DOCSLIB.ORG

Supplemental Material 1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Supplemental Figure 1 MacA MacB1 MacB2 MacB3 N2wkN N2wk 3wk 2wk 3wk Supplemental Figure 1. The 89 genes meeting the statistical criteria for upregulation MacA-2wk compared to MacA-N. For the majority of these genes, the absolute expression levels remained significantly lower in MacA-2wk than in MacB populations. Supplemental Figure 2 M1 markers MacA MacB1 MacB2 MacB3 N2wkN N2wk 3wk 2wk 3wk M2 markers MacA MacB1 MacB2 MacB3 N2wkN N2wk 3wk 2wk 3wk Supplemental Figure 2. Expression of consensus M1/M2 markers in MacA and MacB cells. Top panel – M1 markers; Bottom panel – M2 markers. Genes in gray were not expressed above the threshold (5 FPKM) in any of the populations. Genes differentially expressed in any pairwise comparison Cluster A Cluster B1 Cluster B2 Cluster B2-3wk Cluster B3 0610040J01Rik 1190005I06Rik 1700023F06Rik 5031414D18Rik 1810011O10Rik 1700017B05Rik 1110007C09Rik 2610034B18Rik 9430020K01Rik 8430408G22Rik 2700081O15Rik 2510009E07Rik 1110051M20Rik 4930506M07Rik A530099J19Rik A430078G23Rik A930004D18Rik 5430435G22Rik 1110058L19Rik 4931406C07Rik Abca8a Abca9 Acsbg1 AA467197 1190005I06Rik A230050P20Rik Ablim1 Abi3 Adamts14 Abcc3 1300017J02Rik Abcc5 Ablim3 Acss2 Adamtsl3 Adap2 1500012F01Rik Abcd2 Ace Aox3 Adm Aif1 1600014C10Rik Abcg1 Acer2 Ap1s3 Aebp1 Ang 1700006E09Rik Abhd12 Ackr2 Arhgap15 Ak1 Anpep 1700007K13Rik Abhd17c Adam23 Arhgef10 Amotl1 Aoah 1700017B05Rik Abhd3 Adamts1 Arhgef18 Angptl2 Arg1 1700023F06Rik Abhd5 Adcy4 Arrb1 Ank Arhgap10 1700025G04Rik Acaa1b Adh1 Atp2a3 Ank3 Arhgap19 1700026L06Rik Acot1 Adrbk2 Azin2 Ano1 Asb2 1700029I15Rik Acot2 Afap1l1 BC021614 Apc2 B430306N03Rik 1700056E22Rik Acox1 Aff3 BC035044 Apcdd1 B4galt6 1810011H11Rik Adam22 Ager Bcl11a Arhgap22 Baiap2 1810011O10Rik Adam33 Akap12 Bcl6 Arhgef25 Basp1 2200002D01Rik Adamts2 Aldh1a1 Birc3 Arhgef40 Batf2 2310009B15Rik Adarb1 Aldh1a2 Bmyc Asns Bcl2l1 2510009E07Rik Adcy3 Aplnr Bpifa1 Aspn Blnk 2610034B18Rik Adipor2 Apol7c Bpifb1 B3gnt9 Bnip3 2610524H06Rik Afap1 Aqp1 Btla B9d1 Bst2 2700081O15Rik Agmo Aqp5 Cbr2 Bace1 C1qa 2810417H13Rik Agpat9 Arhgap29 Ccdc88c Bag2 C1qb 2900026A02Rik Aifm2 Arhgef15 Cd300lb Bcar1 C1qc 4930481A15Rik Ak8 Arhgef26 Cd3d Bcat1 C3ar1 4930506M07Rik Alas1 Arl4d Cd55 Bmp1 Ccl12 4931406C07Rik Aldoc Art3 Cdc42ep2 Bnc1 Ccl2 5031414D18Rik Alox5 Astl Cdh23 Btbd11 Ccl24 5330417C22Rik Aloxe3 Axin2 Ceacam1 C1qtnf6 Ccl7 5430435G22Rik