Impact of Natural HIV-1 Nef Alleles and Polymorphisms on SERINC3/5 Downregulation

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Impact of natural HIV-1 Nef alleles and polymorphisms on SERINC3/5 downregulation by Steven W. Jin B.Sc., Simon Fraser University, 2016 Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science in the Master of Science Program Faculty of Health Sciences © Steven W. Jin 2019 SIMON FRASER UNIVERSITY Spring 2019 Copyright in this work rests with the author. Please ensure that any reproduction or re-use is done in accordance with the relevant national copyright legislation. Approval Name: Steven W. Jin Degree: Master of Science Title: Impact of natural HIV-1 Nef alleles and polymorphisms on SERINC3/5 downregulation Examining Committee: Chair: Kanna Hayashi Assistant Professor Mark Brockman Senior Supervisor Associate Professor Masahiro Niikura Supervisor Associate Professor Ralph Pantophlet Supervisor Associate Professor Lisa Craig Examiner Professor Department of Molecular Biology and Biochemistry Date Defended/Approved: April 25, 2019 ii Ethics Statement iii Abstract HIV-1 Nef is a multifunctional accessory protein required for efficient viral pathogenesis. It was recently identified that the serine incorporators (SERINC) 3 and 5 are host restriction factors that decrease the infectivity of HIV-1 when incorporated into newly formed virions. However, Nef counteracts these effects by downregulating SERINC from the cell surface. Currently, there lacks a comprehensive study investigating the impact of primary Nef alleles on SERINC downregulation, as most studies to date utilize lab- adapted or reference HIV strains. In this thesis, I characterized and compared SERINC downregulation from >400 Nef alleles isolated from patients with distinct clinical outcomes and subtypes. I found that primary Nef alleles displayed a dynamic range of SERINC downregulation abilities, thus allowing naturally-occurring polymorphisms that modulate this activity to be identified. In addition, I found that Nef alleles isolated from patients with better clinical outcomes had a poorer ability to counteract SERINC, suggesting that variation in this activity may contribute to differences in HIV-1 pathogenesis. Keywords: HIV/AIDS; Nef; SERINC3; SERINC5; viral diversity; viral infectivity iv Dedication To my mom, who has given up so much of her life so I can have mine, for that, I am forever in your debt. v Acknowledgements The completion of a Master’s degree program is as much an intellectual journey as it is a personal one; in this regard, there is an army of individuals who have shaped both aspects of my journey. Foremost, I would like to extend my sincerest thanks to my senior supervisor Dr. Mark Brockman, as well as Dr. Zabrina Brumme, who have given me the platform to train and grow as a young scientist; my successes and accomplishments would not have been possible without your continuous support and generosity. Lastly, to every single lab member who I have met since joining the lab, you have all made this journey an unforgettable experience and I’m grateful to be able to call some of you my lifelong friends. vi Table of Contents Approval ............................................................................................................................... ii Ethics Statement ................................................................................................................. iii Abstract ............................................................................................................................... iv Dedication ............................................................................................................................v Acknowledgements ............................................................................................................. vi Table of Contents ............................................................................................................... vii List of Tables ....................................................................................................................... ix List of Figures.......................................................................................................................x List of Acronyms ................................................................................................................. xi Chapter 1. Role of HIV-1 accessory proteins in viral pathogenesis ........................ 1 1.1. Introduction to HIV-1 ................................................................................................ 1 1.2. HIV-1 life cycle and pathogenesis ........................................................................... 1 1.3. HIV-1 accessory proteins......................................................................................... 2 1.3.1. Virulence infectivity factor (Vif) ......................................................................... 3 1.3.2. Virulence protein R (Vpr) .................................................................................. 3 1.3.3. Viral protein U (Vpu) ......................................................................................... 4 1.3.4. Negative factor (Nef) ........................................................................................ 4 1.4. Sequence and function variation in primary Nef alleles .......................................... 7 1.5. Conclusions.............................................................................................................. 9 1.6. Thesis Objectives ................................................................................................... 10 1.7. References ............................................................................................................. 11 Chapter 2. HIV-1 Nef alleles isolated from elite controllers are impaired for SERINC5 downregulation activity ....................................................................... 21 2.1. Abstract .................................................................................................................. 21 2.2. Introduction ............................................................................................................ 22 2.3. Materials and Methods .......................................................................................... 23 2.3.1. Study Participants ........................................................................................... 23 2.3.2. Reagents......................................................................................................... 23 2.3.3. Generation of HIV-1 nef expression and proviral constructs ......................... 23 2.3.4. Generation of SERINC5 knockout Jurkat LTR-GFP reporter cells ............... 24 2.3.5. SERINC5 downregulation assays .................................................................. 24 2.3.6. CD4 and HLA class I downregulation assays ................................................ 25 2.3.7. Infectivity and replication capacity .................................................................. 25 2.3.8. Western blot .................................................................................................... 26 2.3.9. Statistical analysis .......................................................................................... 27 2.4. Results ................................................................................................................... 27 2.4.1. Primary HIV-1 Nef alleles display variable abilities to internalize SERINC5 . 27 2.4.2. Natural Nef polymorphisms are associated with SERINC5 downregulation function………... ............................................................................................................ 30 vii 2.4.3. Nef-mediated SERINC5 downregulation correlates more strongly with CD4 internalization compared to HLA internalization ........................................................... 32 2.4.4. Viral adaptation to host cytotoxic T lymphocytes contributes to variability in Nef-mediated SERINC5 downregulation activity .......................................................... 34 2.4.5. CTL escape mutations K94E and H116N selectively impair Nef-mediated SERINC5 downregulation function ............................................................................... 34 2.5. Discussion .............................................................................................................. 38 2.6. References ............................................................................................................. 40 Chapter 3. Differential ability of HIV-1 Nef alleles across viral subtypes to downregulate SERINC3 and SERINC5 ............................................................... 44 3.1. Abstract .................................................................................................................. 44 3.2. Introduction ............................................................................................................ 45 3.3. Materials and Methods .......................................................................................... 46 3.3.1. Study Participants ........................................................................................... 46 3.3.2. Plasmids ......................................................................................................... 46 3.3.3. Site-directed mutagenesis .............................................................................. 47 3.3.4. SERINC, CD4 and HLA-I downregulation...................................................... 47 3.3.5. Generation
Recommended publications
  • Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics

    Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics

    Gamwell et al. Orphanet Journal of Rare Diseases 2013, 8:33 http://www.ojrd.com/content/8/1/33 RESEARCH Open Access Small cell ovarian carcinoma: genomic stability and responsiveness to therapeutics Lisa F Gamwell1,2, Karen Gambaro3, Maria Merziotis2, Colleen Crane2, Suzanna L Arcand4, Valerie Bourada1,2, Christopher Davis2, Jeremy A Squire6, David G Huntsman7,8, Patricia N Tonin3,4,5 and Barbara C Vanderhyden1,2* Abstract Background: The biology of small cell ovarian carcinoma of the hypercalcemic type (SCCOHT), which is a rare and aggressive form of ovarian cancer, is poorly understood. Tumourigenicity, in vitro growth characteristics, genetic and genomic anomalies, and sensitivity to standard and novel chemotherapeutic treatments were investigated in the unique SCCOHT cell line, BIN-67, to provide further insight in the biology of this rare type of ovarian cancer. Method: The tumourigenic potential of BIN-67 cells was determined and the tumours formed in a xenograft model was compared to human SCCOHT. DNA sequencing, spectral karyotyping and high density SNP array analysis was performed. The sensitivity of the BIN-67 cells to standard chemotherapeutic agents and to vesicular stomatitis virus (VSV) and the JX-594 vaccinia virus was tested. Results: BIN-67 cells were capable of forming spheroids in hanging drop cultures. When xenografted into immunodeficient mice, BIN-67 cells developed into tumours that reflected the hypercalcemia and histology of human SCCOHT, notably intense expression of WT-1 and vimentin, and lack of expression of inhibin. Somatic mutations in TP53 and the most common activating mutations in KRAS and BRAF were not found in BIN-67 cells by DNA sequencing.
  • Experimental Chronic Jet Lag Promotes Growth and Lung Metastasis of Lewis Lung Carcinoma in C57BL/6 Mice

    Experimental Chronic Jet Lag Promotes Growth and Lung Metastasis of Lewis Lung Carcinoma in C57BL/6 Mice

