Protein Name Accession Number Alternate ID Molecular
Total Page：16
File Type：pdf, Size：1020Kb
Load more
Recommended publications
-
KO Kidney.Xlsx
Supplemental Table 18: Dietary Impact on the CGL KO Kidney Sulfhydrome DR/AL Accession Molecular Cysteine Spectral Protein Name Number Alternate ID Weight Residues Count Ratio P‐value Ig gamma‐2A chain C region, A allele P01863 (+1) Ighg 36 kDa 10 C 5.952 0.03767 Heterogeneous nuclear ribonucleoprotein M Q9D0E1 (+1) Hnrnpm 78 kDa 6 C 5.000 0.00595 Phospholipase D3 O35405 Pld3 54 kDa 8 C 4.167 0.04761 Ig kappa chain V‐V region L7 (Fragment) P01642 Gm10881 13 kDa 2 C 2.857 0.01232 UPF0160 protein MYG1, mitochondrial Q9JK81 Myg1 43 kDa 7 C 2.333 0.01613 Copper homeostasis protein cutC homolog Q9D8X1 Cutc 29 kDa 7 C 10.333 0.16419 Corticosteroid‐binding globulin Q06770 Serpina6 45 kDa 3 C 10.333 0.16419 28S ribosomal protein S22, mitochondrial Q9CXW2 Mrps22 41 kDa 2 C 7.333 0.3739 Isoform 3 of Agrin A2ASQ1‐3 Agrn 198 kDa 2 C 7.333 0.3739 3‐oxoacyl‐[acyl‐carrier‐protein] synthase, mitochondrial Q9D404 Oxsm 49 kDa 11 C 7.333 0.3739 Cordon‐bleu protein‐like 1 Q3UMF0 (+3)Cobll1 137 kDa 10 C 5.833 0.10658 ADP‐sugar pyrophosphatase Q9JKX6 Nudt5 24 kDa 5 C 4.167 0.15819 Complement C4‐B P01029 C4b 193 kDa 29 C 3.381 0.23959 Protein‐glutamine gamma‐glutamyltransferase 2 P21981 Tgm2 77 kDa 20 C 3.381 0.23959 Isochorismatase domain‐containing protein 1 Q91V64 Isoc1 32 kDa 5 C 3.333 0.10588 Serpin B8 O08800 Serpinb8 42 kDa 11 C 2.903 0.06902 Heterogeneous nuclear ribonucleoprotein A0 Q9CX86 Hnrnpa0 31 kDa 3 C 2.667 0.5461 Proteasome subunit beta type‐8 P28063 Psmb8 30 kDa 5 C 2.583 0.36848 Ig kappa chain V‐V region MOPC 149 P01636 12 kDa 2 C 2.583 0.36848 -
FKBP2 Antibody Cat
FKBP2 Antibody Cat. No.: 23-414 FKBP2 Antibody Western blot analysis of extracts of various cell lines, using FKBP2 antibody (23-414) at 1:1000 dilution. Secondary antibody: HRP Goat Anti-Rabbit IgG (H+L) at 1:10000 dilution. Lysates/proteins: 25ug per lane. Blocking buffer: 3% nonfat dry milk in TBST. Detection: ECL Basic Kit. Exposure time: 90s. Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human, Mouse, Rat Recombinant fusion protein containing a sequence corresponding to amino acids 22-142 IMMUNOGEN: of human FKBP2 (NP_004461.2). TESTED APPLICATIONS: IF, IHC, WB October 2, 2021 1 https://www.prosci-inc.com/fkbp2-antibody-23-414.html WB: ,1:500 - 1:2000 APPLICATIONS: IHC: ,1:100 - 1:200 IF: ,1:50 - 1:200 POSITIVE CONTROL: 1) MCF7 2) SKOV3 3) Jurkat 4) HeLa 5) Mouse thymus 6) Mouse liver PREDICTED MOLECULAR Observed: 14kDa WEIGHT: Properties PURIFICATION: Affinity purification CLONALITY: Polyclonal ISOTYPE: IgG CONJUGATE: Unconjugated PHYSICAL STATE: Liquid BUFFER: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. STORAGE CONDITIONS: Store at -20˚C. Avoid freeze / thaw cycles. Additional Info OFFICIAL SYMBOL: FKBP2 FKBP-13, FKBP13, PPIase, peptidyl-prolyl cis-trans isomerase FKBP2, 13 kDa FK506-binding protein, 13 kDa FKBP, FK506 binding protein 2, 13kDa, FK506-binding protein 2, PPIase ALTERNATE NAMES: FKBP2, epididymis secretory sperm binding protein, immunophilin FKBP13, proline isomerase, rapamycin-binding protein, rotamase GENE ID: 2286 USER NOTE: Optimal dilutions for each application to be determined by the researcher. Background and References October 2, 2021 2 https://www.prosci-inc.com/fkbp2-antibody-23-414.html The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. -
Prostate Cancer Prognostics Using Biomarkers Prostatakrebsprognostik Mittels Biomarkern Prognostic Du Cancer De La Prostate Au Moyen De Biomarqueurs