Angel1 B4galt4 Chad Cald1 Ccl8 8430408G22Rik Angptl3 Bach2 Cldn3 Cbx6 Ccr1 8430419L09Rik Angptl4 BC049352 Clec2g Ccbe1 Ccr5 9430020K01Rik Anxa4 Bcam Clec2i Ccdc136 Cd38 A230050P20Rik Arl11 Bcl2 Clec3b Ccl11 Cd72 A430078G23Rik Atp10a Bcl6b Csgalnact2 Cd248 Cd81 A530032D15Rik Atp6v0d2 Bgn Csrp2 Cda Cd93 A530064D06Rik Atxn1 Bmp4 Cst3 Cdc42ep5 Cebpzos A530099J19Rik Axl Bmp6 Cyp2ab1 Cdr2l Clec4d A730061H03Rik B3gnt7 C130074G19Rik Cyp2f2 Cep170b Cmklr1 A930004D18Rik BC026585 C1qtnf2 Cytip Chpf Col14a1 AA467197 Bcar3 C7 Ddit4 Clip3 Cpne2 Aatk Bckdhb Cadm3 Dennd3 Clstn3 Cst7 AB124611 Bend6 Calcrl Dusp10 Clu Cstb Abca1 Best1 Camk2n1 Dusp2 Cnn3 Ctla2b Abca6 Blvra Car14 E130208F15Rik Col18a1 Ctsc Abca8a Bmpr1a Casc4 Ebi3 Col1a1 Ctsl Abca9 Bmx Casz1 Fam49a Col3a1 Cxcl14 Abcb1b Bzw2 Cbfa2t3 Fam71a Col5a1 Cxcl16 Abcb6 C2cd2l Cblb Fcho1 Col6a1 Cxcl2 Abcc3 C530008M17Rik Ccdc170 Flt3l Col6a2 Cxcl9 Abcc5 Car4 Ccdc92 Foxp1 Col6a3 Dnase1l3 Abcd2 Car5b Ccl17 Frat1 Col8a1 Dok2 Abcg1 Card11 Ccl22 Frat2 Cpe Dppa3 Abcg3 Ccdc80 Ccm2l Fyb Crtap Ecm1 Abhd1 Ccl6 Ccr7 G0s2 Csgalnact1 Emp1 Abhd12 Ccnd2 Cd163 Gbp9 Ctxn1 Etv5 Abhd14a Ccpg1 Cd209a Gm1966 Cul7 Fabp3 Abhd17c Cd101 Cd209c Gpr18 Cxxc5 Fads1 Abhd3 Cd164 Cd209d Haao Cyr61 Fam20c Abhd5 Cd1d1 Cd226 Hes1 Dbn1 Fam213b Abi3 Cd2 Cd300e Hpgd Dcbld2 Fam46c Ablim1 Cd200r1 Cd300ld Hsd11b1 Dcn Fcgr1 Ablim3 Cd200r4 Cd34 Il1b Ddr2 Fcna Abtb2 Cd22 Cd3e Il27 Dkk2 Fcrlb Acaa1b Cd274 Cd7 Ip6k3 Dlg5 Fcrls Ace Cd300lf Cd79a Itga4 Dlx1 Fgd6 Acer2 Cd302 Cd83 Itgal Dlx2 Fgf13 Acer3 Cd9 Cdc14a Itgb3 Dmwd Fmnl2 Ackr2 Cdc25b Cdh5 Itpr1 Dnm1 Fnip2 Ackr3 Cdc42ep3 Cdkn1c Kctd1 Dpt Folr2 Acot1 Cdca7l Cdo1 Klf2 Dpy19l3 Gabbr2 Acot2 Cdh1 Cecr6 Klf9 Dpysl3 Galnt2 Acox1 Celf4 Cep112 Krt80 Dusp18 Gas6 Acp5 Ces2c Cep85l Krtcap3 Dusp9 Gatm Acrbp Chd5 Ces1d Ldlrad3 Egfr Gdf3 Acsbg1 Chil3 Chil1 Lifr Enah Glrx Acss1 Chp1 Chn2 Limd2 Etv1 Gpr34 Acss2 Cib2 Cldn18 Lipe Etv4 Gpr84 Actn1 Cideb Cldn5 Lmo1 Eya1 Grhpr Acyp1 Cidec Clec10a Lpcat4 F3 Grn Ada Cldn1 Clec14a Lrmp Fam149a Hexb Adam19 Clec1b Clec1a Lrrk2 Fam92a Hist1h1a Adam22 Clec7a Clic3 Lst1 Farp1 Hist1h2ab Adam23 Clmn Clic5 Ly6i Fbn1 Hist1h2ae Adam33 Cmbl Col27a1 Lyz1 Fgfr1 Hist1h2ag Adam8 Colec12 Cox4i2 Map3k12 Fhl2 Hist1h2ah Adamts1 Comt Cpm Map3k6 Figf Hist1h2ak Adamts14 Coro2b Crip2 Map3k8 Fkbp10 Hist1h2bh Adamts2 Coro6 Crispld2 Mbp Fkbp11 Hist1h2bk Adamtsl3 Cox6b2 Cryab Mef2c Fkbp9 Hist1h2bm Adap2 Cped1 Ctgf Megf9 Flnb Hist1h3b Adarb1 Cpne5 Ctla2a Mettl7a1 