Recode: a Data Reduction and Compression Description for High Throughput Time-Resolved Electron Microscopy
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Genetic Databases
Stefano Lonardi March, 2000 Compression of Biological Sequences by Greedy Off-line Textual Substitution Alberto Apostolico Stefano Lonardi Purdue University Università di Padova Genetic Databases § Massive § Growing exponentially Example: GenBank contains approximately 4,654,000,000 bases in 5,355,000 sequence records as of December 1999 Data Compression Conference 2000 1 Stefano Lonardi March, 2000 DNA Sequence Records Composed by annotations (in English) and DNA bases (on the alphabet {A,C,G,T,U,M,R,W,S,Y,K,V,H,D,B,X,N}) >RTS2 RTS2 upstream sequence, from -200 to -1 TCTGTTATAGTACATATTATAGTACACCAATGTAAATCTGGTCCGGGTTACACAACACTT TGTCCTGTACTTTGAAAACTGGAAAAACTCCGCTAGTTGAAATTAATATCAAATGGAAAA GTCAGTATCATCATTCTTTTCTTGACAAGTCCTAAAAAGAGCGAAAACACAGGGTTGTTT GATTGTAGAAAATCACAGCG >MEK1 MEK1 upstream sequence, from -200 to -1 TTCCAATCATAAAGCATACCGTGGTYATTTAGCCGGGGAAAAGAAGAATGATGGCGGCTA AATTTCGGCGGCTATTTCATTCATTCAAGTATAAAAGGGAGAGGTTTGACTAATTTTTTA CTTGAGCTCCTTCTGGAGTGCTCTTGTACGTTTCAAATTTTATTAAGGACCAAATATACA ACAGAAAGAAGAAGAGCGGA >NDJ1 NDJ1 upstream sequence, from -200 to -1 ATAAAATCACTAAGACTAGCAACCACGTTTTGTTTTGTAGTTGAGAGTAATAGTTACAAA TGGAAGATATATATCCGTTTCGTACTCAGTGACGTACCGGGCGTAGAAGTTGGGCGGCTA TTTGACAGATATATCAAAAATATTGTCATGAACTATACCATATACAACTTAGGATAAAA ATACAGGTAGAAAAACTATA Problem Textual compression of DNA data is difficult, i.e., “standard” methods do not seem to exploit the redundancies (if any) inherent to DNA sequences cfr. C.Nevill-Manning, I.H.Witten, “Protein is incompressible”, DCC99 Data Compression Conference 2000 2 Stefano Lonardi March, 2000 -
ARC-LEAP User Instructions for The
ARC-LEAP User Instructions Appalachian Regional Commission Local Economic Assessment Package prepared for the Appalachian Regional Commission prepared by Economic Development Research Group, Inc. Glen Weisbrod Teresa Lynch Margaret Collins January, 2004 ARC-LEAP User Instructions Appalachian Regional Commission Local Economic Assessment Package prepared for the Appalachian Regional Commission prepared by Economic Development Research Group, Inc. 2 Oliver Street, 9th Floor, Boston, MA 02109 Telephone 617.338.6775 Fax 617.338.1174 e-mail [email protected] Website www.edrgroup.com January, 2004 ARC-LEAP User Instructions PREFACE LEAP is a software tool that was designed and developed by Economic Development Research Group, Inc. (www.edrgroup.com) to assist practitioners in evaluating local economic development needs and opportunities. ARC-LEAP is a version of this tool developed specifically for the Appalachian Regional Commission (ARC) and it’s Local Development Districts (LDDs). Development of this user guide was funded by ARC as a companion to the ARC-LEAP analysis system. This document presents user instructions and technical documentation for ARC-LEAP. It is organized into three parts: I. overview of the ARC-LEAP tool II. instructions for users to obtain input information and run the analysis model III. interpretation of output tables . A separate Handbook document provides more detailed discussion of the economic development assessment process, including analysis of local economic performance, diagnosis of local strengths and weaknesses, and application of business opportunity information for developing an economic development strategy. Economic Development Research Group i ARC-LEAP User Instructions I. OVERVIEW The ARC-LEAP model serves to three related purposes, each aimed at helping practitioners identify target industries for economic development. -
Lossless Compression of Internal Files in Parallel Reservoir Simulation
Lossless Compression of Internal Files in Parallel Reservoir Simulation Suha Kayum Marcin Rogowski Florian Mannuss 9/26/2019 Outline • I/O Challenges in Reservoir Simulation • Evaluation of Compression Algorithms on Reservoir Simulation Data • Real-world application - Constraints - Algorithm - Results • Conclusions 2 Challenge Reservoir simulation 1 3 Reservoir Simulation • Largest field in the world are represented as 50 million – 1 billion grid block models • Each runs takes hours on 500-5000 cores • Calibrating the model requires 100s of runs and sophisticated methods • “History matched” model is only a beginning 4 Files in Reservoir Simulation • Internal Files • Input / Output Files - Interact with pre- & post-processing tools Date Restart/Checkpoint Files 5 Reservoir Simulation in Saudi Aramco • 100’000+ simulations annually • The