DOCSLIB.ORG

Plexin-B1 Antagonists and Uses Thereof Plexin-B1 Antagonisten Und Verwendungen Davon Antagonistes De Plexine B1 Et Utilisations De Ceux-Ci

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Plexin-B1 Antagonists and Uses Thereof Plexin-B1 Antagonisten Und Verwendungen Davon Antagonistes De Plexine B1 Et Utilisations De Ceux-Ci (19) TZZ ¥¥ _T (11) EP 2 673 362 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12N 15/113 (2010.01) A61K 31/713 (2006.01) 07.06.2017 Bulletin 2017/23 A61P 35/04 (2006.01) A61K 39/395 (2006.01) C07K 16/30 (2006.01) (21) Application number: 12706220.6 (86) International application number: (22) Date of filing: 09.02.2012 PCT/EP2012/052238 (87) International publication number: WO 2012/107531 (16.08.2012 Gazette 2012/33) (54) PLEXIN-B1 ANTAGONISTS AND USES THEREOF PLEXIN-B1 ANTAGONISTEN UND VERWENDUNGEN DAVON ANTAGONISTES DE PLEXINE B1 ET UTILISATIONS DE CEUX-CI (84) Designated Contracting States: • DEAGLIO SILVIA ET AL: "CD38 and CD100 lead AL AT BE BG CH CY CZ DE DK EE ES FI FR GB a network of surface receptors relaying positive GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO signals for B-CLL growth and survival", BLOOD, PL PT RO RS SE SI SK SM TR AMERICAN SOCIETY OFHEMATOLOGY, US, vol. 105, no. 8, 1 April 2005 (2005-04-01) , pages (30) Priority: 09.02.2011 EP 11153784 3042-3050, XP002405817, ISSN: 0006-4971, DOI: 10.1182/BLOOD-2004-10-3873 (43) Date of publication of application: • SWIERCZ JAKUB M ET AL: "Semaphorin 4D 18.12.2013 Bulletin 2013/51 signaling requires the recruitment of phospholipase C gamma into the plexin-B1 (73) Proprietors: receptor complex.", MOLECULAR AND • Ruprecht-Karls-Universität Heidelberg CELLULAR BIOLOGY, vol. 29, no. 23, December 69117 Heidelberg (DE) 2009 (2009-12), pages 6321-6334, XP002640895, • Max-Planck-Gesellschaft zur Förderung ISSN: 1098-5549 cited in the application der Wissenschaften e.V. • SWIERCZ J M ET AL: "ErbB-2 and met 80539 München (DE) reciprocally regulate cellular signaling via plexin-B1", JOURNAL OF BIOLOGICAL (72) Inventors: CHEMISTRY, vol. 283, no. 4, 25 January 2008 • OFFERMANNS, Stefan (2008-01-25), pages 1893-1901, XP002640896, 61231 Bad Nauheim (DE) AMERICAN SOCIETY FOR BIOCHEMISTRY AND • SWIERCZ, Jakub MOLECULAR BIOLOGY INC. US DOI: 61231 Bad Nauheim (DE) 10.1074/JBC.M706822200 • WORZFELD, Thomas • YE SHUANGMEI ET AL: "Plexin-B1 silencing 61231 Bad Nauheim (DE) inhibits ovarian cancer cell migration and invasion.", BMC CANCER, vol. 10, 611, 2010, (74) Representative: Herzog, Fiesser & Partner pages 1-11, XP002640894, ISSN: 1471-2407 Patentanwälte PartG mbB • BERT J. C. JANSSEN ET AL: "Structural basis of Dudenstrasse 46 semaphorin-plexin signalling", NATURE, vol. 68167 Mannheim (DE) 467, no. 7319, 28 October 2010 (2010-10-28), pages 1118-1122, XP55025500, ISSN: 0028-0836, (56) References cited: DOI: 10.1038/nature09468 WO-A2-01/14420 WO-A2-03/031930 WO-A2-2006/110593 WO-A2-2010/129917 Note: Within nine months of the publication of the mention of the grant of the European patent in the European Patent Bulletin, any person may give notice to the European Patent Office of opposition to that patent, in accordance with the Implementing Regulations. Notice of opposition shall not be deemed to have been filed until the opposition fee has been paid. (Art. 99(1) European