(19) TZZ Z_T (11) EP 2 885 640 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: G01N 33/574 (2006.01) C12Q 1/68 (2018.01) 18.07.2018 Bulletin 2018/29 C40B 30/04 (2006.01) (21) Application number: 13829137.2 (86) International application number: PCT/US2013/055429 (22) Date of filing: 16.08.2013 (87) International publication number: WO 2014/028884 (20.02.2014 Gazette 2014/08) (54) PROSTATE CANCER PROGNOSTICS USING BIOMARKERS PROSTATAKREBSPROGNOSTIK MITTELS BIOMARKERN PROGNOSTIC DU CANCER DE LA PROSTATE AU MOYEN DE BIOMARQUEURS (84) Designated Contracting States: • GHADESSI, Mercedeh AL AT BE BG CH CY CZ DE DK EE ES FI FR GB New Westminster, British Columbia V3M 6E2 (CA) GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO • JENKINS, Robert, B. PL PT RO RS SE SI SK SM TR Rochester, Minnesota 55902 (US) • VERGARA CORREA, Ismael A. (30) Priority: 16.08.2012 US 201261684066 P Bundoora, Victoria 3083 (AU) 13.02.2013 US 201361764365 P 14.03.2013 US 201361783124 P (74) Representative: Cornish, Kristina Victoria Joy et al Kilburn & Strode LLP (43) Date of publication of application: Lacon London 24.06.2015 Bulletin 2015/26 84 Theobalds Road London WC1X 8NL (GB) (73) Proprietors: • Genomedx Biosciences, Inc. (56) References cited: Vancouver BC V6B 2W9 (CA) WO-A1-2009/143603 WO-A1-2013/090620 • MAYO FOUNDATION FOR MEDICAL WO-A2-2006/091776 WO-A2-2006/110264 EDUCATION AND RESEARCH WO-A2-2007/056049 US-A1- 2006 134 663 Rochester, MN 55905 (US) US-A1- 2007 037 165 US-A1- 2007 065 827 US-A1- -
Naringenin Regulates FKBP4/NR3C1/TMEM173 Signaling Pathway in Autophagy and Proliferation of Breast Cancer and Tumor-Infltrating Dendritic Cell Maturation
Naringenin Regulates FKBP4/NR3C1/TMEM173 Signaling Pathway in Autophagy and Proliferation of Breast Cancer and Tumor-Inltrating Dendritic Cell Maturation Hanchu Xiong ( [email protected] ) Zhejiang Provincial People's Hospital https://orcid.org/0000-0001-6075-6895 Zihan Chen First Hospital of Zhejiang Province: Zhejiang University School of Medicine First Aliated Hospital Baihua Lin Zhejiang Provincial People's Hospital Cong Chen Zhejiang University School of Medicine Sir Run Run Shaw Hospital Zhaoqing Li Zhejiang University School of Medicine Sir Run Run Shaw Hospital Yongshi Jia Zhejiang Provincial People's Hospital Linbo Wang Zhejiang University School of Medicine Sir Run Run Shaw Hospital Jichun Zhou Zhejiang University School of Medicine Sir Run Run Shaw Hospital Research Keywords: FKBP4, TMEM173, Autophagy, Exosome, Dendritic cell, Breast cancer Posted Date: July 7th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-659646/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/38 Abstract Background TMEM173 is a pattern recognition receptor detecting cytoplasmic nucleic acids and transmits cGAS related signals that activate host innate immune responses. It has also been found to be involved in tumor immunity and tumorigenesis. Methods Bc-GenExMiner, PROMO and STRING database were used for analyzing clinical features and interplays of FKBP4, TMEM173 and NR3C1. Transient transfection, western blotting, quantitative real-time PCR, luciferase reporter assay, immunouorescence and nuclear and cytoplasmic fractionation were used for regulation of FKBP4, TMEM173 and NR3C1. Both knockdown and overexpression of FKBP4, TMEM173 and NR3C1 were used to analyze effects on autophagy and proliferation of breast cancer (BC) cells. -
Figure S1. Quality Control Validation of MS Data. (A‑C) Mass Error Distribution of All Peptides Identified in the Acetylome
