuels Parallel Ecotype Formation in Bottlenose Dolphins
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Haplotypes of CYP1B1 and CCDC57 Genes in an Afro-Caribbean Female
Molecular Biology Reports (2019) 46:3299–3306 https://doi.org/10.1007/s11033-019-04790-y ORIGINAL ARTICLE Haplotypes of CYP1B1 and CCDC57 genes in an Afro‑Caribbean female population with uterine leiomyoma Angela T. Alleyne1 · Virgil S. Bideau1 Received: 13 December 2018 / Accepted: 28 March 2019 / Published online: 13 April 2019 © Springer Nature B.V. 2019 Abstract Uterine leiomyomas (UL) are prevalent benign tumors, especially among women of African ancestry. The disease also has genetic liability and is infuenced by risk factors such as hormones and obesity. This study investigates the haplotypes of the Cytochrome P450 1B1 gene (CYP1B1) related to hormones and coiled-coil domain containing 57 gene (CCDC57) related to obesity in Afro-Caribbean females. Each haplotype was constructed from unphased sequence data using PHASE v.2.1 software and Haploview v.4.2 was used for linkage disequilibrium (LD) studies. There were contrasting LD observed among the single nucleotide polymorphisms of CYP1B1 and CCDC5. Accordingly, the GTA haplotype of CYP1B1 was signifcantly associated with UL risk (P = 0.02) while there was no association between CCDC57 haplotypes and UL (P = 0.2) for the ATG haplotype. As such, our fndings suggest that the Asp449Asp polymorphism and GTA haplotype of CYP1B1 may contribute to UL susceptibility in women of Afro-Caribbean ancestry in this population. Keywords SNP · Fibroids · Haplotyping · Estrogen · Linkage disequilibrium Introduction consistently having a higher risk of UL development than White women [4]. However cumulatively Black women have Globally, 20–25% of women are clinically diagnosed with an earlier onset for diagnosis than White women [2, 10]. -
00006396 201510000 00004
King’s Research Portal DOI: 10.1097/j.pain.0000000000000200 Document Version Publisher's PDF, also known as Version of record Link to publication record in King's Research Portal Citation for published version (APA): Livshits, G., Macgregor, A. J., Gieger, C., Malkin, I., Moayyeri, A., Grallert, H., Emeny, R. T., Spector, T., Kastenmuller, G., & Williams, F. M. K. (2015). An omics investigation into chronic widespread musculoskeletal pain reveals epiandrosterone sulfate as a potential biomarker. Pain, 156(10), 1845-1851. https://doi.org/10.1097/j.pain.0000000000000200 Citing this paper Please note that where the full-text provided on King's Research Portal is the Author Accepted Manuscript or Post-Print version this may differ from the final Published version. If citing, it is advised that you check and use the publisher's definitive version for pagination, volume/issue, and date of publication details. And where the final published version is provided on the Research Portal, if citing you are again advised to check the publisher's website for any subsequent corrections. General rights Copyright and moral rights for the publications made accessible in the Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognize and abide by the legal requirements associated with these rights. •Users may download and print one copy of any publication from the Research Portal for the purpose of private study or research. •You may not further distribute the material or use it for any profit-making activity or commercial gain •You may freely distribute the URL identifying the publication in the Research Portal Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. -
CCDC57 CRISPR/Cas9 KO Plasmid (M): Sc-427913
