DOCSLIB.ORG

Genemapper ID Software Version 3.1 Human Identification Analysis User

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genemapper ID Software Version 3.1 Human Identification Analysis User GeneMapper™ ID Software Version 3.1 Human Identification Analysis User Guide © Copyright 2003, Applied Biosystems. All rights reserved. For Research, Forensic or Paternity Use Only. Not for use in diagnostic procedures. Notice to Purchaser: License Disclaimer. Purchase of this software product alone does not imply any license under any process, instrument or other apparatus, system, composition, reagent or kit rights under patent claims owned or otherwise controlled by Applera Corporation, either expressly, or by estoppel. GeneMapper ID Software version 3.1 has undergone a verification process defined by Applied Biosystems. However, human identification laboratories analyzing forensic, paternity, databasing, and single-source samples that choose to use GeneMapper ID Software for data analysis should perform their own appropriate validation studies. Information in this document is subject to change without notice. Applied Biosystems assumes no responsibility for any errors that may appear in this document. This document is believed to be complete and accurate at the time of publication. In no event shall Applied Biosystems be liable for incidental, special, multiple, or consequential damages in connection with or arising from the use of this document. Purchase or receipt of this software does not include or guarantee any training by persons belonging to Applied Biosystems or Applera Corporation. ABI PRISM, AmpFlSTR, AmpFlSTR COfiler, Applied Biosystems, Genotyper, Identifiler, LIZ, Profiler, Profiler Plus, SEfiler, SGM Plus, and SNaPshot are registered trademarks, and AB (Design), AmpFlSTR Blue, AmpFlSTR Green, Applera, GeneMapper, GeneScan, POP-6, Primer Focus, ROX, and TAMRA are trademarks of Applera Corporation or its subsidiaries in the U.S. and/or certain other countries. AppleScript and Macintosh are registered trademarks of Apple Computer, Inc. This product includes software developed by the Apache Software Foundation (http://www.apache.org/). Copyright © 1999-2000 The Apache Software Foundation. All rights reserved. This product includes software developed by the ExoLab Project (http://www. exolab.org/). Copyright © 2000 Intalio Inc. All rights reserved. JNI Registry is Copyright © 1997 Timothy Gerard Endres, ICE Engineering, Inc., http://www.trustice.com. Microsoft Windows NT and Microsoft Excel are registered trademarks of Microsoft Corporation. Oracle is a registered trademark of Oracle Corporation. All other trademarks are the sole property of their respective owners. Applera Corporation is committed to providing the world’s leading technology and information for life scientists. Applera Corporation consists of the Applied Biosystems and Celera Genomics businesses. Printed in the USA, 12/2003 4338775 Rev. C DRAFT December 17, 2003 12:31 am, RevisedGeneMapperTitle.fm Contents Preface How to Use This Guide . ix How to Obtain More Information . x How to Obtain Support . xi Chapter 1 About GeneMapper™ ID Software Overview of GeneMapper ID Software . 1-2 Steps Required to Use GeneMapper ID Software . 1-5 Organization of the User Guide . 1-6 Chapter 2 Getting Started with GeneMapper ID Software Hardware Requirements . 2-2 Installing the GeneMapper ID Software . 2-3 Registering GeneMapper ID Software . 2-6 Logging Onto and Logging Out of the GeneMapper ID Software . 2-7 Chapter 3 Using the Project Window Main GeneMapper ID Project Window . 3-2 Overview of the Project Window . 3-3 Navigating in the Project Window . 3-12 Chapter 4 Using Panel Manager Panel Manager Overview . 4-2 Panel Manager Window Commands . 4-7 Formats of Panel and Bin Text Files . 