DOCSLIB.ORG

PLXNB1 (Plexin

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
PLXNB1 (Plexin Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Gene Section Mini Review PLXNB1 (plexin B1) José Javier Gómez-Román, Montserrat Nicolas Martínez, Servando Lazuén Fernández, José Fernando Val-Bernal Department of Anatomical Pathology, Marques de Valdecilla University Hospital, Medical Faculty, University of Cantabria, Santander, Spain (JJGR, MN, SL, JFVB) Published in Atlas Database: March 2009 Online updated version: http://AtlasGeneticsOncology.org/Genes/PLXNB1ID43413ch3p21.html DOI: 10.4267/2042/44702 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2010 Atlas of Genetics and Cytogenetics in Oncology and Haematology Identity Pseudogene No. Other names: KIAA0407; MGC149167; OTTHUMP00000164806; PLEXIN-B1; PLXN5; SEP Protein HGNC (Hugo): PLXNB1 Location: 3p21.31 Description Local order: The Plexin B1 gene is located between 2135 Amino acids (AA). Plexins are receptors for axon FBXW12 and CCDC51 genes. molecular guidance molecules semaphorins. Plexin signalling is important in pathfinding and patterning of both neurons and developing blood vessels. Plexin-B1 is a surface cell receptor. When it binds to its ligand SEMA4D it activates several pathways by binding of cytoplasmic ligands, like RHOA activation and subsequent changes of the actin cytoskeleton, axon guidance, invasive growth and cell migration. It monomers and heterodimers with PLXNB2 after proteolytic processing. Binds RAC1 that has been activated by GTP binding. It binds PLXNA1 and by similarity ARHGEF11, Note ARHGEF12, ERBB2, MET, MST1R, RND1, NRP1 Size: 26,200 bases. and NRP2. Orientation: minus strand. This family features the C-terminal regions of various plexins. The cytoplasmic region, which has been called DNA/RNA a SEX domain in some members of this family is involved in downstream signalling pathways, by Description interaction with proteins such as Rac1, RhoD, Rnd1 and other plexins. Functioning gene. 21.00 kb; 37 Exons. Three copies of a cysteine rich repeat are found in Transcription Plexin. The function of the repeat is unknown. 7097.00 bp; Number of transcripts: 1; Type: Expression Messenger. It is highly expressed in fetal kidney, digestive system Two alternatively truncated spliced variant, coding (from esophagus to colon), thyroid, prostate and secreted proteins (lacking the part of the extracellular trachea and at slightly lower levels in fetal brain, lung, domains). female reproductive system (breast, uterus and ovary) and liver. Atlas Genet Cytogenet Oncol Haematol. 2010; 14(3) 249 PLXNB1 (plexin B1) Gómez-Román JJ, et al. Plexin B1 policlonal antibody in foetal human central nervous system. Positive staining in developing neurons. Localisation mutations in the cytoplasmic domain of the PLXNB1 gene in prostate cancer tissue. Mutations were found in Three isoforms have been identified: The isoform 1 is 8 (89%) of 9 prostate cancer bone metastases, in 7 located in cell membrane and the isoforms 2 and 3 are (41%) of 17 lymph node meta-stases, and in 41 (46%) secreted proteins. of 89 primary cancers. Forty percent of prostate cancers Function contained the same mutation, and the majority of the Plexin B1 has several molecular functions, like a primary tumors showed overexpression