Signaling Proteins of the Human Liver Fluke, Opisthorchis Viverrini

Signaling Proteins of the Human Liver Fluke, Opisthorchis viverrini

by Sandi K. Parriott

B.S. in Biomedical Science, May 1984, Texas A&M University B.S. in Animal Science, May 1985, Texas A&M University DVM in Veterinary Medicine, May 1992, Texas A&M University

A dissertation submitted to

The Faculty of Columbian College of Arts and Sciences of The George Washington University in partial fulfillment of the requirements for the degree of Doctor of Philosophy

August 31, 2012

Dissertation directed by

Paul J. Brindley Professor of Microbiology, Immunology, and Tropical Medicine

The Columbian College of Arts and Sciences of The George Washington University

certifies that Sandi Kay Parriott has passed the Final Examination for the degree of

Doctor of Philosophy as of May 31, 2012. This is the final and approved form of the

dissertation.

“Signaling Proteins of the Human Liver Fluke, Opisthorchis viverrini”

Sandi K. Parriott

Dissertation Research Committee:

Paul J. Brindley, Professor of Microbiology, Immunology, & Tropical

Medicine, Dissertation Director

John M. Hawdon, Associate Professor of Microbiology & Tropical

Medicine & of Biological Sciences, Committee Member

Alexander Loukas, Adjunct Assistant Professor of Microbiology,

Immunology, & Tropical Medicine, Committee Member

iii

Dedication

The author wishes to dedicate this work to my loving husband, Daniel J. Simons, and my parents, Robert and Joan Parriott, whose constant support and encouragement kept me focused on the ultimate goal. I’d also like to dedicate this work to my mentors and colleagues at Walter Reed Army Institute of Research, primarily LTC Michael T. O’Neil,

LTC Mark R. Hickman, Dr. Thomas Hudson, and COL Michael Kozar, who pushed, prodded, and cajoled me to finish despite my ‘just trying to keep up with my day job”.

Acknowledgement

The author wishes to acknowledge Dr. Sutas Suttiprapa who brought his knowledge of

proteins, Opisthorchis viverrini, positive attitude, and patience to our laboratory during

his post-doctoral studies. You are a wonderful mentor and teacher. It was a great pleasure

working with and learning from you. I’d also like to thank Dr. Paul J. Brindley, my advisor, for his guidance and willingness to take on a veterinarian with no molecular biology background but a desire to learn. Thank you.

No laboratory would be complete without its own cast of characters. I’d like to thank all the graduate students that worked with me in our laboratory – Dr. Maria Morales, Dr.

Kristine Kines, Dr. Gabriel Rinaldi, Dr. Tunika Okatcha, Dr. Yousef Alrefaei, Danielle

Skinner, and our lab manager, Dr. Victoria Mann. Thanks for sharing the ups and downs.

A very special thanks goes to Jordan Pleiskett whose expertise helped to make a much

improved second anti-O.viverrini caspase 9 antibody for use in the immunolocalization studies.

Finally, this work was supported by NIH award UO1AI065871 and the Long Term

Health Education Training (LTHET) program of the Veterinary Corps, Medical

Command, United States Army.

Abstract of Dissertation

Signaling proteins of the human liver fluke, Opisthorchis viverrini

Cholangiocarcinoma (CCA) – cancer of the bile ducts – is associated with chronic

infection with the oriental liver fluke, Opisthorchis viverrini. Despite being one of only

three eukaryotic organisms designated as a ‘Group 1 carcinogen” by the International

Agency of Research on Cancer (IARC), research into the transcriptome and genome of

this enigmatic parasite is still in its infancy. A gene discovery project for O. viverrini

using the expressed sequence tag (EST) approach was begun in 2007 (Laha, 2007).

Among other genes, EST’s representing putatively secreted or transmembrane proteins

with known roles in tumor induction and progression were identified. The

characterization of three of these secreted or transmembrane proteins, an orthologue of

caspase 9, fibroblast growth factor receptor substrate 2 (FRS2), and transforming growth factor – β receptor type 1 (TGF-βR1) are presented here. All three are members of signaling pathways involved in practically all aspects of cell behavior and homeostasis

(Cooper and Hausman, 2007).

Apoptosis – programmed cell death – is a fundamental physiological process of

metazoan growth and development as well as a protective mechanism against pathogenic

changes. Proteases termed caspases are key mediators in the control and pathways of

apoptosis. Function and role of component caspases have been the subjects of

concentrated scrutiny over the past decade or so. Caspase 9 is the apical caspase of the

intrinsic pathway of apoptosis which is activated by cytochrome c release from the

mitochondrion in response to ionizing radiation, chemotherapeutic drugs, mitochondrial

damage, and specific developmental cues. Once activated, caspase 9 functions

downstream to activate the caspase 3, 7 executioner caspases which stimulate DNase

production and cell death. In studies described here, low levels of apoptosis were noted

in adult liver flukes infecting hamster bile ducts by TUNEL analysis. Bioinformatic and phylogenetic analyses of the O. viverrini caspase 9 elucidated the conserved domains found in all caspases and those orthologues specific to caspase 9 such as the caspase activating and recruitment domain or CARD, catalytic site containing the active cysteine

residue, and conserved aspartate acid residues. Cloning, expression, and purification

were carried out in two different expression vector constructs allowing thorough analyses

of the protein. O. viverrini caspase 9 substrate specificity was verified using the Caspase

Glo-9® luciferase-based assay (Promega) followed by inhibition of O. viverrini caspase 9

activity by a caspase 9 specific reversible aldehyde, Ac-LEHD-CHO. As expected for

the initiator of one apoptotic process crucial to homeostasis and development in

eukaryotes, O. viverrini caspase 9 was found in all developmental stages evaluated by

reverse transcription-PCR.

The TGF-β pathway is involved in all aspects of cell behavior and growth. It is

activated by TGF-β binding with TGF-β receptor type 2 (TGF-βR2) which then binds to

TGF-βR1 and stimulates the cascade effect culminating in changes in gene expression

affecting cell growth and behavior. This is one of the best characterized of the signaling

pathways in trematodes especially in Schistosoma mansoni. A putative O. viverrini TGF-

βR1 was identified through multiple sequence alignments and bioinformatics analyses.

Only a portion of the serine threonine kinase domain has been found in the 197 aa

vii residues. 5’ RACE was only able to find 15 additional amino acids in the contig to total

212aa. The O. viverrini partial serine threonine kinase domain is extremely well conserved when compared with other well-known trematode orthologues such as S. mansoni and Echinococcus multilocularis. Future studies and evaluation of other contigs may help to complete the 5’ end of the O. viverrini TGF-βR1.

Fibroblast growth factors (FGF) induce biological responses by binding to and activating a family of cell surface receptors called FGF receptors. Docking or adaptor proteins lack catalytic action but relay key events of signal transduction from upstream to downstream elements are the FGF receptor substrates. FRS2 is a lipid-anchored docking protein crucial to FGF stimulation of Ras/MAPK and Ras/ERK pathways. Bioinformatic analyses and multiple sequence alignments indicated the presence of conserved domains found in orthologous FRS2 such as myristylation sites, Grb2 and Shp2 binding sites, and protein tyrosine binding (PTB) domain in the O. viverrini FRS2. Cloning, expression, and purification of the O. viverrini FRS2 have been completed. Developmental stage evaluation using reverse transcription (RT)- PCR has shown, as expected, O. viverrini

FRS2 is present in all life cycle stages tested: eggs, metacercariae, juvenile flukes < 1 month of age, and adult flukes.

Disruption of signaling pathways controlling homeostasis and physiologic activities have been shown to result in pathology in many species. The O. viverrini signaling proteins in this dissertation are all factors in essential signaling pathways whose roles within the parasite have yet to be discovered but may provide future targets of intervention for chemotherapeutic and/or vaccine targets. The findings presented here characterizing, to varying degrees, O. viverrini caspase 9, FRS2, and TGF-βR1 can be

viii

expected to provide a foundation for further studies into the physiology of the human

liver fluke.

Table of Contents

Dedication………………………………………………………………...………. .iv

Acknowledgement………………………………………………………..………. v

Abstract of Dissertation…………………………………………………...………. vi

Table of Contents…………………………………………………………..…….. x

List of Figures………………………………………………………..…………… xi

List of Tables………………………………………………………………..……. xiv

List of Abbreviations……………………………………………………..………. xv

Chapter 1: Background and Literature Review…………………………….…..…. 1

Chapter 2: Hypothesis and Aims……………………………...………..….……… 28

Chapter 3: Materials and Methods………………………….. ……….……...……. 32

Chapter 4: Results...…………………………………………………….…...…….. 58

Chapter 5: Discussion.……………………………………………….....…………. 110

References.……………………………………………………….…….....……….. 123

Appendices ………………………………………………………….….....………. 142

Appendix A (permissions for image use).………………….…...……..…... 142

Appendix B (protein sequencing report) …………………….…………… 154

List of Figures

Figure 1. Distribution and prevalence of O.viverrini in the northeast of Thailand (surveyed in 2009)……………………………………….……….……..… 4

Figure 2. Prevalence of O. viverrini and C. sinensis in Asian countries..….….…... 5

Figure 3. The life cycle of Opisthorchis viverrini…………………………….…… 8

Figure 4. Proposed pathways of pathogenesis of O. viverrini induced cholangiocarcinoma…………………………………………...………..…. 11

Figure 5. Schematic representation of one of the pathways activated through FGF receptor 1……………………………………………………………….…. 17

Figure 6. Structural comparison of human FRS2α and FRS2β………………….... 20

Figure 7. Schematic of the TGF-β pathway…………………….…………………. 22

Figure 8. Schematic of the structure of TGF-β receptor type 1…………………… 23

Figure 9A. Caspase cascade in apoptotic cells…...... ……………………….……... 26

Figure 9B. Schematic overview of the intrinsic apoptotic pathway………………. 26

Figure 10. pET-50b(+) expression vector with insertion site of ORF………….….. 38

Figure 11. pET-45b(+) expression vector with insertion site of ORF……….…….. 39

Figure 12. Flow chart for analysis of cellular compartments……………………… 42

Figure 13. Outline of Caspase Glo-9® assay……………….……………………… 47

Figure 14. Flow chart outlining the polyclonal antibody production in mice to O. viverrini caspase 9 fusion protein…………...…………………………. 55

Figure 15. TUNEL analysis of baseline apoptosis levels………………..………... 60

Figure 16. TUNEL assay…………………..…………………………..………….. 61

Figure 17. The 372 deduced amino acids encoded by the ORF of OvAE561...... … 62

Figure 18. Predicted structure of OvAE561 based on conserved domains and BLASTp analysis……………………………….…………..………….….. 63

Figure 19. Multiple sequence alignments of orthologues of caspase 9 and the OvAE561 enzyme…………………………………………………….…… 64

Figure 20. Phylogenetic tree of Opisthorchis viverrini caspase 9 and other informative relative orthologues…………………………………………… 66

Figure 21. Activity of the positive control in the Caspase Glo-9® assay………...... 67

Figure 22. The activity of the O.viverrini adult fluke whole protein lysate……….. 68

Figure 23A. Inhibition study of the whole protein lysate of O.viverrini and Ac-LEHD-CHO…………………………………………………..……….. 68

Figure 23B. Inhibition study of the whole protein lysate of O.viverrini and iodoacetamide……………………………………………………………... 69

Figure 24. Restriction digestion of OvAE561, OvAE1563, and pET50b(+)…...…. 71

Figure 25. ORF insertion location within the vector encoding a fusion protein with encoding elements as diagrammed………………………………..…. 72

Figure 26. Coomassie stained SDS-PAGE undertaken to analyze recombinant fusion protein expression…………………………………….……………. 73

Figure 27. Western blot analyses of cellular fractions for protein expression…..… 75

Figure 28. Affinity chromatography of pET50b(+) O.viverrini caspase 9 construct…… ………………………………………………………….…. 76

Figure 29. Rapid dilution and HRV 3C protease cleavage experiment with western blot analyses………………………………………………………………. 78

Figure 30. Optimization of the refolding buffer conditions……….……….……… 79

Figure 31. Diagram of the construct of pET45b(+) O.viverrini caspase 9 recombinant plasmid……………………………….………………….…... 80

Figure 32. DNA gel electrophoresis of pET45b(+) O.viverrini caspase 9……....… 81

Figure 33. Pilot expression analysis of 5 ml cultures induced overnight with a final concentration of 1 mM IPTG………………………………………… 82

Figure 34. Purification of O. viverrini caspase 9 by affinity chromatography..…... 83

xii

Figure 35. Initial evaluation of refolding buffers using rapid dilution technique utilizing the Caspase Glo-9® assay……………………………………….. 84

Figure 36. pET45b(+) O.viverrini caspase 9 activity and inhibition assay reported in RLU/sec………………………….………………………….………….. 87

Figure 37. O.viverrini caspase 9 protein concentration effects on luminescence in the Caspase Glo-9®assay………………………………………………….. 88

Figure 38. Analysis of O.viverrini caspase 9 substrate specificity in the Caspase Glo-3,7® assay……….……………………………………………………. 90

Figure 39. Western blot analysis of antibody specificity to the O.viverrini caspase 9………………………….………………………………….…….. 92

Figure 40. Western blot analysis of the specificity of the anti-O.viverrini caspase 9 antibody…………………………… …………………………... 93

Figure 41. Developmental stage reverse transcription PCR of O.viverrini caspase 9…………………………………………...………...... …… 94

Figure 42. Multiple sequence alignment of well-characterized FRS2 or FRS2-like orthologues against the translated ORF of OvAE1563……………..….…. 98

Figure 43. Phylogenetic analyses of O.viverrini FRS2 ………………....…...……. 101

Figure 44. Coomassie stained SDS-PAGE undertaken to analyze the recombinant fusion protein expression obtained using the pET50b(+) O.viverrini FRS2 construct transformed BL2 E.coli cells……………………………….…… 102

Figure 45. Affinity chromatography of pET50b(+) O.viverrini FRS2 construct..… 104

Figure 46. Multiple sequence alignments of TGF-βR1 well-known model species and OvAE22………………………………………………….…..……….. 107

Figure 47. The predicted structure of O.viverrini TGF-β receptor type 1….……... 108

Figure 48. A preliminary phylogenetic tree was made from alignments found to be potential orthologues during the BLAST analysis of the putative O.viverrini TGF-β receptor type 1……………………………………..….. 108

xiii

List of Tables

Table 1. Gene-specific primers for contig sequencing……………………………. 33

Table 2. Gene-specific primers with clamps and restriction sites for cloning into expression vectors……………………………………………….………… 37

Table 3. 5’RACE primers for OvAE22 (putative TGF-β receptor type 1)….…….. 53

Table 4. Statistical data from activity and inhibition assays shown in Figures 21-23………………………………………………………………………. 70

Table 5. Raw data and statistical analyses of the Caspase Glo-9® activity assay to evaluate activity of different buffers following refolding………….……… 85

Table 6. Raw data and statistical analyses of activity and inhibition studies of the recombinant O.viverrini caspase 9 as shown in Figure 37…………….…... 87

Table 7. Raw data and statistical analyses of the substrate specificity experiment shown in Figure 38………………………………………………………... 90

xiv

List of Abbreviations

1. Apaf-1 apoptotic protease-activation factor 1

2. ATP adenosine-5’-triphosphate

3. BMP bone morphogenetic protein

4. CARD caspase activation and recruitment domain

5. CCA cholangiocarcinoma

6. cDNA complementary (reverse transcribed) DNA

7. DNA deoxyribonucleic acid

8. EGF epidermal growth factor

9. EMT epithelial to mesenchymal transition

10. E/S excretory/secretory

11. EST expressed sequence tag

12. FGF fibroblast growth factor

13. FRS2 fibroblast growth factor receptor substrate 2

14. Grb2 growth factor receptor binding protein 2

15. IARC International Agency for Research on Cancer

16. IL-6 interleukin-6

17. Kb kilobases

18. kDa kilodaltons

19. kg kilogram

20. LAMP loop mediated isothermal amplification

21. MAPK mitogen activated protein kinase

22. M molar

23. mM millimolar

24. mg milligram

25. ml milliliter

26. µl microliter

27. mm millimeter

28. NGF nerve growth factor

29. NO nitric oxide

30. ORF open reading frames

31. PCR polymerase chain reaction

32. pmole picomole

33. PTB phosphotyrosine binding domain

34. PTK protein tyrosine kinase

35. RLU relative light units

36. RNA ribonucleic acid

37. RT reverse trancriptase

38. RT-PCR reverse transcription PCR

39. Sos guanine nucleotide releasing tyrosine phosphate factor

40. TGF-β transforming growth factor- beta

41. TGF-βR1 transforming growth factor – beta receptor type 1

42. WHO World Health Organization

xvi

Chapter 1: BACKGROUND AND LITERATURE REVIEW

1.1. INTRODUCTION

Approximately 10% of the world’s population or more than 750 million people are at risk for food-borne trematode (or fluke) infections, and greater than 40 million

people have active trematodiasis (Mulvenna et al. 2012). The most clinically relevant

trematodes in Southeast Asia are Opisthorchis viverrini, Clonorchis sinensis, Fasciola spp. and Paragonimus spp (Sripa et al. 2010) The small food-borne flukes, O. viverrini

and C. sinensis are the most abundant and have the most severe associated clinical

complications. Currently, about10 million people are infected with O. viverrini in

Thailand and Lao PDR (Mulvenna et al. 2012) while China alone has over 15 million infected with C. sinensis (Sithithaworn et al. 2012). The International Agency for

Research on Cancer, World Health Organization (WHO) have classified three metazoan

parasites as Group I carcinogens: Opisthorchis viverrini, Clonorchis sinensis, and

Schistosoma haematobium (Bouvard et al. 2009). Chronic infections of O. viverrini have

been strongly correlated with the development of cholangiocarcinoma and indeed,

Thailand has the highest prevalence of cholangiocarcinoma in the world. At present, there

are no vaccines against O. viverrini and only one drug of choice for treatment,

praziquantel. There have been no reports in humans of food-borne trematodes being

resistant to praziquantel, however, during a treatment study for clonorchiasis, a low cure

rate of 29% was reported in a small village in Vietnam (Keiser and Utzinger 2007).

Although O.viverrini was first discovered almost 100 years ago (Leiper 1915) and has

been known to be associated with hepatobiliary diseases in Thailand for over 50 years

information about its genome and transcriptome are just being discovered (Laha et al.

2007; Young et al. 2010) . The initial gene discovery project was commenced by Laha et al in 2007 using the Expressed Sequence Tag (EST) approach, ~5000 ESTs from O.

viverrini were deposited into GenBank (Laha et al. 2007). The transcriptome of O.

viverrini was interpreted using high throughput sequencing and advanced in silico

analyses which assembled >50,000 sequences and categorized them by biological

relevance (Young et al. 2010). Characterization of these ESTs and sequences, the

putative proteins they encode, and investigation of their potential influences on parasite

growth, cell differentiation, programmed cell death, and signal transduction pathways

will provide a groundwork for future proteomic and genomic research on the fluke and

how it induces cancer. They will also provide targets for new drug discovery and vaccine

development.

1.2. OPISTHORCHIASIS

1.2.1. Epidemiology and Public Health Significance

Opisthorchiasis is caused by the human liver fluke, Opisthorchis viverrini, and is

considered to be a major public health concern in Thailand and the neighboring countries

of Cambodia, Vietnam, and Lao PDR. Malaysia, Singapore, and the Philippines have all

had intermittent case reports of opisthorchiasis (Sripa et al. 2010). The geographical

distribution of opisthorchiasis is dictated by the presence and geographical range of

suitable snail and cyprinoid intermediate hosts as well as a cultural preference for raw or

undercooked fish (Sripa et al. 2011). In 2001, in Thailand alone, about 9.4% of the

population, approximately 6 million people, were infected with O. viverrini

(Jongsuksuntigul and Imsomboon 2003) this national prevalence has decreased to 8.7% in

2009 as a result of government backed control and educational programs. Of the four regional areas of Thailand, the highest prevalence of infection occurs in the northeastern

(16.6%) region followed by the northern (10.0%) region and with the central (1.3%) and southern (0.01%) regions of Thailand having very few O. viverrini infections (Figure 1).

After intensive and consistent control measures, the prevalence of infection in the northeastern region has only decreased to 15.7% from 16.6% (Sripa et al. 2011). The provinces of northeastern Thailand have the highest prevalence in the country with the highest rates occurring along the Chi River, and near Lawa and Nong Kongkaew Lakes

(Aunpromma et al. 2012). The Nakhon Panom Province in the Northeast Region has up to

60% prevalence (Sithithaworn et al. 2012). Based on 2009 data, Thailand still has the highest O.viverrini infection rate in the world, ~6 million cases, however this is very likely a large underestimate due to the recent development of more sensitive diagnostics

(Arimatsu et al. 2012).

In Lao PDR, the highest infection rates occur in the central and southern lowlands and the estimate of infection for the entire country is over 2 million people (Rim et al.

2003). Two lowland districts had infection rates as high as 92% (Krong) and 90.0%

(Mounlapamok) when compared to a highland district that only had 5.7% (Paksong) infection rate (Sithithaworn et al. 2012).

The reporting and diagnosis of O. viverrini in Cambodia has been limited and incomplete because there is no nationwide public health process (Sithithaworn et al. 2012) in place, the approximate of 600,000 cases is considered to be a gross underestimate(Bouvard et al. 2009). Along the Mekong River flood plain high infection rates have been found among several communities. A recent study found a 32% infection

rate in Takeo Province and the highest prevalence of 44.8% in Kampong Cham Province.

(Sohn et al. 2011).

Figure 1. Distribution and prevalence of O. viverrini in the northeast of Thailand

(surveyed in 2009). The increasing darkness of color corresponds to increased incidence

of O. viverrini infection. For example, the black corresponds to >30% of the population is

infected with O. viverrini (Sithithaworn et al. 2012) (used with permission).

In Vietnam, O. viverrini is endemic in the 11 southern provinces and the prevalence

ranges from 36.9% - 15.2% in three of those endemic provinces (De et al. 2003) whereas

C. sinensis is distributed in the northern 21 provinces with the highest prevalence near the

Red River delta region(IARC 1994; World Health Organization 1995) (Figure 2).

Figure 2. Prevalence of O. viverrini and C. sinensis in Asian countries. Endemicity level

is defined based on prevalence of infections: low 0—5%; medium 5.1-15%; high >15%

(Sithithaworn et al. 2012) (used with permission).

Infection rates with O. viverrini begin young and rise with age up to adulthood, and

thereafter remain relatively high. More significantly, the intensity of infection rises in both

males and females throughout early life and plateaus at about 40-49 years of age. A

minority of the population harbor the majority of the worms. In areas of heavy transmission, rapid re-infection is quite common following treatment with praziquantel. As

might be expected from dietary habits, the prevalence and intensity of infection is greater

in those people living in rural areas than in urban residents (Upatham and Viyanant 2003).

Within the at risk population, males tend to have a higher incidence rate and heavier

infection intensity than females. The risk of clinical symptoms and disease increase in a

linear fashion with infection, therefore the heavier and/or more chronic the infection, the

more likely the appearance of pathology and clinical disease (Sithithaworn and Haswell-

Elkins 2003).

Transmission from the second intermediate host (cyprinoid fish) to humans is

seasonal and usually occurs in the cooler months when fish have the highest burden of

metacercariae (Sithithaworn et al. 2012). The infection is often sub-clinical and

hepatobiliary changes may resolve with treatment but not in all cases and those

individuals without resolution may be at higher risk for development of

cholangiocarcinoma (Sripa et al. 2009).

