The Genomic Landscape of Clonal Hematopoiesis in Japan

Total Page:16

File Type:pdf, Size:1020Kb

The Genomic Landscape of Clonal Hematopoiesis in Japan Supplementary Materials for : The genomic landscape of clonal hematopoiesis in Japan Authors: Chikashi Terao1-3*, Akari Suzuki4, Yukihide Momozawa5, Masato Akiyama1,6, Kazuyoshi Ishigaki1, Kazuhiko Yamamoto4, Koichi Matsuda7,8, Yoshinori Murakami9, Steven A McCarroll10-12, Michiaki Kubo5, Po-Ru Loh10,13§, Yoichiro Kamatani1,14*§ 1.Laboratory for Statistical and Translational Genetics, RIKEN Center for Integrative Medical Sciences, Kanagawa, Japan 2.Clinical Research Center, Shizuoka General Hospital, Shizuoka, Japan 3.The Department of Applied Genetics, The School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka, Japan 4.Laboratory for Autoimmune Diseases, RIKEN Center for Integrative Medical Sciences, Yokohama, Japan. 5.Laboratory for Genotyping Development, RIKEN Center for Integrative Medical Sciences, Yokohama, Kanagawa, Japan. 6.Department of Ophthalmology, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan. 7.Laboratory of Genome Technology, Human Genome Center, Institute of Medical Science, The University of Tokyo, Tokyo, Japan. 8.Laboratory of Clinical Genome Sequencing, Department of Computational Biology and Medical Sciences, Graduate School of Frontier Sciences, The University of Tokyo, Tokyo, Japan. 9.Division of Molecular Pathology, Institute of Medical Science, The University of Tokyo, Tokyo, Japan 10.Program in Medical and Population Genetics, Broad Institute of MIT and Harvard, Cambridge, MA, USA. 11. Stanley Center for Psychiatric Research, Broad Institute of MIT and Harvard, Cambridge, Massachusetts, USA. 12.Department of Genetics, Harvard Medical School, Boston, Massachusetts, USA. 13.Division of Genetics, Department of Medicine, Brigham and Women's Hospital and Harvard Medical School, Boston, MA, USA. 14.Kyoto-McGill International Collaborative School in Genomic Medicine, Kyoto University Graduate School of Medicine, Kyoto, Japan §these authors equally supervised this work 1 Correspondence should be addressed to: Chikashi TERAO at Laboratory for Statistical and Translational Genetics , RIKEN Center for Integrative Medical Sciences, Yokohama 230-0045, Japan, E-mail address: [email protected] or Yoichiro Kamatani at Laboratory for Statistical and Translational Genetics , RIKEN Center for Integrative Medical Sciences, Yokohama 230-0045, Japan, E-mail address: [email protected] Supplementary Method page 3-10 Supplementary Note page 11-15 Fig. S1-S55 page 16-73 Tables S1-S28 page 74-108 Supplementary Reference page 109 2 Supplementary Methods Calculation of BAF and LRR from genotype intensity 1. Computation of cluster median of X and Y signal intensities. We calculated median of X and Y intensities in each genotype. If a cluster contained calls less than 10, we set its median to missing. 2. Affine-normalization and correction by GC and CpG contents. We took a similar approach to Jacobs et al1, and our method is the same as Loh et al10 regarding this calculation. A pair of multiple variate linear regression was carried out to correct effects of GC and CpG contents. Median of centers (X, Y) were set as two dependent variables to be expected (X, Y) values and modeled with the use of X and Y values in each subject of the genotype, GC and CpG contents in 9 windows of 50, 0.1k, 0.5k, 1k, 10k, 50k, 100k, 250k and 1Mbp at the center of SNPm as covariates as follows. 