of the plexin- receptor activity, transmembrane receptor activity, B1 protein. In vitro functional expression studies of the protein binding, semaphorin receptor and semaphorin 3 most common mutations showed that the mutant receptor binding. It is implicated in the next biological proteins resulted in increased cell motility, inva-sion, processes: Signal transduction, intracellular signalling adhesion, and lamellipodia extension compared to cascade, multicellular organismal development, cell wildtype. The mutations acted by hindering RAC1 and migration and posi-tive regulation of axonogenesis. RRAS binding and GTP activity. Homology Implicated in It belongs to the plexin family and it contains 3 IPT/TIG domains and one Sema domain. Breast cancer Prognosis Mutations Loss of protein Plexin B1 expression is associated with Somatic poor outcome in breast cancer ER (estrogen positive) patients. Wong et al. (2007) identified 13 different somatic Atlas Genet Cytogenet Oncol Haematol. 2010; 14(3) 250 PLXNB1 (plexin B1) Gómez-Román JJ, et al. Renal cell carcinoma Prostate carcinoma Note Note By reverse transcription-polymerase chain reaction 13 somatic missense mutations in the cytoplasmic domain of the Plexin-B1 gene have been reported. plexin B1 is expressed in nonneoplastic renal tissue, Mutations were found in cancer bone metastases, and it is severely downregulated in clear cell renal lymph node metastases, and in primary cancers. carcinomas. By immunohistochemistry on tissue Forty percent of prostate cancers contained the same microarrays it was shown that plexin B1 protein is mutation. Overexpression of the Plexin-B1 protein was absent in more than 80% of renal cell carcinomas. found in the majority of primary tumors. The mutations Otherwise, all kinds of renal tubules showed strong hinder Rac and R-Ras binding and R-RasGAP activity, membrane reactivity. resulting in an increase in cell motility, invasion, When plexin B1 expression is induced with an adhesion, and lamellipodia. expression vector in the renal adenocarcinoma cell line ACHN, a marked reduction in proliferation rate is found. Plexin B1 in normal kidney tissue. Tubular cortical and medular cells reactive The same immunostaining after blocking peptide incubation. Atlas Genet Cytogenet Oncol Haematol. 2010; 14(3) 251 PLXNB1 (plexin B1) Gómez-Román JJ, et al. Plexin B1 loss of expression in three cases of renal cell carcinoma (clear cell upper right and left), and papillary (bottom right). One case of renal clear cell carcinoma with PlexinB1 expression (bottom left). activation by Plexin-B1 and induces cell contraction in COS-7 Osteoarthritis cells. J Biol Chem. 2003 Jul 11;278(28):25671-7 Note Usui H, Taniguchi M, Yokomizo T, Shimizu T. Plexin-A1 and Using semi-quantitative reverse transcription plexin-B1 specifically interact at their cytoplasmic domains. polymerase chain reaction (RT-PCR) analysis, plexin Biochem Biophys Res Commun. 2003 Jan 24;300(4):927-31 B1 (PLXNB1) was confirmed to be consis-tently Conrotto P, Corso S, Gamberini S, Comoglio PM, Giordano S. expressed at lower levels in osteoarthritis. Interplay between scatter factor receptors and B plexins controls invasive growth. Oncogene. 2004 Jul 1;23(30):5131-7 Disease Degenerative bone disease. Oinuma I, Ishikawa Y, Katoh H, Negishi M. The Semaphorin 4D receptor Plexin-B1 is a GTPase activating protein for R- References Ras. Science. 