1.2.2. Life cycle and Biology

The adult O. viverrini flukes are flat, leaf-shaped, and hermaphroditic with an

average size of 7.0 mm long by 1.5 mm wide, morphologically similar but smaller than

Clonorchis sinensis, the better known liver fluke endemic to Japan, China, Korea, and other countries in Asia. The adult flukes live in the biliary system, mainly the intra- and

extrahepatic bile ducts, and gallbladder, and in rare cases, the pancreatic ducts, where they

feed on the epithelium (Kaewpitoon et al. 2008). The flukes take approximately one

month from ingestion of metacercariae from infected fish to migrate into the biliary tree

and mature within the human or other definitive host. The mature flukes then release eggs

6 into the biliary system, the eggs pass through the biliary ducts into the intestines, and the eggs with ciliated miracidia inside are then voided in the fecal stream. The eggs are ingested by freshwater snails of the genus Bithynia, where they hatch and miracidia are released. The snails are found in large numbers in shallow water, wetlands, and rice fields

(Thu et al. 2007). Within the snail over an 8-10 week period, the miracidia develop into sporocysts, rediae, and finally cercariae. The free-swimming cercariae are released from the snail and penetrate under the scales of cyprinoid fish and into the muscle tissue, where they encyst and develop into metacercariae (Upatham and Viyanant 2003). There are at least 20 species of cyprinoid fish able to serve as the second intermediate hosts for O. viverrini (Thu et al. 2007). The infective metacercariae are unknowingly eaten along with the raw or undercooked fish by humans or other fish eating mammals, after which the metacercariae excyst in the small intestine, and the immature flukes migrate through the ampulla of Vater into the common bile duct and then into the intra-hepatic bile ducts to mature and produce eggs, completing the life cycle (Figure 3). The life span of adult worms is largely unknown but is thought to be at least 10 years but may be as long as 25-

30 years (Upatham and Viyanant 2003).

Figure 3. The life cycle of Opisthorchis viverrini, www.dpd.cdc.gov.

Humans are the major definitive hosts and become infected by eating raw or undercooked dishes such as pra hok in Cambodia, koi pla (fish salad) or pla som (short fermented fish) in Thailand. Dogs, cats, and any other piscivorous animals are the animal reservoirs for O. viverrini. A recent study suggests that cats may be the most important animal reservoir. It has been reported that more than 35% of cats in Thailand from endemic areas are infected with O. viverrini and in endemic areas of southern Vietnam, the rate ranges from 33-60% of cats (Aunpromma et al. 2012).

1.2.3. Opisthorchiasis

Infection with O. viverrini is usually asymptomatic. Mild symptoms are usually non-specific and include dyspepsia, abdominal pain, constipation or diarrhea. Only 5-10%

of heavily infected people develop more severe symptoms (Mairiang and Mairiang 2003).

Chronic, heavy infections with this fluke are associated with a number of hepatobiliary

diseases, including inflammation of the biliary system (cholangitis), hepatomegaly,

obstructive jaundice, stones in the biliary system or cholelithiasis, and fibrosis of the

periportal system (Sripa et al. 2007). About 25% of people infected with O. viverrini will

develop periductal fibrosis and many of those will develop cholangiocarcinoma (Sripa et

al. 2007; Shin et al. 2010). The intensity and duration of the infection appears to be associated with the severity of pathology (Kaewpitoon et al. 2008). A single dose of oral praziquantel is considered to be the treatment of choice (Strandgaard et al. 2007) for liver fluke infection and can ameliorate some of the symptoms and pathological changes such as gall bladder enlargement. Unfortunately, O. viverrini infection and treatment does not

seem to provide any protective immunity because re-infection is often rapid post-therapy

(Sithithaworn and Haswell-Elkins 2003).

Experimental and epidemiologic evidence strongly implicates liver fluke infection in the development of bile duct cancer, cholangiocarcinoma (CCA) (IARC 1994). The correlation between infection with O. viverrini and CCA has been known for over 50 years

(Hou and Pang 1956). Several surveys have shown a strong association between fecal egg

count, CCA, and anti-O.viverrini specific antibody titers in the Thai population (Elkins et

al. 1990; Haswell-Elkins et al. 1994; Honjo et al. 2005; Khurana et al. 2005). Worldwide,

CCA represents about 15% of primary liver cancers, but in Khon Kaen province in

northeastern Thailand, CCA has been recorded to be as high as 90% of primary liver

cancers (Young et al. 2010). The majority (90-95%) of CCA arise from the extrahepatic

duct tissue and 5-10% from the intrahepatic ducts in Western countries. In Khon Kaen,

most cases are intrahepatic and arise in the upper hepato-duodenal ligament, extend into

the liver and usually near major blood vessels making early evaluation difficult and

resectability poor (Sripa et al. 2011). It has been proposed that ~ 70 people out of 100,000

infected with O. viverrini for a lifetime will develop CCA (Haswell-Elkins et al. 1994;

Parkin 2006). The prognosis is extremely poor and most patients diagnosed with CCA are

dead within a year (Sripa et al. 2010). Clonorchis sinensis, in Korea, is also associated with the development of CCA but at a rate of more than 5 times lower than that seen with

O. viverrini (Smout et al. 2011).

1.2.4. Pathogenesis

The etiology of liver fluke-induced CCA is multi-factorial (Figure 4). Three primary mechanisms are hypothesized to contribute to the carcinogenesis associated with chronic infection: (1) mechanical irritation and damage, (2) host inflammatory response, and (3) effects of excretory/secretory (E/S) products from the fluke. Mechanical irritation caused by the fluke’s oral and ventral suckers and the effect of that persistent epithelial damage causes constant cell division in an attempt to repair the ongoing damage (Sripa et al. 2007; Smout et al. 2009). The fluke excretory/secretory (E/S) products have been associated with biliary epithelial hyperplasia and increased susceptibility to DNA damage from carcinogens (Khurana et al. 2005) as well as interfere with apoptosis and stimulate cell proliferation in human CCA cell lines (Thuwajit et al. 2006). Exposure to exogenous carcinogens such as N-nitroso compounds found in fermented and preserved foods and the induction of endogenous nitrosamine by O. viverrini has also been implicated in the carcinogenesis of CCA (Srivatanakul et al. 1991; Satarug et al. 1998).

Chronic inflammation caused by long term infection is known to stimulate hyperplasia and proliferation, infiltration by lymphocytes and macrophages as well as fibrosis of the bile ducts, which are consistent histopathological findings in affected livers

(Mairiang and Mairiang 2003; Khurana et al. 2005). In addition to the localized response to the fluke, the E/S products stimulate inflammation in the first order bile ducts that are too small for the flukes to inhabit (Sripa and Kaewkes 2000).

Figure 4. Proposed pathways of pathogenesis of O. viverrini induced cholangiocarcinoma. There appear to be three distinct pathways: (1) mechanical damage from the flukes feeding to the biliary epithelium (yellow arrows); (2) inflammation- induced immunopathology (blue outlined arrows); and (3) direct effects of E/S proteins on

11 the microenvironment (red arrows) converge to cause oxidative DNA damage and chronic overstimulation of cell proliferation. (Smout et al. 2011)}(permission requested).

1.2.5. Diagnosis

Diagnosis is routinely based on fecal examination for fluke eggs using formalin- ether, modified Kato-Katz thick smear, and/or Stoll’s egg count (Kaewpitoon et al. 2008) due to non-invasiveness, cost, and ease. Fecal examination alone is not always diagnostically accurate due to potential false positives from eggs of intestinal flukes having a similar appearance to O.viverrini or false negatives in cases of light infection or bile duct obstruction (Upatham and Viyanant 2003). PCR-based amplification of parasite

DNA from stools is highly specific, but its sensitivity is no better than formalin-ether and

Stoll’s egg count. Several serologic tests have been developed but these tests are prone to show false-positive results due to cross-reactivity to other parasites. A recent study was performed to establish a LAMP-based PCR approach for the rapid and sensitive diagnosis of O. viverrini in stool samples. The loop-mediated isothermal amplification (LAMP) method was developed about 10 years ago. This method can amplify DNA with rapid, efficient, high specificity without a thermocycler using visual detection of turbidity to detect DNA amplification. It has been used successfully to diagnose infection with helminth parasites such as C. sinensis and S. japonicum (Arimatsu et al. 2012). The

LAMP PCR method for O. viverrini can provide results from a stool sample within 40 minutes with a limit of DNA detection of 10-3 ng DNA/µl. There appears to be no cross reaction with other intestinal flukes. This evolving technology is simple, requires minimal

12 equipment, and is practical for use in areas of mixed food-borne trematode infections

(Arimatsu et al. 2012).

1.2.6. Treatment

The treatment of choice for opisthorchiasis according to WHO guidelines is a single oral dose of praziquantel between 40-50 mg/kg (Strandgaard et al. 2007). There is no clinically relevant resistance to this drug known in humans at this time. Recently several drug candidates have been tested with varying amounts of success. Some promising candidates are the antimalarial drugs, artemether and artesunate, which caused large decreases in the worm burden of O. viverrini-infected hamsters and mefloquine an oral malarial prophylactic. Mefloquine, developed at Walter Reed Army Institute of

Research, was tested at a single 300mg/kg oral dose for efficacy against an adult O. viverrini infection in hamsters. This drug dosage resulted in a 96% reduction in the adult fluke burden. (Keiser et al. 2010).

1.3. SIGNALING/SIGNAL TRANSDUCTION

Cell signaling initiates a cascade of intracellular reactions that control practically all facets of cell behavior and homeostasis (Cooper and Hausman 2007). Cell signaling has become a popular research focus because interruption of many of the signaling pathways controlling cellular homeostatic activities has been shown to result in disease states. Signaling molecules range in complexity from simple gases such as nitric oxide

(NO) to proteins and vary in their mechanism of action on their targets. The signaling molecules containing the widest variety of functions are peptides, which range in size

13 from a few to more than a hundred amino acids and include neuropeptides, neurohormones, hormones, and growth factors (Cooper and Hausman 2007). Many of the molecules responsible for cell to cell signaling bind to receptors on the surface of the target cell activating or transmitting the signal internally. Some of the receptors contain gated ion channels that directly control the access across the plasma membrane, e.g. glucose transport or neurotransmitters. Others act by transmitting a signal to intracellular proteins by binding to a receptor on the membrane surface, thereby initiating a chain reaction culminating in programmed gene expression (Cooper and Hausman 2007). Two well-known examples of signal transmitting pathways are the transforming growth factor-

β (TGF-β) pathway responsible for mediating a large number of physiologic processes, and the protein tyrosine receptors which include the growth factors (fibroblast growth factor (FGF), nerve growth factor (NGF), and epidermal growth factor (EGF) (Plowman et al. 1999).

Caenorhabditis elegans was one of the first multicellular organisms to have its genome sequenced (The C. elegans Sequencing Consortium 1998). Many of the proteins identified as signaling proteins in the C elegans genome were found to be similar to those identified in humans thus building the foundation for research into other organisms and signaling pathways (Plowman et al. 1999). Research into the signaling molecules of parasitic platyhelminths, such as Schistosoma mansoni, was first reported in the early

1970s. An initial study addressed the effects of neuropeptides and the tryptaminergic and dopaminergic responses of S. mansoni (Tomosky et al. 1974). In 1992, Wiest et al. examined the regulatory roles of protein kinase C and guanine binding-nucleotide protein

(G-protein) in parasite development as well as the activation of phospholipase C and

production of inositol phosphates in S .mansoni (Wiest et al. 1992a; Wiest et al. 1992b).

Subsequently, genes were characterized that encode many signal transduction functions

in S. mansoni, including epidermal growth factor receptors (Shoemaker et al. 1992),

transforming growth factor receptor (Davies et al. 1998), and receptor serine/threonine

kinases (Forrester et al. 2004; Osman et al. 2006). Numerous intermediates involved in

the protein tyrosine kinases (PTK) receptor-initiated pathways have been characterized in

S. mansoni (Bahia et al. 2006; Bahia et al. 2007; Ludolf et al. 2007) and Echinococcus

multilocularis (Spiliotis et al. 2003; Zavala-Gongora et al. 2006). The protein tyrosine

kinase (PTK) pathways include cell surface receptors that are directly linked to

intracellular enzymes and phosphorylate their substrate proteins on tyrosine residues.

This family of receptors contains polypeptide growth factors such as fibroblast growth

factor receptor (FGFR) and epidermal growth factor receptor (EGFR) involved in the

control of animal cell growth and differentiation (Knobloch et al. 2007).

1.3.1. Protein Tyrosine Kinases

Protein tyrosine kinases (PTKs) play a key role in signal transduction and are important components of intracellular and extracellular communication (Hanks et al.

1988). They are involved in several biological processes such as cytoskeleton reorganization, cell migration, cell adhesion, as well as developmental and differentiation of cells (Bahia et al. 2006). PTKs can be found (1) in the nucleus (2) free in the cytoplasm or (3) anchored in the cell membrane. There are two major classes of PTKs, receptor tyrosine kinases (RTKs) and non-receptor tyrosine kinases (NRTKs), also called cellular or cytoplasmic tyrosine kinases. RTKs are located partially in the extracellular domain

and have a portion on the cytoplasmic side of the cell membrane. They are activated by the

binding of a ligand to a specific site which begins the signaling cascade (Alberts et al.

1994). NRTKs are intracellular and bind to activated phosphotyrosine residues on the PTK

(Neet and Hunter 1996). NRTKs share highly conserved non-catalytic domains, referred to as SH2 and SH3domains. One of the primary features of the NRTK is the SH2 domain.

It is a small protein that binds specifically to tyrosine-phosphorylated peptides and plays an important role in the transduction of the signals through the cell (Machida et al. 2003).

1.3.2. Fibroblast growth factor (FGF) pathway

Fibroblast growth factors (FGFs) consist of 10 different growth factors that control cellular processes such as growth, differentiation, and cell migration. FGFs induce biological responses by binding to and activating a family of cell-surface receptors called

FGF receptors that have intrinsic protein tyrosine kinase (PTK) activity. Once activated, the receptors will dimerize and autophosphorylate several tyrosine residues (Kouhara et al.

1997). The autophosphorylation sites within the catalytic PTK core are involved in

regulation of enzyme activity, while autophosphorylation sites in other regions serve

directly as binding sites for the assembly of many signaling proteins (such as multiple

Grb/Sos complexes that can activate the Ras/mitogen activated protein (MAP) kinase)

(Hadari et al. 2001). Cellular tyrosine kinases lacking catalytic activity called adaptor or

docking proteins relay key events of signal transduction from upstream components, such

as the FGF receptors, to downstream elements (Gotoh 2008).

Figure 5. Schematic representation of one of the pathways activated through FGF

receptor 1.

Fibroblast growth factor receptor substrate 2 (FRS2), also known as SNT-1 (Suc1- associated neurotropic factor target) is a lipid-anchored docking or adaptor protein that has multiple tyrosine phosphorylation sites and forms a complex with growth factor receptor binding protein 2 (Grb2) and guanine nucleotide releasing tyrosine phosphate factor (Sos) to activate signaling pathway (Figure 5) (Kurokawa et al. 2001). FRS2 becomes heavily phosphorylated with FGF receptor activation, recruiting Grb2 and Shp2 at the SH2 domains (Hadari et al. 2001). Since these components can’t associate without the FRS2 in mammalian hosts, it is the crucial connection between the activated receptor and the various downstream signal transduction pathways (Lo et al. 2010).

An adaptor-like protein, ROG-1, was described in C. elegans to have similar functions to FRS2 in vertebrates. It is required to activate the Ras/MAPK pathway which is necessary for oocyte development (Matsubara et al. 2007). The ROG-1 contains only a

PTB domain which is most homologous (36-47%) to the SNT or FRS2 family of adaptors

among Homo sapiens. The rog-1 gene is preferentially expressed in germ cells where it is

essential for oocyst development. Its action is up-stream of the C.elegans Ras (let-60) and

positively regulates the Ras-MAPK pathway that permits germ cells to produce oocysts

(Matsubara et al. 2007).

In vertebrates, FGFRs must utilize FRS2 to a transmit signals from the activated

receptor to the Grb2 and its SH2 domains (Hadari et al. 2001). In C. elegans, a FGFR,

EGL-15, has been identified and is required for several processes including sex myoblast

migration and fluid homeostasis. It is very structurally similar to mammalian FGF

receptors although it does contain an additional extracellular domain. C.elegans also has a

Grb2-like protein called SEM-5. Unlike vertebrates, SEM-5 can interact with EGL-15 directly without the need of ROG-1, the FRS2-like molecule. In C.elegans, ROG-1 is not involved in FGF signal transduction but stimulates activation of different Ras/MAPK pathways critical to germline progression (Lo et al. 2010).

In Drosophila sp., two FGF receptors have been identified, HEARTLESS AND

BREATHLESS, and are essential to early migration and patterning of the embryonic mesoderm and proper branching of the tracheal system, respectively (Michelson et al.

1998). Heartbroken, an FRS2-like adaptor protein, was found to act downstream of both

HEARTLESS and BREATHLESS to stimulate the Ras/MAPK pathway by way of RAS1.

Heartbroken was shown to function upstream of RAS1 or parallel to and convergent with

RAS1 to simulate the Ras/MAPK cascade. Heartbroken does not have any effect on the epidermal growth factor (EGF) receptor dependent embryonic functions and appears to

have specificity for the developmental responses caused by FGF receptor signaling

(Michelson et al. 1998). This relationship is similar to FRS2 in mammalian species.

In Schistosoma mansoni, there have been several NRTKs described in the literature

although none considered FRS2-like. There are four NRTKs specifically identified in

schistosomes – TK5, TK4, TK3, and SmFes. TK3 is a NRTK ortholog of the Src kinase family, containing both SH2 and SH3 domains, and has a direct effect on mitogenic

processes and function in the organization of the cytoskeleton in the gonads of

schistosomes (Kapp et al. 2004). TK5 is also a member of the Src kinase family and the

first member of the Fyn subfamily identified in invertebrates. It appears to play a role in

gut formation and/ or function and appears to have a role in embryogenesis (Kapp et al.

2001). TK4 is the NRTK ortholog to the Syk family containing two SH2 domains and one

tyrosine kinase domain. It has been suggested to have a role in germ cell development. It

is found to be transcribed in larval stages, miracidia and cercariae, as well as maturing and

mature adult stages (Knobloch et al. 2002). The last NRTK, SmFes, is similar to Fes/fps

PTK subfamily and is the first Fes described in helminthes. It is believed to play a role in

the signal transduction pathway used for larval transformation following penetration of

intermediate and definitive hosts (Bahia et al. 2006).

In humans, two closely related yet discrete FRS2s have been identified, FRS2α and

FRS2β (Ong et al. 2000). Their structures are similar (Figure 6) but their functions appear

to differ. FRS2α acts as a coordination center of signaling for FGF receptors and assists

in the promotion of signals to the Ras/MAPK and Ras/ERK pathway, as well as to other

receptor tyrosine kinases (RTK). FRS2β seems to have an inhibitory effect on certain

RTKs although both can stimulate the Ras/ERK pathway (Gotoh 2008).

Figure 6. Structural comparison of human FRS2α and FRS2β (Gotoh 2008) (used with permission).

Many docking proteins including FRS2 share a common structure. A myristylation domain on the N-terminus anchors FRS2 to the intracellular surface of the membrane and

a phosphotyrosine binding (PTB) domain mediates direct association with activated

receptor tyrosine kinases (Ong et al. 2000). There are also multiple tyrosine

phosphorylation sites on the carboxy-terminus which bind to either the SH2 domains of

Grb2 stimulating the Ras/MAPK and to SH3 domains to Shp2 to stimulate Ras/ERK

pathway (Gotoh 2008). The Ras/MAPK signaling cascade is essential for growth factor-

induced cell proliferation and differentiation (Kouhara et al. 1997).

1.3.3. TGF-β Signaling Pathway

Information is conveyed from the cell surface to the nucleus via intracellular

signal transduction pathways that allow the cell to respond, through changes in gene

expression, to stimuli from its environment. Many of the same pathways may activate and transmit signals at the host-parasite level, as well as to the nuclei throughout the body

of the parasite, to regulate expression of genes involved in many homeostatic processes

(Loverde et al. 2007). One of the “best-characterized signaling pathways” in trematodes,

specifically schistosomes, is the TGF-β pathway (Knobloch et al. 2007). The

transforming growth factor-beta (TGF-β) family regulates a large number of physiologic

processes including growth and differentiation, adhesion, cell division, developmental

patterning and tissue repair, and apoptosis (Zavala-Gongora et al. 2006). The TGF-β

superfamily can be divided based on sequence homology and downstream pathway

activation into two subfamilies, the TGF-β/Activin subfamily and the bone

morphogenetic protein (BMP) subfamily (Freitas et al. 2009).

Binding of cytokines to TGF-β receptors associated with the cell surface initiates

signal transduction. The two receptors are transmembrane serine/threonine kinases named

type I and type II. The binding of the ligand to the type II receptor stimulates

phosphorylation which subsequently activates the type I receptor (Zavala-Gongora et al.

2006). Activated type I receptor phosphorylates receptor-regulated Smad proteins (R-

Smad) which complex with common-Smads or CoSmads, traverse the nuclear membrane,

and regulate gene expression (Beall and Pearce 2001) (Figure 7). There are also

inhibitory Smads that prevent the signal from reaching the nucleus by either binding to

Type 1 receptors and/or Smad 4 inhibiting the transduction of the signal e.g. Smad 6 and

7 in vertebrates (Loverde et al. 2007). The two subfamilies activate distinct classes of Smad

proteins. Smads 2 and 3 are activated by the TGF-β subfamily while Smads 1, 5, and 8

are activated by the BMP subfamily (Freitas et al. 2009). Several of the elements from

the TGF-β signaling pathway in S. mansoni have been characterized including a type II

receptor (Forrester et al. 2004; Osman et al. 2006), type I receptor (Davies et al. 1998), several Smad proteins (Beall and Pearce 2001; Osman et al. 2001; Osman et al. 2004;

Carlo et al. 2007) and one member of the TGF-β subfamily, activin (Freitas et al. 2007).

TGF-β pathways in schistosomes have many varied roles within the life cycle especially

in egg embryogenesis involving the vitelline cells, female reproductive development,

host-parasite interaction, and even parasite-parasite interaction (Loverde et al. 2007).

Figure 7. Schematic of the TGF-β pathway (adapted from (Knobloch et al. 2007)).

The structure of S. mansoni TGF-β receptor type 1(SmRK1) has been shown to have an extracellular domain, transmembrane domain, a GS-box, and a serine/threonine

kinase region (Beall and Pearce 2001). This corresponds to other known orthologues of

TGF-β receptor type 1 from Echinococcus multilocularis, Drosophila melanogaster,

Crassotrea gigas, and human TGF-β receptor type 1 (Zavala-Gongora et al. 2006)

(Figure 8).

Figure 8. Schematic of the structure TGF-β receptor type I (adapted from (Beall

and Pearce 2001)).

1.4. APOPTOSIS

Apoptosis, or programmed cell death, is a mechanism used to control cell

proliferation or respond to DNA damage and is central to normal homeostasis in

eukaryotes (Ghobrial et al. 2005). Excessive apoptosis or interruption of the apoptotic

process has been shown to be associated with the development of pathological conditions

such as Alzheimer’s disease, Parkinson’s disease, neuroblastoma, hepatocellular

carcinomas, gastric carcinomas, and advanced colorectal carcinomas. Alteration in the

expression or activity of any of the components of the apoptotic pathway could contribute

to a pathological state (Ho and Hawkins 2005). Another cell signaling system which has

also been well-characterized in many organisms is the apoptotic pathway. Caspases, a

category of cysteine proteases, are integral components of the apoptotic pathway and

serve as either initiators or effectors of cell death.

1.4.1. Caspases

Caspases are a family of cysteine proteases from the MEROPS clan CD, Family

C14 that have diverse roles in inflammatory responses and apoptosis. Some of the features common to all members of the family include the catalytic cysteine residue in the active site and the ability to cleave on the carboxyl side of aspartate residues (Ho and Hawkins

2005). Caspases 1, 4, 5, and 11 are reported to play roles in inflammatory responses and cytokine maturation, while the other ten known caspases are classified as either initiators or executioners depending on their entry point into the apoptotic pathway (Figure 9A)

(Boatright and Salvesen 2003). Caspase 13, originally thought to be a separate human caspase, is a bovine orthologue of human caspase 4 (Koenig et al. 2001). The initiator or apical caspases (caspases 2, 8, 9, 10, and 12) function upstream within apoptotic signaling pathways, activating the executioner caspases directly or indirectly through proteolysis or via a secondary messenger mechanism, respectively. The executioner (or effector) caspases, caspases 3, 6, 7, and 14, are the immediate “executioners” by cleaving certain substrates that cause the death of the cell (Ho and Hawkins 2005).

