NMHS Fourth Quarterly Report-Jan to Dec 2020

Report National Mission on Himalayan Studies (NMHS)

PERFORMA FOR THE QUARTERLY PROGRESS REPORT (Reporting Period from January to March 2020)

1. Project Information

Project ID NMHS/2018-19/MG54/05 Project Title Improving capacity and strengthening wildlife conservation for sustainable livelihoods in Kashmir Himalaya Project Proponent Dr. Karthikeyan Vasudevan CSIR-Centre for Cellular and Molecular Biology (CCMB) Laboratory for Conservation of Endangered Species (LaCONES), Attapur Hyderguda, Hyderabad-500048

2. Objectives • To implement programs for the conservation of Hangul (Cervus elaphus hanglu) using assisted reproduction technologies. • To assess the carnivore population (leopards and black bear) using non-invasive DNA based methods by involving the management team and local people • To screen livestock and wild ungulates for diseases and develop protocols for surveillance and monitoring • Provide training to scientists, forest department staff and skills to the local institutions to serve as referral centres for wildlife forensics (both plant and animals) using DNA based technologies

3. General Conditions • The project proponent will train selected scientists from BNHS, SACON, ZSI, WII and WWF under capacity building part. • Training of the state officials from line agencies should also be attempted in consultation with NMHS-PMU, GBPNIHSED. • A report based on baseline data should be submitted by the project proponent in the 1st quarter of the project. • A Certificate should be provided that this work is not the repeat of earlier work (as a mandatory exercise). • The roles and responsibilities of each implementing partners should be delineated properly with their budget. The budget allocations to partners should be done in accordance with the MoEF & CC guidelines (Max. 30% for salary, 30% for equipment and 5% contingency). The same should be communicated to NMHS-PMU, before start of the project.

• The Periodic Progress Report of the NMHS Project needs to be submitted and updated on the Online Portal of the NMHS (http://nmhsportal.org) by the PI/ Project Proponent on Quarterly basis consistently. The PI must also submit the all the supporting data generated under the NMHS Project along with the quarterly progress report to NMHS- PMU. • On completion of the study, a Seminar/ Conference/ Workshop should essentially be organized by the PI/ Proponent to discuss and disseminate the findings among the experts and concerned beneficiaries/stakeholders.

4. Progress (fill only 3 rd and 4 th Column )

Quantifiable Deliverables Monitoring indicators Progress made Attach the against deliverables Annexure in terms of separately with monitoring other supportive indicators documents i.e. PDF, Excel, JPG, TIFF, etc. 1 2 3 4 • New conservation • Conservation 865 fecal samples of [Annexure I] Strategies of Hangul with Strategies of Hangul hangul collected enhanced access to new (No.) from Dachigam Assisted Reproduction National Park Technologies • Assessment report/papers • The number of Annexure II of the population of carnivore population carnivores (leopard and assessed (Nos.) black bear) using non- • The database invasive DNA based generated (Nos.) techniques

• Method/Manual on • The diseases of wild Questionnaire screening of diseases of ungulates and survey in progress wild ungulates and domestic livestock domestic livestock screened (Nos.)

• Training on population • No. of Awareness Three workshops [Annexure III & estimation and animal Raising/ Capacity training altogether IV] restraint techniques (30 Building (No. 50 students and Scientists, officials Researchers/Student, scientists at CORD No. of Scientist, and and SKUAST, Total no. of Srinagar, Jammy Beneficiaries); and Kashmir

• Green skilling of students on advanced methods in biotechnology (100 students) • No. of Popular article in Reports/Research preparation articles/Policy documents/Manual prepared and published (Nos.) • Hangul conservation • Update on the Hangul [Annexure V] breeding centre enclosure conservation breeding centre at Shikargah visited

5. Financial Progress (fill only 3rd and 4th Column )

Head Total Budget The Attach the Annexure Allocated (Rs) Balance separately with other Amount supportive (Rs) documents i.e. Word, PDF, Excel, JPG, TIFF, etc 1 2 3 4 Salary 8749440.00 [Annexure A] Travel 1800000.00 Expendables/ Consumables 11952880.00

Contingency 900000.00 Activities & other project cost 7700000.00 Institutional Charges 492680.00 Equipments 2500000.00 Total 34095000.00

UC Submitted – Yes

Annexure I

Fourth Quarterly Progress Report (January to March 2020) for the

project entitled

‘Improving capacity and strengthening wildlife conservation for

sustainable livelihoods in Kashmir Himalaya’

Submitted by:

Laboratory for Conservation of Endangered Species (LaCONES),

CCMB, Hyderabad

Project title: Improving capacity and strengthening wildlife conservation for sustainable livelihoods in Kashmir Himalaya

(a) Aim: Achieve conservation outcomes for hangul ( Cervus hanglu ) by improving capacity within the state machinery and partnering with local institutions for skill development in youth towards sustainable livelihoods in Kashmir Himalaya

Objectives

(i) To implement programs for the conservation of hangul ( Cervus hanglu ) using assisted reproduction technologies.

(ii) To assess the carnivore population (leopards and black bear) using non-invasive DNA based methods by involving the management team and local people

(iii) To screen livestock and wild ungulates for diseases and develop protocols for surveillance and monitoring

(iv) Provide training to forest department staff and skills to the local institutions to serve as referral centres for wildlife forensics (both plant and animals) using DNA based technologies

(b) Goal: Enhanced access to technologies that improve conservation of endangered Hangul and livelihoods of people in Kashmir Himalaya

Proposed Activities to Achieve Project Goals

(i) Conservation of Hangul using Assisted Reproduction Technologies

(ii) Assessing population of carnivores (leopard and black bear) using non-invasive DNA based techniques

(iii) Screening of diseases of wild ungulates and domestic livestock

(iv) Impart training on population estimation and animal restraint techniques

(v) Skilling of students on advanced methods in biotechnology

Detailed sampling protocol for fecal sample collection:

• Following a reconnaissance survey in the area 10 permanent trails varying in lengths

from 2 to 4 km were marked in the study area (Fig. 1 and Table 1).

• Trails were laid within an elevation range of 1600 m to 2500 m (i.e. lower Dachigam).

• Trails were marked in a way so that different elevation zones were apparently covered

in proportion to their availability in the area and both the southern and northern

aspects were equally represented.

• Starting and end points of each of the trails were well identified and marked

permanently using paint on trees or rocks.

• All the permanent trails are monitored once every month within a weeks’ time starting

from 1 st of every month.

• Trail monitoring starts at 7:30 am during the spring, summer and autumn season

(between April and October) and at 8:30 am during winter (between November to

March).

• All the necessary information to be recorded at the start of the trail is written on the

datasheet before starting the trail monitoring.

• All the direct and indirect hangul evidences (direct sightings, hoof marks and pellets

groups) encountered while the monitoring are marked on the hand-held GPS and

recorded on the datasheet as well.

• Fecal samples are thoroughly searched and collected from a width of 5 m on either sides

of the trail, thus covering a 10 m wide belt on the transect.

• Fecal samples older than three days are not collected.

