Targeting Casein Kinase 1 Delta Sensitizes Pancreatic and Bladder

Published OnlineFirst May 19, 2020; DOI: 10.1158/1535-7163.MCT-19-0997

MOLECULAR CANCER THERAPEUTICS | SMALL MOLECULE THERAPEUTICS

Targeting Casein Kinase 1 Delta Sensitizes Pancreatic and Bladder Cancer Cells to Gemcitabine Treatment by Upregulating Deoxycytidine Kinase Francesca Vena1, Simon Bayle1, Ainhoa Nieto2, Victor Quereda1, Massimiliano Aceti1, Sylvia M. Frydman1, Samer S. Sansil3, Wayne Grant4, Andrii Monastyrskyi1, Patricia McDonald2, William R. Roush4, Mingxiang Teng5, and Derek Duckett1

ABSTRACT ◥ Although gemcitabine is the cornerstone of care for pancreatic models. Genetic studies confirmed that silencing CK1d or treat- ductal adenocarcinoma (PDA), patients lack durable responses ment with SR-3029 induced a significant upregulation of deox- and relapse is inevitable. While the underlying mechanisms ycytidine kinase (dCK), a rate-limiting enzyme in gemcitabine leading to gemcitabine resistance are likely to be multifactorial, metabolite activation. The combination of SR-3029 with gemci- there is a strong association between activating gemcitabine tabine induced synergistic antiproliferative activity and enhanced metabolism pathways and clinical outcome. This study evaluated apoptosis in both pancreatic and bladder cancer cells. Further- casein kinase 1 delta (CK1d) as a potential therapeutic target for more, in an orthotopic pancreatic tumor model, we observed PDA and bladder cancer, in which CK1d is frequently over- improved efficacy with combination treatment concomitant with expressed. We assessed the antitumor effects of genetically increased dCK expression. This study demonstrates that CK1d silencing or pharmacologically inhibiting CK1d using our in- plays a role in gemcitabine metabolism, and that the combination house CK1d small-molecule inhibitor SR-3029, either alone or in of CK1d inhibition with gemcitabine holds promise as a future combination with gemcitabine, on the proliferation and survival therapeutic option for metastatic PDA as well as other cancers of pancreatic and bladder cancer cell lines and orthotopic mouse with upregulated CK1d expression.