Flnc Hist1h3c Adck3 Cpne8 Ctnnd2 Mtus1 Flrt2 Hist1h4f Adcy3 Cracr2b Cxcl12 Muc1 Fosl1 Hist2h3b Adcy4 Ctsf Cxcl15 Myo18a Foxg1 Hist3h2ba Add3 Cx3cl1 Cxx1c Nav1 Fscn1 Hmox1 Adh1 Cxcr1 Cyfip2 Nbeal2 Fstl1 Hpgds Adipor2 Cxcr2 Cyp2b10 Nedd4l Fstl3 Htr2b Adm Cyb561 Cyp2s1 Nfkbie Gas1 Htra3 Adora2a Cyb561a3 Cyp4b1 Nhsl2 Gas2 Iigp1 Adora2b D330045A20Rik Cys1 Nr4a1 Gja1 Il21r Adora3 D630039A03Rik Cytl1 Nrarp Gli3 Il7r Adrb1 Dapk1 Cyyr1 Nsmaf Gm773 Insl6 Adrb2 Dgat2 Dapl1 Nsun4 Gnb4 Irg1 Adrbk2 Dhrs3 Dcstamp Ntng2 Gpc1 Itga9 Adssl1 Dhrs7b Dennd4a Pdcd4 Gpr124 Kcnj10 Aebp1 Dip2c Dgkh Pik3ip1 Gpsm2 Kcnk13 Afap1 Dmd Dlc1 Pilrb1 Gpx8 Kcnn4 Afap1l1 Dmxl2 Dll4 Plagl1 Grem1 Kctd7 Aff3 Dnajb13 Dnah12 Plbd1 Gxylt2 Lat2 Afmid Dusp13 Dnaja4 Pmaip1 Hic1 Lgals3bp Ager Dysf Dpep1 Pou2f2 Hmga1 Lgmn Agmo Ear1 Dpp4 Ppp1r15a Hmga2 Lhfpl2 Agpat9 Ear2 Dusp16 Psd Hmgn3 Maf Ahnak2 Ear6 Edn1 Ptprj Hoxa7 Mif Ahr Ech1 Efemp1 Rap1gap2 Hoxd8 Mmp12 Aif1 Echdc1 Efnb1 Rasgrf2 Hoxd9 Mmp13 Aif1l Ehhadh Efnb2 Rasgrp4 Hspb8 Mmp14 Aifm2 Enpp1 Egfl7 Rcsd1 Hspg2 Ms4a14 Ak1 Epcam Egflam Rere Htra1 Ms4a6d Ak4 F7 Egr3 Rgs18 Igf2bp2 Ms4a7 Ak8 Fabp1 Ehf Ripk2 Igf2r Msr1 Akap12 Fabp4 Eltd1 Rnase6 Igfbp4 Ndufaf6 Akap2 Fam115a Emcn S1pr4 Igfbp6 Nme4 Akap5 Fam118b Emp2 Samsn1 Il18rap Npy Akr1b8 Fam122b Emr4 Sap25 Il1r1 Nt5dc2 Akr1e1 Fam189a2 Eno3 Satb1 Il1rl1 Nup43 Akt3 Fam213a Enpep Scgb1a1 Il33 Nxpe5 Alas1 Fam69a Epas1 Scgb3a1 Islr Oit3 Aldh1a1 Fam78b Epha4 Scgb3a2 Itpr3 Olfml3 Aldh1a2 Fam89a Ephb4 Sept6 Kcnq5 Ophn1 Aldh1b1 Fcgrt Ephx1 Siglecg Kdelr3 Orc1 Aldoc Fcor Erg Sik1 Kera Paox Alox15 Ffar2 Esam Skint3 Kirrel Pdgfa Alox5 Ffar4 Esrp2 Slc2a6 Klf5 Pdlim4 Aloxe3 Flt1 Etl4 Slc44a2 Krt18 Pdpn Amica1 Fmn1 Ets1 Slc46a3 Krt8 Pf4 Amot Fpr1 Etv3 Slc6a12 Lama5 Pgam1 Amotl1 Fpr2 F2rl2 Sntb1 Lamb1 Plau Ang Fut7 Faim3 Spic Lamc1 Pmepa1 Angel1 Fzd8 Fam174b Sstr4 Leprel2 Ppbp Angptl2 Gal Fas St8sia4 Lgi2 Prkar1b Angptl3 Galm Fcrl1 Stk10 Lpar1 Procr Angptl4 Galnt3 Fcrla Susd3 Lrig1 Rab11fip5 Ank Gca Fermt2 Tbc1d8 Lrrc15 Rab3il1 Ank3 Gdf15 Fgd5 Tex22 Lrrc17 Rai14 Ankrd13b Gm4980 Fhl1 Tmc8 Ltbp1 Rapsn Ankrd33b Gmds Flt3 Tmem88 Ltbp3 Rbpj Ankrd37 Gmpr Fmo1 Traf3ip3 Lum Rgs1 Anln Gna15 Fmo2 Trem3 Maged1 Rgs10 Ano1 Golm1 Fndc1 Upb1 Magi1 Sash1 Anpep Gpd1 Foxf1 Utrn Map1b Scamp5 Anxa4 Gpr137b Fxyd1 Vav3 Mapk8ip1 Sdc4 Aoah Gpr155 Fyn Vps37b Mast4 Serf1 Aox3 Gpr160 Galnt18 Wfdc2 Medag Slc13a3 Ap1s3 Gpr55 Gata2 Wnt11 Mfsd2a Slc29a3 Ap5s1 Grap2 Gata3 Xdh Micall2 Slc2a1 Apbb2 Grb7 