9 2 퐺퐶 푝 퐺퐶 퐶푝퐺 푝 퐶푝퐺 X푚,푖,푒푥푝 = e푥,푖 + Xm,iαx,i + Ym,iαy,i + ∑ ∑[(푓푚,푘 ) ∙ 훼푖,푘,푝 + (푓푚,푘 ) ∙ 훼푖,푘,푝 ] 푘=1 푝=1 9 2 퐺퐶 푝 퐺퐶 퐶푝퐺 푝 퐶푝퐺 Y푚,푖,푒푥푝 = e푦,푖 + Xm,iβx,i + Ym,iβy,i + ∑ ∑[(푓푚,푘 ) ∙ 훽푖,푘,푝 + (푓푚,푘 ) ∙ 훽푖,푘,푝 ] 푘=1 푝=1 where 푋푚,푖,푒푥푝 and 푌푚,푖,푒푥푝 are median of X and Y intensity in a cluster of a genotype of i-th individual in m-th variant, respectively, 푋푚,푖 and 푌푚,푖 are X and Y values in i-th individual for m-th variant, respectively, 훼푥,푖 , 훽푦,푖 are effect sizes of calculated X and Y for i-th 퐺퐶 퐶푝퐺 individual, respectively, 푓푚,푘 or and 푓푚,푘 are fraction of GC and CpG in k-th window, 퐶푝퐺 퐺퐶 훼푖,푘,푝 푎푛푑 훽푖,푘,푝, are effect size of GC and CpG in i-th individual for k-th window, respectively and e푥,푖 and e푦,푖are the error terms of X and Y for i-th individual, respectively. The multi-variate linear regression analyses were conducted per individual (~179k sets of models), assuming fixed effects of X, Y intensities, GC and CpG waves across variants. The GC content was computed with the use of bedtools on the hg19 reference. The CpG content was calculated with the use of EpiGRAPH CpG annotation45. Corrected X, Y values were calculated by expected X and Y values minus residuals of X and Y. 3.Computation of means of corrected X and Y values. 3 Means of corrected X and Y calculated above in the three cluster centers for each genotype were computed. 4.Transformation of corrected X and Y intensities to θ and R values. We transformed corrected X and Y to θ and R as follows; 2 푌 θ = ∙ arctan ( ) 휋 푋 푙표푔2푅 = 푋 + 푌 This follows the method by Staaf et al43 and differs from the method by Loh et al10. 5. Transformation of θ and R to LRR and BAF values. We computed cluster centers of each genotype to obtain θ and R in three cluster centers. We conducted linear interpolation between the cluster centers to estimate expected log2R based on θ in each individual. If cluster centers of homozygotes were missing, we used reflection of the cluster center in the opposite homozygote genotype across the vertical line on the center of heterozygote genotype. 6. Mean shift of LRR. We noticed that LRR in our dataset had slightly downward bias. To avoid noise in mosaic calls due to this bias, we shifted LRR values in each genotype for each variant to have mean 0 (mean shift). Calling mosaic events with the use of BAF and LRR 1.Filtering constitutional duplications The 25 states corresponding to phased BAF deviation (from -0.24 to 0.24 with interval of 0.02) were used in HMM. We assume events in the state revealed mean BAF deviation equal to state value (-0.24 – 0.24 with interval of 0.02) with empirical standard deviation computed across genotyping results. We capped z-score of 4. Transition probability was determined 0.003 from zero to non-zero state, 0.001 from a state to its negative value (phase switch error). Regions to 4 mask were selected by computing maximum likelihood (Viterbi path) and examining contiguous non-zero states. We masked regions of likely constitutional duplications with <2Mb with |ΔBAF|>0.1 and LRR>0.1 and their 2Mb nearby regions. 2.Parameterized hidden Markov model for event detection We used a family of 3 states HMMs parametrized by deviation of BAF, θ, namely, {-θ,0, θ} taking phase switch errors into account with transition matrix slightly different from 1st step (from±θ to 0, 0.0003, from 0 to ±θ, 0.004 * 0.0003 and switch error of 0.001). For acrocentric chromosomes (no p-arm genotypes), starting probability of non-zero state was decreased by a factor of 0.2. Like the 1st step, we assume events in the state revealed mean BAF deviation equal to state value with empirical standard deviation computed across genotyping results. We capped z-score of 2. 3.Calling existence of an event: likelihood ratio test statistics Based on a sequence of phased BAF deviation (ΔBAF) on each chromosome, we can analyze whether the sequence of observed ΔBAF can be explained by presence of mosaic events with the states defined above. We compute the likelihood ratio statistics with the use of a family of HMM paths parameterized by θ and modeled a total probability observing the sequence L(0 | ∆BAF) ofΔBAF. Likelihood ratio for θ can be modeled by f(∆BAF) = 푠푢푝휃{퐿(휃 |∆퐵퐴퐹)} 0 of θ indicates no mosaic events. We discretized θ to run from 0.001 to 0.25 in 50 multiplicative steps in practice. 