Introduction exhibit a good initial clinical response, chemoresistance is inevitable, and patients ultimately succumb to the disease (10). Mechanistically, The development of new targeted agents that specifically inhibit 0 0 gemcitabine acts as a deoxycytidine analogue (2 ,2-difluorodeoxy- kinases involved in tumorigenesis has led to important progress in the cytidine) and belongs to the class of antimetabolite drugs. Gemcitabine treatment of various cancers (1–3). In aggressive tumor types, such as is taken up by the nucleoside transporters hENT1 and hCNT1 and pancreatic ductal adenocarcinoma (PDA), where patients are refrac- phosphorylated by deoxycytidine kinase (dCK) to the mono- and tory to all standard therapies, multiple clinical trials have been con- subsequently to the di-(dFdCDP) and tri-(dFdCTP) phosphorylated ducted in the past three decades. But results have been modest, forms (11). The dFdCTP metabolite is incorporated into DNA where it extending overall survival incrementally and with outcomes con- acts as a false nucleotide, causing replication fork collapse and cell founded by significant side-effects (4, 5), making PDA one of the death by apoptosis (12). Importantly, altered expression of enzymes most lethal human diseases, with a 5-year overall survival rate of less controlling gemcitabine metabolism provoke both gemcitabine resis- than 8% (6, 7). Therefore, an understanding of the main molecular tance and sensitivity. For example, overexpression of cytidine mechanisms that drive PDA disease and the identification of novel deaminase (CDA), the main enzyme of gemcitabine inactivation, actionable therapeutic targets are urgently needed to improve the is associated with gemcitabine resistance (13, 14), whereas upre- clinical outcomes of patients suffering with this dreadful disease (8). gulation of dCK correlates with increased response to gemcitabine Gemcitabine is the mainstay treatment for locally advanced and treatment (15–18). Furthermore, dCK overexpression has also been metastatic PDA (9). Although patients treated with gemcitabine may associated with higher overall survival and progression-free survival in patients with PDA (18). Although several strategies to improve gemcitabine efficacy have 1Department of Drug Discovery, Moffitt Cancer Center, Tampa, Florida. 2Depart- ment of Cancer Physiology, Moffitt Cancer Center, Tampa, Florida. 3Translational been evaluated in the clinic, such as combination with targeted agents, Research Core, Moffitt Cancer Center, Tampa, Florida. 4Department of Chem- immunotherapies, or other chemotherapies, these studies have shown istry, The Scripps Research Institute, Jupiter, Florida. 5Department of Biosta- mainly incremental improvements in outcomes for patients with tistics and Bioinformatics, Moffitt Cancer Center, Tampa, Florida. PDA (4, 19, 20). Approaches that increase gemcitabine sensitivity Note: Supplementary data for this article are available at Molecular Cancer through mechanisms that increase intracellular dFdCTP levels are Therapeutics Online (http://mct.aacrjournals.org/). highly attractive. d e F. Vena and S. Bayle contributed equally to this article. Casein kinase 1 delta and epsilon (CK1 and CK1 , respectively) are serine/threonine kinases known to play a role in multiple cellular Corresponding Author: Derek Duckett, Moffitt Cancer Center, 12902 Magnolia processes, including membrane trafficking, cytokinesis, circadian Drive, Tampa, FL 33612. Phone: 813-745-5410; E-mail: – d derek.duckett@moffitt.org rhythm, and tumorigenesis (21 24). In particular, CK1 has been shown to interact with key molecules of signaling pathways frequently Mol Cancer Ther 2020;19:1623–35 dysregulated in cancer, such as the Wnt/b-catenin, PI3K/AKT signa- doi: 10.1158/1535-7163.MCT-19-0997 lin,g and Hedgehog pathway (25–27). Importantly, alterations in the 2020 American Association for Cancer Research. expression levels or activity of CK1 isoforms have been found in several

AACRJournals.org | 1623

Vena et al.