largest simulation of 10 billion cells • Currently multiple machines in TOP500 • Petabytes of storage required 600x • Resources are Finite • File Compression is one solution 50x 6 Compression algorithm evaluation 2 7 Compression ratio Tested a number of algorithms on a GRID restart file for two models 4 - Model A – 77.3 million active grid blocks 3.5 - Model K – 8.7 million active grid blocks 3 - 15.6 GB and 7.2 GB respectively 2.5 2 Compression ratio is between 1.5 1 compression ratio compression - From 2.27 for snappy (Model A) 0.5 0 - Up to 3.5 for bzip2 -9 (Model K) Model A Model K lz4 snappy gzip -1 gzip -9 bzip2 -1 bzip2 -9 8 Compression speed • LZ4 and Snappy significantly outperformed other algorithms -
Sequence Alignment/Map Format Specification
Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345. -
The Ark Handbook
The Ark Handbook Matt Johnston Henrique Pinto Ragnar Thomsen The Ark Handbook 2 Contents 1 Introduction 5 2 Using Ark 6 2.1 Opening Archives . .6 2.1.1 Archive Operations . .6 2.1.2 Archive Comments . .6 2.2 Working with Files . .7 2.2.1 Editing Files . .7 2.3 Extracting Files . .7 2.3.1 The Extract dialog . .8 2.4 Creating Archives and Adding Files . .8 2.4.1 Compression . .9 2.4.2 Password Protection . .9 2.4.3 Multi-volume Archive . 10 3 Using Ark in the Filemanager 11 4 Advanced Batch Mode 12 5 Credits and License 13 Abstract Ark is an archive manager by KDE. The Ark Handbook Chapter 1 Introduction Ark is a program for viewing, extracting, creating and modifying archives. Ark can handle vari- ous archive formats such as tar, gzip, bzip2, zip, rar, 7zip, xz, rpm, cab, deb, xar and AppImage (support for certain archive formats depends on the appropriate command-line programs being installed). In order to successfully use Ark, you need KDE Frameworks 5. The library libarchive version 3.1 or above is needed to handle most archive types, including tar, compressed tar, rpm, deb and cab archives. To handle other file formats, you need the appropriate command line programs, such as zipinfo, zip, unzip, rar, unrar, 7z, lsar, unar and lrzip. 5 The Ark Handbook Chapter 2 Using Ark 2.1 Opening Archives To open an archive in Ark, choose Open... (Ctrl+O) from the Archive menu. You can also open archive files by dragging and dropping from Dolphin. -
Bzip2 and Libbzip2, Version 1.0.8 a Program and Library for Data Compression
bzip2 and libbzip2, version 1.0.8 A program and library for data compression Julian Seward, https://sourceware.org/bzip2/ bzip2 and libbzip2, version 1.0.8: A program and library for data compression by Julian Seward Version 1.0.8 of 13 July 2019 Copyright© 1996-2019 Julian Seward This program, bzip2, the associated library libbzip2, and all documentation, are copyright © 1996-2019 Julian Seward. All rights reserved. Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: • Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. • The origin of this software must not be misrepresented; you must not claim that you wrote the original software. If you use this software in a product, an acknowledgment in the product documentation would be appreciated but is not required. • Altered source versions must be plainly marked as such, and must not be misrepresented as being the original software. • The name of the author may not be used to endorse or promote products derived from this software without specific prior written permission. THIS SOFTWARE IS PROVIDED BY THE AUTHOR "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DIS- CLAIMED. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. -
Working with Compressed Archives
Working with compressed archives Archiving a collection of files or folders means creating a single file that groups together those files and directories. Archiving does not manipulate the size of files. They are added to the archive as they are. Compressing a file means shrinking the size of the file. There are software for archiving only, other for compressing only and (as you would expect) other that have the ability to archive and compress. This document will show you how to use a windows application called 7-zip (seven zip) to work with compressed archives. 7-zip integrates in the context menu that pops-up up whenever you right-click your mouse on a selection1. In this how-to we will look in the application interface and how we manipulate archives, their compression and contents. 1. Click the 'start' button and type '7-zip' 2. When the search brings up '7-zip File Manager' (as the best match) press 'Enter' 3. The application will startup and you will be presented with the 7-zip manager interface 4. The program integrates both archiving, de/compression and file-management operations. a. The main area of the window provides a list of the files of the active directory. When not viewing the contents of an archive, the application acts like a file browser window. You can open folders to see their contents by just double-clicking on them b. Above the main area you have an address-like bar showing the name of the active directory (currently c:\ADG.Becom). You can use the 'back' icon on the far left to navigate back from where you are and go one directory up. -