4.Calling event boundaries Boundaries of called events were determined based on the consensus of mosaic calls in five samples taken from the posterior of the HMM using the likelihood-maximizing value for θ. 5. Calling copy number Since we noticed that the steepness of slopes in BAF-LRR space to distinguish possible gains and losses from CNN-LOH in the current data set were quite different from the previous study (this is not limited to raw or transformed BAF and LRR values in the current study), we did not use the previously-defined threshold of slopes. We defined 1.3 and -1.05 to distinguish gains 5 and losses from CNN-LOH, respectively. We called copy number only if the most likely call was at least 10 times more likely than the next-most likely call (~90% confidence). 6. Filtering possible constitutional duplications after calling mosaic events. We excluded possible constitutional duplications with length >10 Mb with LRR > 0.35 or LRR >0.2 and |ΔBAF|>0.16. We also filtered events with length <10Mb with LRR >0.2 or LRR>0.1 and |ΔBAF|>0.1. These threshold was defined by the previous study10. We further excluded events classified as gain or unknown and satisfying any of the following criteria: (1) less than 5Mbp length and contained in segmental duplications reported in 1000 genome projects with extension of 0.1Mbp in both directions (2) length <5Mb with LRR>0.13, or (3) length<2Mbp and LRR>0.02. We excluded events with LRR>-0.1 and observed heterozygosity within events less than one third of expected heterozygosity.
Recommended publications
  • PLXNB1 (Plexin
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Gene Section Mini Review PLXNB1 (plexin B1) José Javier Gómez-Román, Montserrat Nicolas Martínez, Servando Lazuén Fernández, José Fernando Val-Bernal Department of Anatomical Pathology, Marques de Valdecilla University Hospital, Medical Faculty, University of Cantabria, Santander, Spain (JJGR, MN, SL, JFVB) Published in Atlas Database: March 2009 Online updated version: http://AtlasGeneticsOncology.org/Genes/PLXNB1ID43413ch3p21.html DOI: 10.4267/2042/44702 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2010 Atlas of Genetics and Cytogenetics in Oncology and Haematology Identity Pseudogene No. Other names: KIAA0407; MGC149167; OTTHUMP00000164806; PLEXIN-B1; PLXN5; SEP Protein HGNC (Hugo): PLXNB1 Location: 3p21.31 Description Local order: The Plexin B1 gene is located between 2135 Amino acids (AA). Plexins are receptors for axon FBXW12 and CCDC51 genes. molecular guidance molecules semaphorins. Plexin signalling is important in pathfinding and patterning of both neurons and developing blood vessels. Plexin-B1 is a surface cell receptor. When it binds to its ligand SEMA4D it activates several pathways by binding of cytoplasmic ligands, like RHOA activation and subsequent changes of the actin cytoskeleton, axon guidance, invasive growth and cell migration. It monomers and heterodimers with PLXNB2 after proteolytic processing. Binds RAC1 that has been activated by GTP binding. It binds PLXNA1 and by similarity ARHGEF11, Note ARHGEF12, ERBB2, MET, MST1R, RND1, NRP1 Size: 26,200 bases. and NRP2. Orientation: minus strand. This family features the C-terminal regions of various plexins. The cytoplasmic region, which has been called DNA/RNA a SEX domain in some members of this family is involved in downstream signalling pathways, by Description interaction with proteins such as Rac1, RhoD, Rnd1 and other plexins.