    ONCOLOGY REPORTS 27: 1417-1428, 2012 Experimental chronic jet lag promotes growth and lung metastasis of Lewis lung carcinoma in C57BL/6 mice 1,2,6 1,3 1,4 1,2 1,5 MINGWEI WU , JING ZENG , YANFENG CHEN , ZHAOLEI ZENG , JINXIN ZHANG , YUCHEN CAI1,2, YANLI YE1,2, LIWU FU1,2, LIJIAN XIAN1,2 and ZHONGPING CHEN1,6 1 2 3 4 State Key Laboratory of Oncology in South China; Departments of Research, Pathology, and Head and Neck Cancer, Cancer Center, Sun Yat-Sen University; 5Department of Medical Statistics and Epidemiology, Sun Yat-Sen University; 6Department of Neurosurgery, Cancer Center, Sun Yat-Sen University, Guangzhou, Guangdong, P.R. China Received December 8, 2011; Accepted January 17, 2012 DOI: 10.3892/or.2012.1688 Abstract. Circadian rhythm has been linked to cancer genesis are governed by a biological clock. The mammalian circadian and development, but the detailed mechanism by which circa- clock contains three components: input pathways, a central dian disruption accelerates tumor growth remains unclear. The pacemaker and output pathways. The mammalian central purpose of this study was to investigate the effect of circadian pacemaker is located in the suprachiasmatic nuclei (SCN) disruption on tumor growth and metastasis in male C57BL/6 of the anterior hypothalamus and controls the activity of the mice, using an experimental chronic jet lag model. Lewis lung peripheral clocks through the neuroendocrine and autonomic carcinoma cells were inoculated into both flanks of the mice nervous systems (1,2). Circadian rhythms govern the rhythmic following 10 days of exposure to experimental chronic jet lag changes in the behavior and/or physiology of mammals, such or control conditions.
  • MS Ritgerð Aðalbjörg Aðalbjörnsdóttir

    MS Ritgerð Aðalbjörg Aðalbjörnsdóttir

    The Vif protein of maedi-visna virus Protein interaction and new roles Aðalbjörg Aðalbjörnsdóttir Thesis for the degree of Master of Science University of Iceland Faculty of medicine School of Health Sciences Vif prótein mæði-visnuveiru Prótein tengsl og ný hlutverk Aðalbjörg Aðalbjörnsdóttir Ritgerð til meistaragráðu í Líf og læknavísindum Umsjónarkennari: Valgerður Andrésdóttir Meistaranámsnefnd: Stefán Ragnar Jónsson og Ólafur S. Andrésson Læknadeild Heilbrigðisvísindasvið Háskóla Íslands Júní 2016 The Vif protein of maedi-visna virus Protein interaction and new roles Aðalbjörg Aðalbjörnsdóttir Thesis for the degree of Master of Science Supervisor: Valgerður Andrésdóttir Masters committee: Stefán Ragnar Jónsson and Ólafur S. Andrésson Faculty of Medicine School of Health Sciences June 2016 Ritgerð þessi er til meistaragráðu í Líf og læknavísindum og er óheimilt að afrita ritgerðina á nokkurn hátt nema með leyfi rétthafa. © Aðalbjörg Aðalbjörnsdóttir 2016 Prentun: Háskólaprent Reykjavík, Ísland 2016 Ágrip Mæði-visnuveira (MVV) er lentiveira af ættkvísl retróveira. Hún veldur hæggengri lungnabólgu (mæði) og heilabólgu (visnu) í kindum. Aðalmarkfrumur veirunnar eru mónocytar/makrófagar. Veiran er náskyld HIV og hefur verið notuð sem módel fyrir HIV sýkingar. Stöðug vopnakapphlaup milli veira og fruma hafa leitt af sér fjölda sértækra aðferða í vörnum hýsilsfrumu gegn veirusýkingum. Fruman hefur þróað með sér innrænar varnir gegn ýmsum sýkingum. Þessar varnir geta verið mjög sérhæfðar og tjáning þeirra spilar stórt hlutverk í hvaða frumur er hægt að sýkja og hverjar ekki. Dæmi um slíkan frumubundinn þátt eru APOBEC3 próteinin. APOBEC3 próteinin eru fjölskylda cytósín deaminasa sem geta hindrað retróveirur og retróstökkla. Þetta gera þau með því að afaminera cýtósín í úrasil í einþátta DNA á meðan á víxlritun stendur og valda þar með G-A stökkbreytingum í forveirunni.
  • 718 HIV Disorders of the Brain; Pathology and Pathogenesis Luis