Caspase 9 is one of the apical caspases that initiate the intrinsic apoptotic pathway

(Figure 9B). The intrinsic signaling pathway can be activated by ionizing radiation, chemotherapeutic drugs, mitochondrial damage, and certain developmental cues.

Mitochondria release cytochrome c which allows the caspase activation and recruitment domain (CARD) of the apoptotic protease-activating factor 1 (Apaf-1) to interact with the

CARD domain of caspase 9 (Riedl et al. 2005). Procaspase 9 is maintained in an inactive state as a zymogen in the cellular cytoplasm, forming dimers when the CARD regions are

24 interacting with the CARD of Apaf-1. The caspase 9 is recruited by the Apaf-1 and ATP into a heptameric complex called an apoptosome, inducing a conformational change in caspase 9 which facilitates autocatalysis (Boatright and Salvesen 2003; Ho and Hawkins

2005). In response to binding to the apoptosome, the large and small subunits of the caspase 9 are cleaved at the interlinker peptide (Twiddy and Cain 2007). Once activated, caspase 9 processes the downstream executioner caspases 3 and 7 (Figure 9B); the executioner proteases display activities against enormous numbers (>400) of natural protein substrates (the degradatome) within the cell, inducing gelsolin, cochaperone 23, serine/threonine kinase rho-associated kinase and lamins during the demolition phase of apoptosis (Stennicke and Salvesen 2000;Stennicke 2000; Luthi and Martin 2007; Walsh et al. 2008)(Figure 9A).

Figure 9. (A) Caspase cascade in apoptotic cells (adapted from (Thornberry 1998));

(B) Schematic overview of the intrinsic apoptotic pathway (adapted from (Boatright and

Salvesen 2003)).

Caspase 9 orthologues have been described in many well studied non-mammalian

organisms such as Dronc in D. melanogaster (Dorstyn et al. 1999), CED-3 in C. elegans

(Yuan et al. 1993), caspase 9 in Dicentrarchus labrax (Reis et al. 2007), and caspase 9 in

Xenopus laevis (Nakajima et al. 2000) but none have been described in trematodes. CED-3 caspase of C. elegans has been shown to be instrumental in embryogenesis and in neural regeneration (Pinan-Lucarre et al. 2012) while Dronc caspase has been found also to be important in the programmed cell death associated with embryogenesis in D. melanogaster

(Quinn et al. 2000).

All three of the signal pathways mentioned above are essential components of

homeostasis and development in most organisms. Their study in O. viverrini will help

increase our understanding of the physiology of this parasitic fluke as well as uncover

potential objectives for therapeutic interactions.

Chapter 2: DISSERTATION HYPOTHESIS AND AIMS

To reiterate, Opisthorchis viverrini is an important human food-borne pathogen endemic in mainland Southeast Asia, predominantly Northeast Thailand and Laos (Sripa et al. 2007; Hotez et al. 2008). Infection with this liver fluke causes opisthorchiasis, which is associated with a number of hepatobiliary abnormalities, including cholangitis, obstructive jaundice, hepatomegaly, cholecystitis, cholelithiasis and cholangiocarcinoma. O. viverrini infection induces pathological changes including epithelial desquamation, epithelial and adenomatous hyperplasia, goblet cell metaplasia, inflammation, periductal fibrosis and granuloma formation (Sripa and Kaewkes 2002). Experimental and epidemiological findings implicate O. viverrini infection in the etiology of cholangiocarcinoma (CCA), cancer of the bile ducts reviewed in (Smout et al. 2011; Sripa et al. 2011). O. viverrini is one of only three metazoan pathogens of humans that are considered to be Group 1 carcinogens by the

International Agency for Research on Cancer (IARC), http://monographs.iarc.fr/ENG/Classification/crthgr01.php (Hou and Pang 1956; IARC 1994;

Bouvard et al. 2009).

A number of studies suggest that inflammation of the bile ducts caused by O. viverrini infection and induction of endogenous nitric oxide are important factors for cholangiocarcinogenesis (Haswell-Elkins et al. 1994; Ohshima et al. 1994). Other studies have related cell proliferation induced by O. viverrini, its antigens and metabolites, and exposure to exogenous carcinogens such as nitrates, nitrites and even N-nitroso compounds found in fermented or preserved foods such as pla-ra (traditional Thai fermented fish), as factors involved with parasite-associated cholangiocarcinogenesis

(Migasena et al. 1980). In addition, the pathogenesis of O. viverrini-mediated

hepatobiliary changes, which in turn can lead to CCA, can be attributed to greater or

lesser degree to mechanical irritation caused by the liver fluke suckers and to the action

of molecules excreted or secreted by the parasite (Sripa et al. 2007).

Accordingly, a current focus of investigation into O. viverrini-associated CCA deals with characterization of the genes and proteins and how these proteins function within the fluke as well as any possible interaction with the host. Understanding how this fluke is similar to or different from other better known parasites such as Schistosoma sp. will help open further areas of study. As part of this larger endeavor (e.g.,(Laha et al.

2007; Young et al. 2010)), my dissertation studies addressed a limited suite of expressed genes of O. viverrini. An initial gene discovery program in 2007 had identified a panel of

20 or so expressed sequence tags that were predicted based on deduced structures to be either secreted or membrane-associated parasite proteins that theoretically would interact with the infected human hosts at the host-parasite interface (Laha et al. 2007). Here I focused on three of these transcripts, OvAE 561, OvAE 1563, and OvAE 22, that initial analysis by Laha et al. (2007) indicated might encode a caspase, a fibroblast growth factor receptor and a transforming growth factor beta (TGF-β) receptor. My dissertation research concentrated on these three proteins which, while dissimilar to each other in terms of predicted functions, all can be categorized as involved with signaling and signal transduction.

2.1. HYPOTHESIS

Gene discovery approaches have indicated that orthologs of caspase 9, fibroblast growth factor receptor substrate 2 (FRS2), and TGF-β receptor 1 are expressed by

Opisthorchis viverrini. It can be expected that these molecules are structurally and biochemically similar to orthologous molecules from phylogenetically similar organisms as well as to those of humans and more distantly related species. Appropriate experimental analyses to include phylogenetic comparisons and functional activity studies of recombinant forms of these O.viverrini orthologues should confirm their identity, inform their likely function, and enhance our understanding of the physiology of this carcinogenic liver fluke.

2.2. AIMS

The following four aims were undertaken in order to address the hypothesis that

Opisthorchis viverrini deploys caspase 9-like protease, FRS2, and TGF-β receptor type I signaling proteins.

Aim 1: Bioinformatics and phylogenetic analyses of the deduced amino acid sequences of the caspase 9-like protease, FRS2, and TGF-β receptor type I.

Aim 2: Recombinant expression in Escherichia coli and affinity purification of the recombinant fluke caspase 9 and FRS2.

Aim 3: Biochemical characterization of the O. viverrini caspase 9 to include substrate and inhibition profiles.

Aim 4: Functional studies of the O. viverrini signaling molecules to include immunolocalization of the proteins in adult flukes and analysis of developmental expression by RT-PCR.

The findings of these studies are described later in Chapters 4. Therefore in Chapter

5 follows a general discussion of the findings and integration of these findings into the larger literature dealing with biology and physiology of O. viverrini and related flukes.

Chapter 3: MATERIALS AND METHODS

3.1. cDNA LIBRARY

In 2007, Dr. Thewarach Laha, from Khon Kaen University, and colleagues began a gene discovery program for O. viverrini using Expressed Sequence Tags (ESTs). The

ESTs were generated from an adult O. viverrini cDNA λ phage library using the SMART cDNA kit (BD Biosciences, San Jose, CA). Five thousand clones were randomly selected from the library, sequenced, and deposited into GenBank. One thousand thirty two contigs were identified as representing ~14% of the entire transcriptome. Of those contigs, open reading frames (ORFs) were identified that represented secreted, excreted, or transmembrane proteins with known roles in tumorigenesis (Laha et al. 2007). From these, OvAE561 (GenBank accession # EL619243), OvAE1563 (EL620245), and

OvAE22 (EL618704) were selected for characterization in the studies described in this dissertation.

3.2. SEQUENCING AND BIOINFORMATICS

3.2.1. Sequencing/cloning

The nucleotide sequences of the ESTs were determined with the aid of the Accelyrs

3.0 software program (Accelrys, Inc, San Diego, CA). Vector-specific and gene-specific primers were designed (Table 1) and purchased from Sigma-Aldrich (St. Louis, MO).

The lyophilized primers were reconstituted with PCR-grade distilled water to a stock concentration of 500 pmol/µl then stored at -80°C. A working stock for each primer was

prepared using 1 ul of 500 pmol/µl stock solution and 49 µl of PCR grade distilled water,

stored at -20°C, giving a final concentration of 10 pmol/µl.

Table 1. Gene-specific primers used for contig sequencing

The cDNA encoding the adult developmental stage of O. viverrini was amplified from pTripleEx2 OvAE561, OvAE1563, and OvAE22 clones (Laha et al. 2007) using 50

µl polymerase chain reactions (PCR). The reaction contained 25µl of GoTaq® Master

Mix (Promega Corp., Madison, WI), 1 µl of vector-specific primer, 1 µl of a gene-

specific primer, and 1 µl of O. viverrini cDNA. The PCR programming consisted of an

initial denaturation step of 95°C for 2 minutes, followed by 30 cycles of 95°C for 30

seconds of denaturation, 50°C for 1 minute for annealing, and 72°C for 1 minute of

extension and a final extension of 72°C for 10 minutes on the Bio-Rad iCycler machine

(Bio-Rad Laboratories, Hercules, CA). The PCR reaction was checked for amplification

by running 10 µl of PCR product on a 1% agarose gel in 1X TAE (Tris-acetate buffer

with EDTA, pH8.0) on a Sub-cell GT horizontal electrophoresis apparatus (Bio-Rad,

Hercules, CA) at 100 V for 55 minutes.

The 4 µl of verified PCR product was mixed with 1 µl of the dilute salt solution (50

® mM NaCL, 2.5 mM MgCl2) and 1µl of the TOPO vector from the TOPO TA Cloning kit (Invitrogen, Carlsbad, CA) and allowed to incubate at room temperature for 5 minutes. Following the incubation, the vial was placed on ice. Two µl of the TOPO reaction was placed into 1 vial of OneShot® Electrocompetent E. coli cells, gently mixed,

and the sample transferred to a 0.1 mm disposable cuvette and electroporated at 1200 V

on the bacteria default setting (Electroporator Gene Pulsar XCell, Bio-Rad, Hercules,

CA). One ml of SOC medium (Invitrogen, Carlsbad, CA) was added to the cuvette and

the entire volume was transferred to a 5 ml snap cap polystyrene tube (BD Falcon™, BD

Bioscience, San Jose, CA) and incubated at 37°C on 225 rpm shaker for 60 minutes.

Fifty µl and 100 µl of the cloning reaction was spread onto two LB agar/kanamycin

(50µg/ml) selection plates and incubated overnight at 37°C.

Colonies were selected from the LB agar/kanamycin plates and grown in 5 ml of

LB broth with 5 µl of kanamycin (50 mg/ml) in the shaker incubator at 37°C, 225 rpm,

overnight. The next day, mini plasmid preparations were isolated on all chosen colonies

using the GenElute™ Plasmid Mini Prep Kit (Sigma-Aldrich, St. Louis, MO) products

and protocol. Restriction digestion of these colonies was carried out to determine if the

TOPO cloning was successful and insertions of the expected size were present. The 10

µl digestion contained 8 µl of DNA from the plasmid miniprep, 1µl of EcoRI enzyme

(New England Biolabs, Ipswich, MA), 1 µl of 10X EcoRI Buffer (New England Biolabs,

Ipswich, MA) and was incubated at 37°C for 4 hours. The restriction digest was run on a

1% agarose gel in 1X TAE buffer using horizontal electrophoresis, as outlined above,

against 5 µl of a Quick Load® 1 kb ladder (New England Biolabs, Ipswich, MA). The

DNA was visualized using ethidium bromide staining (1 µl per 250 ml 1X TAE) and the

Gel Doc™ Imaging system (Bio-Rad, Hercules, CA). The positive clones were sent for

nucleotide sequencing (Davis Sequencing, Davis, CA) using primers designed from both

the gene-specific and vector-specific sequences to provide complete coverage of the

contigs.

3.2.1. Bioinformatics

The sequences were analyzed by the use of several programs including Accelrys

3.0, NCBI (www.ncbi.nlm.nih.gov) BLASTp for potential orthologues and ORF finder

for complete open reading frames, ExPASy (http://expasy.org) for molecular mass and

conserved domains, SignalP(www.cbs.dtu.dk/services/SignalP) for presence of a signal

protein and IMPred 3.0 (www.ch.embrut.org/software/TMPRED form.htm) for presence

of transmembrane domains.

3.2.2. Phylogeny

The phylogenetic analysis was carried out with CLUSTAL W (Thompson et al.

1994) using local alignment and BLOSUM substitution matrix along with Bootstrap support values of 1000 in the Accelyrs 3.0 program and POY4 (American Museum of

Natural History, New York, NY). Input data for the analyses were assembled from

BLASTp alignments matched with orthologues and informative matchs from the

MEROPS database (http://merops.sanger.ac.uk) using Bioedit

(http://www.mbio.ncsu.edu/BioEdit/BioEdit.html) and Genedoc

(http://www.flu.org.cn/en/download-47.html) programs.

3.3. EXPRESSION OF RECOMBINANT PROTEINS

3.3.1. Cloning into pET-50(b)+

To facilitate recombinant plasmid preparation, the plasmid DNA containing the

complete ORFs had unique restriction sites, Kpn1 and Sac1, and clamps engineered into

the 5’-and the 3’ ends by PCR using PCR SuperMix High Fidelity (Invitrogen, Carlsbad,

CA) polymerase which allowed for unidirectional cloning into the pET-50b(+) plasmid

(Novagen, Madison, WI) (Table 2). The 50µl PCR reaction was carried out at 94°C

denaturation for 30 seconds followed by 35 cycles (94°C 30 second denaturation, 55°C

1.5 minute annealing, and 68°C 5 minute extension), and a final extension at 72°C for 10

minutes in the iCycler® (Bio-Rad, Hercules, CA). The PCR product was run on a 0.8%

agarose gel and gel purified using the PureLink™ Quick Gel Extraction Kit (Invitrogen,

Carlsbad, CA) followed by double restriction digest with Kpn1 (Promega, Madison WI)

and Sac1(New England BioLabs, Ipswich, MA) restriction enzymes at 37°C overnight.

The pET-50b(+) (Novagen, Madison, WI) expression vector was prepared by double

restriction digestion at 37°C overnight using the Kpn1 and Sac1 restriction enzymes, as above. The vector was further prepared by 5’- dephosphorylation by Antartic®

phosphatase (New England BioLabs, Ipswich, MA) at 37°C for 30 minutes then

deactivated at 65°C for 5 minutes. The plasmid insert DNA and vector were both gel

purified again using the PureLink™ Gel Extraction Kit with final elution in 50 µl of warm

TE.

Table 2. Gene-specific primers with clamps and restriction sites for cloning into expression vectors

Ligation of the pET-50b(+) vector and the plasmid DNA was completed using T4

DNA Ligase and 10X Ligase Buffer (Promega, Madison, WI) in a 20 µl reaction at 16°C overnight. One Shot® Top 10 electrocompetent E. coli cells were transformed by the ligation product as described under section 3.2.1. using the pre-set setting for E.coli, 1 mm cuvette, 1.8 kV to stabilize the recombinant clone (Figure 10). Positive clones were identified by kanamycin resistance selection, restriction digestion, and verification of reading frames by sequencing (Davis Sequencing, Davis, CA).

Protein encoding ORF

Figure 10. pET-50b(+) expression vector with insertion site of ORF identified

(adapted from(TB418 2004))

3.3.2. Cloning into pET-45(b)+

The cDNA encoding of an O. viverrini pTripleEx2 clone OvAE561 (Laha et al.

2007) was modified to include unique restriction sites for Kpn1 and Sac1 and clamps on the 5’ and 3’ ends, respectively (Table 2) by PCR as described under section 3.3.1. The positive clones were recognized by ampicillin (100 µg/ml) resistance selection, restriction digestion, and verification of reading frames by sequencing (Figure 11).

OvAE561 (casp9) F1 origin (4801‐5248)

Lac operator T7 promoter

Bla (Ap) coding sequence (3819‐4676)

Lac I (752‐1864)

Ori (3058)

Figure 11. pET-45b(+) expression vector with insertion site of ORF identified

(adapted from(TB396 2010)).

3.3.3. Expression of recombinant O. viverrini proteins

Ligation products from cloning into pET-45b(+) or pET-50b(+) were used to transform BL-21 E. coli cells and recombinant clones were selected on ampicillin (pET-

45b(+)) or kanamycin (pET-50b(+)) containing agar plates. Recombinant protein expression of several randomly selected clones was induced by the addition of isopropyl

β-D-1 thioglactopyranoside (IPTG) (Sigma-Aldrich, St. Louis, MO) to the concentration of 1 mM at 37°C for 4 hours. Fusion protein expression was monitored by SDS-PAGE

(4-20% Tris-HEPES-SDS gels, Pierce, Rockford, IL) electrophoresis followed by staining with Coomassie Brilliant Blue R-250 (Bio-Rad, Hercules, CA).

To localize the expression of the protein to a specific fraction and verify the

identity of the protein being expressed, informative fractions of the induced culture were

analyzed. The total cell protein (TCP) fraction was assessed by removing 1 ml of the

well-mixed induced culture and centrifuging 10,000 X g for 1 minute at room temperature. The supernatant was discarded and the pellet allowed to dry inverted for 5

minutes. The pellet was resuspended in 100 µl of 1X phosphate buffered saline (PBS)

concentrating the original sample by 10X. 100 µl of 5X SDS sample buffer was added

and the sample was sonicated with a microtip at the following settings: 5 X 5 sec bursts,

output level 5.0, Misonix Sonicator 3000 (Misonix, Framingdale, NY). The sample was

heat denatured at 95°C for 5 minutes and then stored at -20°C until SDS-PAGE analysis.

The culture medium fraction was analyzed because many recombinant proteins that

are directed to the periplasm can locate to the culture medium through a ‘leakage’

phenomenon or damage to the cell envelope. 40 ml of the well-mixed culture was placed

in a pre-weighed tube and the cells harvested by centrifugation at 10,000 X g for 10

minutes at 4°C in a Sorvall RC6 Plus centrifuge (Thermo Fisher Scientific , Waltham,

MA). The medium was removed from the pellet and the pellet was placed on ice. One

ml of the medium was removed and spin-concentrated by centrifugation (YM-10,

Microcon® Centrifugal filter device, Millipore, Billerica, MA) at 6000 rpm for 15

minutes at 4°C combined with 5X SDS sample buffer, heat denatured at 95°C for 5

minutes, and then stored at -20°C until needed.

Because target proteins can be directed to the periplasm, the periplasmic fraction

was evaluated for soluble protein using the osmotic shock protocol described in the pET

System manual, 11th Edition (Novagen, Madison, WI) using the pellet resulting from the

centrifugation obtaining the medium fraction. Following the osmotic shock with 30 mM

Tris-HCl, 20% sucrose, pH 8 then ice-cold 5 mM MgSO4 on ice, the cells were

centrifuged for 10 minutes at 4°C 10,000 X g to pellet the non-dissolved components.

The supernatant was removed and concentrated by spin centrifugation for assessment of the soluble protein concentration. A portion of the fraction was mixed with an equal amount of 5X SDS sample buffer, heat denatured at 95°C for 5 minutes, and stored at -

20°C.

The soluble cytoplasmic fraction was separated from the insoluble cytoplasmic fraction using BugBuster Master Mix (Novagen, Madison, WI) following the protocol explained in the pET System Manual, 11th Ed to allow maximum recovery of active

soluble protein and determination of solubility of the target protein. Protease inhibitors were not included because of potential inactivation of the O. viverrini caspase cysteine protease. The final centrifugation was for 20 minutes at 16,000 x g in 4°C and the supernatant was harvested. A small aliquot of the supernatant was mixed with an equal volume of 5X SDS sample buffer, heat denatured as before and stored at -20°C.

The insoluble cytoplasmic fraction was analyzed by resuspension of the remaining pellet in BugBuster Master Mix and following the protocol outlined in the pET system manual with the final suspension in binding buffer (50 mM sodium phosphate, 300 mM sodium chloride, and 8M urea, pH7.0). A 100 µl of suspension was mixed with 5X SDS sample buffer, heat denatured, and stored at -20°C.

Figure 12. Flow Chart for Analysis of Cellular Compartments

100 ml of Overnight Express TB media + 100 μl Kanamycin (50 mg/ml)

1 ml sample Spin 10,000 X g for 1 min Insoluble Cytoplasmic Total Cell Resuspend in 100 μl 1X PBS Fraction Protein Sonicate 5 sec 5X Pellet ~1-2 gm 100 μl Heat denature >90°C 3 min

Spin 10,000 X g,10 min, 4°C Resuspend in same volume of Bug Buster Medium Set aside supernatant used in previous step Fraction Add 6 volumes of 1:10 diluted Bug Buster ~99 ml Vortex 1 min pellet Spin 5000 X g, 15 min, 4°C Discard supernatant Resuspend in 60 ml of 30mM Tris-HCl, 20% Sucrose, pH 8 Resuspend in 50 ml of 1:10 Bug Buster, vortex, etc Add 120 μl of 0.5M EDTA pH8 Repeat 2 more times Stir with magnetic bar at ambient,10 min Last time spin 16,000 X g, 15 min, 4°C Spin at 10,000 X g, 10 min, 4°C Pellet is ready for affinity purification Discard supernatant pellet Resuspend in 60 ml of ice-cold 5mM MgSo4 Stir with magnetic bar on ice, 10 min Spin at 10,000 X g, 10 min, 4°C Set aside supernatant Spin 16,000 X g, 20 min, 4°C

Soluble Cytoplasmic Resuspend in Bug Buster master mix Fraction Periplasmic pellet w/ rLysozyme & Benzonase nuclease ~5 ml Incubate on platform shaker, 20 min, Fraction ambient ~60 ml

The majority of protein was insoluble. Protein expression was induced with 1 mM

IPTG at 37°C for 4 hours. The culture was harvested by centrifugation at 12,000 x g, 10 min, at 4°C. The culture medium was removed and the pellet was lysed in binding buffer

(50 mM sodium phosphate, 300 mM sodium chloride, and 8 M urea, pH 7.0) at a ratio of

20 ml of binding buffer to 400 ml of starting culture. The suspension was subjected to sonication (10 x 5 sec burst, output cycle 5.0) followed by centrifugation at 14,000 rpm for 1 hour at 4°C. The supernatant was collected for protein purification.

3.4. ELECTROPHORESIS AND WESTERN BLOT ANALYSIS

3.4.1. SDS-PAGE electrophoresis

Protein expression was monitored by sodium dodecyl sulfate polyacrylamide gel

electrophoresis or SDS-PAGE (Precise® Protein gels (4-20% Tris-Hepes-SDS, 12-well

precast gels, Pierce, Rockford, IL) analysis to determine the approximate masses based

on migration through the gel gradient. A broad range protein standard (Prestained SDS-

PAGE Protein Standard, Bio-Rad, Hercules, CA) was included on gels for molecular

mass comparisons. The electrophoresis was done in the XCell SureLock™Mini-Cell

electrophoresis chamber (Invitrogen, Life Technologies, Grand Island, NY) with 1X Tris-

Hepes-SDS buffer at 150 V for 40 minutes on ice. The gel was then rinsed in distilled water for 5 minutes and stained for 60 minutes with Coomassie Blue for 60 minutes at room temperature on a rolling platform. The gel was destained with 40% methanol/40%

acetic acid solution for 60 minutes at ambient temperature. A final destain at ambient

temperature with 10% methanol/10% acetic acid solution overnight. The gel was visualized and documented under white light on the Bio-Rad Gel Doc™ imaging system.