Figure S1. Quality control validation of MS data. (A‑C) Mass error distribution of all peptides identified in the acetylome, succi- nylome and quantitative proteome, respectively. (D‑F) Length distribution of peptides identified in the acetylome, succinylome and quantitative proteome, respectively. Figure S2. Comparison of modification level between breast cancer tissue and normal tissue. Comparison of acetylation level (A) and succinylation level (B) between breast cancer tissue and normal tissue. Data are medians and were analyzed using Wilcoxon Signed Rank Test. **P<0.01. Table SI. Protein sites whose acetylation and succinylation levels were both significantly upregulated in breast cancer tissues (fold change ≥1.5 compared with normal tissues). Protein ID Protein name Modification site P54868 HMCS2 310K Q15063 POSTN 549K Q99715 COCA1 1601K P51572 BAP31 72K P07237 PDLA1 328K Q06830 PRDX1 192K P48735 IDHP 180K P30101 PDIA3 417K P0DMV9 HS71B 526K Q01995 TAGL 21K P06748 NPM1 27K Q00325 MPCP 209K P00488 F13A 69K P02545 LMNA 260K P08133 ANXA6 478K P02452 CO1A1 751K Table SII. Protein sites whose acetylation and succinylation levels were both significantly downregulated in breast cancer tissues (fold change ≥1.5 compared with normal tissues). Protein ID Protein name Modification site RET4 P02753 30K PSG2 P07585 142K HBA P69905 12K IGKC P01834 80K HBA P69905 8K Table SIII. All proteins whose expression level were significantly upregulated in breast cancer tissues (fold change ≥1.5 compared with normal tissues). Protein ID Protein description -
Type of the Paper (Article
Supplementary Material A Proteomics Study on the Mechanism of Nutmeg-induced Hepatotoxicity Wei Xia 1, †, Zhipeng Cao 1, †, Xiaoyu Zhang 1 and Lina Gao 1,* 1 School of Forensic Medicine, China Medical University, Shenyang 110122, P. R. China; lessen- [email protected] (W.X.); [email protected] (Z.C.); [email protected] (X.Z.) † The authors contributed equally to this work. * Correspondence: [email protected] Figure S1. Table S1. Peptide fraction separation liquid chromatography elution gradient table. Time (min) Flow rate (mL/min) Mobile phase A (%) Mobile phase B (%) 0 1 97 3 10 1 95 5 30 1 80 20 48 1 60 40 50 1 50 50 53 1 30 70 54 1 0 100 1 Table 2. Liquid chromatography elution gradient table. Time (min) Flow rate (nL/min) Mobile phase A (%) Mobile phase B (%) 0 600 94 6 2 600 83 17 82 600 60 40 84 600 50 50 85 600 45 55 90 600 0 100 Table S3. The analysis parameter of Proteome Discoverer 2.2. Item Value Type of Quantification Reporter Quantification (TMT) Enzyme Trypsin Max.Missed Cleavage Sites 2 Precursor Mass Tolerance 10 ppm Fragment Mass Tolerance 0.02 Da Dynamic Modification Oxidation/+15.995 Da (M) and TMT /+229.163 Da (K,Y) N-Terminal Modification Acetyl/+42.011 Da (N-Terminal) and TMT /+229.163 Da (N-Terminal) Static Modification Carbamidomethyl/+57.021 Da (C) 2 Table S4. The DEPs between the low-dose group and the control group. Protein Gene Fold Change P value Trend mRNA H2-K1 0.380 0.010 down Glutamine synthetase 0.426 0.022 down Annexin Anxa6 0.447 0.032 down mRNA H2-D1 0.467 0.002 down Ribokinase Rbks 0.487 0.000 -
De Novo Phosphatidylcholine Synthesis in Intestinal Lipid Metabolism and Disease
De Novo Phosphatidylcholine Synthesis in Intestinal Lipid Metabolism and Disease by John Paul Kennelly A thesis submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Nutrition and Metabolism Department of Agricultural, Food and Nutritional Science University of Alberta © John Paul Kennelly, 2018 Abstract Phosphatidylcholine (PC), the most abundant phospholipid in eukaryotic cells, is an important component of cellular membranes and lipoprotein particles. The enzyme CTP: phosphocholine cytidylyltransferase (CT) regulates de novo PC synthesis in response to changes in membrane lipid composition in all nucleated mammalian cells. The aim of this thesis was to determine the role that CTα plays in metabolic function and immune function in the murine intestinal epithelium. Mice with intestinal epithelial cell-specific deletion of CTα (CTαIKO mice) were generated. When fed a chow diet, CTαIKO mice showed normal