tumor types. For instance, CK1d expression has been associated with a treatment using a Caspase 3/7 Glo Assay (Promega) as per the more aggressive disease and poorer prognosis in breast, glioblastoma, manufacturer’s instructions. All data represent the mean of three ovarian, colorectal, and pancreatic cancers (21, 28–31). Thus, CK1d independent experiments. represents an attractive therapeutic target for human cancers aber- rantly expressing CK1d. The role of CK1e isoform in cancer is less well Synergy quantification of drug combinations understood and has been correlated with both poor (22, 32, 33) and To generate CI values, different volume combinations (1:1 or 4:1) of improved overall survival (34, 35). the initial stock concentration of each drug (gemcitabine 10 mmol/L, In this study, we found CK1d expression to be correlated with SR-3029 10 mmol/L) was used to generate 10-point 1:3 dilution overall survival, tumor grade, and distal metastasis in patients with concentration response curves. Loewe additivity is a dose-effect model, PDA. Our in vitro and in vivo studies have revealed synergistic where additivity occurs in a two-drug combination if the sum of the antitumor activity between gemcitabine and our in-house CK1d ratios of the dose versus the median-effect for each individual drug is 1. inhibitor SR-3029 in both pancreatic and bladder cancer and have In this model, CI scores estimate the interaction between the two drugs. identified a distinctive mechanism responsible for SR-3029 sensitiza- ACI< 1 is considered synergistic, CI > 1 antagonistic, and CI ¼ 1is tion to gemcitabine cytotoxicity. Our findings provide a strong ratio- additive. Chou and Talalay (37) showed that Loewe equations are valid nale for combining the CK1d-specific inhibitor SR-3029 with gemci- for enzyme inhibitors with similar mechanisms of action either tabine in patients with PDA and bladder cancer. competitive or noncompetitive toward the substrate. The CI coeffi- cients were computed on the basis of the Chou–Talalay Median Effect model as outlined in CalcuSyn v2.11 (http://www.biosoft.com/w/ Materials and Methods calcusyn.htm). The degree of interaction between drugs was estimated Cell culture and reagents according to the classification presented by Chou–Talalay (37). Human PDA cell lines BxPC-3, MIAPaCa-2, and PANC-1 and human bladder cancer cell lines 5637, HT-1376, J82, T24, TCCSUP, Lentiviral transduction and UM-UC-3 were purchased from the ATCC. Cells were maintained Lentiviral particles were produced using HEK293T cells and a third- in DMEM (Gibco) or RPMI1640 (Gibco) for both BxPC-3 and generation packaging system, MISSION Lentiviral Packaging Mix MIAPaCa-2 and supplemented with 10% FBS and penicillin/strepto- (Sigma-Aldrich), as per the manufacturer's instructions. To stably fi mycin (Gibco). All cells were cultured at 37 C in a 5% CO2 incubator. express speci c luciferase or the short hairpin RNA (shRNA) against Cells have been regularly tested for Mycoplasma by qPCR and were not CK1d (shCK1d sequence: CCGGGAATTGCAGAGAATCAGACT- maintained in culture or used beyond 20 passages. CCTCGAGGAGTCTGATTCTCTGCAATTCTTTTT), PANC-1 and Gemcitabine triphosphate (dFdCTP) was purchased from Toronto T24 cells were transduced with optimized titers of lentiviruses. Research Chemicals. Tetrahydrouridine was purchased from Biovi- Twenty-four hours later, the medium was exchanged and cells 13 15 0 sion. Cytidine- C9, N3 5 -triphosphate, doxycycline, and gemcita- were allowed to recover for 24 hours before antibiotic selection: bine were purchased from Sigma-Aldrich. Normal bladder and pan- puromycin (1 mg/mL) for 3–6days. creatic protein extracts were purchased from Novus Biologicals Incor- poration. SR-3029 was synthesized and characterized as described Knockdown of dCK previously (36). PANC-1 cells were transfected with 20 nmol/L of siRNA targeting dCK (siRNA-targeted sequence: sense GGUGCCUAUCUUAACA- Clonogenicity assays CUGtt; AM16708 siRNA ID 103564 Life Technologies), or nontarget- Clonogenic assays were performed by seeding cells in 6-well ing (Scramble sequence) with FuGENE HD Transfection Reagent plates at a density of 500 to 1,000 cells per well. Twenty-four hours (Promega). After 48 hours, cells were seeded and treated for 3 days later, cells were treated with DMSO, SR-3029 (25 nmol/L), gemci- with gemcitabine (50 nmol/L) or DMSO in preparation for the Caspase tabine (1 or 5 nmol/L), or the combination of SR-3029 with assay, and seeded and treated for 3 days treatment with SR-3029 gemcitabine for 72 hours, after which time the medium was (50 nmol/L), gemcitabine (50 nmol/L), and their combination in changed and cells were allowed to grow for an additional 7 to preparation for the CellTiter Glo Assay. 10 days. Cells were washed with PBS, fixed with paraformaldehyde (4%), and stained with Crystal Violet (5 mg/mL, 25% methanol). Immunoblotting Colonies of more than 50 cells were counted using a low- SDS-PAGE was performed using NuPAGE 4–12% Bis-Tris Gels magnification light microscope. Alternatively, 10% acetic acid was (Invitrogen) and transferred to nitrocellulose membranes by wet used to resolubilize crystal violet for spectrophotometry. Absor- transfer using Trans-Blot Transfer Medium (NuPAGE; Life Tech- bance was measured in duplicate at 590 nmol/L. The fraction of nologies). Membranes were then blocked in Odyssey Blocking surviving colonies was calculated as the ratio of the absorbance of Buffer (LI-COR Biosciences) and incubated overnight at 4Cwith treated cells to that of nontreated cells. primary antibodies. After three washes of 5 minutes with TBST (20 mmol/L TBS at pH 7.6 and 0.1% Tween 20), blots were incubated In vitro cell proliferation and apoptosis assays for 1 hour with the appropriate IRDye-conjugated secondary To assess inhibition of cellular proliferation after drug treatment, antibody (LI-COR Biosciences) and imaged using the LI-COR 400 cells per well were seeded in a 384-well plate (Greiner Bio-one) and Odyssey CLx. Bands were quantified using the software Image treated for 72 hours with SR-3029, gemcitabine, or their combination Studio Lite (LI-COR Biosciences). by using 8 fixed-ratio concentrations. Inhibition of proliferation was Antibodies used in the study were purchased as indicated: CK1d measured by the Cell Titer Glo Assay (Promega). Synergism or (ab48031, Abcam), glyceraldehyde 3-phosphate dehydrogenase antagonism was determined with the Compusyn software by calcu- (GAPDH; MAB374, Merck Millipore), dCK (ab96599, Abcam), lating the combination index (CI) values using the Chou–Talalay cleaved-PARP (9541, Cell Signaling Technology), and human nucle- method (37). Apoptosis was measured following a 72-hour drug oside transporter 1 (hENT1; ab135756, Abcam).