3.4.2. Western blot

The recombinant enzyme was sized by electrophoresis as described in section

3.4.1. then electro-transferred to polyvinylidene fluoride (PVDF) (Bio-Rad, Hercules,

CA) membrane in 1X Tris-Glycine buffer with 20% methanol for 100V for 60 minutes.

The membrane was blocked in 5% skim milk with PBS containing 0.05% Tween-20 (1X

PBST) or 5% skim milk with TBS containing 0.05% Tween-20 (1X TBST), depending

on the monoclonal or other antibody to be used, overnight at 4°C.

A penta-His specific monoclonal antibody (Qiagen, Valencia, CA) was diluted

1:5000 (v/v) in 5% skim milk powder in 1X PBST and applied to the membrane for 1

hour at room temperature. The membrane was then washed three times for 5 minutes

each in 1X PBST. The membrane probed with the penta-His monoclonal antibody was

incubated in a 1:10,000 dilution (v/v) of goat anti-mouse IgG conjugated to horseradish

peroxidase (HRP) (Invitrogen, Carlsbad, CA) in 1X PBST for 75 minutes at room

temperature. The membrane was washed 5 times for 5 minutes at room temperature with

1X PBST for the first four washes and 1X PBS for the last wash. After the washing, the

signals were developed using chemiluminescence detection kit and protocol

SuperSignal® West Pico ECL (Pierce, Rockland, IL).

An S-protein HRP conjugate antibody (Novagen, Madison, WI) was periodically

used for Western blot analyses of pET-50b(+) expression. The S-protein system has a

ribonuclease S-protein cross-linked with horseradish peroxidase that interacts with a 15

aa S-tag peptide allowing detection of any recombinant protein combined with the S-tag

sequence. It was diluted 1:5000 in 5% skim milk powder dissolved in 1X TBST and

applied to the membrane for 30 minutes at room temperature. The membrane was rinsed

5 times for 5 minutes each in 1X TBST except for the last wash which was in 1X TBS.

After rinsing, the signal was developed using the same chemiluminescence detection kit

and protocol listed above.

The membranes were placed in plastic sheet protectors (Staples, Framingham, MA)

then placed on x-ray film (8” X 10” Blue X-Ray Film, Phenix Research products,

Candler, NC) in a film cassette holder (Kodak®, Sigma-Aldrich, St. Louis, MO) containing two rare earth intensifying screens (BioMax® Transcreen®, Sigma-Aldrich, St.

Louis, MO) for 5 seconds to 1 hour depending on the signal intensity. Development of films was performed using an automated film processor (Kodak, Rochester, NY).

3.5. PROTEIN PURIFICATION

The O. viverrini recombinant proteins were enriched and purified by affinity chromatography on TALON® resin (Clontech Laboratories Inc, MountainView, CA). The

protein was diluted 1:5 with binding buffer (50 mM sodium phosphate, 300mM NaCl, 8

M urea, pH 7.0) and passed over the cobalt resin chromatography column three times.

The column was washed with 5 volumes of binding buffer and bound protein eluted from

the resin by using 5 ml of elution buffer (50 mM sodium phosphate, 300 mM NaCl,

200mM imidazole, 8M urea, pH 7.0). The eluate was collected in 1 ml fractions and

evaluated by Coomassie stained SDS-PAGE and western blot analyses using broad range

protein standard for molecular mass comparison and informative antibody probes as

outlined in section 3.4.

3.6. REFOLDING

The pET-50b(+) O. viverrini recombinant fusion protein, following affinity

chromatography, was folded into its presumptive active conformation by the rapid dilution technique into 1X PBS, pH 7.4, 1 mM dithiothreitol (DTT), 0.5 M l-arginine, 1

mM reduced glutathione (GSH), 0.1 mM oxidized L-glutathione (GSSH) and 1 M urea

(Rudolph and Lilie 1996; Stennicke and Salvesen 1999; Middelberg 2002; Chen et al.

2009). Subsequently, the NusA fusion partner was cleaved from the refolded protein by digestion with HRV 3C protease (Novagen, Madison, WI) at 4°C for 16 hours. Efficiency

of cleavage and refolding was monitored by SDS-PAGE analysis and by western blot.

The western blots were hybridized with either anti-penta-His monoclonal antibody or S-

protein HRP conjugate as described in section 3.4.

The pET-45b(+) O.viverrini recombinant protein, was folded into an active

conformation, using the rapid dilution technique, in 1X PBS, 10% sucrose, 0.1% CHAPS,

and 10 mM DTT. The rapid dilution technique of refolding consists of 50 µl of purified protein eluate vortexed gently into 950 µl of buffer in a 1.5 ml microcentrifuge tube

(Eppendorf, Hamburg, Germany) and incubated overnight at room temperature. The tubes were spun at 14,000 rpm for 15 minutes at 4°C in a tabletop centrifuge (Centrifuge

5810, Eppendorf, Hamburg, Germany). The samples were spin concentrated down 10 X

using a 30,000 kDa Microcon® Filter centrifugation tube at 6000 rpm for 20 minutes,

snap frozen, and stored at -80°C.

3.7. CASPASE ACTIVITY AND INHIBITION ASSAYS

Activity and inhibition assays were performed on both the whole protein lysates of

adult worms as well as the refolded recombinant caspase enzyme expressed in E. coli.

Caspase activity of the recombinant protein was investigated using a luciferase based

assay (Caspase Glo-9® Assay, Promega, Madison, WI). This assay utilizes the caspase 9

specific substrate peptide LEHD covalently linked to aminoluciferin (Z-LEHD-

aminoluciferin). Aminoluciferin released by protein cleavage of the LEHD-

aminoluciferase substrate serves as a substrate for firefly luciferase that is included in the assay components. The generation of the ‘glow type’ luminescent signal is proportional to the amount of caspase activity present (TB333 2011).

Caspase Glo-9® Assay

Z‐LEHD ‐ substrate sequence specific for mammalian caspase 9 Ac‐LEHD‐CHO reversible inhibitor specific for caspase 9

Figure 13. Outline of Caspase Glo-9® assay (adapted from (TB333 2011)).

Adult O. viverrini worms obtained from experimentally infected hamsters (Laha et al. 2007) were snap frozen at -80°C. Subsequently, the worms were thawed to 4°C in 1X

PBS after which they were lysed in a tissue homogenizer (Kontes, Vineland, NJ). The lysate was subjected to sonication (3 X 10 sec bursts, output cycle 5, Misonix Sonicator

3000), after which it was clarified by centrifugation at 14,000rpm (20,000 x g), 4°C, 30 min. Protein concentration was measured at 280 nm using a spectrophotometer

(Nanodrop-1000, Wilmington, DE) after which the supernatant was aliquoted and stored at -80°C.

Recombinant human caspase 9 (BIOMOL International, Enzo, Plymouth Meeting,

PA) was included in the assay as a positive control, along with the inhibitors Ac-LEHD-

CHO (BIOMOL International, Enzo, Plymouth Meeting, PA), a caspase 9-specific

peptide aldehyde (Imao et al. 2006) and iodoacetamide (Sigma-Aldrich, St. Louis, MO),

a general inhibitor of cysteine proteases (Otto and Schirmeister 1997). Inhibitors were

added to the fluke sonicate 10 minutes before the addition of the substrate. Thereafter,

aliquots of 100 µl of sonicate with or without inhibitors were injected into 100µl aminoluciferin (Promega) in single luminometer tubes, covered with aluminum foil, and incubated at 24°C in the dark for one hour. Luciferase activity was measured as relative light units (RLUs) at 560 nm with a luminometer (Berthold Sirius, Pforzheim, Germany).

Triplicate samples were measured, with results presented as the average of the RLU readings per µg of fluke protein.

The refolded recombinant caspase enzyme activity was explored with the Caspase

Glo-9® (Promega, Madison, WI) assay kit following the 96-well plate protocol (Figure

13) described in the manual. The vehicle used throughout the assay was 10 mM HEPES, pH7.5 buffer in 96 well white-walled plate (F96 MicroWell™Plates, Nalge Nunc

International, Rochester, NY) with the recombinant human caspase 9 (0.1 U/well) positive control and Ac-LEHD-CHO caspase 9 specific inhibition (10 µM/well). The wells were mixed and incubated covered by aluminum foil at 24°C for 45 minutes. The plates were read on the Top Count-NXT scintillation and luminescence counter (Packard

Instrument Company, Meriden, CT) using the default luminescent setting for a 96 well plate. Luciferase activity was measured as reflective light units (RLUs) and results

presented as an average of duplicate or triplicate samples minus the average background

RLU per sec of protein.

Substrate specificity was further explored by evaluating the refolded recombinant

O. viverrini caspase 9 in the Caspase Glo-3,7® assay. A recombinant human caspase 3

(BIOMOL International, Enzo, Plymouth Meeting, PA) was included as a positive control, recombinant human caspase 9 (BIOMOL International, Enzo, Plymouth

Meeting, PA) was tested along with the recombinant O. viverrini caspase 9. The assay

was performed under the same conditions and parameters as described above for the

Caspase Glo-9® assay. Results calculated and reported in RLU readings per sec with

standard error reported.

3.8. PROTEIN SEQUENCING

The purified recombinant protein was run on a 4-20% gel as described in section

3.4.1. stained with Coomassie Blue. The gel was documented using the Gel Doc on

white light setting. The gel was packaged wet and shipped to Dr. Nicholas Sherman at

the University of Virginia W.M. Keck Biomedical Mass Spectrometry laboratory where

recombinant bands of 43 KDa and ~30 kDa were sequenced.

The gel pieces were transferred to siliconized tubes, washed, and destained in 200

µl 50% methanol overnight. The gel slices were dehydrated in acetonitrile, rehydrated in

30 µl of 10 mM DTT in 0.1 M ammonium bicarbonate then reduced at room temperature

for 30 minutes. The DTT solution was removed and the sample alkylated in 30 µl of 50

mM iodoacetamide in 0.1 M ammonium bicarbonate at room temperature for 30 minutes.

The reagent was removed and gel pieces dehydrated in 100 µl acetonitrile. The

acetonitrile was removed and gel rehydrated in 100 µl 0.1 M ammonium bicarbonate.

The gel pieces were dehydrated in 100 µl acetonitrile, the acetonitrile removed, and the

gel completely dried by vacuum centrifugation. The gel pieces were rehydrated in 20

ng/µl trypsin in 50 mM ammonium bicarbonate on ice for 10 min. Any excess enzyme

solution was removed and 20 µl 50 mM ammonium bicarbonate added. The sample was

digested overnight at 37 oC and the peptides formed extracted from the polyacrylamide in

two 30 µl aliquots of 50% acetonitrile/5% formic acid. These extracts were combined

and evaporated to 15 µl for MS analysis.

The LC-MS system consisted of a Thermo Electron Orbitrap Velos ETD mass

spectrometer system with a Protana nanospray ion source interfaced to a self-packed 8 cm x 75 um id Phenomenex Jupiter 10 um C18 reversed-phase capillary column. 3 µl of

the extract was injected and the peptides eluted from the column by an acetonitrile/0.1 M

acetic acid gradient at a flow rate of 0.5 µl/min over 0.5 hours. The nanospray ion source

was operated at 2.5 kV. The digest was analyzed using the double play capability of the

instrument acquiring full scan mass spectra to determine peptide molecular masses and

product ion spectra to determine amino acid sequence in sequential scans. This mode of

analysis produces approximately 10000 CAD spectra of ions ranging in abundance over

several orders of magnitude. Not all CAD spectra are derived from peptides. The data

were analyzed by database searching using the Sequest search algorithm against the

deduced amino acid sequence of O.viverrini caspase 9 and E coli.

3.9. REVERSE TRANSCRIPTION-PCR

The developmental expression of O.viverrini caspase 9 and FRS2 were evaluated

by reverse-transcription-PCR (RT-PCR). Using Nucleospin® RNA II (Macherey-Nagel,

Duren, Germany) cDNAs from eggs, metacercariae, juveniles, and adults of O. viverrini

were prepared from fresh samples collected as described{{37 Pinlaor,P. 2009}} and

samples stored in RNAlater® (Ambion, Foster City, CA). Caspase gene specific primers

(forward primer 5’-GGCTCACTTGTCAGCATTGA-3’ and reverse primer 5’-

AAGCAGTCGGTTGTTCACCT-3’) and FRS2 receptor specific primers (forward primer 5’-GCAACGGAACCTTGGAATTA-3’ and reverse primer 5’-

ATCCGTTTCCACAGGACAAG -3’) were designed to amplify a 377-bp and a 417-bp

target, respectively. PCR was performed using GoTaq® polymerase with 35 cycles of

94°C denaturation of 30 seconds, 55°C annealing for 30 seconds, and 68°C extension for

1 min, final extension was 72°C for 10 minutes. PCR targeting O.viverrini actin

(GenBank accession no. EL620339) (Laha et al. 2007) were included as positive controls

(forward primer 5’-CGAGGTATCCTCACCCTCAA-3’ and reverse primer 5’-

GAAGCGCGTAACCCTCATA-3’, 330-bp expected target size) to ensure integrity of

template cDNA while in negative control reactions, water was substituted for reverse

transcriptase. Amplified products were sized by electrophoresis through 0.8% agarose gel

in 1X TAE, stained with ethidium bromide and photographed.

3.10. 5’-RACE – OvAE22

RNA preparation for rapid amplification of cDNA ends (5’-RACE) was as follows:

RNA precipitated in alcohol from adult O. viverrini was kindly provided from Dr. Laha

(Khon Kaen University). The RNA preparation was removed from storage at -20°C and

centrifuged for 15 min at 14,000 rpm, 4°C. The supernatant (alcohol) was removed and

the pellet washed twice with 70% ethanol and 100% ethanol consecutively by

centrifugation at 14,000 rpm for 15 min at 4°C after each wash. The supernatant was

removed and the pellet air dried at ambient temperature for 15 min. The pellet was

resuspended in 20 µl nuclease-free water. The concentration was determined by

NanoDrop™ 1000 Spectrophotometer (Thermo Scientific, Wilmington, DE) at 260nm.

Ten µg of OvRNA was treated with calf alkaline phosphatase (CIP) (Promega, Madison,

WI) in a 20 µl reaction for 37°C for 60 min after gently mixing and quick spin to

catalyze the removal of 5’ phosphate groups from the RNA. The CIP reaction was

terminated per the FirstChoice® 5’ RLM-RACE protocol and kit using ammonium

acetate stop solution, nuclease free water and acid phenol:chloroform (Ambion, Foster

City, CA) extraction followed by a chloroform (Sigma-Aldrich, St. Louis, MO)

extraction and isopropanol (Sigma-Aldrich, St. Louis, MO) precipitation. Following the

kit protocol, the precipitated RNA was dissolved in nuclease-free water, treated with

Tobacco acid pyrophosphatase (TAP) to remove the 5’-triphosphate leaving a 5’- monophosphate available for ligation. It was then subjected to a 5’-RACE adapter ligation at 37°c for 1 hour followed by storage at -20°C. Two µl of the ligation was submitted to reverse transcription using the 5’ RLM-RACE kit components and incubated at 42°C for 1 hour.

Table 3. 5’ RACE primers for OvAE22 (putative TGF-β receptor 1)

Primers (Table 3) were designed from the OvAE22 (GenBank EL618704) contig sequence per the PCR primer design recommendations outlined in the FirstChoice® 5’

RLM-RACE protocol. Primers (Sigma-Aldrich, St. Louis, MO) were reconstituted in TE at 500 pmol/µl stock solutions and then diluted with sterile distilled water to10 pmol/µl to use in PCRs. A nested PCR was accomplished by setting up the outer 50 µl PCR using 1

µl from the reverse transcription reaction, PCR Supermix High Fidelity DNA polymerase

(Invitrogen), outer antisense OvAE22, and the 5’ outer primer from the FirstChoice® kit.

The PCR was performed on the Bio-Rad iCycler under the following conditions: Initial denaturation of 94°C for 3 min, 35 cycles of 94°Cfor 30 sec, 60°C for 30 sec, and 72°C for 1.5 min finishing with a final extension of 72°C for 7 min. The second part of nested

PCR was set up using 2 µl of the outer PCR, with inner antisense OvAE 22 gene specific

53 primer, 5’ RACE inner primer from the kit, and PCR SuperMix High fidelity DNA polymerase (Invitrogen) also in a 50 µl reaction with the same thermocycler conditions.

Products of the PCR were visualized by agarose gel analysis on a 2% high resolution agarose gel in 1X TAE buffer containing ethidium bromide. Images were scanned and captured using a Bio-Rad Gel Doc system.

3.11. ANTI-ENZYME ANTISERA

Affinity purified O. viverrini caspase 9 fusion protein was employed as the antigen to immunize five female 6-8 week old DBA/J mice, 50 ug per immunization administered subcutaneously. The first immunization involved recombinant protease emulsified in

Freund’s complete adjuvant whereas subsequent immunizations employed recombinant protease emulsified in Freund’s incomplete adjuvant. Immunizations were undertaken on days 0, 21, and 35. Blood for serum was obtained from the tail vein of each of the five immunized mice on day 0 (normal serum) and 14 days after the third immunization. Sera from each time point were pooled (Figure 14). Specificity of the antibody to the O. viverrini caspase 9 fusion protein was analyzed by western blot using the antibody at

1:1000 dilution in 5% milk in 1X PBST.

A second polyclonal antibody was produced by utilizing the affinity purified O. viverrini caspase 9 protein. Five gel bands containing the O. viverrini caspase 9 were homogenized in 0.5 ml PBS and folded non-reduced protein was diluted to 0.5 ml with

PBS. The two different samples were each homogenized with 0.5 ml of CFA for the first immunization or 0.5 ml of IFA for the second and third immunizations using an 18g tubing and syringe until emulsified. The emulsification was tested in water prior to

injection. Each 6-8 week old female BALB/c mouse was injected intraperitoneally (i.p.) with 0.25 ml on days 0, 14, 21, and terminally bled on day 42. Antibody specificity to the O. viverrini caspase 9 protein was analyzed by western blot analysis using the antibody at a 1:1000 dilution in 3% milk in 1X PBST buffering buffer on the refolded O.

viverrini caspase 9, crude protein lysate from whole adult O. viverrini worms, human

recombinant procaspase 9 (Cell Signaling Technology, Danvers, MA), and human

recombinant caspase 9 (BioVision, Inc., Milpitas, CA).

Figure 14. A flow chart outlining the polyclonal antibody production in mice to

O. viverrini caspase 9 fusion protein.

Purified fusion protein + FCA Pre-immune bleed* Day 0 50 μg SQ/mouse

Day 0

Purified fusion protein + FIA Purified fusion protein + FIA

Booster 1 Booster 2 Day 21 Day 35 50 μg SQ/mouse 50 μg SQ/mouse

Western blot confirmation of polyclonal antibody to OvCaspase9 fusion protein Preliminary bleed* Day 45 (-)OR (+)

Booster 3 Day 52 Terminal bleed* *Initial bleeds by tail nick. Terminal bleed by 50 μg SQ/mouse cardiac puncture

3.12. TUNEL ASSAY

Hamster liver tissue infected with O.viverrini adult flukes were embedded in paraffin and then sectioned with a microtome to 4 µm thicknesses, as described by Sripa, et al, 2000(Sripa and Kaewkes 2000). The whole mount and sectioned slides of adult worms were provided by Drs. Thewarach Laha and Banchob Sripa (Khon Kaen

University, Thailand). The sections were deparaffinized with xylene and dehydrated with decreasing concentrations of ethanol followed by a wash with 1X PBS. The sections were treated with Proteinase K (Sigma-Aldrich, St. Louis, MO) for 30 min at 25°C and then washed with 1X PBS. Cells undergoing apoptosis were localized in these tissue sections using a commercial TUNEL (TdT-mediated dUTP nick end labeling) assay (In Situ Cell

Death Detection Kit, Flourescein; Roche, Mannheim, Germany). After TUNEL, sections were examined with an Olympus IX-70 inverted light microscope fitted with the

Evolution MP 5.0 megapixel digital camera (Media Cybernetics Inc, Bethesda, MD) under both bright and fluorescent light, digital images were recorded, and the images enhanced using Image Pro Plus 6.2 software (Media Cybernetics Inc, Bethesda, MD).

3.13. IMMUNOLOCALIZATION

Liver tissue from hamsters infected with O.viverrini were fixed in paraffin and cut into sections of 4 µm with a microtome (Sripa and Kaewkes 2000). The sections were deparaffinized in xylene then dehydrated with decreasing concentrations of ethanol and washed in distilled water. The sections were then washed with 1X PBS. The sections were blocked with 5% normal serum in PBS for 20 minutes to prevent non-specific staining. The mouse anti-O. viverrini caspase 9 serum was diluted 1:1000 (v/v) in 1X

PBS and applied to the tissue sections and incubated for 2 hours at room temperature.

The sections were washed for 3-5 minutes in 1X PBS then incubated in goat anti-mouse

IgG HRP conjugated antibody (Invitrogen, Carlsbad, CA) at a dilution of 1:5000 (v/v) in

1X PBS for 1 hr. 1X PBS was used for 2-10 minute washes prior to detecting the antibody with diaminobenzidine (DAB) reagent. The DAB incubation was 5 min in 15-

25°C in the dark. The sections were counterstained with Mayer’s hematoxylin then dehydrated in increasing concentrations of ethanol. After being cleared with xylene, the sections were mounted in Permount® Mounting medium (Thermo Fisher Scientific,

Waltham, MA). Sections were examined under an Olympus IX-70 inverted light microscope fitted with the Evolution MP 5.0 megapixel digital camera (Media

Cybernetics Inc, Bethesda, MD).

Chapter 4: RESULTS

4.1 CASPASE 9

Hypothesis: Gene discovery approaches have indicated that an ortholog of

caspase 9 is expressed by Opisthorchis viverrini. It can be expected that this molecule

is structurally and biochemically similar to orthologous molecules from

phylogenetically similar organisms as well as to those of humans and more distantly related species. Appropriate experimental analyses to include phylogenetic comparisons and functional activity studies of recombinant form of this O. viverrini

ortholog should confirm its identity, inform its likely function, and enhance our

understanding of the physiology of this carcinogenic liver fluke.

Apoptosis, or programmed cell death, is a mechanism used to control cell

proliferation or respond to DNA damage and is central to the normal homeostasis in

eukaryotes (Ghobrial et al. 2005). Excessive apoptosis or interruption of the apoptotic

process has been shown to be associated with the development of pathological conditions

such as Alzheimer’s disease, Parkinson’s disease, neuroblastoma, hepatocellular

carcinomas, gastric carcinomas, and advanced colorectal carcinomas. Alteration in the

expression or activity of any of the components of the apoptotic pathway could contribute

to a pathological state (Ho and Hawkins 2005). Caspases are integral components of the

apoptotic pathway and serve as either initiators or ‘actual’ effectors of cell death. Caspase

9 is an important initiator of apoptosis by way of the intrinsic or mitochrondrial pathway

in response to DNA damage or other signals (Boatright and Salvesen 2003).

4.1.1. Determination of the presence of apoptosis in adult stage O. viverrini

4.1.1.1. TUNEL assay

TdT-mediated dUTP nick-end labeling (TUNEL) is commonly used to detect

apoptosis. This assay allows differentiation of DNA strand breaks that occur during

apoptosis from the DNA changes associated with necrosis (Gold et al. 1994; Labat-

Moleur et al. 1998; Negoescu et al. 1998). In tissue sections of O.viverrini-infected

hamster liver, TUNEL positive cells of the fluke were found primarily in the vitelline

glands and within eggs. Sporadic apoptotic cells were also seen along the tegument as

well as in the lining of the ceca (Figure 15 and Figure 16). The TUNEL assay allows

appreciation of a baseline level of apoptosis occurring in the adult fluke.

Figure 15. TUNEL analysis of baseline apoptosis levels. TUNEL analysis revealed the baseline level of apoptosis in hamster bile duct tissue infected with O. viverrini as well as in the liver fluke itself; panel (A) negative control, (B) positive control, and (C) experimental sample. The black arrows denote specific apoptotic cells.