2004 Aug 6;305(5685):862-5 Swiercz JM, Kuner R, Offermanns S. Plexin-B1/RhoGEF- Maestrini E, Tamagnone L, Longati P, Cremona O, Gulisano mediated RhoA activation involves the receptor tyrosine kinase M, Bione S, Tamanini F, Neel BG, Toniolo D, Comoglio PM. A ErbB-2. J Cell Biol. 2004 Jun 21;165(6):869-80 family of transmembrane proteins with homology to the MET- Torres-Vázquez J, Gitler AD, Fraser SD, Berk JD, Van N hepatocyte growth factor receptor. Proc Natl Acad Sci U S A. Pham, Fishman MC, Childs S, Epstein JA, Weinstein BM. 1996 Jan 23;93(2):674-8 Semaphorin-plexin signaling guides patterning of the Fujii T, Nakao F, Shibata Y, Shioi G, Kodama E, Fujisawa H, developing vasculature. Dev Cell. 2004 Jul;7(1):117-23 Takagi S. Caenorhabditis elegans PlexinA, PLX-1, interacts Basile JR, Afkhami T, Gutkind JS. Semaphorin 4D/plexin-B1 with transmembrane semaphorins and regulates epidermal induces endothelial cell migration through the activation of morphogenesis. Development. 2002 May;129(9):2053-63 PYK2, Src, and the phosphatidylinositol 3-kinase-Akt pathway. Lorenzato A, Olivero M, Patanè S, Rosso E, Oliaro A, Mol Cell Biol. 2005 Aug;25(16):6889-98 Comoglio PM, Di Renzo MF. Novel somatic mutations of the Conrotto P, Valdembri D, Corso S, Serini G, Tamagnone L, MET oncogene in human carcinoma metastases activating cell Comoglio PM, Bussolino F, Giordano S. Sema4D induces motility and invasion. Cancer Res. 2002 Dec 1;62(23):7025-30 angiogenesis through Met recruitment by Plexin B1. Blood. Oinuma I, Katoh H, Harada A, Negishi M. Direct interaction of 2005 Jun 1;105(11):4321-9 Rnd1 with Plexin-B1 regulates PDZ-RhoGEF-mediated Rho Atlas Genet Cytogenet Oncol Haematol. 2010; 14(3) 252 PLXNB1 (plexin B1) Gómez-Román JJ, et al. Basile JR, Gavard J, Gutkind JS. Plexin-B1 utilizes RhoA and B1 and the small GTPase Rac1. J Mol Biol. 2008 Apr Rho kinase to promote the integrin-dependent activation of Akt 11;377(5):1474-87 and ERK and endothelial cell motility. J Biol Chem. 2007 Nov 30;282(48):34888-95 Gómez Román JJ, Garay GO, Saenz P, Escuredo K, Sanz Ibayondo C, Gutkind S, Junquera C, Simón L, Martínez A, Harduf H, Goldman S, Shalev E. Human uterine epithelial Fernández Luna JL, Val-Bernal JF. Plexin B1 is downregulated RL95-2 and HEC-1A cell-line adhesiveness: the role of plexin in renal cell carcinomas and modulates cell growth. Transl B1. Fertil Steril. 2007 Jun;87(6):1419-27 Res. 2008 Mar;151(3):134-40 Tong Y, Chugha P, Hota PK, Alviani RS, Li M, Tempel W, Swiercz JM, Worzfeld T, Offermanns S. ErbB-2 and met Shen L, Park HW, Buck M. Binding of Rac1, Rnd1, and RhoD reciprocally regulate cellular signaling via plexin-B1. J Biol to a novel Rho GTPase interaction motif destabilizes Chem. 2008 Jan 25;283(4):1893-901 dimerization of the plexin-B1 effector domain. J Biol Chem. 2007 Dec 21;282(51):37215-24 Tong Y, Hota PK, Hamaneh MB, Buck M. Insights into oncogenic mutations of plexin-B1 based on the solution Wong OG, Nitkunan T, Oinuma I, Zhou C, Blanc V, Brown RS, structure of the Rho GTPase binding domain. Structure. 2008 Bott SR, Nariculam J, Box G, Munson P, Constantinou J, Feb;16(2):246-58 Feneley MR, Klocker H, Eccles SA, Negishi M, Freeman A, Masters JR, Williamson M.