Patent Convention). EP 2 673 362 B1 Printed by Jouve, 75001 PARIS (FR) (Cont. next page) EP 2 673 362 B1 • MUTSUMI HIROTANI ET AL: "Interaction of • THOMAS WORZFELD ET AL: "Semaphorins and plexin-B1 with PDZ domain-containing Rho plexins as therapeutic targets", NATURE guanine nucleotide exchange factors", REVIEWS DRUG DISCOVERY, vol. 13, no. 8, 1 BIOCHEMICAL AND BIOPHYSICAL RESEARCH August 2014 (2014-08-01) , pages 603-621, COMMUNICATIONS, vol. 297, no. 1, 1 September XP055167541, ISSN: 1474-1776, DOI: 2002 (2002-09-01), pages 32-37, XP55025568, 10.1038/nrd4337 ISSN: 0006-291X, DOI: • I. Chabbert-De Ponnat ET AL: "Soluble CD100 10.1016/S0006-291X(02)02122-8 functions on human monocytes and immature • WORZFELD T ET AL: "HER2/ErbB2 signals dendritic cells require plexin C1 and plexin B1, through Plexin-B1 to promote breast cancer respectively", INTERNATIONAL IMMUNOLOGY., metastasis", NAUNYN-SCHMIEDEBERG’S vol. 17, no. 4, 3 March 2005 (2005-03-03), pages ARCHIVES OF PHARMACOLOGY, vol. 383, no. 439-447, XP055320934, GB ISSN: 0953-8178, DOI: Suppl. 1, March 2011 (2011-03), page 3, 10.1093/intimm/dxh224 XP002674682, & 77TH ANNUAL MEETING ON • Kazunori Yukawa ET AL: "Sema4A induces cell GERMAN-SOCIETY-FOR-EXPERIMENTAL-AND- morphological changes through B-type CLINIC AL-P plexin-mediatedsignaling", International Journal HARMACOLOGY-AND-TOXICOLOGY; of Molecular Medicine, 1 February 2010 FRANKFURT, GERMANY; MARCH 30 -APRIL 01, (2010-02-01), pages 225-230, XP055320937, DOI: 2011 10.3892/ijmm_00000334 Retrieved from the • SWIERCZ JAKUB M ET AL: Internet: "Plexin-B1/RhoGEF-mediated RhoA activation URL:https://www.spandidos-publications.com involves the receptor tyrosine kinase ErbB-2.", /ijmm/25/2/225/download [retrieved on THE JOURNAL OF CELL BIOLOGY, vol. 165, no. 2015-08-11] 6, 21 June 2004 (2004-06-21) , pages 869-880, • S. Artigiani: "Functional Regulation of XP002640897, ISSN: 0021-9525 cited in the Semaphorin Receptors by Proprotein application Convertases", Journal of Biological Chemistry, • SUN QIANGMING ET AL: "Hypoxia-inducible vol. 278, no. 12, 17 January 2003 (2003-01-17), factor-1-mediated regulation of semaphorin 4D pages 10094-10101, XP055320938, US ISSN: affects tumor growth and vascularity.", THE 0021-9258, DOI: 10.1074/jbc.M210156200 JOURNAL OF BIOLOGICAL CHEMISTRY, vol. • SREEHARSHA GURRAPU ET AL: 284, no. 46, 13 November 2009 (2009-11-13), "Transmembrane semaphorins: Multimodal pages 32066-32074, XP002640898, ISSN: signaling cues in development and cancer", 1083-351X CELL ADHESION AND MIGRATION, 13 June 2016 • THOMAS WORZFELD ET AL: "ErbB-2 signals (2016-06-13), pages 1-17, XP055320941, US ISSN: through Plexin-B1 to promote breast cancer 1933-6918, DOI: 10.1080/19336918.2016.1197479 metastasis", J CLIN INVEST, vol. 122, no. 4, 1 • BATTISTINI CHIARA ET AL: "Transmembrane March 2012 (2012-03-01) , pages 1296-1305, semaphorins, forward and reverse signaling: XP55025554, DOI: 10.1172/JCI60568 have a look both ways", CMLS CELLULAR AND • Kumanogoh ET AL: "Identification of CD72 as a MOLECULAR LIFE SCIENCES, BIRKHAUSER lymphocyte receptor for the class IV semaphorin VERLAG, HEIDELBERG, DE, vol. 73, no. 8, 21 CD100: a novel mechanism for regulating B cell January 2016 (2016-01-21), pages 1609-1622, signaling.", Immunity, vol. 13, no. 5, 1 November XP035801849, ISSN: 