• On encounter of a fecal sample – the geo-location of the sample is marked using a hand-

held GPS and other relevant information (mentioned in the datasheet) is recorded.

• Each fecal sample is collected without making any contact with the naked hands and

stored as two sets –

o For hormone analysis – 10 pellets from each pellet group encountered are

collected in a paper bag labeled with a unique code to that sample (e.g. H1)

alongwith all the details recorded on the datasheet. The paper bags are folded

properly so that the samples do not fall off during transportation. These samples

are oven dried at 60ºC for 48 hours and stored at -20 ᵒC until further laboratory

analysis.

o For genetic analysis – 5 pellets from each pellet group encountered are collected

in 50 ml falcon tubes labeled with the unique code given to the sample and date

of collection. Following this, 90% ethanol is added to each tube making sure that

the entire sample is immersed in alcohol and is not left exposed within the tube.

Also, the label on the tube is covered with a cello tape to avoid the label from

being washed off, in case of any leakage of alcohol from the tube. These samples

are stored in -20 ºC till further laboratory analysis.

• Trail monitoring is stopped at the end of the marked trail (which is mostly the highest

point of the trail) and trip odometer at that point is recorded on the data sheet as the

end reading of trail.

• The time taken from the start till end of the trail is recorded. During the next repeat

monitoring, it is tried to complete the monitoring in more or less similar time interval.

• After completion, depending upon the accessibility and terrain of the area, same trail is

followed to come down or an alternative path can be taken. However, the fecal samples

encountered while coming down might or might not be collected depending upon the

fecal sample requirement, and is clearly mentioned on the datasheet to have been

collected during the return trip.

• Depending upon the sampling season, at times we do not encounter fecal samples on

our permanently marked trails. However, the trails are monitored as per the above

mentioned protocol every month as the absence of the species in that area is an

indicator of its seasonal space use pattern.

• If the surveyor does not find enough or no fecal samples at all on the marked trails,

same trails are followed further ahead in order to collect samples for reproductive

physiology and dietary analysis, if needed but not for the population estimation analysis.

For transportation, all the hormone samples are sorted and packed in separate packets date wise. For genetic samples, each falcon tube is kept in a separate zip lock cover and labeled from outside as well to avoid losing their identities while transportation.

Items to be carried during the field survey

1. GPS 7. Pen

2. Paper bags 8. Cello tape

3. 50 ml falcon tubes (30 numbers) 9. Gloves

4. Zip locks 10. Forceps

5. Ethanol (90%) 11. Cotton

6. Permanent markers

Figure 1: Location of permanent sampling trails in lower part of Dachigam National Park.

Table 1: Details of hangul samples collected between September 2019 and February 2020.

Length Elevation S.No. Trail name Habitat type Aspect (km) range (m)

1. Badan Temperate pine mixed forest 4.00 1722-2365 N

2. Zahel Temperate pine mixed forest 4.00 1829-2298 N

3. Kawnar Temperate pine mixed forest 3.00 1860-2082 N

4. Reshwooder Temperate pine mixed forest 3.50 1818-2473 N

5. Yachhagajan Temperate pine mixed forest 3.50 1938-2109 N

6. Drog Temperate grass and scrubland 2.50 1892-2155 S

7. Munew Temperate grass and scrubland 3.50 1882-2288 S

8. Upper Draphama Temperate grass and scrubland 3.50 1898-2235 S

9. Upper Pehlipora Temperate grass and scrubland 2.50 1916-2291 S

10. Washdalaw Temperate grass and scrubland 3.00 1901-2286 S

Work progress to date –

To date we have collected nearly 865 (mostly fresh) fecal samples of hangul by monitoring all the sampling trails once every month between September 2019 and March 2020 (Table 2). We have geolocated all the fecal samples during collection and plotted them on the map of

Dachigam National Park (Fig 2). We had safely transported these samples to LaCONES,

Hyderabad and have stored them at -20 ºC until further laboratory analyses. Early this year i.e. in January 2020, we have initiated the laboratory analysis of the fecal samples standardizing and following the protocols as described below for understanding three different aspects of

10 hangul population in the wild. The preliminary work done so far for each aspect is described below –

Table 2: Details of hangul samples collected between September 2019 and February 2020.

Month # of trails # of monitoring per trail # of samples

September ‘19 10 1 40

October ‘19 10 2 171

November ‘19 10 1 110

December ‘19 10 1 155

January ‘20 10 1 152

February ‘20 10 1 112

March ‘20 10 1 125

Total number of samples 865

Figure 2: Map showing the locations of all hangul samples in Dachigam National Park.

Standardization of laboratory protocol

1. Reproductive and stress hormone monitoring in hangul using fecal hormone metabolites

in Dachigam National Park, Kashmir –

Understanding the variations in steroid hormones including sex steroids and glucocorticoids at a population level is the key to assess the reproductive potential and stress in the population alongwith the same acting as a prerequisite to any conservation breeding programme for endangered species thus enabling the conservation and sustained survival of the species in the wild as well in captivity. Hormone profiling has never been conducted for hangul inspite of the species surviving as a very small population of around 200 individuals in the wilderness of

Kashmir Himalaya. The present study therefore aims at understanding the population level variations in the concentrations of reproductive hormones (estradiol and progesterone metabolites) and glucocorticoids (cortisol) from the non-invasively collected fecal samples from wild in relation to the reproductive stage, season, elevation and diet.

Extraction of hormone metabolites:

We extracted the fecal hormone metabolites following the procedures as described previously by Jachowski et al ., 2015. We pulverized the oven dried fecal samples into fine powder using a mortar and pestle followed by weighing 0.20 gm of each sample. We added 2ml of 90% methanol to the weighed samples in 15 ml falcon tubes, vortexed for 20 minutes and kept overnight at 4ºC. The next day we vortexed the samples for a minute followed by centrifuging for 10 minutes at 4000 rpm. We transferred the supernatant to freshly labeled tubes and stored at -20ᵒC until further processing.

Hormone assays and validation:

We measured fecal estradiol concentration using estradiol polyclonal antibody (R0008; Dr.

Coralie Munro lab, University of California, Davis, CA, USA). Estradiol antibody cross-reacts

100% with estradiol, 3% with estrone and 1% with others. We diluted the antibody to 1:18000,

HRP- conjugated E2 label to 1:100000 and E2 standards (7.81-1000 pg/well) (Umapathy et al .,

2015). We measured fecal progesterone concentration using anti-P4 antiserum (Quidel No.

CL425; provided by Dr. Coralie Munro, University of California, Davis, CA, USA) by diluting it to

1:6000, diluting HRP-conjugated P4 label to 1:1,00,000 and P4 standards (1.56–200 pg/well).

This antibody cross reacts with P4 (100%) and other pregnane metabolites (Mithileshwari et al .,

2016; Kumar et al ., 2014; Kumar et al ., 2019).