lipid absorption after an oil gavage despite a ~30% decrease in small intestinal PC concentrations relative to control mice. These data suggest that biliary PC can fully support chylomicron output under these conditions. However, when acutely fed a high-fat diet, CTαIKO mice showed impaired intestinal fatty acid and cholesterol uptake from the intestinal lumen into enterocytes, resulting in lower postprandial plasma triglyceride concentrations. Impaired intestinal fatty acid uptake in CTαIKO mice was linked to disruption of intestinal membrane lipid transporters (Cd36, Slc27a4 and Npc1l1) and higher postprandial plasma Glucagon-like Peptide 1 and Peptide YY. Unexpectedly, there was a shift in expression of bile acid transporters to the proximal small intestine of CTαIKO mice, which was associated with enhanced biliary bile acid, PC and cholesterol output relative to control mice. -
Aldolase C (C-Terminus Specific) Data Sheet
Aldolase C (C-terminus Specific) Data Sheet Catalog Number: MO22157 Host: Mouse Product Type: Monoclonal IgG1 Species Human, horse, cow, pig, Affinity Purified Antibody Reactivity: chicken, rat, mouse Immunogen Sequence: C-terminal sequence Format: Liquid, 100 ul aliquot KYEGSGEDGGAAAQSLYIANHAY Concentration: 1 mg/ml HGNC name for this protein is ALDOC Applications: Immunofluorescence/Immunocytochemistry: 1:500-1:1,000 Immunohistochemistry: 1: 500-1:1,000 Western Blot: 1:1,000 Dilutions listed as a recommendation. Optimal dilution should be determined by investigator. Storage: Antibody can also be aliquoted and stored frozen at -20° C to -70° C in a manual defrost freezer for six months without detectable loss of activity. The antibody can be stored at 2° - 8° C for 1 month without detectable loss of activity. Avoid repeated freeze-thaw cycles. Application Notes Description/Data: Aldolase A is generally considered to be a muscle enzyme. Northern analysis of cultured cells suggests that it is present in both neurons and glia. Aldolase C shares 81% amino acid identity with aldolase A and 70% identity with aldolase B. Earlier studies using isozyme-specific antibodies report its location in gray matter astrocytes and cells of the pia mater. In situ hybridization of mouse central nervous system using isozyme-specific probes revealed that aldolase A and C are expressed in complementary cell types: aldolase A mRNA is found in neurons; aldolase C message is detected in astrocytes, some cells of the pia mater, and Purkinje cells. Aldolase C can in some situations be used as an astrocyte marker. However Purkinje cells of the cerebellum contain high levels of the enzyme, so the enzyme is not totally astrocyte specific. -
Human FKBP2 Natural ORF Mammalian Expression Plasmid
Human FKBP2 natural ORF mammalian expression plasmid Catalog Number: HG12433-UT General Information Plasmid Resuspension protocol Gene : FK506 binding protein 2, 13kDa 1.Centrifuge at 5,000×g for 5 min. Official Symbol : FKBP2 2.Carefully open the tube and add 100 l of sterile water to Synonym : PPIase, FKBP-13 dissolve the DNA. Source : Human 3.Close the tube and incubate for 10 minutes at room temperature. cDNA Size: 429bp 4.Briefly vortex the tube and then do a quick spin to concentrate RefSeq : BC003384 the liquid at the bottom. Speed is less than 5000×g. Plasmid pCMV3-FKBP2 5.Store the plasmid at -20 ℃. Description Lot : Please refer to the label on the tube The plasmid is ready for: Sequence Description : • Restriction enzyme digestion Identical with the Gene Bank Ref. ID sequence. • PCR amplification Restriction site: HindIII + XbaI (6.1kb + 0.43kb) • E. coli transformation Vector : pCMV3-untagged • DNA sequencing Shipping carrier : Each tube contains approximately 10 μg of lyophilized plasmid. E.coli strains for