1420-682X, DOI: 2000 (2000-11-01), pages 621-631, XP055039972, 10.1007/S00018-016-2137-X [retrieved on ISSN: 1074-7613, DOI: 2016-01-21] 10.1016/S1074-7613(00)00062-5 • DEBORAH A. WITHERDEN ET AL: "The CD100 Remarks: Receptor Interacts with Its Plexin B2 Ligand to Thefile contains technical information submitted after Regulate Epidermal [gamma][delta] T Cell the application was filed and not included in this Function", IMMUNITY., vol. 37, no. 2, 1 August specification 2012 (2012-08-01) , pages 314-325, XP055306038, US ISSN: 1074-7613, DOI: 10.1016/j.immuni.2012.05.026 • KENTA MASUDA ET AL: "Sema4D stimulates axonal outgrowth of embryonic DRG sensory neurones", GENES TO CELLS, WILEY-BLACKWELL PUBLISHING LTD, GB, vol. 9, no. 9, 1 September 2004 (2004-09-01), pages 821-829, XP008144069, ISSN: 1356-9597, DOI: 10.1111/J.1365-2443.2004.00766.X [retrieved on 2004-08-25] 2 EP 2 673 362 B1 Description [0001] The present invention concerns the field of cancer therapy. In particular, it relates to an antagonist of plexin- B1 which prevents the interaction of the plexin-B1 with ErbB-2 for use as a medicament, wherein said antagonist is an 5 antibody specifically binding to the extracellular domain of the plexin-B1 polypeptide and inhibiting binding of said plexin- B1 polypeptide to ErbB-2, but not inhibiting the binding of the ligand Sema4D to its receptor plexin-B1 polypeptide. The invention pertains also to an antagonist of plexin-B1 which prevents the binding of the ligand Sema4D to its receptor plexin-B1 polypeptide for use as a medicament, wherein said antagonist is an antibody specifically binding to the extra- cellular domain of the plexin-B1 polypeptide and inhibiting the binding of the ligand Sema4D to its receptor plexin-B1 10 polypeptide, wherein the antibody i) shows specific binding in Western blot and immunoblot at a concentration of 10 microgram/ml; ii) is able to precipitate plexin-B1 overexpressed in HEK cells and native plexin-B1 in MCF-7 and BT-474 cells; iii) is able to co-immunoprecipitate plexin-B1/ErbB-2 complex in MCF-7, BT-474 and SK-OV-3 cells; 15 iv) does not block basal RhoA activity in BT-474 and SK-OV-3 cells, but blocks Sema4D-dependent RhoA activation in MCF-7 cells, due to the competitive inhibition of binding of the ligand Sema4D to the receptor plexin-B1; v) blocks R-Ras deactivation via plexin-B1 after stimulation with Sema4D in MCF-7 cells; and vi) binds specifically to plexin-B1, and exhibits no cross-reactivity to other plexin-family members. 20 [0002] Described is a method for identifying an antagonist which prevents the interaction of a B-type plexin with ErbB- 2. Finally, a polynucleotide encoding a B-type plexin polypeptide which lacks a functional intracellular domain and the said polypeptide is described. [0003] Breast cancer is the most common primary malignancy in women. About 30% of all breast cancers overexpress the receptor tyrosine kinase ErbB-2 (Slamon 1989, Science 244:707-712). These tumors are characterized by aggressive 25 behavior and poor prognosis. A plethora of evidence including transgenic mice which overexpress ErbB-2 in their mam- mary glands and subsequently develop breast cancer directly implicates ErbB-2 signalling in mammary oncogenesis (Muller 1988, Cell 54:105-15; Guy 1992, Proc Natl Acad Sci U S A 89:10578-82).