1624 Mol Cancer Ther; 19(8) August 2020 MOLECULAR CANCER THERAPEUTICS

Targeting CK1d in Pancreatic and Bladder Cancer

qRT-PCR Spectrophotometer (Thermo Fisher Scientiﬁc). RNA (1 mg) was Total RNA from cultured cells was obtained using the RNeasy Plus reverse transcribed with SuperScript III First-Strand Synthesis System Mini Kit (Qiagen) as per the manufacturer's recommendations. (Life Technologies) as per the manufacturer's recommendations. Quantiﬁcation of RNA was performed using the Nanodrop 1000 RT-PCR detection with Power SYBR Green PCR Master Mix (Life

Figure 1. Pancreatic and bladder cancer cell line sensitivity to the CK1d inhibitor SR-3029. A, CK1d expression in relation to overall survival in the PDA dataset, PACA-AU. Data were compared using the c2 test with P ¼ 0.004 signiﬁcance between the three groups. CSNK1D expression levels for the different patient groups, stable disease versus distal metastasis (B) and comparing the different clinical grades (C) in the same PDA dataset. Gene signals were normalized as described in the Materials and Methods section. Student t test was performed for signiﬁcance estimation assuming unequal variance between groups. D, Structure of SR-3029 and the docking pose of SR-3029 (green sticks) in the active site of CK1d (PDB: 4HGT, surface representation). Key hydrogen bond interactions with protein residues (blue sticks) are shown in yellow dash. E, The basal expression of CK1d was examined by Western blot analysis on a panel of human PDA cell lines (PANC-1, MIAPaCa-2, and BxPC-3) and bladder cancer cell lines (HT-1376, J82, TCCSUP, 5637, T24, and UM-UC-3). GAPDH expression was used as a loading control. Cellular proliferation after 72 hours of treatment with SR-3029 or vehicle was analyzed by CellTiter-Glo Assay on human pancreatic cancer (F) and bladder cancer (G) cell lines with their associated EC50 values. Data shown represent average of three biological replicates SD.

AACRJournals.org Mol Cancer Ther; 19(8) August 2020 1625

Vena et al.