    718 HIV Disorders of the Brain; Pathology and Pathogenesis Luis

    [Frontiers in Bioscience 11, 718-732, January 1, 2006] HIV disorders of the brain; pathology and pathogenesis Luis Del Valle and Sergio Piña-Oviedo Center for Neurovirology and Cancer Biology, Laboratory of Neuropathology and Molecular Pathology, Temple University, 1900 North 12th Street, Suite 240, Philadelphia, Pennsylvania 19122 USA TABLE OF CONTENTS 1. Abstract 2. AIDS-Encephalopathy 2.1. Definition 2.2. HIV-1 Structure 2.3. Histopathology 2.4. Clinical Manifestations 2.5. Physiopathology 3. Progressive Multifocal Leukoencephalopathy 3.1. Definition 3.2. JC Virus Biological Considerations 3.3. JC Virus Structure 3.4. Histopathology 3.5. Clinical Manifestations 3.6. Physiopathology 4. Cryptococcosis 5.1. Definition 5.2. Cryptococcus neoformans Structure 5.3. Histopathology 5.4. Clinical Manifestations 5.5. Physiopathology 5. Toxoplasmosis 5.1. Definition 5.2. Toxoplasma godii Structure 5.3. Histopathology 5.4. Clinical Manifestations 5.5. Physiopathology 6. Primary CNS Lymphomas 6.1. Definition 6.2. Histopathology 6.3. Clinical Manifestations 6.4. Physiopathology 7. Acknowledgments 8. References 1. ABSTRACT Infection with HIV-1 has spread exponentially in still present in approximately 70 to 90% of patients and recent years to reach alarming proportions. It is estimated can be the result of HIV itself or of opportunistic than more than 33 million adults and 1.3 million children infections. Here we briefly review the pathology and are infected worldwide. Approximately 16,000 new cases pathophysiology of AIDS-Encephalopathy, of some of are diagnosed every day and almost 3 million people die the significant opportunistic infections affecting the every year from AIDS, making it the fourth leading brain in the context of AIDS, including Progressive cause of death in the world.
  • UC Merced UC Merced Undergraduate Research Journal

    UC Merced UC Merced Undergraduate Research Journal

    UC Merced UC Merced Undergraduate Research Journal Title Antiviral Drugs Targeting Host Proteins an Efficient Strategy Permalink https://escholarship.org/uc/item/66f5b4m0 Journal UC Merced Undergraduate Research Journal, 9(2) Author Karmonphet, Arrada Publication Date 2017 DOI 10.5070/M492034789 Undergraduate eScholarship.org Powered by the California Digital Library University of California Antiviral Drugs Targeting Host Proteins an Efficient Strategy Arrada Karmonphet University of California, Merced Keywords: Proteins, Viruses, Drugs 1 Abstract Viruses have the ability to spread rapidly because the proteins and enzymes from the host cell help in the development of viruses. Although there are many vaccines that can prevent some viruses from infecting the body, the antiviral drugs today have not been effective in combating viruses from the start of spreading. This is due to the fact that the processes inside a virus are still being studied. However, host proteins proved to be valuable factors responsible for viral replication and spreading. It was found that certain functions such as capsid formation of the virus utilized a biochemical pathway that involved host proteins and some proteins of the host cell were evolutionarily conserved. When the important host proteins were altered, or removed the viruses weren’t able to replicate as effectively. It was concluded that targeting the host proteins had a significant effect in viral replication. This approach can stop viral replication from the start, create less viral resistance, and help find new antiviral drugs that work for many different types of viruses. This review will analyze five research articles about protein interactions in viruses and how monitoring the proteins and biochemical pathways can lead to the discovery of druggable targets during development.
  • Supplementary Table S2