Load more

Recommended publications
  • Neural Map Formation in the Mouse Olfactory System
    Cell. Mol. Life Sci. (2014) 71:3049–3057 DOI 10.1007/s00018-014-1597-0 Cellular and Molecular Life Sciences REVIEW Neural map formation in the mouse olfactory system Haruki Takeuchi · Hitoshi Sakano Received: 25 November 2013 / Revised: 26 February 2014 / Accepted: 27 February 2014 / Published online: 18 March 2014 © The Author(s) 2014. This article is published with open access at Springerlink.com Abstract In the mouse olfactory system, odorants are Introduction detected by ~1,000 different odorant receptors (ORs) pro- duced by olfactory sensory neurons (OSNs). Each OSN In the mouse, various odorants are detected with approxi- expresses only one functional OR species, which is referred mately 1,000 different odorant receptors (ORs) expressed to as the “one neuron–one receptor” rule. Furthermore, OSN in the olfactory sensory neurons (OSNs) [1]. Each OSN in axons bearing the same OR converge to a specific projection the olfactory epithelium (OE) expresses only one functional site in the olfactory bulb (OB) forming a glomerular struc- OR gene in a mono-allelic manner [2]. Furthermore, OSNs ture, i.e., the “one glomerulus–one receptor” rule. Based on expressing the same OR converge their axons to a spe- these basic rules, binding signals of odorants detected by cific pair of glomeruli at stereotyped locations in the olfac- OSNs are converted to topographic information of activated tory bulb (OB) (Fig. 1a, b) [3]. Thus, the odor information glomeruli in the OB. During development, the glomerular detected in the OE is topographically represented as the pat- map is formed by the combination of two genetically pro- tern of activated glomeruli in the OB (Fig.
    [Show full text]
  • PLXNB1 (Plexin
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Gene Section Mini Review PLXNB1 (plexin B1) José Javier Gómez-Román, Montserrat Nicolas Martínez, Servando Lazuén Fernández, José Fernando Val-Bernal Department of Anatomical Pathology, Marques de Valdecilla University Hospital, Medical Faculty, University of Cantabria, Santander, Spain (JJGR, MN, SL, JFVB) Published in Atlas Database: March 2009 Online updated version: http://AtlasGeneticsOncology.org/Genes/PLXNB1ID43413ch3p21.html DOI: 10.4267/2042/44702 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2010 Atlas of Genetics and Cytogenetics in Oncology and Haematology Identity Pseudogene No. Other names: KIAA0407; MGC149167; OTTHUMP00000164806; PLEXIN-B1; PLXN5; SEP Protein HGNC (Hugo): PLXNB1 Location: 3p21.31 Description Local order: The Plexin B1 gene is located between 2135 Amino acids (AA). Plexins are receptors for axon FBXW12 and CCDC51 genes. molecular guidance molecules semaphorins. Plexin signalling is important in pathfinding and patterning of both neurons and developing blood vessels. Plexin-B1 is a surface cell receptor. When it binds to its ligand SEMA4D it activates several pathways by binding of cytoplasmic ligands, like RHOA activation and subsequent changes of the actin cytoskeleton, axon guidance, invasive growth and cell migration. It monomers and heterodimers with PLXNB2 after proteolytic processing. Binds RAC1 that has been activated by GTP binding. It binds PLXNA1 and by similarity ARHGEF11, Note ARHGEF12, ERBB2, MET, MST1R, RND1, NRP1 Size: 26,200 bases. and NRP2. Orientation: minus strand. This family features the C-terminal regions of various plexins. The cytoplasmic region, which has been called DNA/RNA a SEX domain in some members of this family is involved in downstream signalling pathways, by Description interaction with proteins such as Rac1, RhoD, Rnd1 and other plexins.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Figure S1. Validation of the Expression Level of Degs Enriched in Cytokine‑Mediated Signaling and Immune Response