    [Show full text]
  • Open Dogan Phdthesis Final.Pdf
    The Pennsylvania State University The Graduate School Eberly College of Science ELUCIDATING BIOLOGICAL FUNCTION OF GENOMIC DNA WITH ROBUST SIGNALS OF BIOCHEMICAL ACTIVITY: INTEGRATIVE GENOME-WIDE STUDIES OF ENHANCERS A Dissertation in Biochemistry, Microbiology and Molecular Biology by Nergiz Dogan © 2014 Nergiz Dogan Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 ii The dissertation of Nergiz Dogan was reviewed and approved* by the following: Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Dissertation Advisor Chair of Committee David S. Gilmour Professor of Molecular and Cell Biology Anton Nekrutenko Professor of Biochemistry and Molecular Biology Robert F. Paulson Professor of Veterinary and Biomedical Sciences Philip Reno Assistant Professor of Antropology Scott B. Selleck Professor and Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School iii ABSTRACT Genome-wide measurements of epigenetic features such as histone modifications, occupancy by transcription factors and coactivators provide the opportunity to understand more globally how genes are regulated. While much effort is being put into integrating the marks from various combinations of features, the contribution of each feature to accuracy of enhancer prediction is not known. We began with predictions of 4,915 candidate erythroid enhancers based on genomic occupancy by TAL1, a key hematopoietic transcription factor that is strongly associated with gene induction in erythroid cells. Seventy of these DNA segments occupied by TAL1 (TAL1 OSs) were tested by transient transfections of cultured hematopoietic cells, and 56% of these were active as enhancers. Sixty-six TAL1 OSs were evaluated in transgenic mouse embryos, and 65% of these were active enhancers in various tissues.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Leukaemia Section
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST-CNRS Leukaemia Section Short Communication t(7;14)(q35;q32.1) TRB/TCL1A inv(14)(q11q32.1) TRA-TRD/TCL1A t(14;14)(q11;q32.1) TRA-TRD/TCL1A Tatiana Gindina Raisa Gorbacheva Memorial Institute of Children's Oncology, Hematology and Transplantation at First Pavlov St. Petersburg State Medical University, Saint-Petersburg, Russia Published in Atlas Database: June 2018 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/inv14ID2049.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/70184/06-2018-inv14ID2049.pdf DOI: 10.4267/2042/70184 This article is an update of : Boyer J. t(7;14)(q35;q32.1) TRB@/TCL1A. Atlas Genet Cytogenet Oncol Haematol 2001;5(3) This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2019 Atlas of Genetics and Cytogenetics in Oncology and Haematology TRD; B lymphoblastic leukaemia/lymphoma; T Abstract lymphoblastic leukaemia/lymphoma; Adult T-cell Review on t(7;14)(q35;q32), inv(14)(q11q32) and leukemia/lymphoma; T-cell prolymphocytic t(14;14)(q11;q32), with data on clinics, and the leukemia; Angioimmunoblastic T-cell lymphoma; genes involved. Chronic lymphocytic leukemia; syndrome; Mycosis Keywords fungoides; Hepatosplenic T-cell lymphoma; Acute Chromosome 7; Chromosome 14; TCL1A; TRA; myeloid leukaemia; Ataxia telangiectasia. Left: inv(14)(q11q32)and i(8q), G- banding - Courtesy Jean Luc Lai; right: inv(14)(q11q32) and t(14)(14) with i(7q), G- banding - Courtesy Tatiana Gindina. Atlas Genet Cytogenet Oncol Haematol. 2019; 23(4) 90 t(7;14)(q35;q32.1) TRB/TCL1A Gindina T inv(14)(q11q32.1) TRA-TRD/TCL1A t(14;14)(q11;q32.1) TRA-TRD/TCL1A Cytogenetics Clinics and pathology Chromosomal abnormalities are detected in most T- Disease PLL after culture with mitogens like PHA.
    [Show full text]
  • A Private 16Q24.2Q24.3 Microduplication in a Boy with Intellectual Disability, Speech Delay and Mild Dysmorphic Features
    G C A T T A C G G C A T genes Article A Private 16q24.2q24.3 Microduplication in a Boy with Intellectual Disability, Speech Delay and Mild Dysmorphic Features Orazio Palumbo * , Pietro Palumbo , Ester Di Muro, Luigia Cinque, Antonio Petracca, Massimo Carella and Marco Castori Division of Medical Genetics, Fondazione IRCCS-Casa Sollievo della Sofferenza, San Giovanni Rotondo, 71013 Foggia, Italy; [email protected] (P.P.); [email protected] (E.D.M.); [email protected] (L.C.); [email protected] (A.P.); [email protected] (M.C.); [email protected] (M.C.) * Correspondence: [email protected]; Tel.: +39-088-241-6350 Received: 5 June 2020; Accepted: 24 June 2020; Published: 26 June 2020 Abstract: No data on interstitial microduplications of the 16q24.2q24.3 chromosome region are available in the medical literature and remain extraordinarily rare in public databases. Here, we describe a boy with a de novo 16q24.2q24.3 microduplication at the Single Nucleotide Polymorphism (SNP)-array analysis spanning ~2.2 Mb and encompassing 38 genes. The patient showed mild-to-moderate intellectual disability, speech delay and mild dysmorphic features. In DECIPHER, we found six individuals carrying a “pure” overlapping microduplication. Although available data are very limited, genomic and phenotype comparison of our and previously annotated patients suggested a potential clinical relevance for 16q24.2q24.3 microduplication with a variable and not (yet) recognizable phenotype predominantly affecting cognition. Comparing the cytogenomic data of available individuals allowed us to delineate the smallest region of overlap involving 14 genes. Accordingly, we propose ANKRD11, CDH15, and CTU2 as candidate genes for explaining the related neurodevelopmental manifestations shared by these patients.