Gem Zcchc11 Mmp3 Slc37a2 Apc2 Gstt3 Gfra2 Zfp296 Mpzl1 Slc46a1 Apcdd1 Gyg Gimap1 Zfyve9 Mxra8 Slc6a8 Apitd1 Hadhb Gimap4 Myc Slc7a8 Apln Hcar2 Gimap6 Nav3 Spdl1 Aplnr Hebp1 Gja4 Nckap1 Src Apobec1 Hook1 Gja5 Nedd4 Stab1 Apoc1 Hr Gjb2 Ngf Steap3 Apoc2 Hsd17b7 Glp1r Nhsl1 Syngr1 Apoe Hsd3b7 Gm10277 Nid1 Syt11 Apol7c Hspa12a Gpc3 Nkain1 Tgfbi Aprt Htr2c Gpihbp1 Nkx2-2 Tlr1 Aqp1 Hvcn1 Gpr116 Nphp1 Tlr12 Aqp5 Ifitm10 Gpr182 Nptx1 Tm4sf19 Arap1 Il12rb2 Gprc5a Nptxr Tmem119 Arap2 Il18 Gpx3 Nr2f1 Tmem171 Areg Il1rl2 Grap Nrn1 Tmem37 Arg1 Inadl Grasp Ntn1 Tnfrsf14 Arg2 Iqsec1 Grrp1 Nxn Tnfrsf9 Arhgap10 Itgax Gsta3 Oaf Tpi1 Arhgap15 Kazald1 Gucy1a3 Obsl1 Trem2 Arhgap19 Kazn Gzma Osr1 Treml2 Arhgap22 Kcne3 H2-DMb2 Osr2 Tsen15 Arhgap24 Kcnh4 H2-Oa Pard3 Tubb2a Arhgap26 Kcnip4 H2-Ob Parva Xylt2 Arhgap29 Kcnk5 H2-Q5 Pcbp4 Zdhhc14 Arhgef10 Kcnn3 H2-Q6 Pcdh7 Zmynd15 Arhgef10l Kctd12b Hc Pcgf2 Arhgef15 Klhdc4 Hecw2 Pcolce Arhgef18 Krt19 Heg1 Pear1 Arhgef25 Krt79 Hepacam2 Peg10 Arhgef26 Kynu Hey1 Plac1 Arhgef3 Laptm4b Hfe Plod2 Arhgef37 Large Hmcn1 Ppic Arhgef40 Lepr Hs3st1 Prkcdbp Arid5a Lilra5 Icam2 Prkg2 Arl11 Lima1 Igfbp2 Prl2c2 Arl4d Lipa Igfbp5 Prl2c3 Arl5c Lipf Igfbp7 Prrg4 Arntl2 Lmo4 Ikzf3 Prrx1 Arrb1 Lphn2 Il4i1 Ptges Arsg Lphn3 Ildr1 Pthlh Art3 Lpin1 Inmt Ptn Asap2 Lpl Irf4 Ptpla Asb2 Lrp4 Itga8 Ptpn14 Asf1b Lsr Jam2 Ptprn Asns Ltc4s Kdr Ptprs Aspn Ly75 Kif21b Pxdn Ass1 Lyplal1 Kit Rab4a Astl Lyrm4 Klrd1 Rbfox2 Atg9b Magee1 Klri1 Rbp4 Atp10a Mak Lamp3 Rbpms2 Atp1a3 Mamdc2 Ldb2 Rcn1 Atp2a3 Mamld1 Limch1 Rcor2 Atp2b4 Mapre3 Lims2 Rdh10 Atp6v0d2 Marco Loxl1 Rgma Atp8b2 Marveld2 Lphn1 Rgs16 Atxn1 Matn2 Lrrc32 Rgs17 Auts2 Mavs Lsmem1 Rhbdf1 AW112010 Mcam Ltb Rhox2d Axin2 Mccc2 Ltbp4 Rhox2g Axl Mcemp1 Ly6c1 Rhox2h Azin2 Mcoln3 Lysmd2 Rpl13 B3gnt3 Mertk Lyve1 Rtkn B3gnt5 Mfap3l Mal2 Rundc3a B3gnt7 Mfsd7c Map3k14 S100a8 B3gnt8 Mgat4b Mapt S100a9 B3gnt9 Mgll Mcc Samd4 B430306N03Rik Mgst2 Mdm1 Satb2 B4galt2 Mgst3 Meis2 Scara3 B4galt4 Mical3 Mfap4 Sccpdh B4galt6 Mkx Mgl2 Sdc2 B9d1 Mr1 Mgp Sema3a Bace1 Mrc1 Mid2 Sema4c Bach2 Mreg Mmp15 Sema5a Bag2 Mrps33 Mmp23 Sept5 Bahcc1 Ms4a8a Mmp25 Serpinf1 Baiap2 Mtap7d3 Mmrn2 Serpinh1 Bambi Mtfp1 Msrb3 Sertad4 Basp1 Mtmr7 Myct1 Sh3d19 Batf2 Mum1 Myh14 Shisa4 BC021614 Myo6 Mylk Six4 BC026585 Myo7a Myo1b Slc14a1 BC028528 Nabp1 Myo1d Slc16a1 BC035044 Napepld Myo1g Slc20a2 BC049352
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • The Pharmacogenomics of Vincristine-Induced Neurotoxicity