    Figure S1. Validation of the expression level of DEGs enriched in cytokine‑mediated signaling and immune response. Gene expression quantified by RT‑qPCR. DEGs, differentially expressed genes; RT‑qPCR, reverse‑transcription quantitative PCR. Figure S2. Validation of STAU1‑regulated AS events. IGV‑Sashimi plot revealed (A‑C) three A5SS AS events in three different genes. Reads distribution of each AS event was plotted in the left panel with the transcripts of each gene shown below. The sche‑ matic diagrams depict the structures of two AS events, AS1 (purple line) and AS2 (green line). The exon sequences are denoted by black boxes, the intron sequences by a horizontal line (right panel). RNA‑seq quantification and RT‑qPCR validation of ASEs are presented in the panels on the right. STAU1, double‑stranded RNA‑binding protein Staufen homolog 1; AS, alternative splicing; A5SS, alternative 5'splice site; RNA‑seq, RNA sequencing; RT‑qPCR, reverse‑transcription quantitative PCR. Error bars represent mean ± SEM. *P<0.05. Table SI. Primers used in gene validation experiments. IFIT2‑F CAGCCTACGGCAACTAAA IFIT2‑R GAGCCTTCTCAAAGCACA IFIT3‑F ACACCAAACAATGGCTAC IFIT3‑R TGGACAAACCCTCTAAAC OASL‑F AATGGTGACCGTGATGGG OASL‑R ACCTGAGGATGGAGCAGAG IFI27‑F TTCACTGCGGCGGGAATC IFI27‑R TGGCTGCTATGGAGGACGAG S1PR4‑F TGCTGAAGACGGTGCTGATG S1PR4‑R TGCGGAAGGAGTAGATGATGG CCL5‑F ACGACTGCTGGGTTGGAG CCL5‑R ACCCTGCTGCTTTGCCTA CCL2‑F CTAACCCAGAAACATCCAAT CCL2‑R GCTATGAGCAGCAGGCAC CD44‑F TGGAGGACAGAAAGCCAAGT CD44‑R TTCGCAATGAAACAATCAGTAG PLEKHG2‑M/As‑F CCAAAAGTAAGCCTGTCC PLEKHG2‑M‑R
    [Show full text]
  • The Involvement of Rho Gtpases in Plexin Mediated Signal Transduction
    The Involvement of Rho GTPases in Plexin Mediated Signal Transduction Laura Turner A thesis submitted to the University of London for the degree of Doctor of Philosophy November 2003 MRC Laboratory for Molecular Cell Biology University of London Gower Street London WCIE 6BT ProQuest Number: U642461 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest. ProQuest U642461 Published by ProQuest LLC(2015). Copyright of the Dissertation is held by the Author. All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code. Microform Edition © ProQuest LLC. ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 ABSTRACT Plexins are a family of conserved transmembrane proteins. Together with neuropilins, they act as receptors for the semaphorin family of growth cone guidance molecules. Whilst it is clear that guidance involves cytoskeletal changes, little is known of the mechanisms via which plexins regulate growth cone morphology. Hints suggesting the involvement of Rho GTPases stem from observations of localised actin rearrangements elicited by plexins and semaphorins. This feeling is consolidated by the demonstration of the Rac dependent nature of plexin induced cellular responses. To investigate plexin mediated signal transduction, a heterologous assay for semaphorin induced collapse has been developed and characterised. Studies using jasplakinolide indicate that Sema3A-Fc induced collapse requires actin dissassembly.