Official Service Contractor for The2018 International Bluegrass Music Association
International Bluegrass Musical Association OFFICIAL SERVICE September 26 - 29, 2018 CONTRACTOR Raleigh Convention Center Hall C Raleigh, NC Information and Order Forms Table of Contents General Information General Information................................................................2, 3 Payment Policy & Credit Card Authorization.........................4 Third Party Billing & Credit Card Charge Authorization..5,6 Color Chart for Drape, Table Skirts and Carpet...................7 Decorating Services Custom Booth Packages...........................................................8 Furnishing Rentals.......................................................................9 Mailing Address: Custom Signs and Graphics...................................................10 P. O. Box 49837 Greensboro, NC 27419 Labor Cleaning Service.........................................................................11 Street Address: Installation and Dismantle Labor............................................12 121 North Chimney Rock Road Exhibitor Appointed Contractor.........................................13,14 Greensboro, NC 27409 Material Handling Phone: (336) 315-5225 Material Handling General Information............................15,16 Fax: (336) 315-5220 Material Handling Rate Schedule and Order Form.......17,18 Shipping Labels........................................................................19 2 General 2 Information HOLLINS Exposition Services is pleased to have been selected as the Official Service Contractor for the2018 International -
Galileo Formats
Galileo Formats October 1998 edition Chapters INDEX Introduction Booking File Air Transportation Fares Cars Hotels LeisureShopper Document Production Queues Client File/TravelScreen Travel Information Miscellaneous SECURITY Sign On H/SON SON/Z217 or Sign on at own office SON/ followed by Z and a 1 to 3 character I.D.; the I.D. can be SON/ZHA initials, a number or a combination of both SON/ZGL4HA Sign on at branch agency SON/ followed by Z, own pseudo city code and a 1 to 3 character I.D. SON/Z7XX1/UMP Sign on at 4 character PCC branch agency SON/ followed by Z, own pseudo city code, second delimiter and 1 to 3 character I.D. SB Change to work area B SA/TA Change to work area A; different duty code TA (Training) SAI/ZHA Sign back into all work areas at own office SAI/ZGL4HA Sign back into all work areas at branch agency; SAI/ followed by Z, own pseudo city code and a 1 to 3 character I.D. Sign Off SAO Temporary sign out; incomplete Booking Files must be ignored or completed SOF Sign off; incomplete Booking Files must be ignored or completed SOF/ZHA Sign off override (at own office); incomplete transactions are not protected SOF/ZGL4HA Sign off override (at branch agency); incomplete transactions are not protected; SOF/ followed by Z, own pseudo city code and a 1 to 3 character I.D. SECURITY Security Profile STD/ZHA Display security profile, for sign on HA; once displayed, password may be changed SDA List security profiles created by user (second level authoriser and above) SDA/ZXXØ List security profiles associated with agency XXØ (second level authoriser and above) STD/ZXX1UMP or Display profile STD/ followed by Z, own pseudo city code, second delimiter if pseudo STD/Z7XX1/UMP city code is 4 characters and 1 to 3 character I.D. -
Gzip, Bzip2 and Tar EXPERT PACKING