Load more

Recommended publications
  • G Protein Alpha 13 (GNA13) (NM 006572) Human Tagged ORF Clone Lentiviral Particle Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC207762L3V G protein alpha 13 (GNA13) (NM_006572) Human Tagged ORF Clone Lentiviral Particle Product data: Product Type: Lentiviral Particles Product Name: G protein alpha 13 (GNA13) (NM_006572) Human Tagged ORF Clone Lentiviral Particle Symbol: GNA13 Synonyms: G13 Vector: pLenti-C-Myc-DDK-P2A-Puro (PS100092) ACCN: NM_006572 ORF Size: 1131 bp ORF Nucleotide The ORF insert of this clone is exactly the same as(RC207762). Sequence: OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_006572.3 RefSeq Size: 4744 bp RefSeq ORF: 1134 bp Locus ID: 10672 UniProt ID: Q14344, A0A024R8M0 Domains: G-alpha Protein Families: Druggable Genome Protein Pathways: Long-term depression, Regulation of actin cytoskeleton, Vascular smooth muscle contraction MW: 44 kDa This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 G protein alpha 13 (GNA13) (NM_006572) Human Tagged ORF Clone Lentiviral Particle – RC207762L3V Gene Summary: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems (PubMed:15240885, PubMed:16787920, PubMed:16705036, PubMed:27084452).
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • ARHGEF12 Regulates Erythropoiesis and Is Involved in Erythroid Regeneration After Ferrata Storti Foundation Chemotherapy in Acute Lymphoblastic Leukemia Patients
    Red Cell Biology & its Disorders ARTICLE ARHGEF12 regulates erythropoiesis and is involved in erythroid regeneration after Ferrata Storti Foundation chemotherapy in acute lymphoblastic leukemia patients Yangyang Xie,1* Li Gao,2* Chunhui Xu,3 Liming Chu,3,7 Lei Gao,4 Ruichi Wu,1 Yu Liu,1 Ting Liu,1 Xiao-jian Sun,5 Ruibao Ren,5 Jingyan Tang,1 Yi Zheng,6 Yong Zhou7 and Shuhong Shen1 1Key Lab of Pediatrics Hematology/Oncology, Ministry of Health, Department of Haematologica 2020 Hematology/Oncology, Shanghai Children's Medical Center, Shanghai Jiao Tong University, Volume 105(4):925-936 Shanghai, China; 2Department of Hematology and Oncology, Children's Hospital of Soochow University, Suzhou, China; 3Shanghai Institute of Nutrition and Health, University of Chinese Academy of Sciences, Chinese Academy of Sciences, Shanghai, China; 4CAS Key Laboratory of Genome Sciences and Information, Beijing Institute of Genomics, Beijing, China; 5State Key Laboratory for Medical Genomics, Shanghai Institute of Hematology, Ruijin Hospital, Shanghai, China; 6Division of Experimental Hematology and Cancer Biology, Cincinnati Children's Hospital Research Foundation, Cincinnati, OH, USA and 7CAS Key Laboratory of Tissue Microenvironment and Tumor, Shanghai Institute of Nutrition and Health, University of Chinese Academy of Sciences, Chinese Academy of Sciences, Shanghai, China *YX and LG contributed equally to this work. ABSTRACT ematopoiesis is a finely regulated process in vertebrates under both homeostatic and stress conditions. By whole exome sequencing, we Correspondence: Hstudied the genomics of acute lymphoblastic leukemia (ALL) YI ZHENG patients who needed multiple red blood cell (RBC) transfusions after inten- [email protected] sive chemotherapy treatment. ARHGEF12, encoding a RhoA guanine YONG ZHOU nucleotide exchange factor, was found to be associated with chemothera- [email protected] py-induced anemia by genome-wide association study analyses.