    The Pharmacogenomics of Vincristine-Induced Neurotoxicity

    THE PHARMACOGENOMICS OF VINCRISTINE-INDUCED NEUROTOXICITY IN PAEDIATRIC CANCER PATIENTS WITH WILMS TUMOR OR RHABDOMYOSARCOMA by Tenneille Loo A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Experimental Medicine) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) July 2011 © Tenneille Loo, 2011 Abstract Vincristine is one of the most effective and widely utilized antineoplastic agents. However, the clinical utility of this drug is limited by severely debilitating vincristine- induced neurotoxicities (VIN). Previous studies have associated VIN with genetic polymorphisms in genes involved in the metabolism and transportation of vincristine, including CYP3A4, CYP3A5, and ABCB1. However, the findings of such studies have not been consistently reproduced. This study hypothesizes that there are specific variants in genes involved in general drug absorption, metabolism, distribution, excretion, and toxicity (ADME-Tox) that affect the individual susceptibility to VIN in patients with Wilms tumor and rhabdomyosarcoma. Detailed clinical data was collected from 140 patients with Wilms tumor and rhabdomyosarcoma by retrospective chart review. VIN cases were characterized by type of neurotoxicity, and severity was evaluated using a validated clinical grading system for adverse events (NCI-CTCAE v4.03). A customized Illumina GoldenGate Panel was used to genotype 4,536 single nucleotide polymorphisms (SNPs) in candidate genes involved in the metabolism and transportation pathway of vincristine, as well as in genes broadly involved in ADME-Tox. None of the SNPs that were previously reported to be associated with VIN were found to be significantly associated (p-value < 0.05). With similar effect sizes, six novel genetic variants in five genes (PON1, ABCA4, ABCG1, CY51A1, SLCO1C1) were significantly associated with VIN in both tumor types.
  • Differential Physiological Role of BIN1 Isoforms in Skeletal Muscle Development, Function and Regeneration

    Differential Physiological Role of BIN1 Isoforms in Skeletal Muscle Development, Function and Regeneration

    bioRxiv preprint doi: https://doi.org/10.1101/477950; this version posted December 11, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Differential physiological role of BIN1 isoforms in skeletal muscle development, function and regeneration Ivana Prokic1,2,3,4, Belinda Cowling1,2,3,4, Candice Kutchukian5, Christine Kretz1,2,3,4, Hichem Tasfaout1,2,3,4, Josiane Hergueux1,2,3,4, Olivia Wendling1,2,3,4, Arnaud Ferry10, Anne Toussaint1,2,3,4, Christos Gavriilidis1,2,3,4, Vasugi Nattarayan1,2,3,4, Catherine Koch1,2,3,4, Jeanne Lainné6,7, Roy Combe2,3,4,8, Laurent Tiret9, Vincent Jacquemond5, Fanny Pilot-Storck9, Jocelyn Laporte1,2,3,4 1Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC), Illkirch, France 2Centre National de la Recherche Scientifique (CNRS), UMR7104, Illkirch, France 3Institut National de la Santé et de la Recherche Médicale (INSERM), U1258, Illkirch, France 4Université de Strasbourg, Illkirch, France 5Univ Lyon, Université Claude Bernard Lyon 1, CNRS UMR-5310, INSERM U-1217, Institut NeuroMyoGène, 8 avenue Rockefeller, 69373 Lyon, France 6Sorbonne Université, INSERM, Institute of Myology, Centre of Research in Myology, UMRS 974, F- 75013, Paris, France 7Sorbonne Université, Department of Physiology, UPMC Univ Paris 06, Pitié-Salpêtrière Hospital, F- 75013, Paris, France 8CELPHEDIA-PHENOMIN, Institut Clinique de la Souris (ICS), Illkirch, France 9U955 – IMRB, Team 10 - Biology of the neuromuscular system, Inserm, UPEC, Ecole nationale vétérinaire d’Alfort, Maisons-Alfort, 94700, France 10Sorbonne Université, INSERM, Institute of Myology, Centre of Research in Myology, UMRS 794, F- 75013, Paris, France Correspondence to: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/477950; this version posted December 11, 2018.
  • The Mineralocorticoid Receptor Leads to Increased Expression of EGFR