    Supplementary Table S2

    1-high in cerebrotropic Gene P-value patients Definition BCHE 2.00E-04 1 Butyrylcholinesterase PLCB2 2.00E-04 -1 Phospholipase C, beta 2 SF3B1 2.00E-04 -1 Splicing factor 3b, subunit 1 BCHE 0.00022 1 Butyrylcholinesterase ZNF721 0.00028 -1 Zinc finger protein 721 GNAI1 0.00044 1 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 GNAI1 0.00049 1 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 PDE1B 0.00069 -1 Phosphodiesterase 1B, calmodulin-dependent MCOLN2 0.00085 -1 Mucolipin 2 PGCP 0.00116 1 Plasma glutamate carboxypeptidase TMX4 0.00116 1 Thioredoxin-related transmembrane protein 4 C10orf11 0.00142 1 Chromosome 10 open reading frame 11 TRIM14 0.00156 -1 Tripartite motif-containing 14 APOBEC3D 0.00173 -1 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D ANXA6 0.00185 -1 Annexin A6 NOS3 0.00209 -1 Nitric oxide synthase 3 SELI 0.00209 -1 Selenoprotein I NYNRIN 0.0023 -1 NYN domain and retroviral integrase containing ANKFY1 0.00253 -1 Ankyrin repeat and FYVE domain containing 1 APOBEC3F 0.00278 -1 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F EBI2 0.00278 -1 Epstein-Barr virus induced gene 2 ETHE1 0.00278 1 Ethylmalonic encephalopathy 1 PDE7A 0.00278 -1 Phosphodiesterase 7A HLA-DOA 0.00305 -1 Major histocompatibility complex, class II, DO alpha SOX13 0.00305 1 SRY (sex determining region Y)-box 13 ABHD2 3.34E-03 1 Abhydrolase domain containing 2 MOCS2 0.00334 1 Molybdenum cofactor synthesis 2 TTLL6 0.00365 -1 Tubulin tyrosine ligase-like family, member 6 SHANK3 0.00394 -1 SH3 and multiple ankyrin repeat domains 3 ADCY4 0.004 -1 Adenylate cyclase 4 CD3D 0.004 -1 CD3d molecule, delta (CD3-TCR complex) (CD3D), transcript variant 1, mRNA.
  • Assessment of the Interaction Between the Human

    Assessment of the Interaction Between the Human

    VARIATIONS IN THE V3 CROWN OF HIV-1 ENVELOPE IMPACT AFFINITY FOR CCR5 AND AFFECT ENTRY AND REPLICATIVE FITNESS By MICHAEL ANDREW LOBRITZ Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Dissertation advisor: Eric J. Arts, Ph.D. Department of Molecular Biology and Microbiology CASE WESTERN RESERVE UNIVERSITY August 2007 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the dissertation of ______________________________________________________ candidate for the Ph.D. degree *. (signed)_______________________________________________ (chair of the committee) ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. Table of Contents Chapter 1: Introduction........................................................................................................................16 1.A. HIV and AIDS..............................................................................................17 1.B. Retroviruses: Structure, Organization, and Replication...............................20 1.B.1. HIV-1 Genome...............................................................................20 1.B.2. HIV-1 Particle................................................................................23
  • SERINC5 (NM 178276) Human Untagged Clone Product Data