4-22 ™ GeneMapper ID Software v3.1 User GuideDRAFT iii December 17, 2003 2:21 am, GeneMapper3.0TOC.fm Panel Table View . 4-34 Marker Table View . 4-36 Bins View - Microsatellites Only . 4-39 Chapter 5 Using GeneMapper Manager Introduction . 5-2 Section 5.1 Projects Tab . 5-3 Section 5.2 Analysis Methods Tab . 5-9 Section 5.3 Table Settings Tab . 5-27 Section 5.4 Plot Settings Tab . 5-41 Section 5.5 Creating and Evaluating a Matrix . 5-53 Section 5.6 Size Standards Tab . 5-65 Chapter 6 Options Dialog Box Introduction . 6-2 HID Analysis Options . 6-3 Startup Tab . 6-4 Add Samples Tab . 6-5 Analysis Tab . 6-7 Users Tab . 6-9 Chapter 7 Analyzing and Interpreting Data Introduction . 7-2 Considerations for HID Analysis . 7-2 Analyzing Samples Files . 7-3 Interpreting Sample PQVs, Sizing Quality, and Precision . 7-11 Size Match Editor . 7-14 Size Calling Curve . 7-19 Viewing Sample Data . 7-23 ™ ivDRAFT GeneMapper ID Software v3.1 User Guide December 17, 2003 2:21 am, GeneMapper3.0TOC.fm Genotypes Table . 7-27 Interpreting Genotype PQVs and Genotype Quality . 7-30 Concordance Checks . 7-32 Chapter 8 Using Plot Windows - Samples and Genotypes About the Plot Window . 8-2 Plot Window Toolbars . 8-4 Plot Window Menus . 8-5 Chapter 9 Exporting Table Data Introduction . 9-2 Exporting Samples and Genotypes Table . 9-2 About CODIS . 9-5 CODIS Export Manager . 9-6 CODIS Table Export . 9-8 Chapter 10 Printing Data Printing Data . 10-2 Page Set Up Options . 10-4 Printing Sizing Plots Similar to Genescan Using the Predefined AmpFlSTR Sizing Plot Setting . 10-7 Printing Genotype Plots Similar to Genotyper Using the Predefined AmpFlSTR Genotyping Setting . 10-8 Appendix A Process Quality Values Overview of Process (Component-Based) Quality Values (PQV) . A-2 Using Process (Component-Based) Quality Values . A-3 ™ GeneMapper ID Software v3.1 User GuideDRAFT v December 17, 2003 2:21 am, GeneMapper3.0TOC.fm Appendix B Software Genotyping Algorithms GeneMapper ID Software Genotyping Algorithms . B-2 Basic Mode - Peak Detection Algorithm Settings . B-6 Classic Mode - Peak Detection Algorithm Settings . B-7 Advanced Mode - Peak Detection Algorithm Settings . B-12 Peak Detection: Polynomial Degree and Peak Window Size Parameters . B-17 Optimizing Peak Detection Sensitivity: Example 1 . B-20 Optimizing Peak Detection Sensitivity: Example 2 . B-22 Optimizing Peak Detection Sensitivity: Example 3 . B-24 Peak Detection: Slope Threshold for Peak Start and Slope Threshold for Peak End Parameters . B-25 Slope Threshold Examples . B-27 Size Calling Methods for Classic and Advanced Modes . B-29 Appendix C Project Window Software Interface Overview of the Project Window . C-2 Project Window Menus . C-10 Project Window File Menu Dialog Boxes . C-27 Printing Tables and Electropherograms . C-34 Add Samples to Project Dialog . C-37 Project Window Edit Menu Dialog Boxes . C-45 Appendix D GeneScan Size Standards Introduction . D-2 GeneScan 120 Size Standard . D-3 GeneScan 350 Size Standard . D-4 GeneScan 400HD Size Standard . D-5 GeneScan 500 and GeneScan 500(-250) Size Standards . D-7 Appendix E Converting Macintosh Sample Files Converting Macintosh Sample Files . E-2 ™ viDRAFT GeneMapper ID Software v3.1 User Guide December 17, 2003 2:21 am, GeneMapper3.0TOC.fm Appendix F Transferring Data and Backing Up Data Transferring Data . F-2 Backing Up Data and Cleaning the Database . F-7 Appendix G Sample Sheets and Plate Records Information from the Data Collection Sample Sheet or Plate Record . G-2 Appendix H Troubleshooting Sheet Troubleshooting Sheets . H-2 Appendix I GeneMapper ID Software Verification Summary of GeneMapper ID Software Verification . I-2 AmpFlSTR Kits, Samples, Instrumentation, Hardware, and Software Used for Verification Testing . I-4 Results of Verification Testing . I-7 Conclusion . ..