    [Show full text]
  • Spatial and Temporal Second Messenger Codes for Growth Cone Turning
    Spatial and temporal second messenger codes for growth cone turning Xavier Nicol1,2, Kwan Pyo Hong, and Nicholas C. Spitzer Neurobiology Section, Division of Biological Sciences, Kavli Institute for Brain and Mind, University of California at San Diego, La Jolla, CA 92093 Edited* by Lynn T. Landmesser, Case Western Reserve University, Cleveland, OH, and approved July 5, 2011 (received for review January 6, 2011) Cyclic AMP (cAMP) and calcium are ubiquitous, interdependent se- generated in growth cones in response to Netrin-1, the principal cond messengers that regulate a wide range of cellular processes. axon guidance molecule required for attraction of commissural During development of neuronal networks they are critical for the axons by the spinal floor plate. We report a major difference in first step of circuit formation, transducing signals required for axon cAMP/calcium interplay between filopodia and the growth cone fi pathfinding. Surprisingly, the spatial and temporal cAMP and cal- center. Optogenetic elevation of cAMP in lopodia but not in fi cium codes used by axon guidance molecules are unknown. Here, growth cone centers drives growth cone attraction. Both lopo- we identify characteristics of cAMP and calcium transients gener- dial and growth cone center signaling pathways are mediated by ated in growth cones during Netrin-1–dependent axon guidance. In activation of the same Netrin-1 receptor, Deleted in Colorectal Cancer (DCC). We show that cAMP dynamics are also essential filopodia, Netrin-1–dependent Deleted in Colorectal Cancer (DCC) for midline crossing of commissural axons in vivo. receptor activation induces a transient increase in cAMP that causes a brief increase in calcium transient frequency.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Regulation of Axonal Development by Natriuretic Peptide Hormones
    Regulation of axonal development by natriuretic peptide hormones Zhen Zhao and Le Ma1 Zilkha Neurogenetic Institute, Department of Cell and Neurobiology, Keck School of Medicine, Neuroscience Graduate Program, University of Southern California, 1501 San Pablo Street, Los Angeles, CA 90089 Edited by Cornelia I. Bargmann, The Rockefeller University, New York, NY, and approved August 28, 2009 (received for review June 24, 2009) Natriuretic peptides (NPs) are a family of cardiac- and vascular- entially binds to Npr2, could be the environmental cue respon- derived hormones that are well known for regulating blood sible for generating bifurcated axonal branches. These results pressure, but their expression in the brain poses an intriguing yet suggest an intriguing hypothesis that NPs provide a general unanswered question concerning their roles in the nervous system. extracellular mechanism to regulate different processes, such as Here, we report several unique activities of these hormones in branching and guidance, during axonal development via the regulating axonal development of dorsal root ganglion (DRG) regulation of cGMP signaling. neurons in the spinal cord. First, the C-type NP (CNP) is expressed To test this hypothesis, we first examined a spontaneous in a restricted area of the dorsal spinal cord and provides a cue that mouse mutant with a mutation in the Nppc gene encoding the is necessary for bifurcation of central sensory afferents. Second, in CNP precursor and found a similar bifurcation defect during the culture of embryonic DRG neurons, CNP stimulates branch sensory afferent development. In addition, we conducted a formation, induces axon outgrowth, and attracts growth cones. systematic analysis of the functions of NPs in axonal develop- Furthermore, these activities are mediated by cyclic guanosine- ment by using the primary culture of DRG neurons.