    [Show full text]
  • G-Protein-Coupled Receptor Signaling and Polarized Actin Dynamics Drive
    RESEARCH ARTICLE elifesciences.org G-protein-coupled receptor signaling and polarized actin dynamics drive cell-in-cell invasion Vladimir Purvanov, Manuel Holst, Jameel Khan, Christian Baarlink, Robert Grosse* Institute of Pharmacology, University of Marburg, Marburg, Germany Abstract Homotypic or entotic cell-in-cell invasion is an integrin-independent process observed in carcinoma cells exposed during conditions of low adhesion such as in exudates of malignant disease. Although active cell-in-cell invasion depends on RhoA and actin, the precise mechanism as well as the underlying actin structures and assembly factors driving the process are unknown. Furthermore, whether specific cell surface receptors trigger entotic invasion in a signal-dependent fashion has not been investigated. In this study, we identify the G-protein-coupled LPA receptor 2 (LPAR2) as a signal transducer specifically required for the actively invading cell during entosis. We find that 12/13G and PDZ-RhoGEF are required for entotic invasion, which is driven by blebbing and a uropod-like actin structure at the rear of the invading cell. Finally, we provide evidence for an involvement of the RhoA-regulated formin Dia1 for entosis downstream of LPAR2. Thus, we delineate a signaling process that regulates actin dynamics during cell-in-cell invasion. DOI: 10.7554/eLife.02786.001 Introduction Entosis has been described as a specialized form of homotypic cell-in-cell invasion in which one cell actively crawls into another (Overholtzer et al., 2007). Frequently, this occurs between tumor cells such as breast, cervical, or colon carcinoma cells and can be triggered by matrix detachment (Overholtzer et al., 2007), suggesting that loss of integrin-mediated adhesion may promote cell-in-cell invasion.
    [Show full text]
  • Figure S1. Validation of the Expression Level of Degs Enriched in Cytokine‑Mediated Signaling and Immune Response
    Figure S1. Validation of the expression level of DEGs enriched in cytokine‑mediated signaling and immune response. Gene expression quantified by RT‑qPCR. DEGs, differentially expressed genes; RT‑qPCR, reverse‑transcription quantitative PCR. Figure S2. Validation of STAU1‑regulated AS events. IGV‑Sashimi plot revealed (A‑C) three A5SS AS events in three different genes. Reads distribution of each AS event was plotted in the left panel with the transcripts of each gene shown below. The sche‑ matic diagrams depict the structures of two AS events, AS1 (purple line) and AS2 (green line). The exon sequences are denoted by black boxes, the intron sequences by a horizontal line (right panel). RNA‑seq quantification and RT‑qPCR validation of ASEs are presented in the panels on the right. STAU1, double‑stranded RNA‑binding protein Staufen homolog 1; AS, alternative splicing; A5SS, alternative 5'splice site; RNA‑seq, RNA sequencing; RT‑qPCR, reverse‑transcription quantitative PCR. Error bars represent mean ± SEM. *P<0.05. Table SI. Primers used in gene validation experiments. IFIT2‑F CAGCCTACGGCAACTAAA IFIT2‑R GAGCCTTCTCAAAGCACA IFIT3‑F ACACCAAACAATGGCTAC IFIT3‑R TGGACAAACCCTCTAAAC OASL‑F AATGGTGACCGTGATGGG OASL‑R ACCTGAGGATGGAGCAGAG IFI27‑F TTCACTGCGGCGGGAATC IFI27‑R TGGCTGCTATGGAGGACGAG S1PR4‑F TGCTGAAGACGGTGCTGATG S1PR4‑R TGCGGAAGGAGTAGATGATGG CCL5‑F ACGACTGCTGGGTTGGAG CCL5‑R ACCCTGCTGCTTTGCCTA CCL2‑F CTAACCCAGAAACATCCAAT CCL2‑R GCTATGAGCAGCAGGCAC CD44‑F TGGAGGACAGAAAGCCAAGT CD44‑R TTCGCAATGAAACAATCAGTAG PLEKHG2‑M/As‑F CCAAAAGTAAGCCTGTCC PLEKHG2‑M‑R