Figure 16. TUNEL assay. Picture denoted as (A) is the same as panel C of Figure

15 with some fluke morphology identified. (B) is the section of (A) delineated by the black box magnified to show specific apoptotic cells within the tegument of the liver fluke. The apoptotic cells are indicated by the black arrows.

4.1.1.2. Aim 1: Bioinformatics and phylogenetic analysis of the putative

Opisthorchis viverrini caspase 9.

The entire nucleotide sequence of the recombinant insert of clone OvAE561

(EL619243) was determined by sequencing with vector-specific and gene-specific primers. The contig was found to be 1916 base pairs (bp) in length and included 1119 bp

encoding a complete open reading frame (ORF) of 372 deduced amino acid residues (aa)

(Figure 17).

Figure 17. The 372 deduced amino acids encoded by the ORF of OvAE561

Analysis of the ORF of OvAE561 by BLASTp and ExPASy identified three

conserved domains: a CARD or caspase activating and recruitment domain, a CRSc or

caspase, IL-1β converting enzyme, and a peptidase C-14 caspase domain, all of which

indicated that this cDNA sequence encodes a cysteine protease in particular, a caspase

(Figure 18) (Stennicke and Salvesen 1999); (Earnshaw et al. 1999; Riedl et al. 2005).

Figure 18: Predicted structure of OvAE561 based on conserved domains and

BLASTp analysis.

Initial BLASTp showed many putative orthologues with some of the closer

matches to caspase 9 of Xenopus laevis and many to mammalian caspase 9 from Homo

sapiens and Mus musculus. The SignalP3.0 and TMPred analyses of the ORF predicted

that there was neither a signal peptide nor a transmembrane domain. These results

support the hypothesis of a putative caspase 9 since caspase 9 orthologues characterized to date are intracellular components of the intrinsic apoptotic pathway (Ho and Hawkins

2005). The preliminary structure of the O. viverrini orthologue has been discerned through multiple alignments of the various parts of known caspase 9 to the OvAE561 sequence and the identification of the important highly conserved landmarks of a caspase

9 zymogen; e.g. the active site motif, QACRG, which contains the active cysteine (Figure

19).

Figure 19. Multiple sequence alignments of orthologues of caspase 9 well-known model species and the OvAE561 enzyme. The green arrow indicates the CARD region

for the human caspase 9. The red box annotates the catalytic site of caspase 9. The

yellow arrow highlights the active cysteine residue, within the catalytic site, common to

all caspases. Two of the well-conserved aspartic acid residues, also commonly associated

with the various parts of a caspase, are indicated using blue stars.

The predicted structure and lengths of the domains and subunits of the putative O.

viverrini caspase 9 zymogen are shown in Figure 18. The cleavage delineation between

the predicted structural domains and subunits appears to be correlated with the conserved

aspartic acid residues which are a hallmark of caspases and absolute requirement for this

protease. Caspase 9 has substrate specificity for aspartic residues at the P1 position

(Thornberry et al. 1997). Alignment of the OvAE561 sequence using the BioEdit and

GeneDoc programs with other well-documented caspase 9 is shown in Figure 19. A

phylogenetic tree with the least cost was generated from the CLUSTAL W alignments

(Thompson et al. 1994) using the BLOSUM substitution matrix and Bootstrap support

values of 1000 in the Accerlys3.0 program and POY4 (Figure 20). The O.viverrini

OvAE561 branched with caspase 9-like caspases from both invertebrates

(Lophotrochozoa and Ecdysozoa) and vertebrates (Deuterostomia).

Figure 20. Phylogenetic tree of Opisthorchis viverrini caspase 9 (OvAE561) and informative orthologues from mammals, other vertebrate representative Ecdysozoans, representative Lophotrichozoans including planaria, as well as other informative species.

4.1.1.3. O. viverrini whole protein lysate caspase 9 activity

Bioinformatic analyses showed evidence EST OvAE 561, identified initially as a caspase 2 by Laha et al, to be an ortholog of mammalian caspase 9. The next step was to determine if O. viverrini had any activity that could be related to caspase 9 by using an assay specific for mammalian caspase 9. The O. viverrini native protein lysate obtained from adult flukes showed activity specific for caspase 9 on the Caspase Glo-9® (Promega)

LEHD-luciferin assay (Figure 22). At 10 µm and 100 µm concentrations, the caspase 9-

specific peptide aldehyde inhibitor, Ac-LEHD-CHO, showed significant inhibition of the

crude protein lysate activity (Figure 23A). The general cysteine protease inhibitor,

iodoacetamide, at the same concentrations did not show any inhibition (Figure 23B).

Therefore it can be surmised, there is caspase 9-like activity in O. viverrini whole protein

lysate. All statistical data used to make the graphs is in Table 4.

human recombinant Caspase 9 ‐ positive control 100000000 10000000 1000000 100000 human recombinant 10000 Caspase 9 RLU 1000 human recomb Caspase 9 100 + 10 um inhibitor 10 1 sample

Figure 21. Activity of the positive control in the Caspase Glo-9® assay. The human recombinant Caspase 9 was used at 1 unit per sample as the positive control for the mammalian caspase 9-based assay. The caspase 9 was inhibited using 10 µM Ac-LEHD-

CHO.

Whole Protein Lysate Activity 500000 450000 400000 350000 300000 250000 negative control

RLU/sec 200000 OvExt 150000 100000 50000 0 samples

Figure 22. The activity of the O. viverrini adult fluke whole protein lysate as compared to the negative control in the Caspase Glo-9® activity assay. The whole protein lysate is denoted as Ov extract (OvExt).

A Whole protein lysate treated with Ac‐ LEHD‐CHO 70000 60000 50000 40000 OvEXt 30000 OvEXt + 10 uM inhibitor RLU/sec 20000 OvExt + 100 um inhibitor 10000 0 samples

B Whole protein lysate treated with iodoacetamide 80000 70000 60000 OvExt 50000 40000 OvExt + 10 um

RLU/sec 30000 iodoacetamide 20000 OvExt + 100 um 10000 iodoacetamide 0 samples

Figure 23. Inhibition studies of the whole protein lysate of O. viverrini. (A) The activity was inhibited using a caspase 9-specific reversible aldehyde inhibitor, Ac-LEHD-CHO, at two different concentrations; (B) The activity was inhibited using a general cysteine protease inhibitor, iodoacetamide, at two different concentrations. The cysteine protease inhibitor showed no significant inhibition of the whole protein lysate while the caspase 9- specific inhibitor did show significant inhibition.

Table 4. Statistical data from activity and inhibition assays shown in figures 21-23.

4.1.2. Aim 2: Recombinant expression and affinity purification of the O. viverrini

caspase 9

4.1.2.1. pET-50b (+) construct

The OvAE561 ORF, modified by PCR to contain the Kpn1 and Sac1 restriction sites with clamps, was inserted into the prepared expression vector of pET-50b (+) and

the ligation products employed to transform Top10 E.coli cells for stabilization.

Restriction digestion followed by DNA gel electrophoresis indicated potential clones containing the complete insert migrated at the expected size of 1.2 kB against a 10 kB ladder (Figure 24).

12 3 4

8 6

Figure 24. Restriction digestion of OvAE561, OvAE1563, and pET-50b(+).

Restriction digest verification of PCR amplicons and prepared pET50b(+) vector prior to insertion into pET-50b (+) vector run on ethidium bromide-stained agarose gel. The expected size of the inserts for FRS2 was 1.1 kb and caspase 9 was 1.2 kb. Legend: Lane

1 – OvAE1563 (FRS2); Lane 2 - OvAE561 (caspase 9); Lanes 3 & 4 – restriction

digested pET-50b (+).

Nucleotide sequencing with the 5’Nus primer and 3’ S-tag primer of the

recombinant pET-50b(+) plasmids determined the construct contained a NH2- hexa-His

tag, followed by the NusA encoding region, another hexa-His tag, HRV3C protease

cleavage site, the OvAE561 (caspase 9) sequence, followed by the 3’ S-tag (Figure 25).

Figure 25. ORF insertion location within the vector encoding a fusion protein with encoding elements as diagrammed. The ORF for OvAE561 (caspase 9) was inserted into the multiple cloning site (MCS) of the expression vector between the Kpn1 and Sac1 restriction sites. The fusion protein determined by this construct will have tags, a cleavage site, and proteins encoded in the order shown in the cartoon at the bottom of the figure (adapted from (TB418 2004)).

The verified recombinant pET-50 O. viverrini caspase 9 construct was used to transform BL21 expression E. coli cells. Induction of the caspase 9 fusion protein was achieved by using 0.1M IPTG final concentration over 4 hours. Spectrophotometric monitoring using the SmartSpec 3000 (Bio-Rad, Hercules CA) was begun at 2 hours post-induction and continued every 30 minutes until the OD600 was between 0.6-1.0.

Uninduced and induced bacterial preparations were analyzed by Coomassie-stained SDS-

PAGE. The expected molecular mass for the intact fusion protein was 102 kDa, as

calculated by aa sequence in the ExPasy program, with the major component being the

NusA fusion partner at 54 kDa followed by the recombinant O. viverrini caspase at

42kDa and the varying tags and cleavage sites making up the remainder. An increase in band intensity was noted in the induced samples at the ~ 102 k Da position when compared to the uninduced samples (Figure 26).

Figure 26. Coomassie-stained SDS-PAGE undertaken to analyze recombinant fusion protein expression obtained using the pET50 O. viverrini caspase 9 construct transformed BL21 E. coli. cells. The fraction location of the samples induced (I) with

0.1M IPTG are compared to uninduced (U) samples. Legend: lane 1 – broad range protein standard; lanes 2-3 - total cell protein; lanes 4-5 - medium protein; lanes 6-7 – periplasm protein; lanes 8-9 – soluble cytoplasm; and lanes 10-11 – insoluble cytoplasm protein.

The induced protein was analyzed in five different cellular fractions as outlined in section 3.3.3. (Chapter 3). A small portion, predicted to be ~5% of the total, recombinant protein expressed was found to be in the soluble (periplasmic and cytoplasmic) fractions whereas the majority of the protein was expressed as inclusion bodies.

The caspase 9-like fusion protein was analyzed by western blot using a monoclonal antibody to the hexa-His tags and endonuclease S-protein conjugated to HRP which binds to the 15 aa S-tag peptide. The usage of the different hybridizations allowed visualization of both the NH2-terminal and the COOH-terminal ends of the complete fusion protein.

The anti-penta His monoclonal antibody (Qiagen) bound to the 5’ end of the fusion

proteins while the S-protein conjugate (Novagen) readily bound to the 3’end. Using these hybridization techniques, we can show both probes bind to the complete fusion protein at

~102 kDa. There appears to be early termination of translation causing multiple bands or ladder-like formation to occur in the anti-penta-His hybridization most likely due to expression of this eukaryotic protein in a prokaryotic organism (Figure 27).

Figure 27. Western blot analyses of cellular fractions for protein expression using antibodies specific for tags on the NH2- end (penta-His monoclonal antibody) and the

COOH-end (S-protein HRP conjugate) of the fusion protein. Samples induced (I) with

0.1 M IPTG were compared to samples that were not induced (U). Legend: lanes 1-2 - total cell protein; 3-4 – medium protein; 5-6 – periplasm protein; 7-8 – soluble cytoplasm protein; 9-10 – insoluble cytoplasm protein; and 11 – antibody specific broad range protein marker.

The insoluble form was solubilized using 8 M urea in neutral pH phosphate buffer

and purified under the same denaturing conditions. The soluble portion was similarly

enriched and purified using neutral pH phosphate buffer on the TALON® resin (Figure

28).

Figure 28. Affinity chromatography of pET-50b(+) O. viverrini caspase 9

construct. Panel (A) Coomassie blue analysis of the affinity purification of caspase 9; (B)

Western blot analysis with a 10 second radiographic exposure probed with S-protein HRP

conjugate; (C) same western blot analysis as panel (B) but 1 minute radiographic

exposure time. Lane 1 – flow through; 2 - first wash; 3 – last wash; 4 - 150 mM

imidazole; 5 – 200 mM imidazole; 6 – 250 imidazole, 7 – 500 mM imidazole, 8 – protein

standards ( Panel A) broad range protein marker ( Panel B &C) S-protein specific marker,

9- O. viverrini caspase 9 starting material prior to affinity chromatography.

After cleavage with HRV-3C protease, the NusA fusion partner and the hexa-His

tags were separated from the recombinant O. viverrini caspase 9-like protein along with

the S-tag and thrombin sites. The cleavage was confirmed because the S-protein will only

bind with the recombinant O. viverrini caspase (~48 kDa) and not the NusA fusion partner (~60 kDa) similarly the anti-penta His monoclonal will only bind with the whole fusion protein (~102 kDa) and the NusA(~60 kDa) partner but not with the recombinant

O. viverrini protein (~48 kDa) (Figure 29).

The protein solubilized and affinity purified in 8M urea neutral pH phosphate buffer was refolded using the rapid dilution technique, as described above (Chapter3), to achieve an active protease for analysis of activity and substrate specificity. Sixteen different buffer combinations were tested with the aim of refolding the denatured caspase to a proteolytically active conformation. The most promising buffer appeared to be 1X

PBS, pH7.3-7.5, 1 mM DTT, 10% glycerol, +/- 1 M urea. Hybridization of the western blot using S-protein conjugated-HRP showed evidence of putative autocatalysis and a possible activity of caspase 9 (Figure 30). All of the refolded samples were further evaluated in a caspase 9-specific assay for activity. However, no protein activity was observed in the assays although two samples did show what could be autocatalysis in lanes 7 and 8 of Figure 30, Panel A.

Figure 29. Rapid dilution and HRV 3C protease cleavage experiment with western blot analysis. This figure shows the outcome of refolding insoluble protein in triplicate, by the rapid dilution method, followed by HRV 3C protease cleavage of the carrier protein from the recombinant caspase 9 verified by antibody- specific western blot analysis. Rapid dilution change from 8 M urea containing neutral phosphate buffer to 1X

PBS, 1M urea, 1mM DTT, 0.5 M L-arginine. Protein cleavage was accomplished using human rhinovirus (HRV) 3C protease at 4°C for 16 hours. Lane legend (reading left to right for all panels): 1-refolded whole fusion protein; 2 – Fusion protein following cleavage with HRV 3C protease; 3-blank; 4- refolded whole fusion protein; 5 – fusion

protein following cleavage with HRV 3C protease; 6 – blank; 7-refolded whole fusion

protein; 8-fusion protein following cleavage with HRV 3Cprotease. Panel: (A)

Coomassie blue stain showing all bands; (B) anti-penta His monoclonal antibody

illustrating the bands associated with the 5’ end; (C) S-protein-HRP conjugate that binds

to the 15-mer S tag illustrating the cleavage and the 3’ end with the recombinant O. viverrini caspase 9.

Figure 30: Optimization of the refolding buffer conditions for O.viverrini caspase

9 fusion protein. Panel: (A): Western blot analysis of a rapid dilution refolding

79 experiment using the S-protein HRP conjugate as the probe; (B) Cartoon description of the potential autocatalysis hypothesized to have occurred in the samples run in lanes 7 and 8.

4.1.2.2. pET-45b(+) construct

A second construct of recombinant O. viverrini caspase 9 was completed using the expression vector pET-45b (+). This construct contained the NH2-terminal hexa-His tag and the COOH-terminal S-tag similar to the pET-50b (+) vector but without the NusA fusion protein (Figure 31).

3’ 5’ O. viverrini His‐Tag S‐Tag caspase 9

Figure 31. Diagram of the construct of pET-45b (+) O. viverrini caspase 9 recombinant plasmid

As with the previous construct, the OvAE561 ORF, modified by PCR to contain the Kpn1 and Sac1 restriction sites and clamps, was inserted into the prepared pET-45b

(+) expression vector. The ligation products were used to transform BL21 E.coli cells.

Several colonies were picked, cultured, plasmid extracted, double digested with Kpn1 and

Sac1, and gel electrophoresed to verify presence of bands at 1137 bp (Figure 32).

Figure 32. DNA gel electrophoresis of pET-45b (+) O. viverrini caspase 9

recombinant plasmid double restriction digested with Kpn1 and Sac1. The colonies chosen for plasmid preparation and digestion are labeled C1, C2, and C3. The expected insert is present between 1000 and 1500bp bands of the marker.

Recombinant protein expression induction was realized using a final concentration of 1 mM IPTG. As with the pET-50b(+) O. viverrini caspase construct (above), the

majority of the protein was located in the inclusion bodies. The predicted molecular

mass for this recombinant enzyme was ~43 kDa. Protein localization and molecular mass

were verified by Coomassie Blue SDS-PAGE analysis of induced versus uninduced

samples (Figure 33).

uninduced induced‐insoluble induced‐soluble

kDa c1 c2 c3 c1 c2 c3 c1 c2 c3

70 55

40 43 kDa band

1mM IPTG final conc. O/N induction

Figure 33. Pilot expression analysis of 5 ml cultures induced overnight with a final concentration of 1 mM IPTG followed by freeze-thaw and centrifugation to separate soluble and insoluble proteins.

Much of the insoluble protein was solubilized in 8M urea in neutral pH phosphate buffer and affinity purified on the TALON® resin utilizing the His-tag. The elution was maximized at 125mM imidazole concentration in the 8M urea neutral pH phosphate buffer and evaluated by SDS-PAGE. As expected, the band at 43kDa was enriched by the

TALON® affinity chromatography (Figure 34).

43 kDa Caspase 9

Figure 34. Purification of O. viverrini caspase 9 by affinity chromatography-

Following freeze/thaw processing and solubilization of the O. viverrini caspase 9 enzyme

into 8 M urea, the solution was added to an equilibrated cobalt resin column binding the

His-tag of the caspase 9 recombinant protein. Enrichment of the protein was analyzed by

Coomassie stain SDS-PAGE. Lane legend: 1 – broad range protein standard; 2 – pellet

remaining after collection of supernatant; 3- supernatant containing caspase 9 in 8M urea

buffer; 4 – flow through from the column; 5 – wash; 6 – first elution; 7 – second elution;

8 – third elution; 9 – fourth elution; and 10 – final elution.

Dilution into a neutral pH solution and refolding of the expressed recombinant protein into an active conformation was accomplished using the rapid dilution technique.

Ten different buffers combinations were tested to refold 50 µl of protein (~375 ng) into

950 µl of the buffer. Each buffer combination was run on a SDS-PAGE gel and stained

with Coomassie Blue. The buffers were also tested for activity in a Caspase Glo-9®

assay. On initial evaluation, two buffers gave the best signals in the activity assay, buffer

#9 (1X PBS, 10% sucrose, 0.1% CHAPS, and 10 mM DTT) and buffer #10 (100mM

Tris-HCl, 10% sucrose, 0.1% CHAPS, and 10 mM DTT). However, buffer #9 was found

to have a more consistent activity over time than buffer #10 which had the biggest initial signal but a larger standard deviation (Figure 35). The third sample tested for both buffer

#9 and #10 in this experiment had lost much of its activity due to a plate reader

malfunction and therefore the p-value could not be calculated accurately and the standard

deviations are extreme as shown in figure 35. The difference in signal between buffers #9

and #10 and the other buffers tested was considerable (Table 5).

Refolding buffer analyses for activity 10000000

8000000 hCasp9

6000000 buffer 1 buffer 3 4000000 buffer 5 RLU/sec 2000000 buffer 8

0 buffer 9 buffer 10 ‐2000000 buffers

Figure 35. Initial evaluation of refolding buffers using rapid dilution technique

utilizing the Caspase Glo-9® activity assay. Lane legend: 1 – negative ; 2 - 100mM

HEPES/10% sucrose/0.1% CHAPS/10 mM DTT, pH7.5; 3 – 100mM HEPES/15%

sucrose/0.1% CHAPS/10 mM DTT, pH7.5; 4 – 100 mM HEPES/10% glycerol/0.1%

CHAPS/10 mM DTT, pH7.5; 5 – 100 mM MES/10% sucrose/0.1% CHAPS/10 mM

DTT; 6- 1X PBS/10% sucrose/0.1% CHAPS/10 mM DTT, pH7.5; 7 – 100 mM Tris-

HCl/10 % sucrose/0.1% CHAPS/ 10 mM DTT, pH 7.5.

Table 5. Raw data and statistical analyses of the Caspase Glo-9® activity assay to evaluate activity of different buffers following refolding. This was done to optimize the buffer used in further biochemical characterization of the O. viverinni caspase 9.

4.1.3.Aim 3: Biochemical characterization of the O. viverrini caspase 9, including

substrate and inhibition profiles

4.1.3.1. Protein Sequencing

The gel band at ~43 kDa on the Tris-Hepes-SDS gels from the pET-45b(+) construct was consistently enriched during the affinity chromatography as was a second smaller product of ~28kDa (Figure 34). To verify the 43 kDa band was the expected recombinant caspase 9, the products were separated on a Tris-Hepes-SDS gel,

Coomassie-stained, and sent to the University of Virginia, W.M. Keck Biomedical Mass

Spectrometry Laboratory for peptide sequencing by mass spectrometry. The major

component of both bands was clearly identified as caspase 9. Low levels of E. coli were

discovered in many of the background proteins present in each band. Both bands

evaluated had nearly identical coverage. The lower MW band is likely a mixture of NH2- terminal and COOH-terminal truncated species. The molecular weight is similar to the upper MW band when the truncated species are added together. The complete report from Dr. Nicholas Sherman of the W.M. Keck Biomedical Mass Spectrometry

Laboratory is included as Appendix B.

4.1.3.2. Activity and Inhibition Studies

The soluble fraction of the pET-50b (+) O. viverrini caspase 9 exhibited some activity in the Caspase Glo-9® LEHD-luciferin assay. The activity did not improve after

the NusA fusion protein was removed by protease cleavage at the HRV 3C protease site

(data not shown). The paucity of soluble protein expressed from this construct and the

inability to be able to refold the insoluble portion into an active conformation made the biochemical characterization of the construct problematic and not reliably reproducible.

Unlike the pET-50b(+) O. viverrini construct, the pET-45b(+) O. viverrini caspase

9 construct product was amenable to refolding into an active conformation that reliably

exhibited activity in the Caspase Glo-9® LEHD-luciferin assay. The caspase 9-specific reversible aldehyde inhibitor (Ac-LEHD-CHO) at a 10µM concentration, without an

incubation period prior to introduction into the assay, was able to strongly inhibit the

recombinant O. viverrini caspase 9 activity (Figure 36). The raw data and statistical

analyses for this experiment are shown in Table 6.

Activity and Inhibition Studies positive control 700000

600000 Positive control + 10 uM inhibitor 500000 Buffer #9 400000 buffer #9 + 10 uM 300000 RLU/sec inhibitor 200000 buffer #10 100000 buffer #10 + 10 uM 0 inhibitor Samples

Figure 36. pET-45b (+) O. viverrini caspase 9 activity and inhibition assay reported in RLU/sec. The first sample (reading from left to right) is the recombinant human caspase 9 positive control; the second sample is the inhibition of the positive control with 10 µM Ac-LEHD-CHO; third sample shows activity associated with the recombinant O. viverrini caspase 9 refolded in buffer #9; fourth sample is the same

refolded sample as the third but inhibited with 10 µM Ac-LEHD-CHO; fifth sample is

recombinant O. viverrini caspase 9 refolded into buffer #10; and the last sample is the

inhibition of the refolded O. viverrini caspase 9 with 10 µM Ac-LEHD-CHO.

Table 6. Raw data and statistical analyses of activity and inhibition studies of the recombinant O. viverrini caspase 9 as shown in Figure 37.

The Caspase Glo-9® assay showed luminescence to be directly proportional to the concentration of recombinant O. viverrini caspase 9 (Figure 37). The concentrations tested were 375 ng, 187.5 ng, and 93.75 ng for each refolded sample of recombinant O. viverrini caspase 9. The mean of two test samples for each concentration is reported on the graph. No standard deviation was calculated due to the limited number of test samples per concentration.