    [Show full text]
  • Suppl Fig 2 PB2 EUCOMM V3
    Maier et al. Supplementary material Semaphorin 4C and 4G are Plexin-B2 ligands required in cerebellar development 2 Supplementary tables 4 Supplementary figures 1 Supplementary Table 1. Exencephaly and postnatal survival of Sema4C mutants (on C57BL/6 background) Genotype Expected frequency Observed frequency Exencephaly Embryonic stages (n=47)* Wild type 25% 25% (12/47) 0% Sema4c+/- 50% 45% (21/47) 0% Sema4c-/- 25% 30% (14/47) 36% (5/14) Postnatal animals (n=417)* Wild type 25% 27% (113/417) Sema4c+/- 50% 61% (253/417) Sema4c-/- 25% 12% (51/417) * Offspring from Sema4c+/- x +/- matings. Embryonic stages scored at E15-E18, postnatal animals scored at P21. 2 Supplementary Table 2. Cerebellar phenotypes of Sema4C and Sema4G mutants (on CD-1 outbred background) Ectopic Fusion of Gap in Normal Gap in IGL granule cells lobules IGL of cerebellum of lobule II in molecular VIII/IX* lobule X Genotype n layer weak strong Wild type 17 100% 0% 0% 0% 0% 0% Sema4c+/- 11 70% 10% 0% 10% 0% 10% Sema4c-/- 10 20% 70% 0% 40% 0% 40% Sema4c+/-; Sema4g+/- 16 55% 18% 0% 18% 0% 18% Sema4c+/-; Sema4g-/- 13 40% 20% 0% 20% 0% 40% Sema4c-/-; Sema4g+/- 10 20% 30% 0% 50% 0% 60% Sema4c-/-; Sema4g-/- 11 0% 55% 0% 55% 55% 82% *Fusions of lobules VIII and IX were scored as “weak” when ectopic granule cells formed a band of cells at the fusion line, and as “strong” when a continuous bridge of granule cells connected the IGL of the two lobules. 3 Supplementary figure legends Maier et al. Suppl. Fig.
    [Show full text]
  • Sema4a Induces Cell Morphological Changes Through B-Type Plexin-Mediated Signaling
    225-230.qxd 18/12/2009 10:31 Ì Page 225 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 25: 225-230, 2010 225 Sema4A induces cell morphological changes through B-type plexin-mediated signaling KAZUNORI YUKAWA1, TETSUJI TANAKA2, KENJI YOSHIDA1, NORIKO TAKEUCHI1, TAKUJI ITO1, HYOTA TAKAMATSU3, HITOSHI KIKUTANI4 and ATSUSHI KUMANOGOH3 1Department of Physiology, Faculty of Pharmacy, Meijo University, 150 Yagotoyama, Tempaku-ku, Nagoya 468-8503; 2Department of Obstetrics and Gynecology, Wakayama Medical University, 811-1 Kimiidera, Wakayama 641-8509; Department of 3Immunopathology; 4Molecular Immunology, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamada-oka, Suita, Osaka 565-0871, Japan Received September 14, 2009; Accepted November 6, 2009 DOI: 10.3892/ijmm_00000334 Abstract. Semaphorins are a family of secreted and membrane- compared with the control plasmid. Sema4A thus induces bound proteins known as axonal pathfinders. Sema4A, a growth cone collapse through the down-regulation of R-Ras member of class 4 semaphorins, induces growth cone collapse activity in mouse hippocampal neurons. of hippocampal neurons. The binding of Sema4A to growth cones indicates the presence of receptors transmitting signals Introduction through the intracellular effectors to induce growth cone collapse in hippocampal neurons. Transfection experiments Semaphorins compose a large family of phylogenetically of the candidate receptor genes into COS-7 cells conserved soluble and transmembrane molecules, which are demonstrated that Sema4A binds to axonal guidance further divided into eight classes (1). Semaphorins were receptors Plexin-B1, -B2 and -B3. To identify the functional originally identified as repulsive axonal guidance cues which Sema4A receptor and the signal transduction machinery, induce growth cone collapse in developing neurons (2-4).