Figure 2. Combination of SR-3029 plus gemcitabine in vitro. CellTiter-Glo Assay was used to assess the effects of SR-3029 with gemcitabine on growth inhibition at 72 hours in pancreatic (PANC-1, MIAPaCa-2) and bladder (T24, UM-UC-3) cancer cells. Synergy between SR-3029 and gemcitabine was analyzed using the Chou–Talalay method. CI calculations were performed by Compusyn Software. Values < 1 indicated synergism and >1 indicated antagonism. The mean CI values are shown (A, B). Colony formation assays of PANC-1 (C) and T24 (D) cells were performed by seeding 500/1,000 cells per well in 6-well plates. PANC-1 and T24 cells were treated with SR-3029 (50 or 25 nmol/L, respectively), gemcitabine (25 or 1 nmol/L, respectively), or the combination of the two drugs for 72 hours and cultured for 1 week. Cells were stained and counted. Data are presented as mean SD (one-way ANOVA, , P < 0.05; , P < 0.001). Apoptosis of PANC-1 (E) and T24 (F) cells was detected by measuring the levels of caspase-3/7 activity after 72 hours of treatment with SR-3029 (50 nmol/L), gemcitabine (50 nmol/L), or SR-3029 þ gemcitabine. Results are presented as fold-increase to untreated samples and as mean SD. Statistical signiﬁcance was calculated by one-way ANOVA (, P < 0.05; , P < 0.01; , P < 0.001). The experiment presented is representative of three independent experiments.

1626 Mol Cancer Ther; 19(8) August 2020 MOLECULAR CANCER THERAPEUTICS

Targeting CK1d in Pancreatic and Bladder Cancer

Figure 3. Modulation of dCK expression by CK1d inhibition or silencing. A, qRT-PCR analysis for the mRNA expression of dCK was performed on PANC-1 and T24 cells treated with SR-3029 (25 nmol/L) for 24 hours. Results are expressed as a fold-change (mean SD) normalized to an untreated control. Statistical signiﬁcance was calculated by two-tailed Student t test (, P < 0.05; , P < 0.01; , P < 0.001). B, Modulation of dCK protein levels after 24 hours of treatment with SR-3029 (25 nmol/L), gemcitabine (50 nmol/L), or their combination was analyzed by Western blot analysis in PANC-1 and T24 cells. The experiment presented is representative of three independent experiments. PANC-1 cells were transduced with doxycycline-inducible shRNA targeting CK1d or with a nontargeting shRNA (scramble). Efﬁciency of CK1d knockdown was assessed by qRT-PCR analysis (C) and Western blot analysis (D). The mRNA and protein expression of dCK was analyzed (D, E). Data shown represent average of three biological replicates SD.

AACRJournals.org Mol Cancer Ther; 19(8) August 2020 1627

Vena et al.