Protein Concentration Analysis

70000 60000 buffer 9 ‐ 375 ng 50000 buffer 9 ‐ 187.5 ng 40000 buffer 9 ‐ 93.75 ng 30000 RLU/sec 20000 buffer 10 ‐ 375 ng 10000 buffer 10 ‐ 187.5 0 buffer 10 ‐ 93.75 ng

Sample average

Figure 37. O. viverrini caspase 9 protein concentration effects on luminescence in

the Caspase Glo-9® activity assay. Samples 1-3 were in 1X PBS/10%sucrose/0.1%

CHAPS/10 mM DTT solution and samples 4-6 were in 100 mM Tris-HCl/10% sucrose/0.1% CHAPS/10 mM DTT, pH7.5. Sample legend: Sample 1 – 375 ng of

88 protein in 1X PBS- based buffer; Sample 2 – 187.5 ng of protein in the 1X PBS-based buffer; sample 3 - 93.75 ng in 1X PBS- based buffer; Samples 4- 375 ng of protein 100 mM Tris-HCl based buffer; Sample 5 - 187.5 ng of protein in the 100 mM Tris-HCl based buffer; and 93.75 ng of protein in 100 mM Tris-HCl based buffer.

To explore the substrate specificity of the recombinant O. viverrini caspase 9, the protein was tested in a Caspase Glo-3,7® (Promega) specific assay against a recombinant human caspase 3 and recombinant human caspase 9. The caspase 9 ortholog in C. elegans has been shown to have both initiator and executioner caspase-like functions rather than the mammalian caspase 9, initiator, that activates a caspase 3, executioner, causing the actual programmed cell death (Chinnaiyan 1999). The caspase 3/7 assay utilizes the specificity of the caspase 3/7 substrate that contains the DEVD tetrapeptide versus the caspase 9 specific substrate of LEHD ((Thornberry et al. 1997). The O. viverrini caspase 9 had no significant activity in the 3,7 specific assay which was comparable to the activity of the recombinant human caspase 9 control in the same test when compared to the human caspase 3 control (Figure 38). The data and statistical analyses are presented in Table 7.

Substrate Specificity Study 10000000

1000000

100000 human rec Caspase 3 positive control 10000 human rec Caspase 9 1000 RLU/sec

100 rec Ov Caspase 9

1 Samples

Figure 38. Analysis of O. viverrini caspase 9 substrate specificity in the Caspase-

Glo- 3,7® assay reported in RLU/sec on a log scale and with negative control

(background) subtracted from all samples. Sample legend: 1 - human recombinant

Caspase 3; 2 - human recombinant Caspase 9; and 3 - O. viverrini Caspase 9. The error

bars were only reported in positive direction due to log scale formatting of graph.

Table 7. Raw data and statistical analyses of the substrate specificity experiment

shown in Figure 38. The w/o bkgd column denotes subtraction of the negative or vehicle

control signal from the other protein signals. The first column under p value (p<.05) is

comparing the signal of each sample back to the positive control, recombinant human

caspase 3. The last unlabeled column is the p value calculated comparing the signal of

human recombinant caspase 9 and recombinant O. viverinni caspase 9 with the negative

or vehicle control. The recombinant O. viverrini caspase 9 showed no more activity than

the vehicle control in this assay.

4.1.4. Functional studies of the O. viverrini caspase 9

Functional studies can aid in determination of the role of the protein as well as

where the protein is located within the adult fluke. These studies included TUNEL assay

(shown in, reverse transcription-PCR at several stages in the fluke development, and immunolocalization using polyclonal antibodies produced against recombinant

O.viverrini caspase 9.

4.1.4.1. Anti- O. viverrini caspase 9 polyclonal antibody

The initial mouse polyclonal antibody produced as described in section 3.11,

using as an antigen the O.viverrini caspase 9 fusion protein, reacted strongly with the O. viverrini caspase 9 fusion protein in the 102 kDa range but also to various other bands at lower molecular masses. Following treatment of the fusion protein with HRV 3C

protease, the anti-O.viverrini caspase 9 reacted strongly with the fusion protein at 102

kDa, the NusA (NH2-terminal) portion at 55-59 kDa but not the COOH-terminal

portion containing the caspase 9 (Figure 39). Because NusA carrier protein (54 kDa) is

much bigger than the Caspase 9 (44 kDa) it may interfere with the immune system being

able to access antigenic areas on the smaller portion (3’-end) of the fusion protein.

Figure 39. Western blot analysis of antibody specificity to the O. viverrini caspase

9. Panel (A) Mouse negative control sera - lane 1 – complete fusion protein and lane 2 –

fusion protein cleaved with HRV 3C protease; (B) Anti-O. viverrini caspase 9 fusion

protein – lane 1 – complete fusion protein and lane 2 – cleaved fusion protein.

The second antibody raised against O.viverrini caspase 9 in BALB/c mice showed

reactivity to the recombinant forms of O.viverrini caspase 9 and was able to react to

native O.viverrini caspase 9 in crude extracts of whole adult worms. There was no

reactivity seen to either human caspase 9 antibodies or with human procaspase 9

recombinant proteins in their non-reduced form. The western blots were repeated using

the reduced forms of human procaspase 9. The human caspase monoclonal antibody

showed only slight binding to reduced forms of procaspase 9 but none to crude O.

viverrini extract or recombinant O. viverrini caspase 9. The anti-O.viverrini caspase 9

showed equal reactivity to both reduced and non-reduced forms of the crude extract. The

anti-O.viverrini caspase 9 will recognize native caspase 9 within sections from fluke-

infected hamster bile ducts and is appropriate for immunolocalization (Figure 40).

Figure 40. Western blot analyses of the specificity of the anti-O.viverrini caspase 9 antibody. Lane legend: 1-Mark 12 marker; 2 – recombinant Ov-caspase 9 eluate; 3-blank;

4- recombinant Ov-caspase 9 refolded into neutral phosphate buffer; 5 – blank; 6- recombinant Ov-caspase 9 (8/2/10 sample); 7- 1 µg human pro-Caspase 9 (BioVision);

8-5 µg human pro-caspase 9 (BioVision); 9- 5 µg Ov whole protein extract; 10-blank;

11- 20 µg Ov whole protein lysate; 12- Ov whole protein antigen. The arrows indicate the specificity for the crude protein antigen and the whole protein lysate shown by the anti-O.viverrini caspase 9 antibody.

4.1.4.2. Developmental stage reverse transcription-PCR

Reverse transcription (RT)-PCR was used to evaluate the expression of the recombinant caspase 9 in developmental stages of O.viverrini. The O.viverrini caspase 9-

like cDNA was detected in all developmental stages examined: eggs, metacercariae,

juvenile (<1 month), and adult flukes. The expected product size of 377 bp was found in

each sample. The negative control in which water was substituted for the reverse

transcriptase indicated the absence of genomic DNA contamination in the cDNA

preparation. The positive control, O.viverrini actin, showed expression in all

developmental stages (Figure 41).

Figure 41. Developmental stage reverse transcription-PCR. Panel legend: (A) O.

viverrini caspase 9 specific RT-PCR; (B) O. viverrini actin specific control RT-PCR.

Developmental stages examined: (A) adults >1 month of age, (J) juvenile fluke <1 month

of age, (M) metacercariae, and (E) eggs.

4.2. FRS2 AND TGF-β

Two well-known signal transmitting pathways are the transforming growth factor-β

(TGF-β) pathway responsible for mediating a large number of physiologic processes and the protein tyrosine receptors which include the growth factors fibroblast growth factor

(FGF), nerve growth factor (NGF), and the epidermal growth factor (EGF) pathways.

Genes have been characterized from some trematodes, particularly S. mansoni, that encode signal transduction functions including epidermal growth factor receptors

(Shoemaker et al. 1992) transforming growth factor receptors (Davies et al. 1998) and receptor serine/threonine kinases (Forrester et al. 2004). Two expressed sequence tags identified by the O.viverrini genome discovery project initiated by Dr. Laha at Khon

Kaen University in 2007, upon preliminary BLAST analysis, appeared to encode a FGF receptor and a TGF-β receptor.

4.2.1. FRS2

Hypothesis: Gene discovery approaches have indicated that an ortholog of FRS2

is expressed by Opisthorchis viverrini. It can be expected that this molecule is

structurally and biochemically similar to orthologous molecules from phylogenetically similar organisms as well as to those of humans and more distantly related species. Appropriate experimental analyses to include phylogenetic comparisons and functional activity studies of recombinant form of this O. viverrini

ortholog should confirm its identity, inform its likely function, and enhance our

understanding of the physiology of this carcinogenic liver fluke.

Fibroblast growth factors (FGF) are essential for the control of cellular processes

such as growth, differentiation, and cell migration. FGFs, by way of FGF receptor

stimulation, cause induction of tyrosine phosphorylation of the lipid-anchored docking

protein, fibroblast receptor substrate 2 (FRS2). This protein forms a complex with Grb2

and Sos1 thereby activating the Ras/MAPK signaling pathway which is essential for

growth factor-induced cell proliferation and differentiation (Figure 5).

4.2.1.1. Aim 1: Bioinformatics and phylogenetic analyses

The nucleotide sequence of OvAE1563 (EL620245) EST was determined at the

George Washington University by using vector- and gene-specific primers containing an

ORF of 315 deduced amino acids. Characterization utilizing the BLASTp and ExPASy programs showed the ORF contained a highly conserved region corresponding to a phosphotyrosine binding (PTB) domain, an NH2-terminal myristylation site, and several

well conserved COOH-terminal tyrosines. These components are common to the family

of FRS2 docking proteins involved in the signal transmission from FGF or NGF to FGF

receptors of the Ras/mitogen activated protein kinase (MAPK) signaling cascade.

BLASTp analysis showed many putative orthologues with some of the closest to the

putative O. viverrini FRS2 being an uncharacterized sequence of Schistosoma japonicum,

and several well-documented FRS2 sequences from Apis mellifera, Xenopus laevis, and

Danio rerio. SignalP3.0 analysis predicted this was not a signaling protein; however,

TMPred analysis did predict that this ORF was associated with a transmembrane protein

on the inside of the membrane. This transmembrane association was expected since the

NH2-terminal myristylation is a site of lipid β anchoring to the membrane (Kurokawa et

96 al. 2001). The preliminary structure has been predicted from multiple alignments of the various domains against known FRS2s. The predicted length and location of the various components, i.e. myristylation site, Grb2 binding sites, Shp2 binding sites, and PTB domain are indicated in Figure 42 comparing O. viverrini FRS2 to several well- documented orthologues of FRS2. Alignment of the O. viverrini FRS2 sequence against orthologues from Xenopus laevis, H. sapiens, A. mellifera, and C. elegans using the

BioEdit and GeneDoc program are shown below (Figure 42).

Figure 42. Multiple sequence alignment of well- characterized FRS2 or FRS2-

like orthologues against the translated ORF of OvAE1563 (O. viverrini FRS2). The

OvAE1563 is the middle sequence denoted by the wording translation. The various

domains and sites of fibroblast growth factor receptor substrates are denoted by the

various boxes. The myristylation site is outlined by a purple box, Grb2 binding sites

(YXN) by red boxes, Shp2 binding sites (Y, I/V/A, X, V/I/L/P) by blue boxes, putative

Shp2 binding sites by green boxes, and the PTB domain is indicated by the black arrow.

The myristylation region has a consensus sequence of MGXXXS/T at the NH2-

terminal site that allows binding of lipids to the plasma membrane (Gotoh 2008). The

“X” denotes that any residue can be in that place. The putative O. viverrini FRS2 has a

myristylation sequence of MGLSQS at the NH2-terminal end of the PTB domain. The

Grb2 has SH2 domains with the consensus sequence of YXNX that interacts with Sos

and activates the Ras/MAPK pathway(Gotoh 2008). The O. viverrini contains one Grb2

site near the COOH-terminal end of the protein sequence and three putative Grb2 SH3

domains which function as Shp2 binding sites when tyrosine phosphorylated activates

ERK in response to fibroblast growth factor resulting in Ras/ERK pathway stimulation

((Gotoh 2008; Ahmed et al. 2010). The consensus sequence for the Shp2 site is Y, I/V/A,

X, V/I/L/P. There are three putative Shp2 binding sites present in the alignment that

varies from YPVL to YLIA and to YVDE. Based on the blast searches and multiple

sequence alignments, it is possible now to identify OvAE1563 as a fibroblast growth

factor receptor substrate.

A phylogenetic tree with the least cost was generated from the CLUSTAL W

(Thompson et al. 1994) alignments using the BLOSUM substitution matrix and Bootstrap support values of 1000 in the Accerlys3.0 program and POY4. Sequence alignments and subsequent phylogenetic analyses of O. viverrini FRS2 compared to FGF receptor orthologues and FGF receptor substrate orthologues indicated the O. viverrini FRS2 was more closely related to other FGF receptor substrate orthologues than the FGF receptor orthologues (Figure 43). The following accession numbers from GenBank were used to generate the tree: FRS2 (Mus musculus – NP_808466, Homo sapiens-NP_006645,

Xenopus laevis- AAH46943, Danio rerio – AA165296, and Apis mellifera

XP_001122793); FRS3 (Mus musculus – NP_659188, Homo sapiens – NP_006644,

Xenopus laevis- AAH71027); ROG-1 C. elegans-BAF48662; FGFR1 (Stronglocentrotus purpuratus- XP_792985, Dugesia-BAB92085); FGFR2 (Dugesia- BAB92086, Bombyx mori-BAE94421); FGFR (P. falciparum- XP_001351028, D. melanogaster – AAF52672,

Debarynomyces hansenii- CAG85765).

100

Figure 43. Phylogenetic analyses of O.viverrini FRS2 indicated the O. viverrini orthologue was more closely related to FGF substrates than to FGF receptors. This least cost phylogenetic tree was generated from ClustalW alignments using the BLOSUM substitution matrix and Bootstrap support values of 1000 in the Accerlrys 3.0 program

and POY4. A fast alignment speed with an open gap penalty of 8, extended gap penalty

of 0.05, and delay divergents of 30% were also employed.

4.2.1.2. Aim 2: Recombinant expression and affinity purification

The OvAE1563 ORF was modified by PCR to contain Kpn1 and Sac1 restriction sites with clamps then ligated into expression vector of pET-50b(+) and the subsequent ligation products used to transform Top 10 E. coli cells for stabilization. Double

101

restriction digestion with Kpn1 and Sac1 followed by gel electrophoresis was used to verify the presence of the OvAE1563 insert which was confirmed by nucleotide sequencing using vector- and gene-specific primers. Following confirmation of the correct sequence, the construct was then employed to transform BL21 expression E. coli cells. Protein expression was induced in the bacterial culture by the addition of 0.1 M

IPTG final concentration and incubation for ~ 4 hours. Induced cultures were analyzed and shown to have stronger band density at ~94 kDa when compared to the uninduced cultures on a Coomassie stained SDS-PAGE analysis (Figure 44).

Figure 44. Coomassie-stained SDS-PAGE undertaken to analyze the recombinant fusion protein expression obtained using the pET-50b(+) O. viverrini FRS2 construct

transformed BL21 E. coli cells. The fraction location of the samples induced (I) by 0.1 M

IPTG are compared to uninduced (U) samples. Lane legend: 1 – broad range protein

standard; 2 – empty lane; 3 & 4 – total cell protein; 5 & 6 – medium protein; 7 & 8 –

102

periplasm protein; 9 & 10 – soluble cytoplasm protein; and 11 & 12 – insoluble cytoplasm protein.

The complete recombinant fusion protein containing the 5’-hexa-His tags and 3’-

S-tag was validated by western blot analyses using monoclonal anti-penta His and S-

protein-HRP conjugate antibodies. The expected molecular mass of this fusion protein is

~94 kDa with the majority made up by the NusA fusion partner, 54 kDa, and the remainder being the recombinant O.viverrini FRS2, 40 kDa, and the various tags and cleavage sites.

The location of the recombinant protein was evaluated in various cellular compartments and found to be primarily in the inclusion bodies. This finding was further validated by western blot analyses by penta-His tag antibody to identify the NH2- terminal end of the protein and S-tag conjugate to detect the COOH-terminal end of the protein. The insoluble fraction of the protein was solubilized in an 8M urea neutral pH

phosphate buffer and affinity purified under denaturing conditions on TALON® resin.

The elution was optimized by adding 150 mM imidazole to the 8M urea neutral pH

phosphate buffer. The affinity enrichment was documented by western blot and

coomassie blue analyses (Figure 45).

103

54 kDa

40 kDa

Figure 45. Affinity chromatography of pET-50b(+) O. viverrini FRS2 construct -

Panel legend: (A) Coomassie blue analysis of the affinity purification of FRS2; (B)

Western blot analysis probed with hexa-His antibody; (C) Western blot analysis probed with S-tag conjugate HRP. Lane legend: 1 – broad range marker; 2 – flow through; 3 – first wash; 4 – last wash; 5 through 9 – purified protein elution fractions. The 40 kDa band is approximately the size of the recombinant O. viverrini FRS2 protein.

Refolding experiments were undertaken, in similar fashion as the O. viverrini

caspase 9, with the eluate from affinity chromatography utilizing the small scale rapid

dilution technique. These were monitored with coomassie and western blot analysis. The

recombinant protein was then cleaved with the HRV-3C protease which uses a neutral pH

104 buffer for its reaction. No activity assays have been done to evaluate if the refolding resulted in an active conformation.

4.2.1.3. Aim 4: Functional studies

Reverse transcription (RT)-PCR was used to evaluate the expression of the recombinant FRS2 in O.viverrini life cycle stages. The O.viverrini FRS2-like cDNA was evaluated in all developmental stages: eggs, metacercariae, juvenile (<1 month), and adult flukes. The expected product size of 417 bp was seen in each developmental stage.

The negative control in which water was substituted for the reverse transcriptase indicated the absence of genomic DNA contamination in the cDNA preparation.

O.viverrini actin, included as the target positive control, was expressed in all developmental stages examined, confirming the integrity of the RNA samples. (Laha, personal communication) (not shown).

4.2.2. TGF-β receptor type 1

Hypothesis: Gene discovery approaches have indicated that an ortholog of

TGF-β receptor type 1 is expressed by Opisthorchis viverrini. It can be expected that this molecule is structurally and biochemically similar to orthologous molecules from phylogenetically similar organisms as well as to those of humans and more distantly related species. Appropriate experimental analyses to include phylogenetic comparisons and functional activity studies of recombinant form of this O. viverrini ortholog should confirm its identity, inform its likely function, and enhance our understanding of the physiology of this carcinogenic liver fluke.

105

The transforming growth factor-β family regulates a wide variety of biological

processes such as differentiation, adhesion, migration, cell division, and apoptosis.

Binding of cytokines to the TGF-β cell surface receptors initiates the signaling cascade.

The cell surface receptors are transmembrane serine/threonine kinases denoted either

Type I or Type II (Beall and Pearce 2001; Zavala-Gongora et al. 2006; Loverde et al.

2007) .

4.2.2.1. Aim 1: Phylogenetic analyses

EST clone OvAE22 was obtained from Dr. Thewarach Laha, Khon Kaen

University, Thailand ((Laha et al. 2007). The insert of this clone has been assigned

GenBank accession EL618704. At the George Washington University, nucleotide

sequencing using vector- and gene-specific primers showed it included an ORF of 197 aa

residues. Blastp revealed the serine/threonine kinase domain of a TGF-β receptor Type 1

(TGF-βR1). Phylogenetic analysis and multiple sequence alignments of the

serine/threonine kinase domain have shown highly conserved regions which align with

similar regions of Schistosoma mansoni (SmTR1), Echinococcus multilocularis

(EmTR1), and human TGF-βR1 (Figures 46).

106

Figure 46. Multiple sequence alignments of TGF-βR1well-known model species and OvAE22. The two highly conserved regions commonly found in serine/threonine kinase domains regions in TGF-β receptor type 1 are indicated by the purple and red boxes. The region AIAHRD is highlighted by the purple box and GTKRYMA by the red box. The specific alignments are as follows human TGF-βR1 is Homo sapiens, SmRK1 is Schistosoma mansoni TGF-β receptor 1, OvAE22 denotes the O. viverrini putative

TGF-β receptor type 1., and EMTR1 is Echinococcus multilocularis TGF-β receptor type

OvAE22 consists of 197 amino acids which are part of the serine/threonine kinase domain and contain two highly conserved stretches of amino acids, AIAHRD and

GTKRYM (Zavala-Gongora et al. 2006)(Zavala-Gongora et al. 2006). SignalP3.0 and

TMPred analyses indicated the absence of signal peptide or transmembrane regions in the

107

known portion of the receptor sequence. The predicted structure of the receptor is

presented in Figure 47.

Figure 47. The predicted structure of O. viverrini TGF-β receptor Type I. Legend:

ED = extracellular domain; TM = transmembrane; GS = glycine-serine rich domain; and

Kinase – serine/threonine kinase domain.

108

Figure 48. A preliminary phylogenetic tree was made from alignments found to be potential orthologues during the BLAST analysis of the putative O. viverrini TGF-β receptor type 1. The Accelyrs 3.0 program under default settings was used to make to the tree.

Several attempts were made to obtain more of the amino acid sequence at the 5’end by using a 5’RACE technique and RNA from adult O. viverrini worms. An additional 15 amino acids have been located at the N-terminal end of the receptor to give a total of 212 residues encoding a serine/threonine kinase region. Unfortunately, without the entire

ORF, biochemical analysis of receptor function is not likely to be informative nor definitive identification of the protein possible.

109

Chapter 5: DISCUSSION

This research project has undertaken to characterize, to varying degrees, three

different O. viverrini proteins involved in a number of fundamental cellular processes, to include apoptosis, cell differentiation, cell growth and behavior. Cell signaling creates a flow of intracellular reactions that control almost all aspects of cell behavior and homeostasis (Cooper and Hausman 2007). The O. viverrini proteins characterized were caspase 9, fibroblast growth factor receptor substrate 2 (FRS2), and a partial transforming growth factor- beta (TGF-β) receptor type 1. While all are dissimilar to each other, they can all be categorized as involved in signaling and signal transduction.

5.1. O. viverrini CASPASE 9

Caspases are a family of cysteine proteases from the MEROPS clan CD, Family

C14 that have diverse roles in inflammatory responses and apoptosis. Some of the features common to all family members include the catalytic active site cysteine and a preference to cleave on the carboxyl side of aspartate residues. Caspases can be classified based on their function into one of three categories: inflammatory response and cytokine maturation, apical or initiator caspases, and executioner or effector caspases. Caspase 9 is an initiator or apical caspase that functions in the intrinsic pathway of apoptosis,

activating directly the executioner caspases by proteolysis (Ho and Hawkins 2005). The

intrinsic signaling pathway can be activated by ionizing radiation, chemotherapeutic

drugs, mitochondrial damage, and developmental cues. Mitochondria release cytochrome

110

c which allows the CARD (caspase activation and recruitment domain) on Apaf-1 to bind with the CARD domains of the caspase 9, forming dimers. The binding of the zymogen

caspase 9, Apaf-1, cytochrome c along with the ATP forms the apoptosome which

induces a conformational change in the caspase 9, stimulating autoactivation. Activated

caspase 9 initiates the downstream executioner caspases 3 and 7, effecting small cell

death (Boatright and Salvesen 2003).