    The Mineralocorticoid Receptor Leads to Increased Expression of EGFR

    www.nature.com/scientificreports OPEN The mineralocorticoid receptor leads to increased expression of EGFR and T‑type calcium channels that support HL‑1 cell hypertrophy Katharina Stroedecke1,2, Sandra Meinel1,2, Fritz Markwardt1, Udo Kloeckner1, Nicole Straetz1, Katja Quarch1, Barbara Schreier1, Michael Kopf1, Michael Gekle1 & Claudia Grossmann1* The EGF receptor (EGFR) has been extensively studied in tumor biology and recently a role in cardiovascular pathophysiology was suggested. The mineralocorticoid receptor (MR) is an important efector of the renin–angiotensin–aldosterone‑system and elicits pathophysiological efects in the cardiovascular system; however, the underlying molecular mechanisms are unclear. Our aim was to investigate the importance of EGFR for MR‑mediated cardiovascular pathophysiology because MR is known to induce EGFR expression. We identifed a SNP within the EGFR promoter that modulates MR‑induced EGFR expression. In RNA‑sequencing and qPCR experiments in heart tissue of EGFR KO and WT mice, changes in EGFR abundance led to diferential expression of cardiac ion channels, especially of the T‑type calcium channel CACNA1H. Accordingly, CACNA1H expression was increased in WT mice after in vivo MR activation by aldosterone but not in respective EGFR KO mice. Aldosterone‑ and EGF‑responsiveness of CACNA1H expression was confrmed in HL‑1 cells by Western blot and by measuring peak current density of T‑type calcium channels. Aldosterone‑induced CACNA1H protein expression could be abrogated by the EGFR inhibitor AG1478. Furthermore, inhibition of T‑type calcium channels with mibefradil or ML218 reduced diameter, volume and BNP levels in HL‑1 cells. In conclusion the MR regulates EGFR and CACNA1H expression, which has an efect on HL‑1 cell diameter, and the extent of this regulation seems to depend on the SNP‑216 (G/T) genotype.
  • Human ADAM12 Quantikine ELISA

    Human ADAM12 Quantikine ELISA

    Quantikine® ELISA Human ADAM12 Immunoassay Catalog Number DAD120 For the quantitative determination of A Disintegrin And Metalloproteinase domain- containing protein 12 (ADAM12) concentrations in cell culture supernates, serum, plasma, and urine. This package insert must be read in its entirety before using this product. For research use only. Not for use in diagnostic procedures. TABLE OF CONTENTS SECTION PAGE INTRODUCTION .....................................................................................................................................................................1 PRINCIPLE OF THE ASSAY ...................................................................................................................................................2 LIMITATIONS OF THE PROCEDURE .................................................................................................................................2 TECHNICAL HINTS .................................................................................................................................................................2 MATERIALS PROVIDED & STORAGE CONDITIONS ...................................................................................................3 OTHER SUPPLIES REQUIRED .............................................................................................................................................3 PRECAUTIONS .........................................................................................................................................................................4
  • Quantikine® ELISA

    Quantikine® ELISA

    Quantikine® ELISA Human ADAMTS13 Immunoassay Catalog Number DADT130 For the quantitative determination of human A Disintegrin And Metalloproteinase with Thombospondin type 1 motif, 13 (ADAMTS13) concentrations in cell culture supernates, serum, and plasma. This package insert must be read in its entirety before using this product. For research use only. Not for use in diagnostic procedures. TABLE OF CONTENTS SECTION PAGE INTRODUCTION .....................................................................................................................................................................1 PRINCIPLE OF THE ASSAY ...................................................................................................................................................2 LIMITATIONS OF THE PROCEDURE .................................................................................................................................2 TECHNICAL HINTS .................................................................................................................................................................2 MATERIALS PROVIDED & STORAGE CONDITIONS ...................................................................................................3 OTHER SUPPLIES REQUIRED .............................................................................................................................................4 PRECAUTIONS .........................................................................................................................................................................4
  • Crystal Structures of the Noncatalytic Domains of ADAMTS13 Reveal Multiple Discontinuous Exosites for Von Willebrand Factor