    [Show full text]
  • Download (PDF)
    Table S1. Putative miR-322 target transcripts which is highly expressed in MGCs ________________________________________________________________________________ 0610037L13Rik, 1700037H04Rik, 2310061I04Rik, 2810006K23Rik, Abcc5, Abhd16a, Acbd3, Acox1, Acsbg1, Acsl4, Actr1a, Actr2, Adck5, Adh5, Adrbk1, Aff4, Agk, Ahcyl1, Akap11, Akap7, Akirin1, Alg3, Amfr, Ammecr1, Amotl2, Ankfy1, Ankhd1, Ankrd52, Ap2a1, Ap2b1, Ap3b1, Ap3d1, App, Arcn1, Arf3, Arfgap2, Arhgap12, Arhgap5, Arhgdia, Arhgef11, Arih1, Arl2, Arl3, Arl8b, Armcx6, Asap1, Asnsd1, Atf6, Atg13, Atg4b, Atp13a3, Atp5g1, Atp6v1a, Atxn2, Atxn7l3, Atxn7l3b, AW549877, B4galt1, B4galt7, Bace1, Bag5, Baiap2, Baz2a, BC037034, Bcl2l1, Bcl2l2, Bfar, Bmpr1a, Bptf, Brd2, Brd4, Brpf3, Btbd3, Btg2, Cab39, Cacna2d1, Calm1, Capns1, Caprin1, Capza2, Carm1, Caskin1, Cbfa2t3, Cbx5, Cbx6, Cc2d1b, Ccdc127, Ccdc6, Ccnd2, Ccnt2, Ccnyl1, Cd164, Cd2ap, Cdc25a, Cdc27, Cdc37l1, Cdc42se2, Cdca4, Cdipt, Cdk5rap3, Cdk8, Cdk9, Cdv3, Celf1, Cfl2, Chchd3, Chd6, Chmp1a, Chmp7, Chordc1, Chpf, Chpt1, Chst8, Chtf8, Cisd2, Clasrp, Clcn3, Clstn1, Cmpk1, Cnih2, Cnot1, Cnot2, Col4a3bp, Cope, Cops2, Cops7a, Cops7b, Copz1, Coq6, Cpd, Crebzf, Crim1, Crk, Crkl, Csde1, Cse1l, Ctnnb1, Cul4a, Cul4b, Cxx1a, Cxx1b, Cxx1c, D15Ertd621e, D2hgdh, Dcaf7, Dcbld2, Dcp1a, Dctn5, Ddost, Ddr1, Ddx39, Ddx3x, Ddx6, Dedd, Dhdds, Dhx16, Diap1, Dido1, Dlst, Dmtf1, Dnaja2, Dnajb14, Dnajb2, Dnajc1, Dnajc16, Dnajc25, Dph3, Dpm1, Dpp9, Dpy19l4, Dsel, Dtl, Dvl1, Dync1li2, Dynll2, Dynlt3, Dyrk1a, Dyrk1b, Ebna1bp2, Edc4, Eftud2, Egln2, Eif1a, Eif2b2, Eif2s1,
    [Show full text]
  • 4 Understanding the Role of GNA13 Deregulation in Lymphomagenesis
    Integrative Genomics Reveals a Role for GNA13 in Lymphomagenesis by Adrienne Greenough University Program in Genetics and Genomics Duke University Approved: ___________________________ Sandeep Dave, Supervisor ___________________________ Fred Dietrich ___________________________ Jack Keene ___________________________ Yuan Zhuang Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the University Program in Genetics and Genomics in the Graduate School of Duke University 2014 i v ABSTRACT Integrative Genomics Reveals a Role for GNA13 in Lymphomagenesis by Adrienne Greenough University Program in Genetics and Genomics Duke University Approved: ___________________________ Sandeep Dave, Supervisor ___________________________ Fred Dietrich ___________________________ Jack Keene ___________________________ Yuan Zhuang An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the University Program in Genetics and Genomics in the Graduate School of Duke University 2014 Copyright by Adrienne Greenough 2014 Abstract Lymphomas comprise a diverse group of malignancies derived from immune cells. High throughput sequencing has recently emerged as a powerful and versatile method for analysis of the cancer genome and transcriptome. As these data continue to emerge, the crucial work lies in sorting through the wealth of information to hone in on the critical aspects that will give us a better understanding of biology and new insight for how to treat disease. Finding the important signals within these large data sets is one of the major challenges of next generation sequencing. In this dissertation, I have developed several complementary strategies to describe the genetic underpinnings of lymphomas. I begin with developing a better method for RNA sequencing that enables strand-specific total RNA sequencing and alternative splicing profiling in the same analysis.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Gene Networks Activated by Specific Patterns of Action Potentials in Dorsal Root Ganglia Neurons Received: 10 August 2016 Philip R