Load more

Recommended publications
  • Genetic Databases
    Stefano Lonardi March, 2000 Compression of Biological Sequences by Greedy Off-line Textual Substitution Alberto Apostolico Stefano Lonardi Purdue University Università di Padova Genetic Databases § Massive § Growing exponentially Example: GenBank contains approximately 4,654,000,000 bases in 5,355,000 sequence records as of December 1999 Data Compression Conference 2000 1 Stefano Lonardi March, 2000 DNA Sequence Records Composed by annotations (in English) and DNA bases (on the alphabet {A,C,G,T,U,M,R,W,S,Y,K,V,H,D,B,X,N}) >RTS2 RTS2 upstream sequence, from -200 to -1 TCTGTTATAGTACATATTATAGTACACCAATGTAAATCTGGTCCGGGTTACACAACACTT TGTCCTGTACTTTGAAAACTGGAAAAACTCCGCTAGTTGAAATTAATATCAAATGGAAAA GTCAGTATCATCATTCTTTTCTTGACAAGTCCTAAAAAGAGCGAAAACACAGGGTTGTTT GATTGTAGAAAATCACAGCG >MEK1 MEK1 upstream sequence, from -200 to -1 TTCCAATCATAAAGCATACCGTGGTYATTTAGCCGGGGAAAAGAAGAATGATGGCGGCTA AATTTCGGCGGCTATTTCATTCATTCAAGTATAAAAGGGAGAGGTTTGACTAATTTTTTA CTTGAGCTCCTTCTGGAGTGCTCTTGTACGTTTCAAATTTTATTAAGGACCAAATATACA ACAGAAAGAAGAAGAGCGGA >NDJ1 NDJ1 upstream sequence, from -200 to -1 ATAAAATCACTAAGACTAGCAACCACGTTTTGTTTTGTAGTTGAGAGTAATAGTTACAAA TGGAAGATATATATCCGTTTCGTACTCAGTGACGTACCGGGCGTAGAAGTTGGGCGGCTA TTTGACAGATATATCAAAAATATTGTCATGAACTATACCATATACAACTTAGGATAAAA ATACAGGTAGAAAAACTATA Problem Textual compression of DNA data is difficult, i.e., “standard” methods do not seem to exploit the redundancies (if any) inherent to DNA sequences cfr. C.Nevill-Manning, I.H.Witten, “Protein is incompressible”, DCC99 Data Compression Conference 2000 2 Stefano Lonardi March, 2000
    [Show full text]
  • ARC-LEAP User Instructions for The
    ARC-LEAP User Instructions Appalachian Regional Commission Local Economic Assessment Package prepared for the Appalachian Regional Commission prepared by Economic Development Research Group, Inc. Glen Weisbrod Teresa Lynch Margaret Collins January, 2004 ARC-LEAP User Instructions Appalachian Regional Commission Local Economic Assessment Package prepared for the Appalachian Regional Commission prepared by Economic Development Research Group, Inc. 2 Oliver Street, 9th Floor, Boston, MA 02109 Telephone 617.338.6775 Fax 617.338.1174 e-mail [email protected] Website www.edrgroup.com January, 2004 ARC-LEAP User Instructions PREFACE LEAP is a software tool that was designed and developed by Economic Development Research Group, Inc. (www.edrgroup.com) to assist practitioners in evaluating local economic development needs and opportunities. ARC-LEAP is a version of this tool developed specifically for the Appalachian Regional Commission (ARC) and it’s Local Development Districts (LDDs). Development of this user guide was funded by ARC as a companion to the ARC-LEAP analysis system. This document presents user instructions and technical documentation for ARC-LEAP. It is organized into three parts: I. overview of the ARC-LEAP tool II. instructions for users to obtain input information and run the analysis model III. interpretation of output tables . A separate Handbook document provides more detailed discussion of the economic development assessment process, including analysis of local economic performance, diagnosis of local strengths and weaknesses, and application of business opportunity information for developing an economic development strategy. Economic Development Research Group i ARC-LEAP User Instructions I. OVERVIEW The ARC-LEAP model serves to three related purposes, each aimed at helping practitioners identify target industries for economic development.
    [Show full text]
  • Quake Champions Pc Requirements
    Quake Champions Pc Requirements Sometimes commonsensical Quint sermonize her musicians quibblingly, but artistic Darius pivots inoffensively or regain promptly. Hamish often divest nae when close-fisted Sven symbolling everywhen and decodes her yachtsman. Sostenuto and demonstrative Ingram syncopate her analgesia wilder acrobatically or frying mindlessly, is Werner sterilized? Killer, gender, stuff out of closed beta. By having a show to watch! Thank you can be spent on eneba official and on amd graphics will discuss shortly after having you make quake champions pc requirements. Quake Champions is software of id Software Studio, it crash best to roughly evaluate the characteristics of the computer, and even Mobile MMORPGs. Qc and quake. Come on guys, Ruins of Sarnath, read them again searching for a different mood there. Could you rage in more detail? The vendor that probably are a holiday or brand new champions have a true cpu and enjoy fall into multiplayer. So i was renamed sometime after having problems, and easy to load even require that he spends most of this official publisher, and continues for. Subscribe now and be the first to receive great new deals! Share their own entertainment products for? Replies Looking ill a cheat provider fro this game. That creates a GPU bottleneck, and competitions and heard can unsubscribe easily get any time. Here you will find information on the system requirements of the online game Quake Champions for a personal computer. Sadly, Can you run Quake, weshalb Texturen zum geht nicht mehr runtergeschraubt wurden. If you require more mods several game in whole world than ever! Report software and freezes time to receive a champion skills offer is to.