Based on findings with other species of the phylum Platyhelminthes (e.g. (Hwang

et al. 2004)), it is likely that trematodes utilize apoptosis in programmed cell death and

other physiological processes. To begin to address these issues in O. viverrini, baseline

apoptosis was visualized in adult flukes through TUNEL (terminal deoxynucleotidyl

transferase dUTP nick end labeling) analysis of fixed sections of adult O. viverrini in bile

ducts of experimentally infected hamsters. These studies identified low levels of

apoptotic cells in the tegument and other regions of the adult flukes. Apoptosis is

important in normal cell development by controlling the cell number and growth

(Ghobrial et al. 2005) and therefore would be expected to exist in all developmental

stages of the O. viverrini life cycle. Developmental stage reverse transcription PCR

indicated that O. viverrini caspase 9 is present in all life cycle stages - eggs,

metacercariae, juvenile, and adult flukes. Caspase activity and inhibition studies using

soluble lysate of adult flukes showed activity specific to caspase 9 by cleavage of peptide

substrate for mammalian caspase 9. The inhibition of the whole protein lysate from the

adult flukes of O. viverrini by the caspase 9-specific inhibitor, Ac-LEHD-CHO, was

found to be statistically significant however not complete. This finding is likely due to

several factors. Since the assay was developed using mammalian caspase 9, it is very

111

likely that the O. viverrini cleavage of the substrate may not be as complete or there may

be more flexibility or competition in the inhibitor binding due to natural conformation

variations between species and different kinetic rate constants. The caspase activity

studies of the recombinant O. viverrini caspase 9 showed the luminescence was

proportional to the protein concentration used within the assay. Further substrate studies

using the recombinant O. viverrini caspase 9, showed very specific activity to the caspase

9 substrate whereas little to no activity was noted against the downstream caspase 3

substrate (Chapter 4). The caspase 3/7 assay utilizes the specificity of the caspase 3/7

substrate that contains the DEVD tetrapeptide versus the caspase 9 specific substrate of

LEHD (Thornberry et al. 1997). This finding was of interest due to CED-3 has some

function not only as a initiator of the intrinsic apoptotic pathway but also as an

executioner (Chinnaiyan 1999).

Bioinformatic and phylogenetic studies categorized the contig of OvAE561 to

encode a caspase 9-like protein that branched with other well-known caspase 9 of

vertebrates and invertebrates (Chapter 4). Multiple sequence alignment analyses

discerned the preliminary structure of the O. viverrini orthologue and identification of the important highly conserved landmarks of a caspase 9 such as the QACRG active site

motif containing the active cysteine residue.

The recombinant O. viverrini caspase 9 was able to be expressed using two

different expression vectors in sufficient enough quantities to allow study in the

functional assays outlined in Chapter 3. The pET50b (+) vector encoded a recombinant

construct containing a NusA fusion protein. The original construct utilized NusA, on the

NH2-terminal end, as a carrier protein to stabilize and express proteins in soluble form

112 that are usually thought to be insoluble (De Marco et al. 2004). NusA has the ability to express at high levels and to solubilize large proteins (Harrison 2000) and may also allow the soluble form of the target protein to be obtained in an active form without the need for refolding (De Marco et al. 2004). The S-tag in both constructs was considered an asset due to its location at the COOH-terminal. S-tag provided a control to determine if the complete protein was expressed or only a portion as well as provided a marker to analyze the cleavage of the NusA from the O. viverrini protein through the HRV 3C protease site (Chapter 3). The S-tag is 15 amino acid residues, has high detection sensitivity, is highly soluble, and a net charge close to neutral pH making it unlikely to interfere with function or proper refolding(Raines et al. 2000). Further manipulation of the expressed enzyme, to include refolding and cleavage, yielded enough active enzyme for evaluation of substrate specificity and inhibition. Peptide sequencing confirmed the expression of a recombinant caspase 9 of O. viverrini.

5.2. O. viverrini FIBROBLAST GROWTH FACTOR RECEPTOR SUBSTRATE 2

(FRS2)

There are ten different fibroblast growth factors (FGFs) that control cellular processes such as cellular differentiation, cellular growth, and cell migration. Biological responses are induced by binding and activating cell-surface receptors called FGF receptors. These receptors all have intrinsic protein tyrosine kinase activity (Kouhara et al. 1997). These FGF receptors have associated proteins, adaptor or docking proteins, which lack catalytic activity but relay key events of signal transduction from upstream to

113

downstream (Gotoh 2008) these are members of the class of protein tyrosine kinases

(PTK) called non-receptor tyrosine kinases (NRTKs) (Neet and Hunter 1996). FRS2 is a

docking protein which is activated by FGF receptor and recruits growth factor binding

protein 2 (Grb2) and guanine nucleotide releasing tyrosine phosphate factor (Sos) to

further signal transduction along the pathway (Hadari et al. 2001). FRS2 is crucial to

signal transduction because Grb2 and Sos cannot interact with the FGF receptor alone

(Lo et al. 2010). FRS2, like many docking proteins, share a common structure which

includes an NH2-terminal myristylation domain that anchors FRS2 to the intracellular

surface of the membrane and a phosphotyrosine binding (PTB) domain that facilitates the

direct association of the activated receptor tyrosine kinases (Ong et al. 2000). The

COOH- terminus usually has multiple tyrosine phosphorylation sites which bind to either

the SH2 domains of Grb2 to stimulate the Ras/MAPK pathway or to SH3 domains to

Shp2 to stimulate Ras/ERK pathway (Gotoh 2008). Many components involved in the

protein tyrosine kinase (PTK) receptor-initiated pathways, which include the FGF

pathway and the EGF pathway, have been characterized in S. mansoni (Bahia et al. 2006;

Bahia et al. 2007; Ludolf et al. 2007) and Echinococcus multilocularis (Spiliotis et al.

2003; Zavala-Gongora et al. 2006).

Bioinformatic analyses and multiple sequence alignments determined several conserved domains in the OvAE1563 ORF such as myristylation site at the NH2- terminal

end, PTB binding site, and several conserved tyrosines in the COOH terminal area. Initial

blast searches included homologs from FGF receptors along with FRS2 and FRS3.

Phylogenetic analyses showed the OvAE1563 branched more closely with the FGF

receptor substrate orthologs than to the FGF receptors. The identification of OvAE1563

114 as O. viverrini FRS2 was further confirmed with the TMPred prediction of an association with a transmembrane protein along with the SignalP3.0 prediction of no signaling protein (Chapter 4). The transmembrane association was expected since the NH2- myristylation is a site of lipid anchoring to the membrane (Ong et al. 2000). FRS2 and

FRS3 share common conserved domains such as the myristylation site, PTB, and the tyrosine sites of Grb2 and Shp2 and there is a 49% sequence identity between them. The

FRS2-like protein, ROG-, contains only a PTB domain which shows 36-47% homology to SNT or FRS2 family of adaptors in Homo sapiens (Matsubara et al. 2007). FRS2 has critical role in FGF pathway resulting in successful cell differentiation, proliferation, migration, and cycle arrest. FRS3 role is less understood (Valencia et al. 2011).

With the pervasiveness of the FGF pathway in all aspects of homeostasis, it is hypothesized that FRS2 will be found in all developmental stages of the O. viverrini life cycle. O. viverrini FRS2 was evaluated for expression using reverse transcription PCR and found to be present in all life stages – eggs, metacercariae, juveniles (<1 month) and adults flukes (Laha and coworkers, unpublished).

The putative O. viverrini FRS2 was expressed primarily in the inclusion bodies and solubilized in 8 M urea containing neutral pH phosphate buffer. Refolding experiments were completed using the rapid dilution technique. The NusA protein was cleaved from the fusion protein using HRV 3C protease and verified with Coomassie and western blot analyses. Future studies should include immunolocalization and investigation of the role of O. viverrini FRS2. In vertebrates, FRS2 critically ties FGF receptors to Grb2 and thereby stimulates the Ras/MAPK pathway however, in C. elegans the FRS2-like gene, rog-1, activity is upstream for oocyte maturation function of the Ras/MAPK pathway but

115

is not required for the EGL-15, the C. elegans FGF receptor, to interact with the FGF

pathway (Lo et al. 2010). At present, no specific FRS2-like proteins have been described in trematodes however several NRTKs (non- receptor tyrosine kinases) have been described in Schistosoma mansoni.

5.3. PUTATIVE O. viverrini TRANSFORMING GROWTH FACTOR-β

RECEPTOR TYPE I (TGF-β type 1)

The TGF-β family regulates many physiologic processes within the body of the

parasite but also activates and transmits signals at the host-parasite level (Loverde et al.

2007). This pathway and family is one of the best characterized signaling pathways in

trematodes, particularly schistosomes (Knobloch et al. 2007). The family can be

subdivided into two subfamilies: the TGF-β/Activin subfamily and the bone

morphogenetic protein (BMP) subfamily (Freitas et al. 2009b). Binding of cytokines to

TGF-β receptors at the cell surface initiates signal transduction. The two receptors are

transmembrane serine/threonine kinases denoted as type I and type II. Binding of a ligand

to the type II receptor causes phosphorylation and activation of type I receptor (Zavala-

Gongora et al. 2006). The type I receptor then phosphorylates Smad proteins which

complex with Co-Smads, cross the nuclear membrane, and regulates gene expression

(Beall and Pearce 2001). A type I receptor has been described for S. mansoni (Davies et

al. 1998).

The structure of the S. mansoni TGF-β receptor type I (SmRK1) and those of

other known orthologues contain an extracellular domain, transmembrane domain, GS-

116

box, and a serine/threonine kinase region (Beall and Pearce 2001; Zavala-Gongora et al.

2006). The O. viverrini EST OvAE22 was found on bioinformatics analysis to have the

serine/threonine kinase domain of a TGF-β receptor type I (TGF-βRI). Multiple sequence

alignment and phylogenetic study have shown alignment with highly conserved regions

in the serine/threonine kinase domain similar to E. multilocularis, S. mansoni, and human

TGF-βRI. The O. viverrini contig is incomplete at this time containing only the most

COOH-terminal structure. A total of 212 amino acids have been differentiated following

multiple iterations using the 5’RACE technique. At present, a putative partial O. viverrini

TGF-βRI has been uncovered. Future studies should investigate O. viverrini sequences

uncovered in the initial gene O. viverrini discovery program (Laha et al. 2007) and

supplemented by Young et al (2010) for either the complete sequence or the NH2-

terminal end of the TGF-βR1 gene.

5.4. O. viverrini SIGNALING PROTEINS AS TARGETS FOR

INTERVENTIONS

Three signaling proteins have been characterized, to varying degrees, in this

research project. Signaling molecules that contain the widest variety of functions are the

peptides which include neuropeptides, neurohormones, hormones, and growth factors

(Cooper and Hausman 2007). Some of the molecules function on the cell surface as

receptors and others function by transmitting signals within the cell setting off a chain

reaction ending in programmed gene expression. All three molecules discussed in this

117

project are components of important signaling pathways involved in the cell differentiation, cell growth, migration, and apoptosis.

5.4.1. O. viverrini caspase 9

Apoptosis or programmed cell death is a mechanism used throughout the life of an

organism to control cell proliferation or respond to DNA damage. It is central to normal

homeostasis in many organisms (Ghobrial et al. 2005). Dronc, the caspase 9 ortholog of

D. melanogaster has been found to be important in the programmed cell death associated

with embryogenesis (Quinn et al. 2000). In C. elegans, CED-3 is involved in embryogenesis as well as in neural regeneration (Pinan-Lucarre et al. 2012). A recent paper described an Bcl-2-regulated cell death pathway in schistosomes (Lee et al. 2011).

The Bcl-2 family has an anti-apoptotic effect on the intrinsic pathway inhibiting the release of cytochrome C from the mitochondria or in response to activation of a different subset of the Bcl-2 family, containing BH3 domains, will be pro-apoptotic by stimulating the release of cytochrome C (Tischner et al. 2010) . It was found that a prosurvival protein associated with cell death in schistosomes binds to a BH3 mimetic drug used in cancer chemotherapy. This is initial evidence that this class of compounds may have feasibility as potential therapy for schistosomiasis (Lee et al. 2011).

Functional apoptosis has not been demonstrated in parasitic worms. Parasites have developed adaptations to cope with their parasitic way of life such as optimum temperature conditions which match their hosts and increased fecundity to ensure transmission and continuation of the life cycle. In establishing chronic infections,

118

parasitic helminths have also adapted to the assault of stress-inducing molecules that

could trigger apoptosis (Mohapatra et al. 2011). A critical step for transmission and survival of parasites is successful embryogenesis (Freitas et al. 2009b). Using Setaria digitata, a parasitic filarial of cattle, Mohapatra et al was able to demonstrate induction of apoptosis. The embryonic death caused by apoptosis was found to be a caspase dependent occurrence mediated primarily by the induction of intracellular ROS (Mohapatra et al.

2011). Testing of approved pharmaceutical compounds against developing embryos of

Setaria digitata showed curcumin, which is known to stimulate ROS mediated apoptosis in mammals, had the most effect followed by Primaquine. Chloroquine and DEC had minimal and no effect, respectively (Mohapatra et al. 2011). These studies show the apoptotic pathway, known to be crucial to embryogenesis, is a valid target for developing antiparasitic therapies.

5.4.2. O. viverrini FRS2

Ras-MAPK pathway is positively regulated by Ras (let-60) which operates downstream of ROG-1, the adaptor like protein with similar functions to vertebrate FRS2 in C. elegans permitting germ cells to produce oocytes (Matsubara et al. 2007). FRS2 is an excellent target for chemotherapeutics because of its critical role in the signaling and activation of the Ras/MAPK pathway (Valencia et al. 2011). The role of FRS2 in O. viverrini is not known at this time and as yet the Ras/MAPK pathway has not been outlined either. Protein tyrosine kinases have been identified as potential intervention targets for schistosomiasis due to the identification of several cytosolic and receptor

119

PTKs with characteristics similar to but still different enough to provide potential targets

(Dissous et al. 2007).

In Drosophila, several members of the FGF pathway have been identified. They

have been found to be essential to the early migration and patterning of the embryonic

mesoderm and proper branching of the tracheal system. Heartbroken, an FRS2-like adaptor of Drosophila, stimulates the Ras/MAPK pathway by way of RAS1. Heartbroken was found to have specificity for the developmental responses stimulated by the FGF receptor signaling and no effect on the EGF pathway (Michelson et al. 1998). This relationship is very similar to FRS2 effect in mammals.

Four cytosolic tyrosine kinases have been described in schistosomes although none are considered to be FRS2-like. TK3, a Src kinase ortholog, has been shown to have a direct effect on mitogenic processes and organization of the cytoskeleton of schistosome

gonads (Kapp et al. 2004). TK5, a Fyn-like member of the Src kinase family, plays a role

in gut formation and/or function as well as embryogenesis (Kapp et al. 2001). TK4, an

ortholog of the Syk family of kinases, is suggested to have a role in germ cell development and has been found in all stages of development (Knobloch et al. 2002).

SmFes, an ortholog similar to the Fes/fps subfamily, has a role in signal transduction pathway used for larval transformation following penetration of intermediate and definitive hosts (Ludolf et al. 2007).

High sequence identity of schistosome components of the FGF signaling pathway to mammalian orthologues suggest host factors may be utilized for growth and development in addition to its own (You et al. 2011). Using this information regarding

120 the activity of the known NRTKs in parasitic and model species, a parasite-specific protein tyrosine kinase would provide a unique chemotherapy opportunity (Dissous et al.

2007).

5.4.3. O. viverrini TGF-β receptor type 1

There is much work to be done to fully characterize a TGF-βR1 for O. viverrini.

The TGF-β pathway is very important in many aspects of cellular physiology regulating genes responsible for cell division, developmental patterning, tissue repair, cell adhesion, growth and differentiation (Zavala-Gongora et al. 2006). The TGF-β superfamily contains 2 subfamilies, TGF-β/Activin family and the bone morphogenetic protein

(BMP) family. Two transmembrane serine/threonine kinase receptors have been described in schistosomes, type I and type II. The type II receptor is bound by a ligand, phosphorylated, and then activated the type I receptor (Zavala-Gongora et al. 2006). Type

I receptor than phosphorylates the R-Smads which complex with Co-Smads, cross the nuclear membrane, and stimulate gene expression (Beall and Pearce 2001).

The TGF-β pathway has been widely studied in schistosomes with many components of the pathway characterized. SmTRβRII can activate SmTRβRI in the presence of human TGF-βI thereby showing that S. mansoni can use host ligand for growth and development (Loverde et al. 2007). Recent data has shown that several reproductive functions such as the pairing process, proliferation, and differentiation of vitelline cells, expression of female-specific genes and egg embryogenesis are regulated by the TGF-β pathway as well as by protein tyrosine kinases in schistosomes (LoVerde et

121

al. 2009). It is very possible that the TGF-β pathway and TGF-βRI will play similar roles

in O. viverrini.

The inital characterizations of O. viverrini caspase 9, FRS2, and TGF-βR1

presented here provide the platform for future studies into these signaling pathways. The

O. viverrini signaling proteins characterized during this study all likely represent key

components in the homeostatic and physiologic processes of the liver fluke’s reproduction and survival. As shown earlier in this chapter, finding the function of a

specific signaling pathway in the survival and transmission of an organism can provide many potential targets for intervention. Some examples are the BH3 mimetics (Lee et al.

2011) and curcumin (Mohapatra et al. 2011) to interfere with apoptotic pathway

important in embryogenesis, tyrosine phosphorylation inhibitors used for cancer therapy

to interrupt the FGF and EGF pathways (You et al. 2011), and development of parasite-

specific therapies which would not interfere with the host signaling systems (Dissous et

al. 2007). It is my hope that the findings described here will represent a useful foundation

for subsequent investigation in the signaling physiology of liver flukes.

122

References

Ahmed, Z., George, R., Lin, C.C., Suen, K.M., Levitt, J.A., Suhling, K., and Ladbury,

J.E., 2010. Direct binding of Grb2 SH3 domain to FGFR2 regulates SHP2 function. Cell.

Signal. 22, 23-33.

Alberts, A.S., Montminy, M., Shenolikar, S., and Feramisco, J.R., 1994. Expression of a

peptide inhibitor of protein phosphatase 1 increases phosphorylation and activity of

CREB in NIH 3T3 fibroblasts. Mol. Cell. Biol. 14, 4398-4407.

Arimatsu, Y., Kaewkes, S., Laha, T., Hong, S.J., and Sripa, B., 2012. Rapid detection of

Opisthorchis viverrini copro-DNA using loop-mediated isothermal amplification

(LAMP). Parasitol. Int. 61, 178-182.

Aunpromma, S., Tangkawattana, P., Papirom, P., Kanjampa, P., Tesana, S., Sripa, B., and

Tangkawattana, S., 2012. High prevalence of Opisthorchis viverrini infection in reservoir

hosts in four districts of Khon Kaen province, an opisthorchiasis endemic area of

Thailand. Parasitol. Int. 61, 60-64.

Bahia, D., Andrade, L.F., Ludolf, F., Mortara, R.A., and Oliveira, G., 2006. Protein

tyrosine kinases in Schistosoma mansoni. Mem. Inst. Oswaldo Cruz 101 Suppl 1, 137-

143.

Bahia, D., Mortara, R.A., Kusel, J.R., Andrade, L.F., Ludolf, F., Kuser, P.R., Avelar, L.,

Trolet, J., Dissous, C., Pierce, R.J., and Oliveira, G., 2007. Schistosoma mansoni:

Expression of fes-like tyrosine kinase SmFes in the tegument and terebratorium suggests

its involvement in host penetration. Exp. Parasitol. 116, 225-232.

123

Beall, M.J., and Pearce, E.J., 2001. Human transforming growth factor-beta activates a receptor serine/threonine kinase from the intravascular parasite Schistosoma mansoni. J.

Biol. Chem. 276, 31613-31619.

Boatright, K.M., and Salvesen, G.S., 2003. Mechanisms of caspase activation. Curr.

Opin. Cell Biol. 15, 725-731.

Bouvard, V., Baan, R., Straif, K., Grosse, Y., Secretan, B., El Ghissassi, F., Benbrahim-

Tallaa, L., Guha, N., Freeman, C., Galichet, L., Cogliano, V., and WHO International

Agency for Research on Cancer Monograph Working Group, 2009. A review of human carcinogens--part B: Biological agents. Lancet Oncol. 10, 321-322.

Carlo, J.M., Osman, A., Niles, E.G., Wu, W., Fantappie, M.R., Oliveira, F.M., and

LoVerde, P.T., 2007. Identification and characterization of an R-Smad ortholog

(SmSmad1B) from Schistosoma mansoni. FEBS J. 274, 4075-4093.

Chen, J., Liu, Y., Li, X., Wang, Y., Ding, H., Ma, G., and Su, Z., 2009. Cooperative effects of urea and L-arginine on protein refolding. Protein Expr. Purif. 66, 82-90.

Chinnaiyan, A.M., 1999. The apoptosome: Heart and soul of the cell death machine.

Neoplasia 1, 5-15.

Cooper, D.M., and Hausman, R.E., 2007. The cell- A molecular approach. Sinauer

Associates, Inc., Sunderland, MA.

124

Davies, S.J., Shoemaker, C.B., and Pearce, E.J., 1998. A divergent member of the transforming growth factor beta receptor family from Schistosoma mansoni is expressed on the parasite surface membrane. J. Biol. Chem. 273, 11234-11240.

De Marco, V., Stier, G., Blandin, S., and de Marco, A., 2004. The solubility and stability of recombinant proteins are increased by their fusion to NusA. Biochem. Biophys. Res.

Commun. 322, 766-771.

De, N.V., Murrell, K.D., Cong le, D., Cam, P.D., Chau le, V., Toan, N.D., and Dalsgaard,

A., 2003. The food-borne trematode zoonoses of vietnam. Southeast Asian J. Trop. Med.

Public Health 34 Suppl 1, 12-34.

Dissous, C., Ahier, A., and Khayath, N., 2007. Protein tyrosine kinases as new potential targets against human schistosomiasis. Bioessays 29, 1281-1288.

Dorstyn, L., Colussi, P.A., Quinn, L.M., Richardson, H., and Kumar, S., 1999. DRONC, an ecdysone-inducible Drosophila caspase. Proc. Natl. Acad. Sci. U. S. A. 96, 4307-4312.

Earnshaw, W.C., Martins, L.M., and Kaufmann, S.H., 1999. Mammalian caspases:

Structure, activation, substrates, and functions during apoptosis. Annu. Rev. Biochem.

68, 383-424.

Elkins, D.B., Haswell-Elkins, M.R., Mairiang, E., Mairiang, P., Sithithaworn, P.,

Kaewkes, S., Bhudhisawasdi, V., and Uttaravichien, T., 1990. A high frequency of hepatobiliary disease and suspected cholangiocarcinoma associated with heavy

125

Opisthorchis viverrini infection in a small community in north-east Thailand. Trans. R.

Soc. Trop. Med. Hyg. 84, 715-719.

Forrester, S.G., Warfel, P.W., and Pearce, E.J., 2004. Tegumental expression of a novel type II receptor serine/threonine kinase (SmRK2) in Schistosoma mansoni. Mol.

Biochem. Parasitol. 136, 149-156.

Freitas, T.C., Jung, E., and Pearce, E.J., 2007. TGF-beta signaling controls embryo

development in the parasitic flatworm Schistosoma mansoni. PLoS Pathog. 3, e52.

Freitas, T.C., Jung, E., and Pearce, E.J., 2009. A bone morphogenetic protein homologue

in the parasitic flatworm, Schistosoma mansoni. Int. J. Parasitol. 39, 281-287.

Ghobrial, I.M., Witzig, T.E., and Adjei, A.A., 2005. Targeting apoptosis pathways in

cancer therapy. CA Cancer. J. Clin. 55, 178-194.

Gold, R., Schmied, M., Giegerich, G., Breitschopf, H., Hartung, H.P., Toyka, K.V., and

Lassmann, H., 1994. Differentiation between cellular apoptosis and necrosis by the

combined use of in situ tailing and nick translation techniques. Lab. Invest. 71, 219-225.

Gotoh, N., 2008. Regulation of growth factor signaling by FRS2 family docking/scaffold

adaptor proteins. Cancer. Sci. 99, 1319-1325.

Hadari, Y.R., Gotoh, N., Kouhara, H., Lax, I., and Schlessinger, J., 2001. Critical role for

the docking-protein FRS2 alpha in FGF receptor-mediated signal transduction pathways.

Proc. Natl. Acad. Sci. U. S. A. 98, 8578-8583.

126

Hanks, S.K., Quinn, A.M., and Hunter, T., 1988. The protein kinase family: Conserved

features and deduced phylogeny of the catalytic domains. Science 241, 42-52.

Harrison, R., 2000. Expression of soluble heterologous proteins via fusion with NusA protein. InNovations 11, 4.