    www.nature.com/scientificreports OPEN Gene networks activated by specific patterns of action potentials in dorsal root ganglia neurons Received: 10 August 2016 Philip R. Lee1,*, Jonathan E. Cohen1,*, Dumitru A. Iacobas2,3, Sanda Iacobas2 & Accepted: 23 January 2017 R. Douglas Fields1 Published: 03 March 2017 Gene regulatory networks underlie the long-term changes in cell specification, growth of synaptic connections, and adaptation that occur throughout neonatal and postnatal life. Here we show that the transcriptional response in neurons is exquisitely sensitive to the temporal nature of action potential firing patterns. Neurons were electrically stimulated with the same number of action potentials, but with different inter-burst intervals. We found that these subtle alterations in the timing of action potential firing differentially regulates hundreds of genes, across many functional categories, through the activation or repression of distinct transcriptional networks. Our results demonstrate that the transcriptional response in neurons to environmental stimuli, coded in the pattern of action potential firing, can be very sensitive to the temporal nature of action potential delivery rather than the intensity of stimulation or the total number of action potentials delivered. These data identify temporal kinetics of action potential firing as critical components regulating intracellular signalling pathways and gene expression in neurons to extracellular cues during early development and throughout life. Adaptation in the nervous system in response to external stimuli requires synthesis of new gene products in order to elicit long lasting changes in processes such as development, response to injury, learning, and memory1. Information in the environment is coded in the pattern of action-potential firing, therefore gene transcription must be regulated by the pattern of neuronal firing.
    [Show full text]
  • Suppl Fig 2 PB2 EUCOMM V3
    Maier et al. Supplementary material Semaphorin 4C and 4G are Plexin-B2 ligands required in cerebellar development 2 Supplementary tables 4 Supplementary figures 1 Supplementary Table 1. Exencephaly and postnatal survival of Sema4C mutants (on C57BL/6 background) Genotype Expected frequency Observed frequency Exencephaly Embryonic stages (n=47)* Wild type 25% 25% (12/47) 0% Sema4c+/- 50% 45% (21/47) 0% Sema4c-/- 25% 30% (14/47) 36% (5/14) Postnatal animals (n=417)* Wild type 25% 27% (113/417) Sema4c+/- 50% 61% (253/417) Sema4c-/- 25% 12% (51/417) * Offspring from Sema4c+/- x +/- matings. Embryonic stages scored at E15-E18, postnatal animals scored at P21. 2 Supplementary Table 2. Cerebellar phenotypes of Sema4C and Sema4G mutants (on CD-1 outbred background) Ectopic Fusion of Gap in Normal Gap in IGL granule cells lobules IGL of cerebellum of lobule II in molecular VIII/IX* lobule X Genotype n layer weak strong Wild type 17 100% 0% 0% 0% 0% 0% Sema4c+/- 11 70% 10% 0% 10% 0% 10% Sema4c-/- 10 20% 70% 0% 40% 0% 40% Sema4c+/-; Sema4g+/- 16 55% 18% 0% 18% 0% 18% Sema4c+/-; Sema4g-/- 13 40% 20% 0% 20% 0% 40% Sema4c-/-; Sema4g+/- 10 20% 30% 0% 50% 0% 60% Sema4c-/-; Sema4g-/- 11 0% 55% 0% 55% 55% 82% *Fusions of lobules VIII and IX were scored as “weak” when ectopic granule cells formed a band of cells at the fusion line, and as “strong” when a continuous bridge of granule cells connected the IGL of the two lobules. 3 Supplementary figure legends Maier et al. Suppl. Fig.