    [Show full text]
  • The Interactome of KRAB Zinc Finger Proteins Reveals the Evolutionary History of Their Functional Diversification
    Resource The interactome of KRAB zinc finger proteins reveals the evolutionary history of their functional diversification Pierre-Yves Helleboid1,†, Moritz Heusel2,†, Julien Duc1, Cécile Piot1, Christian W Thorball1, Andrea Coluccio1, Julien Pontis1, Michaël Imbeault1, Priscilla Turelli1, Ruedi Aebersold2,3,* & Didier Trono1,** Abstract years ago (MYA) (Imbeault et al, 2017). Their products harbor an N-terminal KRAB (Kru¨ppel-associated box) domain related to that of Krüppel-associated box (KRAB)-containing zinc finger proteins Meisetz (a.k.a. PRDM9), a protein that originated prior to the diver- (KZFPs) are encoded in the hundreds by the genomes of higher gence of chordates and echinoderms, and a C-terminal array of zinc vertebrates, and many act with the heterochromatin-inducing fingers (ZNF) with sequence-specific DNA-binding potential (Urru- KAP1 as repressors of transposable elements (TEs) during early tia, 2003; Birtle & Ponting, 2006; Imbeault et al, 2017). KZFP genes embryogenesis. Yet, their widespread expression in adult tissues multiplied by gene and segment duplication to count today more and enrichment at other genetic loci indicate additional roles. than 350 and 700 representatives in the human and mouse Here, we characterized the protein interactome of 101 of the ~350 genomes, respectively (Urrutia, 2003; Kauzlaric et al, 2017). A human KZFPs. Consistent with their targeting of TEs, most KZFPs majority of human KZFPs including all primate-restricted family conserved up to placental mammals essentially recruit KAP1 and members target sequences derived from TEs, that is, DNA trans- associated effectors. In contrast, a subset of more ancient KZFPs posons, ERVs (endogenous retroviruses), LINEs, SINEs (long and rather interacts with factors related to functions such as genome short interspersed nuclear elements, respectively), or SVAs (SINE- architecture or RNA processing.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • Small Cell Carcinoma of the Ovary, Hypercalcemic Type (SCCOHT) Beyond SMARCA4 Mutations: a Comprehensive Genomic Analysis
    cells Article Small Cell Carcinoma of the Ovary, Hypercalcemic Type (SCCOHT) beyond SMARCA4 Mutations: A Comprehensive Genomic Analysis Aurélie Auguste 1,Félix Blanc-Durand 2 , Marc Deloger 3 , Audrey Le Formal 1, Rohan Bareja 4,5, David C. Wilkes 4 , Catherine Richon 6,Béatrice Brunn 2, Olivier Caron 6, Mojgan Devouassoux-Shisheboran 7,Sébastien Gouy 2, Philippe Morice 2, Enrica Bentivegna 2, Andrea Sboner 4,5,8, Olivier Elemento 4,8, Mark A. Rubin 9 , Patricia Pautier 2, Catherine Genestie 10, Joanna Cyrta 4,9,11 and Alexandra Leary 1,2,* 1 Medical Oncologist, Gynecology Unit, Lead Translational Research Team, INSERM U981, Gustave Roussy, 94805 Villejuif, France; [email protected] (A.A.); [email protected] (A.L.F.) 2 Gynecological Unit, Department of Medicine, Gustave Roussy, 94805 Villejuif, France; [email protected] (F.B.-D.); [email protected] (B.B.); [email protected] (S.G.); [email protected] (P.M.); [email protected] (E.B.); [email protected] (P.P.) 3 Bioinformatics Core Facility, Gustave Roussy Cancer Center, UMS CNRS 3655/INSERM 23 AMMICA, 94805 Villejuif, France; [email protected] 4 Caryl and Israel Englander Institute for Precision Medicine, Weill Cornell Medicine, New York, NY 10001, USA; [email protected] (R.B.); [email protected] (D.C.W.); [email protected] (A.S.); [email protected] (O.E.); [email protected] (J.C.) 5 Institute for Computational Biomedicine, Weill Cornell
    [Show full text]
  • PDF Download