SANTA CRUZ BIOTECHNOLOGY, INC. CCDC57 CRISPR/Cas9 KO Plasmid (m): sc-427913 BACKGROUND APPLICATIONS The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CCDC57 CRISPR/Cas9 KO Plasmid (m) is recommended for the disruption of CRISPR-associated protein (Cas9) system is an adaptive immune response gene expression in mouse cells. defense mechanism used by archea and bacteria for the degradation of foreign genetic material (4,6). This mechanism can be repurposed for other 20 nt non-coding RNA sequence: guides Cas9 functions, including genomic engineering for mammalian systems, such as to a specific target location in the genomic DNA gene knockout (KO) (1,2,3,5). CRISPR/Cas9 KO Plasmid products enable the U6 promoter: drives gRNA scaffold: helps Cas9 identification and cleavage of specific genes by utilizing guide RNA (gRNA) expression of gRNA bind to target DNA sequences derived from the Genome-scale CRISPR Knock-Out (GeCKO) v2 library developed in the Zhang Laboratory at the Broad Institute (3,5). Termination signal Green Fluorescent Protein: to visually REFERENCES verify transfection CRISPR/Cas9 Knockout Plasmid CBh (chicken β-Actin 1. Cong, L., et al. 2013. Multiplex genome engineering using CRISPR/Cas hybrid) promoter: drives systems. Science 339: 819-823. 2A peptide: expression of Cas9 allows production of both Cas9 and GFP from the 2. Mali, P., et al. 2013. RNA-guided human genome engineering via Cas9. same CBh promoter Science 339: 823-826. Nuclear localization signal 3. Ran, F.A., et al. 2013. Genome engineering using the CRISPR-Cas9 system. Nuclear localization signal SpCas9 ribonuclease Nat. Protoc. 8: 2281-2308. -
Impact of Natural HIV-1 Nef Alleles and Polymorphisms on SERINC3/5 Downregulation
Impact of natural HIV-1 Nef alleles and polymorphisms on SERINC3/5 downregulation by Steven W. Jin B.Sc., Simon Fraser University, 2016 Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science in the Master of Science Program Faculty of Health Sciences © Steven W. Jin 2019 SIMON FRASER UNIVERSITY Spring 2019 Copyright in this work rests with the author. Please ensure that any reproduction or re-use is done in accordance with the relevant national copyright legislation. Approval Name: Steven W. Jin Degree: Master of Science Title: Impact of natural HIV-1 Nef alleles and polymorphisms on SERINC3/5 downregulation Examining Committee: Chair: Kanna Hayashi Assistant Professor Mark Brockman Senior Supervisor Associate Professor Masahiro Niikura Supervisor Associate Professor Ralph Pantophlet Supervisor Associate Professor Lisa Craig Examiner Professor Department of Molecular Biology and Biochemistry Date Defended/Approved: April 25, 2019 ii Ethics Statement iii Abstract HIV-1 Nef is a multifunctional accessory protein required for efficient viral pathogenesis. It was recently identified that the serine incorporators (SERINC) 3 and 5 are host restriction factors that decrease the infectivity of HIV-1 when incorporated into newly formed virions. However, Nef counteracts these effects by downregulating SERINC from the cell surface. Currently, there lacks a comprehensive study investigating the impact of primary Nef alleles on SERINC downregulation, as most studies to date utilize lab- adapted or reference HIV strains. In this thesis, I characterized and compared SERINC downregulation from >400 Nef alleles isolated from patients with distinct clinical outcomes and subtypes. I found that primary Nef alleles displayed a dynamic range of SERINC downregulation abilities, thus allowing naturally-occurring polymorphisms that modulate this activity to be identified. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Ingenuity Pathway Analysis of Differentially Expressed Genes Involved in Signaling Pathways and Molecular Networks in Rhoe Gene‑Edited Cardiomyocytes
INTERNATIONAL JOURNAL OF MOleCular meDICine 46: 1225-1238, 2020 Ingenuity pathway analysis of differentially expressed genes involved in signaling pathways and molecular networks in RhoE gene‑edited cardiomyocytes ZHONGMING SHAO1*, KEKE WANG1*, SHUYA ZHANG2, JIANLING YUAN1, XIAOMING LIAO1, CAIXIA WU1, YUAN ZOU1, YANPING HA1, ZHIHUA SHEN1, JUNLI GUO2 and WEI JIE1,2 1Department of Pathology, School of Basic Medicine Sciences, Guangdong Medical University, Zhanjiang, Guangdong 524023; 2Hainan Provincial Key Laboratory for Tropical Cardiovascular Diseases Research and Key Laboratory of Emergency and Trauma of Ministry of