We measured fecal glucocorticoid metabolite (fGCM) concentration using cortisol polyclonal antibody R4866; Dr. Coralie Munro lab University of California, Davis) in which the cortisol polyclonal antibody was diluted to 1:9000, HRP-conjugated Cortisol label diluted to 1:250000 and standards (7.81-1000 pg/well). The cortisol antibody cross-reacts with cortisol 100%, prednisolone 9.9%, prednisone 6.3% cortisone 5% and <1% with corticosterone, desoxycorticosterone, 21 - desoxycortisone, testosterone, androstenedione, androsterone and

11-desoxycortisol (Young et al ., 2004; Kumar et al ., 2014, 2019).

Enzyme Immunoassay (EIA) procedure:

We performed direct competitive EIAs by following previously reported procedure (Kumar et al ., 2019). We coated a 96-well plate (Nunc-Immunomaxisorp; Fisher Scientific International,

Inc, Hampton, NH) with antibody by diluting with a coating buffer (0.05 M sodium bicarbonate buffer, pH 9.6), incubated overnight at 4ºC and washed four times with washing buffer (0.15 M

NaCl and 0.05% Tween 20; Sigma-Aldrich, India). We diluted the fecal extracts to 1:10 for estradiol, 1:32 for progesterone metabolite and 1:2 for cortisol and added 50 μl of the extractor

Standards diluted in assay buffer (0.1 M phosphate-buffered saline, pH 7, containing 0.1% bovine serum albumin) to the wells, followed by 50 μl of conjugated HRP steroids. After 2 hrs of incubation at room temperature, we washed the plate and 50 μl of TMB (tetramethyl benzidine)/H 2O2 (Genei, Bangalore, India) substrate was added and kept in the dark for 10–15 min. The reaction was stopped by addition of 50 μl of 1 N HCl and read the absorbance at 450 nm in the ELISA reader (Thermo Multiskan Spectrum Plate Reader, version 2.4.2; Thermo

Scientific, Finland).

Validation of EIAs

We have validated all the EIAs by demonstrating parallelism between the serial dilution of pooled fecal extracts (endogenous antigen) and respective standards (exogenous antigen). We performed parallelism to determine the optimal fecal sample dilution at 50% binding and detect the immunological activity of endogenous antigen with the antibody used

(Bhattacharjee et al ., 2015; Kumar &Umapathy, 2019). Assay sensitivity was calculated at 90% binding for each EIAs.

Results from work done to date –

To date, we have analyzed 521 fecal samples in the lab for measuring fecal metabolite concentrations of estradiol, progesterone and cortisol.

Monthly fecal estradiol concentrations of hangul increased continuously from September till

December 2019 indicating estrous in hangul to occur between October and December (Fig. 2).

Moreover, the mean estradiol concentration varied significantly among months (Kruskal Wallis

χ2 = 235.26, p < 0.001). The timing of estrous however, seems different from previous anecdotal reports occurring between September and November. Mean fecal progesterone metabolite concentrations in October, November and December were more or less similar to each other, however, all of them were significantly higher than that in September (Kruskal Wallis χ 2 = 56.99, p < 0.001; p < 0.00 - Dunn’s test for September) (Fig. 2). This probably represents cycling females in the months of October, November and December. Mean monthly cortisol showed a significant rise in its concentration from September reaching its maximum in November followed by a significant decline in December (Kruskal Wallis χ 2 = 170.94, p < 0.001; p < 0.00 -

Dunn’s test for all pairwise comparisons) (Fig. 2).

Overall cortisol concentration exhibited higher values at the mid-elevation in Dachigam

National Park (Fig. 3a). However, we do not find any significant relationships between the concentrations of fecal cortisol and reproductive hormone metabolites i.e. estradiol and progesterone from the data generated to date (Fig. 3b & c).

Figure 2 : Fecal metabolite concentrations (ng/g) of estradiol, progesterone and cortisol in hangul in the months from September to December 2019.

(a)

200 180 160 140 120 100 80 60

Fecal cortisol (ng/g) Fecal 40 20 0 1500 1700 1900 2100 2300 2500 2700 Elevation (m)

(b) (c)

200 200 180 180 160 160 140 140 120 R² = 0.016 120 R² = 0.031 100 100 80 80 60 60

Fecal cortisol (ng/g) Fecal 40 Fecal cortisolFecal (ng/g) 40 20 20 0 0 0 500 1000 1500 2000 2500 3000 3500 4000 0 250 500 750 100012501500175020002250 Fecal estradiol (ng/g) Fecal progesterone (ng/g)

Figure 3 : Correlation of fecal cortisol with elevation (m) and fecal metabolites of estradiol and

progesterone in hangul between September and December 2019.

2. Genetic profiling to understand the differences in reproductive physiology with sex and

individual identity and estimate the hangul population in Kashmir Himalaya –

We also aim at understanding the differences in reproductive physiology between the two sexes and at individual level and to estimate the hangul population in Dachigam National Park and Shikargah, Tral Wildlife Sanctuary. As a prerequisite to the large scale genetic study on a critically endangered species like hangul, we have to conduct a species validation of all the fecal samples collected from the field. Therefore, following the DNA isolation from the feces stored in ethanol using standard protocol, we started the laboratory analyses with a subset of samples collected. We selected a species identification marker reported by Rak et al. (2014) for red deer for preliminary screening of fecal pellets in the present study (Table 1). Apart from the reported amplicon size, we also selected this marker for its robustness in processed and fragmented

DNA. Following species validation, we aim at the selection of markers for individual identification and sex identification. Once the markers are selected, we will use them to identify the sex and individual identity of all the fecal samples collected through all the months to date and in future.

Selection of Microsatellites for individual identification of hangul

Microsatellites are short (2-5 bp) tandem repeats of DNA that are widespread throughout the eukaryotic genome and show sufficient variability among individuals in a population. These markers are ideal for studying various population genetic parameters. 14 polymorphic microsatellites have been selected from previously published papers on European red deer

(Kuehn et al. 2003; Zhou et al. 2014) based on the following criteria –

• Hangul being a red deer, we preferred microsatellites used for other red deer species

(Table 3).

• Allele size – We selected markers in the size range of 100 bp to 300 bp.

• We selected markers also based on their reported polymorphisms and heterozygosity

values in several other studies on red deer.

Markers for sex identification of genotyped samples

We selected partial sequence of the Y-specific SRY gene (Fain & LeMay 1995) and X- and Y- homologous regions of amelogenin gene (Pfeiffer & Brenig 2005) to identify the sex of genotyped individuals (Table 1).

Results from work done to date –

We have isolated DNA from a set of 104 fecal samples of hangul collected in November 2019.

We have standardized the PCR conditions for the aforesaid 14 microsatellite loci with a subset of 35 samples. We will analyze these results for polymorphism, allele frequency and genetic diversity parameters before proceeding with the rest of the fecal samples.