    Crystal Structures of the Noncatalytic Domains of ADAMTS13 Reveal Multiple Discontinuous Exosites for Von Willebrand Factor

    Crystal structures of the noncatalytic domains of ADAMTS13 reveal multiple discontinuous exosites for von Willebrand factor Masashi Akiyamaa,1, Soichi Takedaa,1,2, Koichi Kokamea, Junichi Takagib, and Toshiyuki Miyataa,2 aNational Cardiovascular Center Research Institute, Suita, Osaka 565-8565, Japan; and bLaboratory of Protein Synthesis and Expression, Institute for Protein Research, Osaka University, Suita, Osaka 565-0871, Japan Edited by Philip W. Majerus, Washington University Medical School, St. Louis, MO, and approved September 16, 2009 (received for review August 27, 2009) ADAMTS13 specifically cleaves plasma von Willebrand factor (VWF) distribution of VWF multimers is important for normal hemo- and thereby controls VWF-mediated platelet thrombus formation. stasis, as large multimers are hemostatically more active than Severe deficiencies in ADAMTS13 can cause life-threatening throm- small multimers (3). Deficiencies in ADAMTS13 activity, caused botic thrombocytopenic purpura. Here, we determined 2 crystal either by genetic mutations in the ADAMTS13 gene or by structures of ADAMTS13-DTCS (residues 287–685), an exosite- acquired inhibitory autoantibodies directed against the AD- containing human ADAMTS13 fragment, at 2.6-Å and 2.8-Å reso- AMTS13 protein, results in the accumulation of UL-VWF in the lution. The structures revealed folding similarities between the plasma (8–11). The UL-VWF accumulation leads to the forma- disintegrin-like (D) domain and the N-terminal portion of the tion of disseminated platelet-rich microthrombi in the micro- cysteine-rich domain (designated the CA domain). The spacer (S) vasculature, which results in the life-threatening disease, throm- domain forms a globular functional unit with a 10-stranded botic thrombocytopenic purpura (TTP).
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • ABCG1 (ABC8), the Human Homolog of the Drosophila White Gene, Is a Regulator of Macrophage Cholesterol and Phospholipid Transport

    ABCG1 (ABC8), the Human Homolog of the Drosophila White Gene, Is a Regulator of Macrophage Cholesterol and Phospholipid Transport

    ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport Jochen Klucken*, Christa Bu¨ chler*, Evelyn Orso´ *, Wolfgang E. Kaminski*, Mustafa Porsch-Ozcu¨ ¨ ru¨ mez*, Gerhard Liebisch*, Michael Kapinsky*, Wendy Diederich*, Wolfgang Drobnik*, Michael Dean†, Rando Allikmets‡, and Gerd Schmitz*§ *Institute for Clinical Chemistry and Laboratory Medicine, University of Regensburg, 93042 Regensburg, Germany; †National Cancer Institute, Laboratory of Genomic Diversity, Frederick, MD 21702-1201; and ‡Departments of Ophthalmology and Pathology, Columbia University, Eye Research Addition, New York, NY 10032 Edited by Jan L. Breslow, The Rockefeller University, New York, NY, and approved November 3, 1999 (received for review June 14, 1999) Excessive uptake of atherogenic lipoproteins such as modified low- lesterol transport. Although several effector molecules have been density lipoprotein complexes by vascular macrophages leads to proposed to participate in macrophage cholesterol efflux (6, 9), foam cell formation, a critical step in atherogenesis. Cholesterol efflux including endogenous apolipoprotein E (10) and the cholesteryl mediated by high-density lipoproteins (HDL) constitutes a protective ester transfer protein (11), the detailed molecular mechanisms mechanism against macrophage lipid overloading. The molecular underlying cholesterol export in these cells have not yet been mechanisms underlying this reverse cholesterol transport process are characterized. currently not fully understood. To identify effector proteins that are Recently, mutations of the ATP-binding cassette (ABC) trans- involved in macrophage lipid uptake and release, we searched for porter ABCA1 gene have been causatively linked to familial HDL genes that are regulated during lipid influx and efflux in human deficiency and Tangier disease (12–14).
  • Original Article Association Between the ADAMT33 Variant and Carotid Artery Intima-Media Thickness in the Chinese Han Population

    Original Article Association Between the ADAMT33 Variant and Carotid Artery Intima-Media Thickness in the Chinese Han Population