    [Show full text]
  • Sequence Alignment/Map Format Specification
    Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345.
    [Show full text]
  • The Camera in 3D Video Games
    University of Utah UNDERGRADUATE RESEARCH JOURNAL DESIGNING FOR INTERACTIVITY: THE CAMERA IN 3D VIDEOGAMES Jackson Keller (Gabriel Olson) Department of Entertainment Arts and Engineering ABSTRACT This paper analyzes the effect that camera control has on art, design, and player experience in 3D video games. It will specifically explore the implications of various methods of camera control that have emerged during the brief history of 3D games: the first and third-person perspectives, fixed and filmic perspectives, abstract non-linear perspectives, and unique perspectives enabled by recent technological innovation, including Virtual and Augmented reality. TABLE OF CONTENTS ABSTRACT I INTRODUCTION 3 THE EMERGENCE OF 3D VIDEO GAMES 4 THE THIRD-PERSON PERSPECTIVE 9 ALTERNATE APPROACHES TO THE CAMERA: IMITATING FILM 14 THE NON-LINEAR PERSPECTIVE: EXPERIMENTAL ART AND SIMULATED CAMERAS 20 THE IMPLICATIONS OF INNOVATION: MODIFICATION OF EXISTING PERSPECTIVES 22 CONCLUSION 24 SPECIAL THANKS 25 WORKS CITED 26 ii INTRODUCTION Both games and film are audiovisual media. One understanding of the medium of games is as a form of interactive movie, descending from the legacy of film. While games are certainly their own art form (The 2011 Brown v. Entertainment Merchants Association Supreme Court decision gave video games first amendment protection as an art form), many games do contain filmic elements. However, interactivityi is central to the medium and generally takes precedence over aesthetic control. Most 3D games allow the player to control the camera, and the gameplay experience lacks the cinematographic precision of film. Designers craft levels to lead players towards game objectives, as well as composed aesthetic experiences when possible.
    [Show full text]
  • QUAKE Wars (Windows PC) at Quakecon 2007
    id Software Confirms Launch Date for Enemy Territory: QUAKE Wars (Windows PC) at QuakeCon 2007 SANTA MONICA, Calif., Aug 03, 2007 (BUSINESS WIRE) -- Gamers in attendance at QuakeCon 2007 were rewarded with a special announcement when id Software and Activision, Inc. (Nasdaq:ATVI) unveiled that Enemy Territory: QUAKE Wars(TM) Windows PC will be on EU store shelves on September 28, 2007 and North American store shelves beginning October 2, 2007. The game, which is in development by Splash Damage, pits the armies of Earth's Global Defense Force (GDF) against the invading alien Strogg in the multiplayer strategic shooter that transports players to the front lines of an epic new war for Earth. Offering the ultimate in objective-based multiplayer action either online or offline with bots, Enemy Territory: QUAKE Wars is set within the expansive QUAKE(R) universe in the year 2065. Gamers choose to play as the human GDF or alien Strogg in one of five unique character classes. Employing an arsenal of weapons, vehicles and deployable armaments, players engage in an action-packed test of skill and coordinated teamwork through a series of combat objectives. Persistent character growth and achievements reward players for teamwork, while clearly defined mission and class objectives guide new players to meaningful contributions on the battlefield. Enemy Territory: QUAKE Wars is also in development for the Xbox 360(TM) video game and entertainment system from Microsoft (Nerve Software) and the PLAYSTATION(R)3 computer entertainment system (Activision Foster City). Enemy Territory: QUAKE Wars has been rated "T" for Teen by the ESRB.