Table 3: List of markers selected for the present study

Marker Primer Seq. 5’ -3’ Annealing Allele length Repeat type Reference temperature (bp) (ºC) BM -1818 F agtgctttcaaggtccatgc 58 235 -255 Pure (GT) Kuehn et al. 2003 R agctgggaatataaccaaagg Cer -14 F tctcttgcgtctcctgcattgac 61 212 -238 Pure (GT) Kuehn et al. 2003 R aatggcacccactccagtattcttc Haut -14 F ccagggaagatgaagtgacc 53 104 -136 Pure (GT) Kuehn et al. 2003 R tgaccttcactcatgttattaa CSSM -16 F agagccacttgttacaccccaaag 57 151 -165 Interrupted (GT) Kuehn et al. 2003 R gatgcagtctccacttgattcaaa INRA -35 F ttgtgctttatgacactatccg 56 102 -126 Pure (GT) Kuehn et al. 2003 R atcctttgcagcctccacattc CSSM -22 F tctctctaatggagttggtttttg 56 211 -217 Pure (GT) Kuehn et al. 2003 R atatcccactgaggataagaattc CSSM -19 F ttgtcagcaacttcttgtatcttt 55 133 -169 Interrupted (GT) Kuehn et al. 2003 R tgttttaagccacccaattatttg ETH -225 F acatgacagccagctgctact 56 135 -169 Interrupted (GT) Kuehn et al. 2003 R gatcaccttgccactatttcct CSPS -115 F aaagtgacacaacagcttctccag 56 241 -257 Interrupted (GT) Kuehn et al. 2003 R aacgagtgtcctagtttggctgtg ILSTS06 F tgtctgtatttctgctgtgg 54 273 -299 Pure (GT) Kuehn et al. 2003 R acacggaagcgatctaaacg CSSM -66 F aatttaatgcactgaggagcttgg 57 163 -189 Pure (GT) Kuehn et al. 2003 R acacaaatcctttctgccagcttga CSRM -60 F aagatgtgatccaagagagaggca 51 101 -123 Pure (GT) Kuehn et al. 2003 R ggaccagatcgtgaaaggcatag BM -888 F aggccatataggaggcaagctt 48 160 -200 - Zhou et al. 2014 R ctcggtcagctcaaaacgag BM -4208 F tcagtacactggccaccatg 50 135 -162 - Zhou et al. 2014 R cactgcatgcttttccaaac HS F cccattttacattttacatccaccaacc 50 160 Non coding mt D - Rak et al. 2014 (species R tataaataatagaaagtaca loop region specific) SRY F cccatgaacgcattcattgtgtgg 60 224 Y-specific gene Fain & LeMay R attttagccttccgacgaggtcgata partial sequence 1995 SE (AML F cagccaaacctccctctgc 56 127 -136 X- and Y - Pfeiffer & Brenig gene) R cccgcttggtcttgtctgttgc homologous gene 2005 partial sequence

3. Dietary profiling to understand the variations in diet composition of hangul with season

and elevation –

Hangul is known to be a seasonal elevational migrant as many other mountain ungulates inhabiting the mountainous ecosystems. It is known to use the pine mixed and riparian habitats of lower Dachigam as its breeding ground and winter refuge, and migrates to the coniferous forests and alpine meadows in Upper Dachigam during summer to access abundant high quality forage during the energetically demanding phases of their reproductive cycle i.e. birth and lactation. It also helps them in gaining body stores to survive through the harsh winter in these areas.

Considering this, we expect the number and abundances of plant species to vary in hangul diet with season and elevation. We therefore aim to understand the seasonal diet composition of hangul using plant DNA metabarcoding using the fecal samples collected.

Work done to date –

We firstly aim at standardizing the laboratory protocol to isolate DNA from fecal samples of hangul. For this, we have been isolating DNA from plant as well as fecal samples of hangul using

CTAB method specifically used to break plant cells (Buglione et al. 2018). This is followed by trying different PCR conditions to amplify the extracted fecal plant DNA.

Selection of primers to identify plant species in hangul feces

We have selected two primers i.e. rbcL and ITS2 to amplify plant DNA isolated from the hangul feces. RbcL locus is a plastid gene and has been successfully used to identify forage species in

21 fecal samples (McShea et al . 2019). Similarly, ITS2 is potentially useful as a standard DNA barcode to identify plants and shows significant sequence variability at the species level or lower. Following this, we will separate multiple plant species DNA expected to be present in the amplified PCR products using denaturing gradient gel electrophoresis (DGGE) (Myers et al.

1987).

Future work plan

• We will continue trail monitoring and fecal sample collection in the upcoming months.

• We will analyze the fecal samples from January to June 2020 to assess reproductive

physiology and assign sex and individual identity to each of the collected sample.

• We would also start analyzing the fecal samples for seasonal dietary profiling of hangul

once we are able to standardize the laboratory protocol for the same.

References

Bhattacharjee, S., Kumar, V., Mithileshwari, C., Malviya, M., Ganswindt, A., Ramesh, K., Sankar,

K. and Umapathy, G. (2015). Glucocorticoid Stress Responses of Reintroduced Tigers in Relation to Anthropogenic Disturbance in Sariska Tiger Reserve in India. PLOS ONE.

DOI:10.1371/journal.pone.0127626. 1-13.

Buglione, M., Maselli, V., Rippa, D., de Filippo, G., Trapnese, M. and Fulgione, D. 2018. A pilot study on the application of DNA metabarcoding for non-invasive diet analysis in the Italian hare.

Mammalian Biology 88: 31-42.

Fain S. R. and LeMay J. P. (1995). Gender identification of humans and mammalian wildlife species from PCR amplified sex linked genes. Proceedings of the American Academy of Forensic

Sciences 1:34.

Jachowski, D. S., McCorquodale, S., Washburn, B. E. and Millspaugh, J. J. (2015). Human

Disturbance and the Physiological Response of Elk in Eastern Washington. Wildl. Biol. Pract. 11:

12-25.

Kuehn, R., Schroeder, W., Pirchner, F. and Rottmann, O. (2003). Genetic diversity, gene flow and drift in Bavarian red deer populations ( Cervus elaphus ). Conservation Genetics 4: 157–166.

Kumar, V., Pradheep, M., Kokkiligadda, A., Niyogi, R. and Umapathy, G. (2019). Non-Invasive

Assessment of Physiological Stress in Captive Asian Elephants. Animals 9: 1-12.

Kumar, V., Reddy, P. V., Kokkiligadda, A., Shivaji, S. and Umapathy, G. (2014). Non-invasive assessment of reproductive status and stress in captive Asian elephants in three south Indian zoos. General and Comparative Endocrinology 201: 37–44.

Kumar, V. and Umapathy, G. (2019). Non-invasive monitoring of steroid hormones in wildlife for

Conservation and management of endangered species- A review. Indian Journal of

Experimental Biology 57: 307-314.

McShea, W. J., Sukmasuang, R., Erickson, D. L., Herrmann, V., Ngoprasert, D., Bhumpakphan, N. and Davies, S. J. (2019). Metabarcoding reveals diet diversity in an ungulate community in

Thailand. Biotropica 00: 1-15.

Mithileshwari, C., Srivastava, T., Kumar, V., Kumar, A. and Umapathy, G. (2016). Non-invasive assessment of fecal progestagens and pregnancy detection in Himalayan musk deer ( Moschus chrysogaster ). Theriogenology 85: 216–223.