Technologies) was performed with the resulting cDNA and a 50/50 seconds; binning, 8; field of view, 15 cm; f/stop, 1; open filter). Average forward primer:reverse primer ratio using the QuantStudio 5 (Applied radiance (p/s/cm2/sr) was determined from the tumor region of Biosystems). Analysis of each gene of interest as compared with interest using Living-Image (Xenogen) analysis software. Forty-five DDC fi GAPDH was performed using the t method and is expressed as days after initial treatment, mice were sacri ced and their tumors arbitrary units. The primers used are listed in Supplementary Materials excised, measured using a caliper, and weighed on a balance to (Supplementary Table S1). determine primary tumor burden. Metastases were counted through visual inspection of the spleen and liver. Tumor samples were collected Orthotopic pancreatic cancer model and snap-frozen in liquid nitrogen for protein and RNA analysis. All animal studies were approved by the Institutional Animal Care and Use Committee at the Scripps Research Institute (Jupiter, FL) and Orthotopic bladder cancer model were carried out in compliance with NIH Guide for the Care and Use of Stable T24 cells expressing luciferase were orthotopically injected into Laboratory Animals. Stable PANC-1 cells expressing luciferase were the bladder wall of 8-week-old female athymic nude mice (Charles River orthotopically injected into the pancreas of 6-week-old female athymic Laboratories). An incision was made with a scalpel in the lower midline nude mice (Charles River Laboratories). Briefly, 5 105 cells were of the abdominal layer. The bladder was exposed by gentle pressure on 5 resuspended in 50% Matrigel PBS, kept on ice, and slowly injected into the abdomen. A total of 5 10 luciferase expressing cells were the tail of the pancreas of anesthetized mice. The externalized pancreas resuspended in PBS, kept on ice, and slowly injected into the wall of was left untouched for 1 minute, then carefully returned to inside the the bladder of anesthetized mice with the bevel of the needle facing organ and the wound closed. Starting 2/3 weeks after injection, mice upward. The externalized bladder was then carefully returned to behind were treated daily with SR-3029 (20 mg/kg) or vehicle (ratio of DMSO: the abdominal wall and the incision was closed with sutures for the Tween80:water; 10:10:80) by intraperitoneal injection (i.p.). For the peritoneum and clips for the external wound. Starting 2/3 weeks after combination study, mice were treated twice a week with gemcitabine injection, mice were treated daily with SR-3029 (20 mg/kg) or vehicle (i.p. of 50 mg/kg), daily with SR-3029 (i.p. of 20 mg/kg), or their (ratio of DMSO:Tween80:water; 10:10:80) by i.p. injection. Following combination (daily with SR-3029 20 mg/kg; twice a week with subcutaneous injection of luciferin (15 mg/mL, Goldbio Technology), gemcitabine 50 mg/kg). Following subcutaneous injection of luciferin tumor growth was measured by luminescence imaging using the IVIS (15 mg/mL, Goldbio Technology), tumor growth was measured by 100 Imager (exposure time, 1–60 seconds; binning, 8; field of view, 15 2 luminescence imaging using the IVIS 100 Imager (exposure time, 1–60 cm; f/stop, 1; open filter). Average radiance (p/s/cm /sr) was determined

Figure 4. Antitumor activity of SR-3029 on the PANC-1 orthotopic tumor model. PANC-1 cells were transduced with luciferase-expressing lentivirus and injected in the pancreas of athymic nude mice. Two weeks after implantation, mice were randomized into two groups (n ¼ 5 vehicle, n ¼ 9 SR-3029) and treated daily with vehicle (ratio of DMSO:Tween80%:water; 10:10:80) or 20 mg/kg SR-3029 by intraperitoneal injection. A, The graph representing tumor growth evolution by biolumi- nescence is shown. At the end of the study, the volume of each tumor was measured (B) and weighed (C). Data are represented as mean SEM , P < 0.05; , P < 0.01 compared using the Mann–Whitney statistical test. D, Western blot analysis validating upregulation of dCK and activation of apoptosis marker cleaved PARP upon SR-3029 treatment of PANC-1 xenograft tumors.

1628 Mol Cancer Ther; 19(8) August 2020 MOLECULAR CANCER THERAPEUTICS

Targeting CK1d in Pancreatic and Bladder Cancer

from the tumor region of interest using Living-Image (Xenogen) Liquid chromatography with tandem mass spectrometry analysis software. At the end of the experiment, mice were sacriﬁced methodology and their tumors excised, measured using a caliper, and weighed on a To form calibration sets for cell line analyses, known amounts of balance to determine primary tumor burden. Tumor samples were dFdCTP were added to aqueous solution to give ﬁnal concentrations of collected and snap-frozen in liquid nitrogen for protein and RNA 0.39, 0.78, 1.56, 3.125, 6.25, 12.5, 25, 50, 100, 200, and 400 ng/mL for analysis. the standards and 4.68, 18.75, and 75 ng/mL for the quality controls.