    SERINC5 (NM 178276) Human Untagged Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC313396 SERINC5 (NM_178276) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: SERINC5 (NM_178276) Human Untagged Clone Tag: Tag Free Symbol: SERINC5 Synonyms: C5orf12; TPO1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_178276, the custom clone sequence may differ by one or more nucleotides ATGTCAGCTCAGTGCTGTGCGGGCCAGCTGGCCTGCTGCTGTGGGTCTGCAGGCTGCTCTCTCTGCTGTG ATTGCTGCCCCAGGATTCGGCAGTCCCTCAGCACCCGCTTCATGTACGCCCTCTACTTCATTCTGGTCGT CGTCCTCTGCTGCATCATGATGTCAACAACCGTGGCTCACAAGATGAAAGAGCACATTCCTTTTTTTGAA GATATGTGTAAAGGCATTAAAGCTGGTGACACCTGTGAGAAGCTGGTGGGATATTCTGCCGTGTATAGAG TCTGTTTTGGAATGGCTTGTTTCTTCTTTATCTTCTGTCTACTGACCTTGAAAATCAACAACAGCAAAAG TTGTAGAGCTCATATTCACAATGGCTTTTGGTTCTTTAAACTTCTGCTGTTGGGGGCCATGTGCTCAGGA GCTTTCTTCATTCCAGATCAGGACACCTTTCTGAACGCCTGGCGCTATGTGGGAGCCGTCGGAGGCTTCC TCTTCATTGGCATCCAGCTCCTCCTGCTCGTGGAGTTTGCACATAAGTGGAACAAGAACTGGACAGCAGG CACAGCCAGTAACAAGCTGTGGTACGCCTCCCTGGCCCTGGTGACGCTCATCATGTATTCCATTGCCACT GGAGGCTTGGTTTTGATGGCAGTGTTTTATACACAGAAAGACAGCTGCATGGAAAACAAAATTCTGCTGG GAGTAAATGGAGGCCTGTGCCTGCTTATATCATTGGTAGCCATCTCACCCTGGGTCCAAAATCGACAGCC ACACTCGGGGCTCTTACAATCAGGGGTCATAAGCTGCTATGTCACCTACCTCACCTTCTCAGCTCTGTCC AGCAAACCTGCAGAAGTAGTTCTAGATGAACATGGGAAAAATGTTACAATCTGTGTGCCTGACTTTGGTC AAGACCTGTACAGAGATGAAAACTTGGTGACTATACTGGGGACCAGCCTCTTAATCGGATGTATCTTGTA
  • Autophagy and Mammalian Viruses: Roles in Immune Response, Viral Replication, and Beyond

    Autophagy and Mammalian Viruses: Roles in Immune Response, Viral Replication, and Beyond

    Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2016 Autophagy and mammalian viruses: roles in immune response, viral replication, and beyond Paul, P ; Münz, C Abstract: Autophagy is an important cellular catabolic process conserved from yeast to man. Double- membrane vesicles deliver their cargo to the lysosome for degradation. Hence, autophagy is one of the key mechanisms mammalian cells deploy to rid themselves of intracellular pathogens including viruses. How- ever, autophagy serves many more functions during viral infection. First, it regulates the immune response through selective degradation of immune components, thus preventing possibly harmful overactivation and inflammation. Additionally, it delivers virus-derived antigens to antigen-loading compartments for presentation to T lymphocytes. Second, it might take an active part in the viral life cycle by, eg, facili- tating its release from cells. Lastly, in the constant arms race between host and virus, autophagy is often hijacked by viruses and manipulated to their own advantage. In this review, we will highlight key steps during viral infection in which autophagy plays a role. We have selected some exemplary viruses and will describe the molecular mechanisms behind their intricate relationship with the autophagic machinery, a result of host–pathogen coevolution. DOI: https://doi.org/10.1016/bs.aivir.2016.02.002 Posted at the Zurich Open Repository and Archive, University of Zurich ZORA URL: https://doi.org/10.5167/uzh-131236 Book Section Accepted Version The following work is licensed under a Creative Commons: Attribution-NonCommercial-NoDerivatives 4.0 International (CC BY-NC-ND 4.0) License.
  • Coevolution of Retroviruses with Serincs Following Whole-Genome

    Coevolution of Retroviruses with Serincs Following Whole-Genome

    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.24.962506; this version posted February 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Ramdas et al. 1 Coevolution of retroviruses with SERINCs following whole-genome duplication 2 divergence 3 4 Pavitra Ramdas1, Vipin Bhardwaj1, Aman Singh1, Nagarjun Vijay2, Ajit Chande1* 5 1Molecular Virology Laboratory & 2Computational Evolutionary Genomics Lab from the 6 Department of Biological Sciences, Indian Institute of Science Education and Research (IISER) 7 Bhopal, India. 8 9 Abstract 10 The SERINC gene family comprises of five paralogs in humans of which SERINC3 and 11 SERINC5 restrict HIV-1 in a Nef-dependent manner. The origin of this anti-retroviral activity, its 12 prevalence among the remaining human paralogs, and its ability to target retroviruses remain 13 largely unknown. Here we show that despite their early divergence, the anti-retroviral activity is 14 functionally conserved among four human SERINC paralogs with SERINC2 being an 15 exception. The lack of activity in human SERINC2 is associated with its post-whole genome 16 duplication (WGD) divergence, as evidenced by the ability of pre-WGD orthologs from yeast, 17 fly, and a post-WGD-proximate SERINC2 from coelacanth to inhibit HIV-1. Intriguingly, potent 18 retroviral factors from HIV-1 and MLV are not able to relieve the SERINC2-mediated particle 19 infectivity inhibition, indicating that such activity was directed towards other retroviruses that 20 are found in coelacanth (like foamy viruses).
  • Expression Analysis of Genes Located Within the Common Deleted Region