Myers, R. M., Maniatis, T. and Lerman, L. S. (1987). Detection and localization of single base changes by denaturing gradient gel electrophoresis. Methods in Enzymology 155: 501-527.

Pfeiffer, I. and Brenig, B. (2005). X- and Y-chromosome specific variants of the amelogenin gene allow sex determination in sheep ( Ovis aries ) and European red deer ( Cervus elaphus ). BMC

Genetics 6:16 doi: 10.1186/1471-2156-6-16

Rak, L., Knapik, K., Bania, J., Sujkowski, J. and Gadzinowski, A. (2014). Detection of roe deer, red deer, and hare meat in raw materials and processed products available in Poland. European

Food Research Technology 239: 189–194.

Tyagi, A., Kumar, V., Kittur, S., Reddy, M., Naidenko, S., Ganswindt, A. and Umapathy, G.,

(2019). Physiological stress responses of tigers due to anthropogenic disturbance especially tourism in two central Indian tiger reserves. Conservation Physiology 7: 1-9.

Umapathy, G., Deepak, V., Kumar, V., Mithileshwari, C., Vasudevan, K.. (2015). Endocrine profiling of endangered tropical chelonians using non-invasive fecal steroid analyses. Chelonian

Conservation and Biology 14: 108-115.

Zhou C-L., Turdy R. and Halik M. (2014) Genetic differentiation between red deer from different sample sites on the Tianshan Mountains ( Cervus elaphus ), China. Mitochondrial DNA Early

Online: 1–11.

Annexure II

Clarification for no assessment of the population of carnivores (leopard and black bear) using non-invasive DNA based techniques

During the initial consultative meeting held in May 2019 at Srinagar, the Department of Wildlife

Protection, J &K mentioned that the carnivore population monitoring is not needed in

Dachigam National Park as of now. However, it was informed that after listing out the work that has been done on carnivores in the valley to date, LaCONES, CCMB will be informed for assistance as and when needed by the Department. It was however suggested that baseline surveys can be conducted in Tral and other areas including outside Dachigam National Park to look at meso-carnivores.

Annexure III

Report on workshops held at the Centre of Research for Development, University of Kashmir,

Srinagar, J&K under NMHS Project between 12-13 th and 16-17 th of March 2020

Opening

As part of the NMHS project entitled ‘Improving capacity and strengthening wildlife conservation for sustainable livelihoods in Kashmir Himalaya’ two workshops- ‘Basics of R for

Ecology’ and ‘Basic open source GIS’ were organized on scheduled dates between 12-13 th and

16-17 th of March 2020 at the Centre of Research for Development (CORD), University of

Kashmir. The Centre of Research for Development, University of Kashmir being a partner and beneficiary in the project, these workshops were meant for capacity building and imparting training to the students of the Kashmir University. The notification for participation in the workshops was advertised during the first week on February and the last date for the submission of filled applications was set on 25 th Feb, 2020. We received more than 125 applications for each workshop, and after rigorous screening 25 candidates were selected for each. The results were communicated to the selected candidates via email on 4 th March, 2020.

The workshops were jointly organized by CSIR, CCMB – LaCONES and the Centre of Research for

Development (CORD), University of Kashmir.

1. Workshop on Basics of R for Ecology – 12-14 th March, 2020:

The first workshop on ‘Basics of R for Ecology’ was actually scheduled for two days i.e. 12-13 th

March, 2020, but due to the COVID-19 advisory issued by the University of Kashmir as well as the Government of Jammu and Kashmir on 11-03-2020, imposing restriction on large gatherings in workshops, we had to split the number of participants into two groups (morning and afternoon). Each group included 10-12 participants, and we had to repeat all the lectures and hands-on-training exercises every time therefore involving double effort. Because of this rearrangement the workshop had to be extended for one more day (i.e. 14 th March) in order to complete the scheduled programme.

Day I – 12 th March, 2020 (both morning and afternoon group):

The workshop started with a short formal welcome to the participants by the Chief Guest, Prof.

Bashir A. Ganai, Director, Centre of Research for Development, University of Kashmir. This was followed by a brief introduction to the Workshop by Dr. Karthikeyan Vasudevan, Scientist-In- charge, CSIR-CCMB, LaCONES, Hyderabad. Dr. Vasudevan also gave a comprehensive talk on

‘Fundamental Duties for Wildlife’. After this, Mr. Ashish Jha, PhD student/resource person,

LaCONES, Hyderabad gave a presentation on ‘Introduction to R Programming’. This was followed by the hands-on exercise that started with installation of R software, R studio, R packages, and CRAN repository. The resource persons demonstrated different ways of working with data in R. This included importing and exporting of data, loading R packages for different statistical analysis, data examination, exploration and structuring; and saving R session and R codes for records and further analysis.

Day II – 13 th March, 2020 (both morning and afternoon group):

The second day started with a recap of what was discussed on day one. This was followed by continuation of the data analysis demonstration techniques and hands-on exercises. This included a comprehensive presentation followed by demonstration of various statistical tests that can be carried out using R for different type of data in different formats and scales. The main emphasis was laid on regression (linear regression) and ordination analysis. Hands-on training exercise was carried out on a test data set for practise and interpretation of results.

Similar exercise and hands-on was carried out for conducting Environmental Niche overlap analysis in R. After this the participants were given a home task to try these tools on their own data sets and share their experiences.

Day III – 14 th March, 2020 (both morning and afternoon group)

The third day started with data visualization exercises involving both demonstration and hands- on training on a test data set. This included different ways of plotting data before analysis in order to check for data structure and distribution. This was followed by hands-on exercise for exporting plots and graphs from a desired analysis; and finally troubleshooting. The participants were then given different data sets for practice, and problems if any were addressed and discussed at individual level. After this rigorous hands-on session, feedback forms were distributed among participants and they were asked to provide their response and comments on the different sections of the workshop. After this, the certificates were distributed to the participants by Prof. Bashir A. Ganai, Director, CORD and Dr. Karthikeyan Vasudevan, Scientist

In-Charge, LaCONES, Hyderabad. A formal vote of thanks was given by Dr. Tawqir Bashir, Local

Course Coordinator, CORD, University of Kashmir, followed by a group photograph.