    Int J Clin Exp Med 2019;12(1):1269-1275 www.ijcem.com /ISSN:1940-5901/IJCEM0073744 Original Article Association between the ADAMT33 variant and carotid artery intima-media thickness in the Chinese Han population Xiaolin Zhang, Liwen Liu, Ruoxi Gu, Xiaozeng Wang Cardiovascular Research Institute and Department of Cardiology, The General Hospital of Northern Theater Command, 83 Wen Hua Road, Shenyang, Liaoning Province, China Received January 31, 2018; Accepted October 8, 2018; Epub January 15, 2019; Published January 30, 2019 Abstract: Background: The ADAM33 with a disintegrin domain and a metalloprotease domain attaches an important role in regulating smooth vascular cell migration and proteolysis. In the present study, we investigated the associa- tion between ADAM33 variants and carotid artery intima-media thickness (CIMT) in the Chinese Han population. Methods: In a community population (n=620), CIMT was determined using the ultrasound to detect the carotid artery intima-media thickness. We screened the ADAM33 variations using PCR-direct sequencing method and in- vestigated the relationship between ADAM33 variations and CIMT in Chinese Northern Han population. Results: The ADAM33 expression was increased in the atherosclerotic carotid artery from CIMT patients compared with the normal subjects by the immunohistochemical staining. Furthermore, ADAM33 rs514174 was closely related to the increased risk of CIMT patients (OR=1.43, 95% CI: 1.08-1.89, P≤0.05). In addition, the rs514174 TT genotype of ADAM33 was significantly associated with the increased ADAM33 mRNA expression in patients with CIMT (P<0.05). Conclusion: Our study provides the further support for the ADAM33 rs514174 variant as a direct risk factor for CIMT.
  • Patient-Based Cross-Platform Comparison of Oligonucleotide Microarray Expression Profiles

    Patient-Based Cross-Platform Comparison of Oligonucleotide Microarray Expression Profiles

    Laboratory Investigation (2005) 85, 1024–1039 & 2005 USCAP, Inc All rights reserved 0023-6837/05 $30.00 www.laboratoryinvestigation.org Patient-based cross-platform comparison of oligonucleotide microarray expression profiles Joerg Schlingemann1,*, Negusse Habtemichael2,*, Carina Ittrich3, Grischa Toedt1, Heidi Kramer1, Markus Hambek4, Rainald Knecht4, Peter Lichter1, Roland Stauber2 and Meinhard Hahn1 1Division of Molecular Genetics, Deutsches Krebsforschungszentrum, Heidelberg, Germany; 2Chemotherapeutisches Forschungsinstitut Georg-Speyer-Haus, Frankfurt am Main, Germany; 3Central Unit Biostatistics, Deutsches Krebsforschungszentrum, Heidelberg, Germany and 4Department of Otorhinolaryngology, Universita¨tsklinik, Johann-Wolfgang-Goethe-Universita¨t Frankfurt, Frankfurt, Germany The comparison of gene expression measurements obtained with different technical approaches is of substantial interest in order to clarify whether interplatform differences may conceal biologically significant information. To address this concern, we analyzed gene expression in a set of head and neck squamous cell carcinoma patients, using both spotted oligonucleotide microarrays made from a large collection of 70-mer probes and commercial arrays produced by in situ synthesis of sets of multiple 25-mer oligonucleotides per gene. Expression measurements were compared for 4425 genes represented on both platforms, which revealed strong correlations between the corresponding data sets. Of note, a global tendency towards smaller absolute ratios was observed when
  • Murine Megakaryopoiesis Is Critical for P21 SCL-Mediated Regulation Of

    Murine Megakaryopoiesis Is Critical for P21 SCL-Mediated Regulation Of

    From bloodjournal.hematologylibrary.org at UNIVERSITY OF BIRMINGHAM on March 1, 2012. For personal use only. 2011 118: 723-735 Prepublished online May 19, 2011; doi:10.1182/blood-2011-01-328765 SCL-mediated regulation of the cell-cycle regulator p21 is critical for murine megakaryopoiesis Hedia Chagraoui, Mira Kassouf, Sreemoti Banerjee, Nicolas Goardon, Kevin Clark, Ann Atzberger, Andrew C. Pearce, Radek C. Skoda, David J. P. Ferguson, Steve P. Watson, Paresh Vyas and Catherine Porcher Updated information and services can be found at: http://bloodjournal.hematologylibrary.org/content/118/3/723.full.html Articles on similar topics can be found in the following Blood collections Platelets and Thrombopoiesis (260 articles) Information about reproducing this article in parts or in its entirety may be found online at: http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requests Information about ordering reprints may be found online at: http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprints Information about subscriptions and ASH membership may be found online at: http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtml Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036. Copyright 2011 by The American Society of Hematology; all rights reserved. From bloodjournal.hematologylibrary.org at UNIVERSITY OF BIRMINGHAM on March 1, 2012. For personal use only. PLATELETS AND THROMBOPOIESIS SCL-mediated regulation of the cell-cycle regulator p21 is critical for murine megakaryopoiesis Hedia Chagraoui,1 *Mira Kassouf,1 *Sreemoti Banerjee,1 Nicolas Goardon,1 Kevin Clark,1 Ann Atzberger,1 Andrew C.