transformation (recommended but not limited) Storage : Most commercially available competent cells are appropriate for The lyophilized plasmid can be stored at ambient temperature for three months. the plasmid, e.g. TOP10, DH5α and TOP10F´. Quality control : The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. Sequencing primer list : pCMV3-F： 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ pcDNA3-R ： 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ Or Forward T7 ： 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH ： 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier. -
Datasheet: VPA00226
Datasheet: VPA00226 Description: RABBIT ANTI ALDOA Specificity: ALDOA Format: Purified Product Type: PrecisionAb™ Polyclonal Isotype: Polyclonal IgG Quantity: 100 µl Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio-rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Western Blotting 1/1000 PrecisionAb antibodies have been extensively validated for the western blot application. The antibody has been validated at the suggested dilution. Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Further optimization may be required dependant on sample type. Target Species Human Species Cross Reacts with: Mouse, Rat Reactivity N.B. Antibody reactivity and working conditions may vary between species. Product Form Purified IgG - liquid Preparation Rabbit Ig fraction prepared by ammonium sulphate precipitation Buffer Solution Phosphate buffered saline Preservative 0.09% Sodium Azide (NaN3) Stabilisers Immunogen KLH conjugated synthetic peptide between 66-95 amino acids from the N-terminal region of human ALDOA External Database UniProt: Links P04075 Related reagents Entrez Gene: 226 ALDOA Related reagents Page 1 of 2 Synonyms ALDA Specificity Rabbit anti Human ALDOA antibody recognizes fructose-bisphosphate aldolase A, also known as epididymis secretory sperm binding protein Li 87p, fructose-1,6-bisphosphate triosephosphate-lyase, lung cancer antigen NY-LU-1 and muscle-type aldolase. Encoded by the ALDOA gene, fructose-bisphosphate aldolase A is a glycolytic enzyme that catalyzes the reversible conversion of fructose-1,6-bisphosphate to glyceraldehyde 3-phosphate and dihydroxyacetone phosphate. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Tumor Growth and Cancer Treatment
Molecular Cochaperones: Tumor Growth and Cancer Treatment The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Calderwood, Stuart K. 2013. “Molecular Cochaperones: Tumor Growth and Cancer Treatment.” Scientifica 2013 (1): 217513. doi:10.1155/2013/217513. http://dx.doi.org/10.1155/2013/217513. Published Version doi:10.1155/2013/217513 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:11879066 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Hindawi Publishing Corporation Scientifica Volume 2013, Article ID 217513, 13 pages http://dx.doi.org/10.1155/2013/217513 Review Article Molecular Cochaperones: Tumor Growth and Cancer Treatment Stuart K. Calderwood Division of Molecular and Cellular Biology, Department of Radiation Oncology, Beth Israel Deaconess Medical Center, Harvard Medical School, 99 Brookline Avenue, Boston, MA 02215, USA Correspondence should be addressed to Stuart K. Calderwood; [email protected] Received 11 February 2013; Accepted 1 April 2013 Academic Editors: M. H. Manjili and Y. Oji Copyright © 2013 Stuart K. Calderwood. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Molecular chaperones play important roles in all cellular organisms by maintaining the proteome in an optimally folded state. They appear to be at a premium in cancer cells whose evolution along the malignant pathways requires the fostering of cohorts of mutant proteins that are employed to overcome tumor suppressive regulation.