    TFIIIC90 Polyclonal Antibody Catalog No : YT4623 Reactivity : Human,Rat,Mouse, Applications : WB,ELISA Gene Name : GTF3C4 Protein Name : General transcription factor 3C polypeptide 4 Human Gene Id : 9329 Human Swiss Prot Q9UKN8 No : Mouse Swiss Prot Q8BMQ2 No : Immunogen : The antiserum was produced against synthesized peptide derived from human TF3C4. AA range:611-660 Specificity : TFIIIC90 Polyclonal Antibody detects endogenous levels of TFIIIC90 protein. Formulation : Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. Source : Rabbit Dilution : Western Blot: 1/500 - 1/2000. ELISA: 1/20000. Not yet tested in other applications. Purification : The antibody was affinity-purified from rabbit antiserum by affinity- chromatography using epitope-specific immunogen. Concentration : 1 mg/ml Storage Stability : -20°C/1 year Molecularweight : 92001 Observed Band : 95 1 / 3 Background : catalytic activity:Acetyl-CoA + histone = CoA + acetylhistone.,function:Essential for RNA polymerase III to make a number of small nuclear and cytoplasmic RNAs, including 5S RNA, tRNA, and adenovirus-associated (VA) RNA of both cellular and viral origin. Has histone acetyltransferase activity (HAT) with unique specificity for free and nucleosomal H3. May cooperate with GTF3C5 in facilitating the recruitment of TFIIIB and RNA polymerase through direct interactions with BRF1, POLR3C and POLR3F. May be localized close to the A box.,sequence caution:Contaminating sequence. Potential poly-A sequence.,similarity:Belongs to the TFIIIC subunit 4 family.,subunit:Part of the TFIIIC subcomplex TFIIIC2, consisting of six subunits, GTF3C1, GTF3C2, GTF3C3, GTF3C4, GTF3C5 and GTF3C6. Interacts with BRF1, GTF3C1, GTF3C2, GTF3C5, GTF3C6, POLR3C and POLR3F., Function : catalytic activity:Acetyl-CoA + histone = CoA + acetylhistone.,function:Essential for RNA polymerase III to make a number of small nuclear and cytoplasmic RNAs, including 5S RNA, tRNA, and adenovirus-associated (VA) RNA of both cellular and viral origin.
    [Show full text]
  • Figure S1. Validation of the Expression Level of Degs Enriched in Cytokine‑Mediated Signaling and Immune Response
    Figure S1. Validation of the expression level of DEGs enriched in cytokine‑mediated signaling and immune response. Gene expression quantified by RT‑qPCR. DEGs, differentially expressed genes; RT‑qPCR, reverse‑transcription quantitative PCR. Figure S2. Validation of STAU1‑regulated AS events. IGV‑Sashimi plot revealed (A‑C) three A5SS AS events in three different genes. Reads distribution of each AS event was plotted in the left panel with the transcripts of each gene shown below. The sche‑ matic diagrams depict the structures of two AS events, AS1 (purple line) and AS2 (green line). The exon sequences are denoted by black boxes, the intron sequences by a horizontal line (right panel). RNA‑seq quantification and RT‑qPCR validation of ASEs are presented in the panels on the right. STAU1, double‑stranded RNA‑binding protein Staufen homolog 1; AS, alternative splicing; A5SS, alternative 5'splice site; RNA‑seq, RNA sequencing; RT‑qPCR, reverse‑transcription quantitative PCR. Error bars represent mean ± SEM. *P<0.05. Table SI. Primers used in gene validation experiments. IFIT2‑F CAGCCTACGGCAACTAAA IFIT2‑R GAGCCTTCTCAAAGCACA IFIT3‑F ACACCAAACAATGGCTAC IFIT3‑R TGGACAAACCCTCTAAAC OASL‑F AATGGTGACCGTGATGGG OASL‑R ACCTGAGGATGGAGCAGAG IFI27‑F TTCACTGCGGCGGGAATC IFI27‑R TGGCTGCTATGGAGGACGAG S1PR4‑F TGCTGAAGACGGTGCTGATG S1PR4‑R TGCGGAAGGAGTAGATGATGG CCL5‑F ACGACTGCTGGGTTGGAG CCL5‑R ACCCTGCTGCTTTGCCTA CCL2‑F CTAACCCAGAAACATCCAAT CCL2‑R GCTATGAGCAGCAGGCAC CD44‑F TGGAGGACAGAAAGCCAAGT CD44‑R TTCGCAATGAAACAATCAGTAG PLEKHG2‑M/As‑F CCAAAAGTAAGCCTGTCC PLEKHG2‑M‑R
    [Show full text]
  • The Function and Evolution of C2H2 Zinc Finger Proteins and Transposons