LINUXUSER Command Line: gzip, bzip2, tar gzip, bzip2 and tar EXPERT PACKING A short command is all it takes to pack your data or extract it from an archive. BY HEIKE JURZIK rchiving provides many bene- fits: packed and compressed Afiles occupy less space on your disk and require less bandwidth on the Internet. Linux has both GUI-based pro- grams, such as File Roller or Ark, and www.sxc.hu command-line tools for creating and un- packing various archive types. This arti- cle examines some shell tools for ar- chiving files and demonstrates the kind of expert packing that clever combina- tained by the packing process. If you A gzip file can be unpacked using either tions of Linux commands offer the com- prefer to use a different extension, you gunzip or gzip -d. If the tool discovers a mand line user. can set the -S (suffix) flag to specify your file of the same name in the working di- own instead. For example, the command rectory, it prompts you to make sure that Nicely Packed with “gzip” you know you are overwriting this file: The gzip (GNU Zip) program is the de- gzip -S .z image.bmp fault packer on Linux. Gzip compresses $ gunzip screenie.jpg.gz simple files, but it does not create com- creates a compressed file titled image. gunzip: screenie.jpg U plete directory archives. In its simplest bmp.z. form, the gzip command looks like this: The size of the compressed file de- Listing 1: Compression pends on the distribution of identical Compared gzip file strings in the original file. -
Deduplicating Compressed Contents in Cloud Storage Environment
Deduplicating Compressed Contents in Cloud Storage Environment Zhichao Yan, Hong Jiang Yujuan Tan* Hao Luo University of Texas Arlington Chongqing University University of Nebraska Lincoln [email protected] [email protected] [email protected] [email protected] Corresponding Author Abstract Data compression and deduplication are two common approaches to increasing storage efficiency in the cloud environment. Both users and cloud service providers have economic incentives to compress their data before storing it in the cloud. However, our analysis indicates that compressed packages of different data and differ- ently compressed packages of the same data are usual- ly fundamentally different from one another even when they share a large amount of redundant data. Existing data deduplication systems cannot detect redundant data among them. We propose the X-Ray Dedup approach to extract from these packages the unique metadata, such as the “checksum” and “file length” information, and use it as the compressed file’s content signature to help detect and remove file level data redundancy. X-Ray Dedup is shown by our evaluations to be capable of breaking in the boundaries of compressed packages and significantly Figure 1: A user scenario on cloud storage environment reducing compressed packages’ size requirements, thus further optimizing storage space in the cloud. will generate different compressed data of the same con- tents that render fingerprint-based redundancy identifi- cation difficult. Third, very similar but different digital 1 Introduction contents (e.g., files or data streams), which would other- wise present excellent deduplication opportunities, will Due to the information explosion [1, 3], data reduc- become fundamentally distinct compressed packages af- tion technologies such as compression and deduplica- ter applying even the same compression algorithm. -
Arc Welding Solutions from ESAB
Arc Welding solutions from ESAB ESAB Welding & Cutting Products / esabna.com / 1.800.ESAB.123 A full line of arc welding equipment for every application, industry and environment. Arc Welding Equipment Table of Contents Description Page Description Page Process Description .....................................................2 Genuine Heliarc® Tig Torches Arc Welding Equipment Selection Guide ...................4 Heliarc Tig Torch Selection Guide ................................56 Compacts (power source with built-in wire feeder) Gas-Cooled Torches Caddy Mig C200i ............................................................6 HW-24 ...................................................................57 Migmaster™ 215 Pro/280 Pro .........................................8 HW-90 ...................................................................59 MIG, DC Power Sources, CV/CVCC HW-9 .....................................................................61 Aristo™ Mig U5000i .......................................................10 HW-17 ...................................................................63 Origo™ Mig 320/410 ......................................................12 HW-26 ...................................................................65 Origo Mig 4002c/6502c ................................................21 Water-Cooled Torches Wire Feeders - Semi-Automatic HW-20 ...................................................................67 MobileFeed™ 300AVS .....................................................15 HW-18 ...................................................................69