Education, Institute of Cardiovascular Research of The First Affiliated Hospital, Hainan Medical University, Haikou, Hainan 571199, P.R. China Received January 7, 2020; Accepted May 20, 2020 DOI: 10.3892/ijmm.2020.4661 Abstract. RhoE/Rnd3 is an atypical member of the Rho super- injury and abnormalities, cell‑to‑cell signaling and interaction, family of proteins, However, the global biological function and molecular transport. In addition, 885 upstream regulators profile of this protein remains unsolved. In the present study, a were enriched, including 59 molecules that were predicated RhoE‑knockout H9C2 cardiomyocyte cell line was established to be strongly activated (Z‑score >2) and 60 molecules that using CRISPR/Cas9 technology, following which differentially were predicated to be significantly inhibited (Z‑scores <‑2). In expressed genes (DEGs) between the knockout and wild‑type particular, 33 regulatory effects and 25 networks were revealed cell lines were screened using whole genome expression gene to be associated with the DEGs. Among them, the most signifi- chips. A total of 829 DEGs, including 417 upregulated and cant regulatory effects were ‘adhesion of endothelial cells’ and 412 downregulated, were identified using the threshold of ‘recruitment of myeloid cells’ and the top network was ‘neuro- fold changes ≥1.2 and P<0.05. -
Rabbit Anti-TAF1C/FITC Conjugated Antibody
SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-TAF1C/FITC Conjugated antibody SL24053R-FITC Product Name: Anti-TAF1C/FITC Chinese Name: FITC标记的TATA盒Binding protein相关因子TAF1C抗体 RNA polymerase I-specific TBP-associated factor 110 kDa; SL1; Taf1c; TAF1C_MOUSE; TAFI110; TAFI95; TATA box binding protein associated factor 1C; TATA box-binding protein-associated factor 1C; TATA box-binding protein-associated Alias: factor RNA polymerase I subunit C; TBP associated factor 1C; TBP associated factor RNA polymerase I 95 kDa; TBP associated factor, RNA polymerase I, 110-KD; TBP- associated factor 1C; Transcription initiation factor SL1/TIF-IB subunit C. Organism Species: Rabbit Clonality: Polyclonal React Species: ICC=1:50-200IF=1:50-200 Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 95kDa Form: Lyophilized or Liquid Concentration: 2mg/1ml immunogen: KLHwww.sunlongbiotech.com conjugated synthetic peptide derived from mouse TAF1C Lsotype: IgG Purification: affinity purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20°C. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 °C. background: Initiation of transcription by RNA polymerase I requires the formation of a complex Product Detail: composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. -
(MINA) (NM 032778) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC212554L4 MINA53 (MINA) (NM_032778) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: MINA53 (MINA) (NM_032778) Human Tagged ORF Clone Tag: mGFP Symbol: RIOX2 Synonyms: JMJD10; MDIG; MINA; MINA53; NO52; ROX Vector: pLenti-C-mGFP-P2A-Puro (PS100093) E. coli Selection: Chloramphenicol (34 ug/mL) Cell Selection: Puromycin ORF Nucleotide The ORF insert of this clone is exactly the same as(RC212554). Sequence: Restriction Sites: SgfI-MluI Cloning Scheme: ACCN: NM_032778 ORF Size: 1392 bp This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 MINA53 (MINA) (NM_032778) Human Tagged ORF Clone – RC212554L4 OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_032778.3, NP_116167.3 RefSeq Size: 2221 bp RefSeq ORF: 1395 bp Locus ID: 84864 UniProt ID: Q8IUF8 Protein Families: Druggable Genome MW: 52.5 kDa Gene Summary: MINA is a c-Myc (MYC; MIM 190080) target gene that may play a role in cell proliferation or regulation of cell growth. -
Noelia Díaz Blanco
Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr. -
Cross-Cohort Analysis Identifies a TEAD4– MYCN Positive Feedback Loop As the Core Regulatory Element of High-Risk Neuroblastoma