    The function and evolution of C2H2 zinc finger proteins and transposons by Laura Francesca Campitelli A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Molecular Genetics University of Toronto © Copyright by Laura Francesca Campitelli 2020 The function and evolution of C2H2 zinc finger proteins and transposons Laura Francesca Campitelli Doctor of Philosophy Department of Molecular Genetics University of Toronto 2020 Abstract Transcription factors (TFs) confer specificity to transcriptional regulation by binding specific DNA sequences and ultimately affecting the ability of RNA polymerase to transcribe a locus. The C2H2 zinc finger proteins (C2H2 ZFPs) are a TF class with the unique ability to diversify their DNA-binding specificities in a short evolutionary time. C2H2 ZFPs comprise the largest class of TFs in Mammalian genomes, including nearly half of all Human TFs (747/1,639). Positive selection on the DNA-binding specificities of C2H2 ZFPs is explained by an evolutionary arms race with endogenous retroelements (EREs; copy-and-paste transposable elements), where the C2H2 ZFPs containing a KRAB repressor domain (KZFPs; 344/747 Human C2H2 ZFPs) are thought to diversify to bind new EREs and repress deleterious transposition events. However, evidence of the gain and loss of KZFP binding sites on the ERE sequence is sparse due to poor resolution of ERE sequence evolution, despite the recent publication of binding preferences for 242/344 Human KZFPs. The goal of my doctoral work has been to characterize the Human C2H2 ZFPs, with specific interest in their evolutionary history, functional diversity, and coevolution with LINE EREs.
    [Show full text]
  • TCL1A Expression Delineates Biological and Clinical Variability in B-Cell Lymphoma
    Modern Pathology (2009) 22, 206–215 & 2009 USCAP, Inc All rights reserved 0893-3952/09 $32.00 www.modernpathology.org TCL1A expression delineates biological and clinical variability in B-cell lymphoma Mohit Aggarwal1,4, Raquel Villuendas1, Gonzalo Gomez2, Socorro M Rodriguez-Pinilla1, Margarita Sanchez-Beato1, David Alvarez1, Nerea Martinez1, Antonia Rodriguez1, Maria E Castillo1, Francisca I Camacho1, Santiago Montes-Moreno1, Jose A Garcia-Marco3, Eva Kimby4, David G Pisano2 and Miguel A Piris1 1Molecular Pathology Programme, Spanish National Cancer Research Centre (CNIO), Madrid, Spain; 2Bioinformatics Unit, Structural Biology and Biocomputing Programme, CNIO, Madrid, Spain; 3Department of Haematology, Hospital Universitario Puerta de Hierro, Madrid, Spain and 4Division of Hematology, Department of Internal Medicine at Huddinge, Karolinska Institutet, Stockholm, Sweden The assembly of a collection of gene-expression signatures of the major types of B-cell non-Hodgkin’s lymphoma has identified increased T-cell leukemia/lymphoma 1A (TCL1) expression in multiple lymphoma types and cases, and has enabled the investigation of the functional and clinical importance of TCL1 expression. Specifically, Burkitt’s lymphoma cases show a homogeneously strong expression of TCL1, whereas diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, chronic lymphocytic leukemia, nodal marginal zone lymphoma, and splenic marginal zone lymphoma display a striking variability in the intensity of TCL1 staining. This was validated in two independent series. A Gene-Set Enrichment Analysis of the genes correlated with TCL1A expression found that variation in the level of expression of TCL1A was significantly associated with some of the most important gene signatures recognizing B-cell lymphoma pathogenesis and heterogeneity, such as germinal center, B-cell receptor, NF-jB (and its target genes), death, MAP kinases, TNFR1, TOLL, and IL1R.
    [Show full text]