Figure 5. Combination therapy of SR-3029 with gemcitabine in vivo. A, The orthotopic tumor model used was generated by PANC-1 cells injected into the pancreas of athymic mice. Two weeks after implantation mice were randomized into four groups; tumor mice were treated daily with vehicle, with 20 mg/kg SR-3029 daily, with 50 mg/kg gemcitabine twice a week, or with SR-3029 þ gemcitabine. B, Around 6/7 weeks after treatment, mice were sacriﬁced and their tumors were excised, measured, and weighed. Statistical analysis was performed with Mann–Whitney test (, P < 0.01; , P < 0.001). C, Cleaved-PARP was examined by Western blot analysis. GAPDH was used as a loading control. D, dCK expression was analyzed by qPCR on RNA extracts from tumors derived from all cohorts. Statistical analysis was performed with one-way ANOVA (, P < 0.05; , P < 0.01; , P < 0.001). E, dCK protein expression on tumor protein extracts was examined by Western blot analysis. GAPDH was used as a loading control.

AACRJournals.org Mol Cancer Ther; 19(8) August 2020 1629

Vena et al.

Figure 6. SR-3029 induces dCK expression, increasing levels of gemcitabine's active metabolite. PANC-1 cells were transduced with dCK-expressing lentivirus. A, Western blot analysis validating upregulation of dCK for the transduced cells. B, Cellular proliferation after 72 hours of treatment with gemcitabine was analyzed by a CellTiter-Glo Assay on the PANC-1–overexpressing dCK cells compared with control cells. C, Apoptosis of PANC-1 cells overexpressing GFP or dCK was detected by measuring the levels of caspase-3/7 activity after 72 hours of treatment with gemcitabine (50 nmol/L) or DMSO. Results are presented as fold-increase to untreated samples and as mean SD. Statistical signiﬁcance was calculated by two-tailed Student t test (P < 0.05). (Continued on the following page.)