    Expression Analysis of Genes Located Within the Common Deleted Region

    Leukemia Research 84 (2019) 106175 Contents lists available at ScienceDirect Leukemia Research journal homepage: www.elsevier.com/locate/leukres Research paper Expression analysis of genes located within the common deleted region of del(20q) in patients with myelodysplastic syndromes T ⁎ Masayuki Shiseki , Mayuko Ishii, Michiko Okada, Mari Ohwashi, Yan-Hua Wang, Satoko Osanai, Kentaro Yoshinaga, Naoki Mori, Toshiko Motoji, Junji Tanaka Department of Hematology, Tokyo Women’s Medical University, 8-1 Kawada-cho, Shinjuku-ku, Tokyo, 162-8666, Japan ARTICLE INFO ABSTRACT Keywords: Deletion of the long arm of chromosome 20 (del(20q)) is observed in 5–10% of patients with myelodysplastic Deletion 20q syndromes (MDS). We examined the expression of 28 genes within the common deleted region (CDR) of del Common deleted region (20q), which we previously determined by a CGH array using clinical samples, in 48 MDS patients with (n = 28) Myelodysplastic syndromes or without (n = 20) chromosome 20 abnormalities and control subjects (n = 10). The expression level of 8 of 28 genes was significantly reduced in MDS patients with chromosome 20 abnormalities compared to that of control subjects. In addition, the expression of BCAS4, ADA, and YWHAB genes was significantly reduced in MDS pa- tients without chromosome 20 abnormalities, which suggests that these three genes were commonly involved in the molecular pathogenesis of MDS. To evaluate the clinical significance, we analyzed the impact of the ex- pression level of each gene on overall survival (OS). According to the Cox proportional hazard model, multi- variate analysis indicated that reduced BCAS4 expression was associated with inferior OS, but the difference was not significant (HR, 3.77; 95% CI, 0.995-17.17; P = 0.0509).
  • Role of Reverse Transcriptase and APOBEC3G in Survival of Human

    Role of Reverse Transcriptase and APOBEC3G in Survival of Human

    & My gy co lo lo ro g i y V Soni et al., Virol Mycol 2013, 3:1 Virology & Mycology DOI: 10.4172/2161-0517.1000125 ISSN: 2161-0517 Review Article Open Access Role of Reverse Transcriptase and APOBEC3G in Survival of Human Immune Deficiency Virus -1 Genome Raj Kumar Soni*, Amol Kanampalliwar and Archana Tiwari School of Biotechnology, Rajiv Gandhi Proudyogiki Vishwavidyalaya (State Technological University), Madhya Pradesh, India Abstract Development of an effective vaccine against HIV-1 is a major challenge for scientists at present. Rapid mutation and replication of the virus in patients contribute to the evolution of the virus, which makes it unconquerable. Hence a deep understanding of critical elements related to HIV-1 is necessary. Errors introduced during DNA synthesis by reverse transcriptase are the primary source of genetic variation within retroviral populations. Numerous current studies have shown that apolipo protein B mRNA-editing enzyme-catalytic polypeptide-like 3G (APOBEC3G) proteins mediated sub- lethal mutagenesis of HIV-1 proviral DNA contributes in viral fitness by accelerating human immunodeficiency virus-1 evolution. This results in the loss of the immunity and development of resistance against anti-viral drugs. This review focuses on the latest biological, biochemical, and structural studies in an attempt to discuss current ideas related to mutations initiated by reverse transcriptase and APOBEC3G. It also describes their effect on immunological diversity and retroviral restriction, and their overall effect on the viral genome respectively. A new procedure for eradication of HIV-1 has also been proposed based on the previous studies and proven facts. Keywords: HIV-1; Reverse transcriptase; Recombination; defined.