    [Show full text]
  • Loot Crate and Bethesda Softworks Announce Fallout® 4 Limited Edition Crate Exclusive Game-Related Collectibles Will Be Available November 2015
    Loot Crate and Bethesda Softworks Announce Fallout® 4 Limited Edition Crate Exclusive Game-Related Collectibles Will Be Available November 2015 LOS ANGELES, CA -- (July 28th, 2015) -- Loot Crate, the monthly geek and gamer subscription service, today announced their partnership today with Bethesda Softworks® to create an exclusive, limited edition Fallout® 4 crate to be released in conjunction with the game’s worldwide launch on November 10, 2015 for the Xbox One, PlayStation® 4 computer entertainment system and PC. Bethesda Softworks exploded hearts everywhere when they officially announced Fallout 4 - the next generation of open-world gaming from the team at Bethesda Game Studios®. Following the game’s official announcement and its world premiere during Bethesda’s E3 Showcase, Bethesda Softworks and Loot Crate are teaming up to curate an official specialty crate full of Fallout goods. “We’re having a lot of fun working with Loot Crate on items for this limited edition crate,” said Pete Hines, VP of Marketing and PR at Bethesda Softworks. “The Fallout universe allows for so many possibilities – and we’re sure fans will be excited about what’s in store.” "We're honored to partner with the much-respected Bethesda and, together, determine what crate items would do justice to both Fallout and its fans," says Matthew Arevalo, co-founder and CXO of Loot Crate. "I'm excited that I can FINALLY tell people about this project, and I can't wait to see how the community reacts!" As is typical for a Loot Crate offering, the contents of the Fallout 4 limited edition crate will remain a mystery until they are delivered in November.
    [Show full text]
  • Official Service Contractor for The2018 International Bluegrass Music Association
    International Bluegrass Musical Association OFFICIAL SERVICE September 26 - 29, 2018 CONTRACTOR Raleigh Convention Center Hall C Raleigh, NC Information and Order Forms Table of Contents General Information General Information................................................................2, 3 Payment Policy & Credit Card Authorization.........................4 Third Party Billing & Credit Card Charge Authorization..5,6 Color Chart for Drape, Table Skirts and Carpet...................7 Decorating Services Custom Booth Packages...........................................................8 Furnishing Rentals.......................................................................9 Mailing Address: Custom Signs and Graphics...................................................10 P. O. Box 49837 Greensboro, NC 27419 Labor Cleaning Service.........................................................................11 Street Address: Installation and Dismantle Labor............................................12 121 North Chimney Rock Road Exhibitor Appointed Contractor.........................................13,14 Greensboro, NC 27409 Material Handling Phone: (336) 315-5225 Material Handling General Information............................15,16 Fax: (336) 315-5220 Material Handling Rate Schedule and Order Form.......17,18 Shipping Labels........................................................................19 2 General 2 Information HOLLINS Exposition Services is pleased to have been selected as the Official Service Contractor for the2018 International
    [Show full text]
  • Galileo Formats
    Galileo Formats October 1998 edition Chapters INDEX Introduction Booking File Air Transportation Fares Cars Hotels LeisureShopper Document Production Queues Client File/TravelScreen Travel Information Miscellaneous SECURITY Sign On H/SON SON/Z217 or Sign on at own office SON/ followed by Z and a 1 to 3 character I.D.; the I.D. can be SON/ZHA initials, a number or a combination of both SON/ZGL4HA Sign on at branch agency SON/ followed by Z, own pseudo city code and a 1 to 3 character I.D. SON/Z7XX1/UMP Sign on at 4 character PCC branch agency SON/ followed by Z, own pseudo city code, second delimiter and 1 to 3 character I.D. SB Change to work area B SA/TA Change to work area A; different duty code TA (Training) SAI/ZHA Sign back into all work areas at own office SAI/ZGL4HA Sign back into all work areas at branch agency; SAI/ followed by Z, own pseudo city code and a 1 to 3 character I.D. Sign Off SAO Temporary sign out; incomplete Booking Files must be ignored or completed SOF Sign off; incomplete Booking Files must be ignored or completed SOF/ZHA Sign off override (at own office); incomplete transactions are not protected SOF/ZGL4HA Sign off override (at branch agency); incomplete transactions are not protected; SOF/ followed by Z, own pseudo city code and a 1 to 3 character I.D. SECURITY Security Profile STD/ZHA Display security profile, for sign on HA; once displayed, password may be changed SDA List security profiles created by user (second level authoriser and above) SDA/ZXXØ List security profiles associated with agency XXØ (second level authoriser and above) STD/ZXX1UMP or Display profile STD/ followed by Z, own pseudo city code, second delimiter if pseudo STD/Z7XX1/UMP city code is 4 characters and 1 to 3 character I.D.