    [Show full text]
  • Lysophosphatidic Acid Activates Arf6 to Promote the Mesenchymal Malignancy of Renal Cancer
    ARTICLE Received 6 Jun 2015 | Accepted 6 Jan 2016 | Published 8 Feb 2016 DOI: 10.1038/ncomms10656 OPEN Lysophosphatidic acid activates Arf6 to promote the mesenchymal malignancy of renal cancer Shigeru Hashimoto1,*, Shuji Mikami2,*,w, Hirokazu Sugino1, Ayumu Yoshikawa1, Ari Hashimoto1, Yasuhito Onodera1, Shotaro Furukawa1,3, Haruka Handa1, Tsukasa Oikawa1, Yasunori Okada4, Mototsugu Oya5 & Hisataka Sabe1 Acquisition of mesenchymal properties by cancer cells is critical for their malignant behaviour, but regulators of the mesenchymal molecular machinery and how it is activated remain elusive. Here we show that clear cell renal cell carcinomas (ccRCCs) frequently utilize the Arf6-based mesenchymal pathway to promote invasion and metastasis, similar to breast cancers. In breast cancer cells, ligand-activated receptor tyrosine kinases employ GEP100 to activate Arf6, which then recruits AMAP1; and AMAP1 then binds to the mesenchymal- specific protein EPB41L5, which promotes epithelial–mesenchymal transition and focal adhesion dynamics. In renal cancer cells, lysophosphatidic acid (LPA) activates Arf6 via its G-protein-coupled receptors, in which GTP-Ga12 binds to EFA6. The Arf6-based pathway may also contribute to drug resistance. Our results identify a specific mesenchymal molecular machinery of primary ccRCCs, which is triggered by a product of autotaxin and it is associated with poor outcome of patients. 1 Department of Molecular Biology, Graduate School of Medicine, Hokkaido University, Sapporo 060-8638, Japan. 2 Division of Diagnostic Pathology, Keio University Hospital, Tokyo 160-0016, Japan. 3 Department of Gastroenterological Surgery II, Graduate School of Medicine, Hokkaido University, Sapporo 060-8638, Japan. 4 Department of Pathology, Keio University School of Medicine, Tokyo 160-0016, Japan.
    [Show full text]
  • G-Protein-Coupled Receptor Signaling and Polarized Actin Dynamics 2 Drive Cell-In-Cell Invasion
    1 G-protein-coupled receptor signaling and polarized actin dynamics 2 drive cell-in-cell invasion 3 Vladimir Purvanov , Manuel Holst, Jameel Khan, Christian Baarlink and Robert Grosse 4 Institute of Pharmacology, University of Marburg, 35043, Marburg, Germany 5 Correspondence: [email protected] 6 7 8 Homotypic or entotic cell-in-cell invasion is an integrin-independent process 9 observed in carcinoma cells exposed during conditions of low adhesion such as in 10 exudates of malignant disease. Although active cell-in-cell invasion depends on 11 RhoA and actin the precise mechanism as well as the underlying actin structures 12 and assembly factors driving the process are unknown. Furthermore, whether 13 specific cell surface receptors trigger entotic invasion in a signal-dependent fashion 14 has not been investigated. Here we identify the G-protein-coupled LPA receptor 2 15 (LPAR2) as a signal transducer specifically required for the actively invading cell 16 during entosis. We find that G12/13 and PDZ-RhoGEF are required for entotic 17 invasion, which is driven by blebbing and a uropod-like actin structure at the rear 18 of the invading cell. Finally, we provide evidence for an involvement of the RhoA- 19 regulated formin Dia1 for entosis downstream of LPAR2. Thus, we delineate a 20 signaling process that regulates actin dynamics during cell-in-cell invasion. 21 1 22 Entosis has been described as a specialized form of homotypic cell-in-cell invasion in 23 which one cell actively crawls into another (Overholtzer, Mailleux et al. 2007). 24 Frequently, this occurs between tumor cells such as breast, cervical or colon 25 carcinoma cells and can be triggered by matrix detachment (Overholtzer, Mailleux et 26 al.
    [Show full text]