    [Show full text]
  • The Human Gene Connectome As a Map of Short Cuts for Morbid Allele Discovery
    The human gene connectome as a map of short cuts for morbid allele discovery Yuval Itana,1, Shen-Ying Zhanga,b, Guillaume Vogta,b, Avinash Abhyankara, Melina Hermana, Patrick Nitschkec, Dror Friedd, Lluis Quintana-Murcie, Laurent Abela,b, and Jean-Laurent Casanovaa,b,f aSt. Giles Laboratory of Human Genetics of Infectious Diseases, Rockefeller Branch, The Rockefeller University, New York, NY 10065; bLaboratory of Human Genetics of Infectious Diseases, Necker Branch, Paris Descartes University, Institut National de la Santé et de la Recherche Médicale U980, Necker Medical School, 75015 Paris, France; cPlateforme Bioinformatique, Université Paris Descartes, 75116 Paris, France; dDepartment of Computer Science, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel; eUnit of Human Evolutionary Genetics, Centre National de la Recherche Scientifique, Unité de Recherche Associée 3012, Institut Pasteur, F-75015 Paris, France; and fPediatric Immunology-Hematology Unit, Necker Hospital for Sick Children, 75015 Paris, France Edited* by Bruce Beutler, University of Texas Southwestern Medical Center, Dallas, TX, and approved February 15, 2013 (received for review October 19, 2012) High-throughput genomic data reveal thousands of gene variants to detect a single mutated gene, with the other polymorphic genes per patient, and it is often difficult to determine which of these being of less interest. This goes some way to explaining why, variants underlies disease in a given individual. However, at the despite the abundance of NGS data, the discovery of disease- population level, there may be some degree of phenotypic homo- causing alleles from such data remains somewhat limited. geneity, with alterations of specific physiological pathways under- We developed the human gene connectome (HGC) to over- come this problem.
    [Show full text]
  • Regulatory T Cells Modulate Granulomatous Inflammation in an HLA-DP2 Transgenic Murine Model of Beryllium-Induced Disease
    Regulatory T cells modulate granulomatous inflammation in an HLA-DP2 transgenic murine model of beryllium-induced disease Douglas G. Macka, Michael T. Faltaa, Amy S. McKeea, Allison K. Martina, Philip L. Simoniana, Frances Crawfordb,c, Terry Gordond, Robert R. Mercere, Mark D. Hoovere, Philippa Marrackb,c, John W. Kapplerb,c,1, Rubin M. Tudera, and Andrew P. Fontenota,b,1 Departments of aMedicine and bImmunology, University of Colorado Anschutz Medical Campus, Aurora, CO 80045; dDepartment of Environmental Medicine, New York University, Tuxedo, NY 10987; eNational Institute for Occupational Safety and Health, Centers for Disease Control and Prevention, Morgantown, WV 26505; and cHoward Hughes Medical Institute, National Jewish Health, Denver, CO 80206 Contributed by John W. Kappler, May 2, 2014 (sent for review March 10, 2014) Susceptibility to chronic beryllium disease (CBD) is linked to certain a determination of the factors that contribute to their presence in HLA-DP molecules, including HLA-DP2. To elucidate the molecular the lung. basis of this association, we exposed mice transgenic (Tg) for HLA- Here, we exposed mice transgenic (Tg) for HLA-DP2 (the most DP2 to beryllium oxide (BeO) via oropharyngeal aspiration. As prevalent βGlu69-containing molecule) to Be oxide (BeO), a form opposed to WT mice, BeO-exposed HLA-DP2 Tg mice developed of the metal that is used in the workplace. BeO-exposed HLA- mononuclear infiltrates in a peribronchovascular distribution that DP2–expressing mice developed mononuclear infiltrates in the + were composed of CD4 T cells and included regulatory T (Treg) cells. lung, a Be-specific adaptive immune response in lung and spleen, Beryllium-responsive, HLA-DP2–restricted CD4+ T cells expressing andanexpansionofTreg cells in the lung.
    [Show full text]