Haswell-Elkins, M.R., Satarug, S., Tsuda, M., Mairiang, E., Esumi, H., Sithithaworn, P.,

Mairiang, P., Saitoh, M., Yongvanit, P., and Elkins, D.B., 1994. Liver fluke infection and cholangiocarcinoma: Model of endogenous nitric oxide and extragastric nitrosation in

human carcinogenesis. Mutat. Res. 305, 241-252.

Ho, P.K., and Hawkins, C.J., 2005. Mammalian initiator apoptotic caspases. FEBS J. 272,

5436-5453.

Honjo, S., Srivatanakul, P., Sriplung, H., Kikukawa, H., Hanai, S., Uchida, K., Todoroki,

T., Jedpiyawongse, A., Kittiwatanachot, P., Sripa, B., Deerasamee, S., and Miwa, M.,

2005. Genetic and environmental determinants of risk for cholangiocarcinoma via

Opisthorchis viverrini in a densely infested area in Nakhon Phanom, northeast Thailand.

Int. J. Cancer 117, 854-860.

Hotez, P.J., Brindley, P.J., Bethony, J.M., King, C.H., Pearce, E.J., and Jacobson, J.,

2008. Helminth infections: The great neglected tropical diseases. J. Clin. Invest. 118,

1311-1321.

127

Hou, P.C., and Pang, S.C., 1956. Chorioepithelioma: An analytical study of 28

necropsied cases, a special reference to the possibility of spontaneous retrogression. J

Pathol Bacteriol 72, 95-104.

Hwang, J.S., Kobayashi, C., Agata, K., Ikeo, K., and Gojobori, T., 2004. Detection of

apoptosis during planarian regeneration by the expression of apoptosis-related genes and

TUNEL assay. Gene 333, 15-25.

IARC, 1994. Schistosomes, liver flukes and Helicobacter pylori.. IARC Monograph

Evaluation of Carcinogenic Risks to Humans 61, 1-241.

Imao, M., Nagaki, M., Imose, M., and Moriwaki, H., 2006. Differential caspase-9-

dependent signaling pathway between tumor necrosis factor receptor- and fas-mediated

hepatocyte apoptosis in mice. Liver International 26, 137-146.

Jongsuksuntigul, P., and Imsomboon, T., 2003. Opisthorchiasis control in Thailand. Acta

Trop. 88, 229-232.

Kaewpitoon, N., Kaewpitoon, S.J., Pengsaa, P., and Sripa, B., 2008. Opisthorchis viverrini: The carcinogenic human liver fluke. World J. Gastroenterol. 14, 666-674.

Kapp, K., Knobloch, J., Schussler, P., Sroka, S., Lammers, R., Kunz, W., and Grevelding,

C.G., 2004. The Schistosoma mansoni src kinase TK3 is expressed in the gonads and

likely involved in cytoskeletal organization. Mol. Biochem. Parasitol. 138, 171-182.

128

Kapp, K., Schussler, P., Kunz, W., and Grevelding, C.G., 2001. Identification, isolation and characterization of a fyn-like tyrosine kinase from Schistosoma mansoni.

Parasitology 122, 317-327.

Keiser, J., Duthaler, U., and Utzinger, J., 2010. Update on the diagnosis and treatment of food-borne trematode infections. Curr. Opin. Infect. Dis. 23, 513-520.

Keiser, J., and Utzinger, J., 2007. Food-borne trematodiasis: Current chemotherapy and

advances with artemisinins and synthetic trioxolanes. Trends Parasitol. 23, 555-562.

Khurana, V., dubey, M.L., and Malla, N., 2005. Association of parasitic diseases of

cancer. Indian Journal of Medical Microbiology 23, 74-79.

Knobloch, J., Beckmann, S., Burmeister, C., Quack, T., and Grevelding, C.G., 2007a.

Tyrosine kinase and cooperative TGFbeta signaling in the reproductive organs of

Schistosoma mansoni. Exp. Parasitol. 117, 318-336.

Knobloch, J., Beckmann, S., Burmeister, C., Quack, T., and Grevelding, C.G., 2007b.

Tyrosine kinase and cooperative TGFbeta signaling in the reproductive organs of

Schistosoma mansoni. Exp. Parasitol. 117, 318-336.

Knobloch, J., Winnen, R., Quack, M., Kunz, W., and Grevelding, C.G., 2002. A novel syk-family tyrosine kinase from Schistosoma mansoni which is preferentially transcribed in reproductive organs. Gene 294, 87-97.

Koenig, U., Eckhart, L., and Tschachler, E., 2001. Evidence that caspase-13 is not a human but a bovine gene. Biochem. Biophys. Res. Commun. 285, 1150-1154.

129

Kouhara, H., Hadari, Y.R., Spivak-Kroizman, T., Schilling, J., Bar-Sagi, D., Lax, I., and

Schlessinger, J., 1997. A lipid-anchored Grb2-binding protein that links FGF-receptor activation to the Ras/MAPK signaling pathway. Cell 89, 693-702.

Kurokawa, K., Iwashita, T., Murakami, H., Hayashi, H., Kawai, K., and Takahashi, M.,

2001. Identification of SNT/FRS2 docking site on RET receptor tyrosine kinase and its role for signal transduction. Oncogene 20, 1929-1938.

Labat-Moleur, F., Guillermet, C., Lorimier, P., Robert, C., Lantuejoul, S., Brambilla, E., and Negoescu, A., 1998. TUNEL apoptotic cell detection in tissue sections: Critical evaluation and improvement. J. Histochem. Cytochem. 46, 327-334.

Laha, T., Pinlaor, P., Mulvenna, J., Sripa, B., Sripa, M., Smout, M.J., Gasser, R.B.,

Brindley, P.J., and Loukas, A., 2007. Gene discovery for the carcinogenic human liver fluke, Opisthorchis viverrini. BMC Genomics 8, 189.

Lee, E.F., Clarke, O.B., Evangelista, M., Feng, Z., Speed, T.P., Tchoubrieva, E.B.,

Strasser, A., Kalinna, B.H., Colman, P.M., and Fairlie, W.D., 2011. Discovery and molecular characterization of a bcl-2-regulated cell death pathway in schistosomes. Proc.

Natl. Acad. Sci. U. S. A. 108, 6999-7003.

Leiper, R.T., 1915. Notes on the occurrence of parasites presumably rare in man. Journal of the Royal Army Medical Corps 24, 569-575.

130

Lo, T.W., Bennett, D.C., Goodman, S.J., and Stern, M.J., 2010. Caenorhabditis elegans fibroblast growth factor receptor signaling can occur independently of the multi-substrate adaptor FRS2. Genetics 185, 537-547.

LoVerde, P.T., Andrade, L.F., and Oliveira, G., 2009. Signal transduction regulates schistosome reproductive biology. Curr. Opin. Microbiol. 12, 422-428.

Loverde, P.T., Osman, A., and Hinck, A., 2007. Schistosoma mansoni: TGF-beta

signaling pathways. Exp. Parasitol. 117, 304-317.

Ludolf, F., Bahia, D., Andrade, L.F., Cousin, A., Capron, M., Dissous, C., Pierce, R.J.,

and Oliveira, G., 2007. Molecular analysis of SmFes, a tyrosine kinase of Schistosoma

mansoni orthologous to the members of the Fes/Fps/Fer family. Biochem. Biophys. Res.

Commun. 360, 163-172.

Luthi, A.U., and Martin, S.J., 2007. The CASBAH: A searchable database of caspase

substrates. Cell Death Differ. 14, 641-650.

Machida, K., Mayer, B.J., and Nollau, P., 2003. Profiling the global tyrosine

phosphorylation state. Mol. Cell. Proteomics 2, 215-233.

Mairiang, E., and Mairiang, P., 2003. Clinical manifestation of opisthorchiasis and

treatment. Acta Trop. 88, 221-227.

Matsubara, Y., Kawasaki, I., Urushiyama, S., Yasuda, T., Shirakata, M., Iino, Y.,

Shibuya, H., and Yamanashi, Y., 2007. The adaptor-like protein ROG-1 is required for

131 activation of the ras-MAP kinase pathway and meiotic cell cycle progression in

Caenorhabditis elegans. Genes Cells 12, 407-420.

Michelson, A.M., Gisselbrecht, S., Buff, E., and Skeath, J.B., 1998. Heartbroken is a specific downstream mediator of FGF receptor signalling in Drosophila. Development

125, 4379-4389.

Middelberg, A.P., 2002. Preparative protein refolding. Trends Biotechnol. 20, 437-443.

Migasena, P., Reaunsuwan, W., and Changbumrung, S., 1980. Nitrates and nitrites in local thai preserved protein foods. J. Med. Assoc. Thai. 63, 500-505.

Mohapatra, A.D., Kumar, S., Satapathy, A.K., and Ravindran, B., 2011. Caspase dependent programmed cell death in developing embryos: A potential target for therapeutic intervention against pathogenic nematodes. PLoS Negl Trop. Dis. 5, e1306.

Mulvenna, J., Yonglitthipagon, P., Sripa, B., Brindley, P.J., Loukas, A., and Bethony,

J.M., 2012. Banking on the future: Biobanking for "omics" approaches to biomarker discovery for opisthorchis-induced cholangiocarcinoma in Thailand. Parasitol. Int. 61,

173-177.

Nakajima, K., Takahashi, A., and Yaoita, Y., 2000. Structure, expression, and function of the Xenopus laevis caspase family. J. Biol. Chem. 275, 10484-10491.

Neet, K., and Hunter, T., 1996. Vertebrate non-receptor protein-tyrosine kinase families.

Genes Cells 1, 147-169.

132

Negoescu, A., Guillermet, C., Lorimier, P., Brambilla, E., and Labat-Moleur, F., 1998.

Importance of DNA fragmentation in apoptosis with regard to TUNEL specificity.

Biomed. Pharmacother. 52, 252-258.

Ohshima, H., Bandaletova, T.Y., Brouet, I., Bartsch, H., Kirby, G., Ogunbiyi, F.,

Vatanasapt, V., and Pipitgool, V., 1994. Increased nitrosamine and nitrate biosynthesis mediated by nitric oxide synthase induced in hamsters infected with liver fluke

(Opisthorchis viverrini). Carcinogenesis 15, 271-275.

Ong, S.H., Guy, G.R., Hadari, Y.R., Laks, S., Gotoh, N., Schlessinger, J., and Lax, I.,

2000. FRS2 proteins recruit intracellular signaling pathways by binding to diverse targets on fibroblast growth factor and nerve growth factor receptors. Mol. Cell. Biol. 20, 979-

989.

Osman, A., Niles, E.G., and LoVerde, P.T., 2001. Identification and characterization of a

Smad2 homologue from Schistosoma mansoni, a transforming growth factor-beta signal transducer. J. Biol. Chem. 276, 10072-10082.

Osman, A., Niles, E.G., and LoVerde, P.T., 2004. Expression of functional Schistosoma mansoni Smad4: Role in erk-mediated transforming growth factor beta (TGF-beta) down- regulation. J. Biol. Chem. 279, 6474-6486.

Osman, A., Niles, E.G., Verjovski-Almeida, S., and LoVerde, P.T., 2006. Schistosoma mansoni TGF-beta receptor II: Role in host ligand-induced regulation of a schistosome target gene. PLoS Pathog. 2, e54.

133

Otto, H.H., and Schirmeister, T., 1997. Cysteine proteases and their inhibitors. Chem.

Rev. 97, 133-172.

Parkin, D.M., 2006. The global health burden of infection-associated cancers in the year

2002. Int. J. Cancer 118, 3030-3044.

Pinan-Lucarre, B., Gabel, C.V., Reina, C.P., Hulme, S.E., Shevkoplyas, S.S., Slone, R.D.,

Xue, J., Qiao, Y., Weisberg, S., Roodhouse, K., Sun, L., Whitesides, G.M., Samuel, A.,

and Driscoll, M., 2012. The core apoptotic executioner proteins CED-3 and CED-4 promote initiation of neuronal regeneration in Caenorhabditis elegans. PLoS Biol. 10,

e1001331.

Plowman, G.D., Sudarsanam, S., Bingham, J., Whyte, D., and Hunter, T., 1999. The

protein kinases of caenorhabditis elegans: A model for signal transduction in

multicellular organisms. Proc. Natl. Acad. Sci. U. S. A. 96, 13603-13610.

Quinn, L.M., Dorstyn, L., Mills, K., Colussi, P.A., Chen, P., Coombe, M., Abrams, J.,

Kumar, S., and Richardson, H., 2000. An essential role for the caspase Dronc in

developmentally programmed cell death in Drosophila. J. Biol. Chem. 275, 40416-40424.

Raines, R.T., McCormick, M., Van Oosbree, T.R., and Mierendorf, R.C., 2000. The S.tag

fusion system for protein purification. Methods Enzymol. 326, 362-376.

Reis, M.I., do Vale, A., Pinto, C., Nascimento, D.S., Costa-Ramos, C., Silva, D.S., Silva,

M.T., and Dos Santos, N.M., 2007. First molecular cloning and characterisation of

134

caspase-9 gene in fish and its involvement in a gram negative septicemia. Mol. Immunol.

44, 1754-1764.

Riedl, S.J., Li, W., Chao, Y., Schwarzenbacher, R., and Shi, Y., 2005. Structure of the apoptotic protease-activating factor 1 bound to ADP. Nature 434, 926-933.

Rim, H.J., Chai, J.Y., Min, D.Y., Cho, S.Y., Eom, K.S., Hong, S.J., Sohn, W.M., Yong,

T.S., Deodato, G., Standgaard, H., Phommasack, B., Yun, C.H., and Hoang, E.H., 2003.

Prevalence of intestinal parasite infections on a national scale among primary

schoolchildren in Laos. Parasitol. Res. 91, 267-272.

Rudolph, R., and Lilie, H., 1996. In vitro folding of inclusion body proteins. FASEB J.

10, 49-56.

Satarug, S., Haswell-Elkins, M.R., Sithithaworn, P., Bartsch, H., Ohshima, H., Tsuda, M.,

Mairiang, P., Mairiang, E., Yongvanit, P., Esumi, H., and Elkins, D.B., 1998.

Relationships between the synthesis of N-nitrosodimethylamine and immune responses to

chronic infection with the carcinogenic parasite, Opisthorchis viverrini, in men.

Carcinogenesis 19, 485-491.

Shin, H.R., Oh, J.K., Masuyer, E., Curado, M.P., Bouvard, V., Fang, Y.Y., Wiangnon, S.,

Sripa, B., and Hong, S.T., 2010. Epidemiology of cholangiocarcinoma: An update focusing on risk factors. Cancer. Sci. 101, 579-585.

135

Shoemaker, C.B., Ramachandran, H., Landa, A., dos Reis, M.G., and Stein, L.D., 1992.

Alternative splicing of the Schistosoma mansoni gene encoding a homologue of

epidermal growth factor receptor. Mol. Biochem. Parasitol. 53, 17-32.

Sithithaworn, P., Andrews, R.H., Nguyen, V.D., Wongsaroj, T., Sinuon, M., Odermatt,

P., Nawa, Y., Liang, S., Brindley, P.J., and Sripa, B., 2012. The current status of

opisthorchiasis and clonorchiasis in the Mekong basin. Parasitol. Int. 61, 10-16.

Sithithaworn, P., and Haswell-Elkins, M., 2003. Epidemiology of Opisthorchis viverrini.

Acta Trop. 88, 187-194.

Smout, M.J., Laha, T., Mulvenna, J., Sripa, B., Suttiprapa, S., Jones, A., Brindley, P.J.,

and Loukas, A., 2009. A granulin-like growth factor secreted by the carcinogenic liver

fluke, Opisthorchis viverrini, promotes proliferation of host cells. PLoS Pathog. 5,

e1000611.

Smout, M.J., Sripa, B., Laha, T., Mulvenna, J., Gasser, R.B., Young, N.D., Bethony,

J.M., Brindley, P.J., and Loukas, A., 2011. Infection with the carcinogenic human liver

fluke, Opisthorchis viverrini. Mol. Biosyst 7, 1367-1375.

Sohn, W.M., Shin, E.H., Yong, T.S., Eom, K.S., Jeong, H.G., Sinuon, M., Socheat, D.,

and Chai, J.Y., 2011. Adult Opisthorchis viverrini flukes in humans, Takeo, Cambodia.

Emerg. Infect. Dis. 17, 1302-1304.

136

Spiliotis, M., Kroner, A., and Brehm, K., 2003. Identification, molecular characterization

and expression of the gene encoding the epidermal growth factor receptor orthologue

from the fox-tapeworm Echinococcus multilocularis. Gene 323, 57-65.

Sripa, B., Bethony, J.M., Sithithaworn, P., Kaewkes, S., Mairiang, E., Loukas, A.,

Mulvenna, J., Laha, T., Hotez, P.J., and Brindley, P.J., 2011. Opisthorchiasis and opisthorchis-associated cholangiocarcinoma in Thailand and Laos. Acta Trop. 120 Suppl

1, S158-68.

Sripa, B., and Kaewkes, S., 2000. Localisation of parasite antigens and inflammatory responses in experimental opisthorchiasis. Int. J. Parasitol. 30, 735-740.

Sripa, B., and Kaewkes, S., 2002. Gall bladder and extrahepatic bile duct changes in

Opisthorchis viverrini-infected hamsters. Acta Trop. 83, 29-36.

Sripa, B., Kaewkes, S., Intapan, P.M., Maleewong, W., and Brindley, P.J., 2010. Food- borne trematodiases in Southeast Asia epidemiology, pathology, clinical manifestation and control. Adv. Parasitol. 72, 305-350.

Sripa, B., Kaewkes, S., Sithithaworn, P., Mairiang, E., Laha, T., Smout, M., Pairojkul, C.,

Bhudhisawasdi, V., Tesana, S., Thinkamrop, B., Bethony, J.M., Loukas, A., and

Brindley, P.J., 2007. Liver fluke induces cholangiocarcinoma. PLoS Med. 4, e201.

Sripa, B., Mairiang, E., Thinkhamrop, B., Laha, T., Kaewkes, S., Sithithaworn, P.,

Tessana, S., Loukas, A., Brindley, P.J., and Bethony, J.M., 2009. Advanced periductal

137 fibrosis from infection with the carcinogenic human liver fluke Opisthorchis viverrini correlates with elevated levels of interleukin-6. Hepatology 50, 1273-1281.

Srivatanakul, P., Ohshima, H., Khlat, M., Parkin, M., Sukaryodhin, S., Brouet, I., and

Bartsch, H., 1991. Opisthorchis viverrini infestation and endogenous nitrosamines as risk factors for cholangiocarcinoma in Thailand. Int. J. Cancer 48, 821-825.

Stennicke, H.R., 2000. Caspases--at the cutting edge of cell death. Symp. Soc. Exp. Biol.

52, 13-29.

Stennicke, H.R., and Salvesen, G.S., 1999. Caspases: Preparation and characterization.

Methods 17, 313-319.

Stennicke, H.R., and Salvesen, G.S., 2000. Caspases - controlling intracellular signals by protease zymogen activation. Biochim. Biophys. Acta 1477, 299-306.

Strandgaard, H., Johansen, M.V., Montresor, A., and Ornbjerg, N., 2007. Field testing of the WHO dose pole for administration of praziquantel in the treatment of opisthorchiasis in Lao PDR. Trans. R. Soc. Trop. Med. Hyg. 101, 1120-1123.

TB333, 2011. Technical bulletin TB333 caspase glo-9.

TB396, 2010. Technical bulletin TB396 pET-45b(+) vector.

TB418, 2004. Technical bulletin TB418 pET-50b(+) vector.

The C. elegans Sequencing Consortium, 1998. Genome sequence of the nematode

C.elegans: A platform for investigating biology. Science 282, 2012-2018.

138

Thompson, J.D., Higgins, D.G., and Gibson, T.J., 1994. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673-

4680.

Thornberry, N.A., 1998. Caspases: Key mediators of apoptosis. Chem. Biol. 5, R97-103.

Thornberry, N.A., Rano, T.A., Peterson, E.P., Rasper, D.M., Timkey, T., Garcia-Calvo,

M., Houtzager, V.M., Nordstrom, P.A., Roy, S., Vaillancourt, J.P., Chapman, K.T., and

Nicholson, D.W., 1997. A combinatorial approach defines specificities of members of the

caspase family and granzyme B. functional relationships established for key mediators of

apoptosis. J. Biol. Chem. 272, 17907-17911.

Thu, N.D., Dalsgaard, A., Loan, L.T., and Murrell, K.D., 2007. Survey for zoonotic liver

and intestinal trematode metacercariae in cultured and wild fish in an Giang province,

vietnam. Korean J. Parasitol. 45, 45-54.

Thuwajit, C., Thuwajit, P., Uchida, K., Daorueang, D., Kaewkes, S., Wongkham, S., and

Miwa, M., 2006. Gene expression profiling defined pathways correlated with fibroblast

cell proliferation induced by Opisthorchis viverrini excretory/secretory product. World J.

Gastroenterol. 12, 3585-3592.

Tischner, D., Woess, C., Ottina, E., and Villunger, A., 2010. Bcl-2-regulated cell death

signalling in the prevention of autoimmunity. Cell. Death Dis. 1, e48.

139

Tomosky, T.K., Bennett, J.L., and Bueding, E., 1974. Tryptaminergic and dopaminergic responses of Schistosoma mansoni. J. Pharmacol. Exp. Ther. 190, 260-271.

Twiddy, D., and Cain, K., 2007. Caspase-9 cleavage, do you need it? Biochem. J. 405,

e1-2.

Upatham, E.S., and Viyanant, V., 2003. Opisthorchis viverrini and opisthorchiasis: A

historical review and future perspective. Acta Trop. 88, 171-176.

Valencia, T., Joseph, A., Kachroo, N., Darby, S., Meakin, S., and Gnanapragasam, V.J.,

2011. Role and expression of FRS2 and FRS3 in prostate cancer. BMC Cancer 11, 484.

Walsh, J.G., Cullen, S.P., Sheridan, C., Luthi, A.U., Gerner, C., and Martin, S.J., 2008.

Executioner caspase-3 and caspase-7 are functionally distinct proteases. Proc. Natl. Acad.

Sci. U. S. A. 105, 12815-12819.

Wiest, P.M., Burnham, D.C., Olds, G.R., and Bowen, W.D., 1992a. Developmental

expression of protein kinase C activity in Schistosoma mansoni. Am. J. Trop. Med. Hyg.

46, 358-365.

Wiest, P.M., Li, Y., Olds, G.R., and Bowen, W.D., 1992b. Inhibition of phosphoinositide

turnover by praziquantel in Schistosoma mansoni. J. Parasitol. 78, 753-755.

World Health Organization, 1995. Control of foodborne trematode infections. Technical

Report Series 849, .

140

You, H., Gobert, G.N., Jones, M.K., Zhang, W., and McManus, D.P., 2011. Signaling

pathways and the host-parasite relationship: Putative targets for control interventions against schistosomiasis: Signaling pathways and future anti-schistosome therapies.

Bioessays 33, 203-214.

Young, N.D., Campbell, B.E., Hall, R.S., Jex, A.R., Cantacessi, C., Laha, T., Sohn,

W.M., Sripa, B., Loukas, A., Brindley, P.J., and Gasser, R.B., 2010. Unlocking the transcriptomes of two carcinogenic parasites, Clonorchis sinensis and Opisthorchis viverrini. PLoS Negl Trop. Dis. 4, e719.

Yuan, J., Shaham, S., Ledoux, S., Ellis, H.M., and Horvitz, H.R., 1993. The C. elegans cell death gene ced-3 encodes a protein similar to mammalian interleukin-1 beta- converting enzyme. Cell 75, 641-652.

Zavala-Gongora, R., Kroner, A., Bernthaler, P., Knaus, P., and Brehm, K., 2006. A member of the transforming growth factor-beta receptor family from Echinococcus multilocularis is activated by human bone morphogenetic protein 2. Mol. Biochem.

Parasitol. 146, 265-271.

141

Appendix A

142

143

144

145

146

147

148

149

150

151

152

153

Appendix B

154

155

156