Cross-Cohort Analysis Identifies a TEAD4– MYCN Positive Feedback Loop as the Core Regulatory Element of High-Risk Neuroblastoma The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Rajbhandari, Presha et al. “Cross-Cohort Analysis Identifies a TEAD4–MYCN Positive Feedback Loop as the Core Regulatory Element of High-Risk Neuroblastoma.” Cancer Discovery 8, 5 (March 2018): 582–599 © 2018 AACR As Published http://dx.doi.org/10.1158/2159-8290.CD-16-0861 Publisher American Association for Cancer Research Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/117503 Terms of Use Creative Commons Attribution-Noncommercial-Share Alike Detailed Terms http://creativecommons.org/licenses/by-nc-sa/4.0/ HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Cancer Manuscript Author Discov. Author manuscript; Manuscript Author available in PMC 2018 August 01. Published in final edited form as: Cancer Discov. 2018 May ; 8(5): 582–599. doi:10.1158/2159-8290.CD-16-0861. Cross-cohort analysis identifies a TEAD4 ↔ MYCN positive- feedback loop as the core regulatory element of high-risk neuroblastoma Presha Rajbhandari1,2,$, Gonzalo Lopez1,3,$, Claudia Capdevila1, Beatrice Salvatori1, Jiyang Yu1,#, Ruth Rodriguez-Barrueco4,5, Daniel Martinez3, Mark Yarmarkovich3, Nina Weichert-Leahey6, Brian J. Abraham7, Mariano J Alvarez1, Archana Iyer1, Jo Lynne Harenza3, Derek Oldridge3, Katleen De Preter8, Jan Koster9, Shahab Asgharzadeh10,11, Robert -
SERINC5 (NM 178276) Human Untagged Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC313396 SERINC5 (NM_178276) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: SERINC5 (NM_178276) Human Untagged Clone Tag: Tag Free Symbol: SERINC5 Synonyms: C5orf12; TPO1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_178276, the custom clone sequence may differ by one or more nucleotides ATGTCAGCTCAGTGCTGTGCGGGCCAGCTGGCCTGCTGCTGTGGGTCTGCAGGCTGCTCTCTCTGCTGTG ATTGCTGCCCCAGGATTCGGCAGTCCCTCAGCACCCGCTTCATGTACGCCCTCTACTTCATTCTGGTCGT CGTCCTCTGCTGCATCATGATGTCAACAACCGTGGCTCACAAGATGAAAGAGCACATTCCTTTTTTTGAA GATATGTGTAAAGGCATTAAAGCTGGTGACACCTGTGAGAAGCTGGTGGGATATTCTGCCGTGTATAGAG TCTGTTTTGGAATGGCTTGTTTCTTCTTTATCTTCTGTCTACTGACCTTGAAAATCAACAACAGCAAAAG TTGTAGAGCTCATATTCACAATGGCTTTTGGTTCTTTAAACTTCTGCTGTTGGGGGCCATGTGCTCAGGA GCTTTCTTCATTCCAGATCAGGACACCTTTCTGAACGCCTGGCGCTATGTGGGAGCCGTCGGAGGCTTCC TCTTCATTGGCATCCAGCTCCTCCTGCTCGTGGAGTTTGCACATAAGTGGAACAAGAACTGGACAGCAGG CACAGCCAGTAACAAGCTGTGGTACGCCTCCCTGGCCCTGGTGACGCTCATCATGTATTCCATTGCCACT GGAGGCTTGGTTTTGATGGCAGTGTTTTATACACAGAAAGACAGCTGCATGGAAAACAAAATTCTGCTGG GAGTAAATGGAGGCCTGTGCCTGCTTATATCATTGGTAGCCATCTCACCCTGGGTCCAAAATCGACAGCC ACACTCGGGGCTCTTACAATCAGGGGTCATAAGCTGCTATGTCACCTACCTCACCTTCTCAGCTCTGTCC AGCAAACCTGCAGAAGTAGTTCTAGATGAACATGGGAAAAATGTTACAATCTGTGTGCCTGACTTTGGTC AAGACCTGTACAGAGATGAAAACTTGGTGACTATACTGGGGACCAGCCTCTTAATCGGATGTATCTTGTA -
Thai Malena a Ha Una Alta Kama Nina Mitte
THAI MALENA A US009976180B2HA UNA ALTA KAMA NINA MITTE (12 ) United States Patent (10 ) Patent No. : US 9 , 976 , 180 B2 Hatchwell et al. (45 ) Date of Patent: May 22 , 2018 ( 54 ) METHODS FOR DETECTING A GENETIC 5 ,665 , 549 A 9 / 1997 Pinkel et al . 5 , 700 ,637 A 12 / 1997 Southern VARIATION IN SUBJECTS WITH 5 , 744 ,305 A 4 / 1998 Fodor et al . PARKINSONISM 5 ,776 ,434 A 7 / 1998 Purewal et al . 5 ,811 , 128 A 9 / 1998 Tice et al . (71 ) Applicant: Population Bio , Inc ., Melville , NY 5 , 814 ,344 A 9 / 1998 Tice et al . (US ) 5 ,820 , 883 A 10 / 1998 Tice et al . 5 ,837 , 832 A 11/ 1998 Chee et al. 5 ,853 , 763 A 12 / 1998 Tice et al. ( 72 ) Inventors : Eli Hatchwell , Winchester (GB ); Peggy 5 , 858 ,659 A 1 / 1999 Sapolsky et al. S . Eis , Fitchburg , WI (US ) 5 , 928 ,647 A 7 / 1999 Rock 5 , 942 ,252 A 8 / 1999 Tice et al. ( 73 ) Assignee: POPULATION BIO , INC ., Melville , 5 , 945 , 334 A 8 / 1999 Besemer et al . NY (US ) 6 ,040 , 138 A 3 / 2000 Lockhart et al . 6 ,054 , 270 A 4 / 2000 Southern 6 , 146 , 834 A 11/ 2000 Schaad et al . ( * ) Notice : Subject to any disclaimer , the term of this 6 , 207, 392 B1 3 / 2001 Weiss et al. patent is extended or adjusted under 35 6 ,210 , 878 B1 4 /2001 Pinkel et al . U . S . C . 154 ( b ) by 0 days. days . 6 , 251, 607 B1 6 /2001 Tsen et al .