Resource persons: Dr. Karthikeyan Vasudevan, Mr. Ashish Jha, Dr. Tawqir Bashir

List of Participants in the R workshop:

S. No Application No. Name Department Session 1 5 SHABIR AHMAD ZARGAR BOTANY Morning 2 7 JAHANGIR AHMAD DAR ZOOLOGY Morning 3 9 HAMEEM MUSHTAQ ZOOLOGY Morning 4 18 MOHAMMAD ASGAR KHAN BOTANY Morning 5 23 AFSHANA BOTANY Morning 6 29 IRFAN IQBAL SOFI BOTANY Morning 7 37 SAIMA ANDRABI ZOOLOGY Morning 8 41 ABID HUSSAIN WANI BOTANY Morning 9 42 SHAFAT ALI CORD Morning 10 45 ZARKA ZAHEEN ENV SCI Morning 11 50 IQRAM-UL-HAQ ZOOLOGY Morning 12 54 CHAMBA WANGMO CORD Morning 13 63 ISHFAQ QAYOOM SHAH ENV SCI Afternoon 14 71 SHAZIA RIYAZ ZOOLOGY Afternoon 15 73 MAHEEN JAVAID ENV SCI Afternoon 16 75 HINA MUSHTAQ CORD Afternoon 17 79 HANEEF MOHAMMAD BHAT CORD Afternoon 18 102 MIR RIASA ZAFFAR ENV SCI Afternoon 19 109 NAZIYA KHURSHID CORD Afternoon 20 74 SAMEER AHMAD DAR CORD Afternoon 21 70 SHEEMA TABASUM ZOOLOGY Afternoon 22 104 INSHA AMIN ENV SCI Afternoon 23 111 MAROFULL NISA CORD Afternoon 24 55 SHAHID HAMEED ENV SCI Afternoon

2. Workshop on Basic open source GIS – 16-17 th March, 2020:

The second workshop on ‘Basic open source GIS’ was also scheduled for two days i.e. 16-17 th

March, 2020. But, by this time the COVID-19 advisory issued by the University of Kashmir had being properly implemented in the campus. Since, the resource persons for this workshop were already present in the campus since 10 th March, 2020 and there was no further involvement of any incoming guest/resource persons/delegate from outside J & K; special permission was procured from the Registrar, University of Kashmir on these grounds for conducting the workshop. Therefore, in order to avoid large gathering this workshop was also structured on the same lines as the first one involving splitting into two groups (morning and afternoon), each with 10-12 participants. Furthermore, as one of our resource persons from Hyderabad could not travel because of his health issues, we had to arrange a local resource person for the purpose, which was very challenging.

Day I – 16 th March, 2020 (both morning and afternoon group):

In order to avoid large gathering, we did not have any formal inaugural session for this workshop. The workshop instead started with a brief introduction about the workshop by Dr.

Karthikeyan Vasudevan, Scientist In-Charge, CSIR-CCMB, LaCONES, Hyderabad. This was immediately followed by the workshop related activities. This included a comprehensive presentation by Ms. Mahreen Khaleel, local resource person on the overview of data sources, features and examples in open source GIS. This was followed by installation of software and hands-on. Mr. Ashish Jha, PhD student/resource person, LaCONES, Hyderabad also gave a brief presentation on data sources and downloading GIS and related data from various authentic

31 sources. This was followed by demonstration and hands-on different tools in QGIS related to raster-vector data, geo-referencing, plotting locations on the map, preparation of study area maps, extraction of data layers from a given DEM and land-use land cover maps, inserting legends, scale, geo-coordinates, etc in a map. Resources persons gave a demonstration of using mobile phone applications (e.g. Google Maps) for recording geo-coordinate data. After this exercise, the participants were given a task to get five different locations from their respective areas and plot those on the land-use land cover map with reference to three topographic parameters/variables.

Day II – 17 th March, 2020 (both morning and afternoon group):

The second day started with compilation of the data locations brought by the participants. The resource persons demonstrated the procedure for plotting these locations on the land-use land cover map of the area. This was followed by hands-on training so that each participant practices the procedure at the individual level. As a next step towards using GIS techniques few case studies were discussed before the participants for their better understanding of the GIS approach, use of advanced tools and their application in ecology and conservation. The first case study was presented by Dr. Tawqir Bashir, DST-INSPIRE Faculty/local course coordinator,

CORD, University of Kashmir on the topic ‘Predicting suitable habitat for species conservation: a case study on snow leopard ( Panthera uncia ) in Khangchendzonga, India’ during which he discussed habitat suitability modeling technique using Ecological Niche Factor Analysis (ENFA).

The second case study was presented by Mr. Ashish Jha, PhD student/resource person,

LaCONES, Hyderabad on the topic ‘Maxent Case Study – Yellow-throated Bulbul’ during which

32 he discussed the use of Maximum Entropy Model (Maxent) for predicting species distribution over a large landscape. After this, QGIS tutorials were distributed among the participants. Later, feedback forms were distributed among participants and their response and comments on the different sections of the workshop were recorded. This was followed by the certificate distribution session during which certificates were distributed to the participants by Prof. Bashir

A. Ganai, Director, CORD and Dr. Karthikeyan Vasudevan, Scientist In-Charge, LaCONES,

Hyderabad. In the concluding session, Dr. Tawqir Bashir, Local Course Coordinator, CORD,

University of Kashmir, gave a formal vote of thanks to all the participants, resource persons, organizers, technical staff, and volunteers; which was followed by a group photograph.

Resource persons: Dr. Karthikeyan Vasudevan, Ms. Mahreen Khaleel, Mr. Ashish Jha, Dr. Tawqir

Bashir.

List of Participants in the GIS workshop:

S. No Application No. Name Department Session 1 4 ISHFAQ-UL-REHMAN BOTANY Morning 2 5 SHABIR AHMAD ZARGAR BOTANY Morning 3 8 ROUF AHMAD BHAT ZOOLOGY Morning 4 10 UMER HAMEED SHANSAZ ZOOLOGY Morning 5 22 KHURSHEED HUSSAIN BOTANY Morning 6 34 RUQUIA GULZAR BOTANY Morning 7 44 ALI MOHAMMAD YATOO ENV SCI Morning 8 57 SHAHNAWAZ HASSAN ENV SCI Morning 9 64 ZULAYKHA KHURSHID DIJOO ENV SCI Morning 10 66 KHAIR-UL-NISSA ENV SCI Morning 11 103 SAIMA ENV SCI Morning 12 65 NAVEEDA ALI ENV SCI Morning 13 54 CHAMBA WANGMO CORD Afternoon 14 35 SAKINA BANOO BOTANY Afternoon 15 19 ISHFAQ AHMAD SHEERGOJRI BOTANY Afternoon 16 68 RAYEES AHMAD BHAT ZOOLOGY Afternoon 17 70 SHEEMA TABASUM ZOOLOGY Afternoon 18 79 HANEEF MOHAMMAD BHAT CORD Afternoon 19 101 LONE RAFIYA MAJEED ENV SCI Afternoon 20 110 MUNIZA MANZOOLOGYR CORD Afternoon 21 116 ZAHOOR AHMAD SOFI GEO & RD Afternoon 22 123 TAHIR GAZANFAR WTI Afternoon 23 76 ANEES UN NISA BOTANY Afternoon 24 48 BIRJEES HASSAN ENV SCI Afternoon

(a)

(b)

Plate 1: Group photograph of the workshops (a) Basic R in ecology and (b) Basic open source

GIS.

(a) (b)

(c)

Plate 2: (a) Training session during the workshop; (b) Certificate distribution for workshops at

CORD, Kashmir University; (c) Talk given at the Green Valley School, Srinagar on Conservation of wildlife in Kashmir valley on the 18 th of March 2020.