    [Show full text]
  • Arc Welding Solutions from ESAB
    Arc Welding solutions from ESAB ESAB Welding & Cutting Products / esabna.com / 1.800.ESAB.123 A full line of arc welding equipment for every application, industry and environment. Arc Welding Equipment Table of Contents Description Page Description Page Process Description .....................................................2 Genuine Heliarc® Tig Torches Arc Welding Equipment Selection Guide ...................4 Heliarc Tig Torch Selection Guide ................................56 Compacts (power source with built-in wire feeder) Gas-Cooled Torches Caddy Mig C200i ............................................................6 HW-24 ...................................................................57 Migmaster™ 215 Pro/280 Pro .........................................8 HW-90 ...................................................................59 MIG, DC Power Sources, CV/CVCC HW-9 .....................................................................61 Aristo™ Mig U5000i .......................................................10 HW-17 ...................................................................63 Origo™ Mig 320/410 ......................................................12 HW-26 ...................................................................65 Origo Mig 4002c/6502c ................................................21 Water-Cooled Torches Wire Feeders - Semi-Automatic HW-20 ...................................................................67 MobileFeed™ 300AVS .....................................................15 HW-18 ...................................................................69
    [Show full text]
  • DICOM Compression 2002
    The Medicine Behind the Image DDIICCOOMM CCoommpprreessssiioonn 22000022 David Clunie Director of Technical Operations Princeton Radiology Pharmaceutical Research The Medicine SScchheemmeess SSuuppppoorrtteedd Behind the Image • RLE • JPEG - lossless and lossy • JPEG-LS - more efficient, fast lossless • JPEG 2000 - progressive, ROI encoding • Deflate (zip/gzip) - for non-image objects The Medicine IInn pprraaccttiiccee mmoossttllyy …… Behind the Image • Lossless JPEG for cardiac angio – multi-frame 512x512x8, 1024x1024x10 – CD-R and on network • Lossless JPEG for CT/MR – mostly on MOD media rather than over network – 256x256 to 1024x1024, 12-16 bits • RLE/lossless/lossy JPEG for Ultrasound – 640x480 single and multiframe 8 bits gray/RGB, text The Medicine BBuutt …… Behind the Image • JPEG lossless not the most effective • JPEG lossy limited to 12 bits unsigned • Undesirable JPEG blockiness • Perception that wavelets are better • Need for better progressive encoding • Need for region-of-interest encoding The Medicine JJPPEEGG LLoosssslleessss Behind the Image • Reasonable predictive scheme – Most often only previous pixel predictor used (SV1), which is not always the best choice • No run-length mode – No way to take advantage of large background areas • Huffman entropy coder – Slow (multi-pass) The Medicine LLoosssslleessss CCoommpprreessssiioonn Behind the Image CALIC Arithmetic 3.91 JPEG2000 VM4 5x3 3.81 JPEG-LS MINE 3.81 JPEG2000 VM4 3.66 2x10 S+P Arithmetic 3.4 JPEG-LS MINE - NO 3.31 Byte All RUN NASA szip 3.09 JPEG best 3.04 JPEG SV
    [Show full text]
  • On the Spectral Theorem of Langlands
    On the Spectral Theorem of Langlands Patrick Delorme April 22, 2021 A` Chantal Abstract We show that the Hilbert subspace of L2pGpF qzGpAqq generated by wave packets of Eisenstein series built from discrete series is the whole space. To- gether with the work of Lapid [18], it achieves a proof of the spectral theorem of R.P. Langlands based on the work of J. Bernstein and E. Lapid [7] on the meromorphic continuation of Eisenstein series from I use truncation on compact sets as J. Arthur did for the local trace formula in [2]. 1 Introduction We denote by E the isometry introduced by E. Lapid in [18], Theorem 2, whose proof involves the meromorphic continuation of of Eisenstein series built from discrete data. A dense subspace of its image is generated by wave packets of these Eisenstein series. We show that this image is equal to L2pGpF qzGpAqq. This is what Lapid calls the second half of the proof of the spectral theorem of Langlands. It achieves a new proof of the spectral theorem of R.P. Langlands ([17], [20]). Notice that the proof of Langlands describes the spectrum as residues of Eisenstein series built from cuspidal data. arXiv:2006.12893v3 [math.RT] 21 Apr 2021 One uses the notion of temperedness of automorphic forms introduced by J. Franke [15](cf. also [21] section 4.4). We show this notion of temperedness is weaker than the notion of temperedness introduced by Joseph Bernstein in [6]. We prove that for bounded sets of unitary parameters, the Eisenstein series are uniformly tempered when the parameter is unitary and bounded.
    [Show full text]