Annexure IV

A Report on Two-day workshop on –

Assisted Reproductive Technologies and Bio -Banking for Conservation of Endangered Wildlife at Srinagar, J&K

As part of our on-going project titled “Improving capacity and strengthening wildlife conservation for sustainable livelihoods in Kashmir Himalaya" funded by National Mission on

Himalayan Studies (NMHS), a two -day workshop was conducted on ‘ Assisted Reproductive

Technologies and Bio-Banking for Conservation of Endangered Wildlife’ in association with

Di vision of Animal Biotechnology, F.V.Sc. & AH, SKUAST -K at Shuhama on March 11 and 12,

2020. The workshop was conducted in Division of Animal Biotechnology, F.V.Sc. & AH, SKUAST -

K at Shuhama, Srinagar.

Plate 3: Inaugural session – Dr. Karthikeyan Vasudevan, Prof. Nazeer Ahmad, Dr. M. L. Madan,

Prof. M. Ashraf Paul, Prof. Riaz A. Shah (From right to left) and Mr. Rashid Y. Naqash delivering the speech.

The workshop started with an inaugural session with the gracious presence of Chief Guest,

Professor Nazeer Ahmed, Hon. Vice-Chancellor, SKUAST-K and guests of honour, Prof. ML

Madan, former DDG, ICAR and Mr. Rashid Naqash, Regional Wildlife Warden, Kashmir. Prof. M

Ashraf Pal, Dean, F.V.Sc. & AH, Shuhama, SKUAST-K, Dr. Karthikeyan Vasudevan, Scientist In- charge, CCMB-LaCONES and Prof. Riaz A Shah, Head, Division of Biotechnology, FVSc & AH,

SKUAST-K, workshop coordinator were also present.

The two-day workshop comprised of scientific lectures and practical demonstrations by CCMB scientists on Assisted Reproductive Technologies and Bio-banking for conservation on endangered wildlife as follows. The scientific lectures were on Overview of Assisted

Reproductive Technologies in Wildlife, Basic Principles of Cryopreservation and Overview of Bio banking for wildlife conservation. The practical demonstrations on: 1) Collection and transportation of samples for biobanking, 2). Collection, evaluation and preservation of spermatozoa from testicles, 3) Recovery, maturation and preservation of oocytes and 4)

Preservation of skin, testicular and ovarian tissues. The participants were also given hands-on practical training on biological sample collection and preservation for biobanking, recovery and evaluation of spermatozoa from testicles and oocytes from the testicles and ovaries.

A total of 24 participants from different disciplines including field veterinarians, research scholars and faculty from BGSBU, CORD, Zoology dept, University of Kashmir, SKUAST

(Veterinary Sciences and Fisheries), wildlife protection department and sheep husbandry department attended the workshop. Workshop was concluded by the valedictory function on

12 th March, attended by Prof. M Ashraf Pal, Dean, F.V.Sc & AH, Shuhama, SKUAST-K, Dr.

Karthikeyan Vasudevan, Scientist In-charge, CCMB-LaCONES and Prof. Riaz A Shah, Head,

Division of Biotechnology, FVSc&AH, SKUAST-K, workshop coordinator. The certificates were distributed to the participants by the dignitaries.

Plate 2: Practical demonstration of collection and preservation of spermatozoa to participants by Dr. Sadanand Sontakke, CCMB.

Salient points made during the workshop

1. Dignitaries of the inaugural session appreciated CCMB’s initiative towards capacity

building and conservation efforts in association with local organizations in Kashmir

Valley.

2. All the dignitaries expressed their views on importance of assisted reproductive

technologies and bio-banking for conservation of endangered species and suggested to

use these advanced technologies for conservation of highly endangered species.

3. They were also of opinion that in addition to Hangul conservation, attention should also

be given towards conservation of other native endangered wildlife particularly for

Markhor, Kiang and Chiru.

4. They also wished to have similar workshops at regular intervals in Kashmir. Hon. Vice-

Chancellor and Dean, FVSc & AH, SKUAST welcomed CCMB’s initiative on bio-banking

and conducting capacity building workshops.

5. Mr. Rashid Naqash, Regional Wildlife Warden, Kashmir briefed about present

conservation status of Wildlife in Valley and conservation activities being undertaken by

the Wildlife Protection Department, Kashmir with other organizations. He informed that

the Department is working with WII, SKUAST, Smithsonian Institute, USA and CCMB,

Hyderabad for conservation of wildlife species in Kashmir region.

6. Participants of the workshop keenly participated in the workshop and interacted with

the experts during practical demonstrations. The feedback from the participants

suggested that CCMB in coordination with SKAUST should organize similar workshops.

7. Participants also wished that the workshops could be of longer duration (one-week) and

more techniques should be incorporated in the curriculum to get wider exposure.

8. Several participants also expressed their views on conservation efforts to be made in

other endangered native species (such as, Markhor, Chiru) of Kashmir, in addition to

Hangul deer.

9. Dr. Karthikeyan Vasudevan, Scientist-In-Charge, LaCONES-CCMB welcomed the

suggestions made by participants and agreed to follow-up on them after discussions at

CCMB.

Plate 3: Participant receiving certificate at the valedictory function in the presence of Dr. M.

Ashraf Pal, Dean FVSc and AH, SKUAST-K

Recommendations of the workshop for implementation

1. The participants and experts felt that the applications of assisted reproductive

technologies are essential for endangered species and securing their reproductive

potential. Therefore, capacity to implement these technologies should be enhanced.

2. The participants and experts felt that assisted reproductive technologies are essential

strategies to be employed for conservation of endangered species such as Hangul,

Markhor and Chiru.

Resource persons:

1. Professor Riaz A. Shah , Head, Division of Animal Biotechnology, FVSc & AH, SKUAST-K.

2. Dr. Sadanand D. Sontakke , Principal Scientist, LaCONES-CCMB, Hyderabad.

3. Dr. B. Sambasiva Rao , Principal Scientist, LaCONES-CCMB, Hyderabad.

Participants

S.No Name of the Designation/degree Department/Institute participant 1 Tashook A Dar M. Phil Dept. of Biosciences, BGSBU 2 Dr. Omer Mukthar VAS, Mantigam Dept. of Sheep Husbandry, Bandipora 3 Dr. Javed Ahmad Sofi VAS, Ramhall Dept. of Sheep Husbandry, Kupwara 4 Dr. Wasim Ahmad Naik VAS, Shopian Dept. of Sheep Husbandry, Shopian 5 Zakir Hussain Najar JRF Dept. of Zoology, University of Kashmir 6 Iyaz Qayoom JRF Dept. of Zoology, University of Kashmir 7 Farooq A Wani Lab Assistant Wildlife Protection Department, Kashmir 8 Dr. Md. Ashraf Rather Asst. Professor Faculty of Fisheries, SKUAST-K 9 Dr Insha Amin Ph.D F.V.Sc & A.H, SKUAST-K 10 Isthiyq Majeed Ph.D F.V.Sc & A.H, SKUAST-K 11 Aqdeemul Islam Ph.D F.V.Sc & A.H, SKUAST-K 12 Jasmeena Jan Ph.D Dept. of Biotechnology, Central University 13 Rojia Ashraf Ph.D Dept. of Biotechnology, Central University 14 Umar Aziz Mir Ph.D Dept. of Zoology, Univ. of Kashmir 15 Sameer Sayood Ph.D Dept. of Biotechnology, Univ. of Kashmir 16 Maqsood Ah. Dar Ph.D Clinical Biochemistry, Univ. of Kashmir 17 Tajmul Muntaz Ph.D Dept. of Biotechnology, SKUAST 18 Qamar Taban Ph.D CSIR-JRF Dept of Biotechnology, Univ. of Kashmir 19 Javaid Hameed Project JRF CCMB, Hyderabad 20 Mohd. Anwar Ph.D Dept. of Zoology, Univ. of Kashmir 21 Umar Nazir Veterinary Officer Wildlife Protection Department, Kashmir 22 Bashir Ali Reshi Guard Wildlife Protection Department, Kashmir 23 Rooh ul Amin VAS Dept. of Animal Husbandry 24 Muzafar Ahmed Rather Dept. of Biotechnology, SKUAST-K

Report on the Visit to the Hangul Conservation Breeding Centre, Shikargah

The CCMB team members made a visit on 30. 07.2019 to the Hangul Conservation Breeding Centre at Shikargha, and interacted with the field staff. The team made observations on the design of the enclosure and suggested some measures. Subsequently, the CCMB visiting visited the Hangul Conservation Breeding Centre, Shikarga, on 17.03.2020. The members who participated in the recent visit were:

1. Dr. Karthikayan Vasudevan, Scientist in charge, LaCONES-CCMB, Hyderabad 2. Dr. B Sambasiva Rao, Principal Scientist, LaCONES-CCMB, Hyderabad 3. Mir. Iqbal Khursheed, Ranger, Shikargah, Division Sophian, Dept. of Wildlife Protection J&K 4. Mr. Javaid Hameed, Project JRF, LaCONES-CCMB, Hyderabad 5. Mr. Moomin John Project JRF ,LaCONES-CCMB, Hyderabad

The team made a full tour of the enclosure and interacted with the field staff managing the facility. The team put together some suggestions that could be implemented for management of the conservation breeding facility. The points are numbered as per the call out boxes indicated in Figures 1 and 2 attached.

1. The predator proof (barbed wire and solar fencing on ‘y’ angles) for the outer fencing should be completed with proper support. It was noticed that in some places the Y angles are weak. The fencing should be covered with green mesh or iron sheets and together they should cover a height of 12 ft. 2. Provision for a sliding door of 10 ft wide for emergency use should be made at the place indicated for ease of access and also movement of animals. The unused open iron angles planted in the outer paddock area near this location. This should be removed or covered with concrete to avoid injuries to the animals. 3. The ‘Y’ angles of the fencing in the Inner paddock area are weak and sagging towards the outer paddock that needs to be strengthened. The fence should be covered by green mesh to a height of 12 ft. 4. The fawning area could be used as an observation area or isolation area for keeping injured or pregnant animals. There is no need for change in this part of the enclosure. 5. Provision for sliding gate should be made in the corridor between the inner paddock (near the fawning area) and the outer fencing. It will be used to access the outer paddock. 6. A shelter should be provided in the inner paddock area with proper drainage facilities. The water and feed troughs should be provided in the night house with proper drainage facility to clean the water and feed troughs. It will also serve as shelter to the animals during snow and rain. 7. At the corner of the inner paddock area near to the outer fencing and monitoring centre, there should be a sliding gate operational from outside. This is for movement of the animals in and out of the two paddock areas. 8. Opposite to the Maintenance Entrance Gate, there should be a provision to enter into the inner paddock area. It will be used for the staff to enter and clean the inner paddock area and feeding troughs.

1 9. There should be provision for a Maintenance Entrance Gate facing the access road to the facility. This gate should have a sliding mechanism, and it will serve to access the service area, inner and outer paddocks for any maintenance. 10. The rear side gate opening into the forest trail outside should to be modified by providing the slight inclination as well as a latch to close the gates smoothly to avoid the disturbance and harm to the animals. This gate should have one moving frame instead of two. 11. There should provision for a service entrance sliding door which will open into the corridor for maintenance. The staff will close this gate before opening the service gate described in point 8 above. 12. An Anteroom of 6ft X 6ft is required before the service entrance gate. This room will have a

KMNO4 bath and shelves for storing things that are needed routinely for managing the cages. 13. The feeding stall should be raised to 2 ft height and have troughs that have good drainage for cleaning. The surfaces should be made smooth and shallow. 14. Three sides of the shelter’s perimeter on the ground should have a drainage that takes away slurry and water and this should be drained outside the entire enclosure to avoid any infections. 15. The roof of the shelter should be supported by vertical members that are 12ft in height to allow males with large antlers inside the shelter. 16. The floor of the shelter should be rough and have a gentle slope towards to two sides that are provisioned with drainage.

In addition to the above points, the team felt that a water storage facility should be made for perennial supply of freshwater to animals. It was felt that visitors should be limited to the area below the access road and not be allowed to walk around the enclosure. To protect the outer paddock fence from the far side, the department should raise a fence further away, so that no one enters the area from that side. Proper measures for control of rodent population inside the enclosures should be taken. Since Hangul venture into the lower elevation in winter and sometimes entre kitchen gardens and eat nutritious greens, the outer paddock area should be planted with lettuce and other vegetables to provision them with sufficient food. These vegetables should be raised without any fertilizers or pesticides. As suggested by the CCMB team earlier, the forest trail at one end of the enclosure should be made into a tunnel to drive the animals into the enclosure. Further, the cultivated greens in the outer paddock can serve as an attractant for the animals to reach the site and settle down. This might be a stress free method of acquiring animals into the enclosure in Shikargha conservation breeding facility.

2 Some images of the visit made by CCMB team:

The Y angle on the inner paddock fence sagging down Gate at the rear end of the outer paddock with two sliding doors

Vertical member protruding from surface in the outer paddock The team at the outer paddock where greens can be cultivated to attract hangul

3 Figure 1 1 Shikargha Hangul Conservation Breeding Centre layout Not to scale

Suggestions made Sliding 3 2 based on visit of 5 maintenance 4 entrance Sliding emergency gate 10 ft CCMB scientists gate 10 ft Outer Paddock tram visit on 17th enclosure Observation Fauning March 2020 / Entrance to 6 - - Location of observation Shelter CCTV cameras enclosure

9 8 from outside) (operational entry gate 8 ft animal Sliding 10 ft entrance gate maintenance Sliding Inner Paddock gate 4 ft 4 gate Service 10 Service Sliding gate 8ft entrance 4 ft

Anteroom 11 before 12 entrance Trail Figure 2 Shikargha Hangul Conservation Breeding Centre – night shelter design (not to scale)

Feeding and water troughs 13 1.5 ft wide 2 ft height 1 ft depth 20 ft 15 Support columns for roof 14

Drainage channels 0.5 ft 0.5 channels Drainage 12 ft 20 ft Feeding and water troughs

16 Support roof columns for Drainage channels 0.5 ft 20 ft Cross section view