1630 Mol Cancer Ther; 19(8) August 2020 MOLECULAR CANCER THERAPEUTICS

Targeting CK1d in Pancreatic and Bladder Cancer

PANC-1 cells were incubated with 1 mmol/L gemcitabine for 1 hour in human pancreatic cancer and survival, analysis of CK1d mRNA at 37C. Five million cells for each condition were spun. Cell pellets levels in human pancreatic tumor specimens was performed. High were then precipitated with 200 mL of ice-cold 0.3 mol/L perchloric expression of CK1d was significantly correlated with worse survival acid (J.T. Baker) in Eppendorf microcentrifuge tubes. Samples were outcomes, as shown by the Kaplan–Meier curve (P ¼ 0.004; Fig. 1A). vortexed for 15 seconds and placed in 4C for 15 minutes. The mixture Interestingly, a significant increase in CK1d (CSNK1D) expression was then centrifuged at 4C at 12,500 RPM for 20 seconds. Acidic was observed in patients with metastatic pancreatic cancer compared supernatant was transferred into another microcentrifuge tube and with patients with stable disease (P ¼ 0.001; Fig. 1B), and CSNK1D 100 mL of 0.5 mol/L potassium hydroxide was added to neutralize the expression was strongly correlated with tumor grades in the same solution (38). Samples were centrifuged for 20 seconds at 4Cata patients (g2 and g3, P < 0.0004; Fig. 1C) suggesting that CK1d status is speed of 12,500 RPM. Supernatant was transferred to a 96-well plate associated with aggressive disease in pancreatic cancer. Notably, our for analysis. A total of 10 mL of sample were injected into a Thermo previous studies in triple-negative breast cancer models, in which Accela Ultra High-Performance Liquid Chromatography system cou- CK1d is frequently overexpressed, have shown promising results by pled to a Thermo TSQ Quantum Tandem Mass Spectrometer targeting CK1d with SR-3029, a potent, selective inhibitor for CK1d (Thermo Electron). Gradient elution was achieved with mobile phases and CK1e (28). Thus, we sought to investigate the cytotoxic effect of of 10 mmol/L ammonium acetate and methanol (J.T. Baker), both SR-3029 on pancreatic cancer models. The structure and the docking containing 0.1% ammonium hydroxide (Thermo Fisher Scientific). A pose of SR-3029 (green sticks) in the active site of CK1d is represented 2.1 30 mm 1.7-mm Acquity UPLC BEH C18 Column (Waters) was in Fig. 1D (PDB:4HGT; ref. 39). used to separate compounds. The mass spectrometry system employed We determined the basal expression of CK1d in a panel of human heated electrospray ionization in the source followed by selected PDA and bladder cancer cell lines by Western blot analysis. All cancer reaction monitoring of the target compound. The following selected cell lines tested displayed higher levels of CK1d compared with normal reaction monitoring transition was monitored in positive ion mode for tissue extracts (Fig. 1E). These results are consistent with the data from quantitation: 504.01 to 326.062 of dFdCTP. The assay has a linear Brockschmidt and coworkers who demonstrated that CK1d is highly range from 0.39 to 400 ng/mL in aqueous solution. The resulting expressed in human pancreatic cancer cell lines (30). chromatographic peaks were integrated by Thermo TraceFinder Next, we tested the effect of SR-3029 in short-term proliferation software. Linear regression was used to form the calibration curve assays, confirming its promising anticancer activity against human in vitro from standards; quality control samples were checked against the cancer cells , with EC50 values ranging from 5 to 400 nmol/L regression line and unknown samples were plotted for backcalculation (Fig. 1F and 1G). of the raw concentrations. Gemcitabine, the standard-of-care for patients with advanced PDA and bladder cancer, has limited efficacy due to the rapid PACA-AU data analysis acquisition of resistance (40). To evaluate the in vitro potential of Patient information and normalized gene expression data of pan- SR-3029 to sensitize cells to gemcitabine-induced cytotoxicity, cells creatic cancer samples were downloaded from International Cancer were treated with SR-3029, gemcitabine, or their combination, and Genome Consortium Data Portal. Only array-based gene expressions drug-effect interactions were analyzed by Bliss additivity modeling from the PACA-AU project were selected for downstream survival calculating CIs using the Chou–Talalay method (37). Notably, the analysis to avoid potential batch effects compared with sequencing combination of SR-3029 with gemcitabine induced synergistic data, as well as to keep sufficient sample size (269 arrays vs. 91 antiproliferative activity in pancreatic and bladder cancer cell lines sequencing samples). Gene expression was averaged across probes when tested, as shown by the CI values being all less than 1 (Fig. 2A that corresponded to the same genes. Patients were then categorized and 2B; Supplementary Fig. S1). into three groups based on their expression level of the CK1d gene To confirm the effects of SR-3029 plus gemcitabine treatment on CSNK1D: bottom quartile, top quartile, and middle (50%). Censored cell survival, 7-day clonogenicity assays were performed on PANC-1 survival analysis and gene correlation analysis were then performed and T24 cells. A significant reduction of colony formation was using R. observed from the combination treatment compared with cells treated with DMSO or either single drug alone (Fig. 2C and 2D). Finally, to determine the drug combination effect on cell death by apoptosis, the Results levels of caspase-3/7 activation were measured 72 hours after treat- SR-3029 sensitizes PDA and bladder cancer cells to ment with SR-3029, gemcitabine, or their combination. A significant gemcitabine cytotoxicity increase of apoptosis was observed in both PANC-1 and T24 cells CK1d, a serine/threonine kinase involved in the regulation of several when the two drugs were coadministered compared with either single cellular processes, has increased expression in a variety of solid drug alone (Fig. 2E and 2F). This result was confirmed by the increased tumors (27). To assess the correlation between expression of CK1d protein levels of the cleaved PARP caspase substrate (shown by

(Continued.) D, Western blot analysis validating downregulation of dCK for the transfected cells with 20 nmol/L of siRNA Scramble (Sc) or against dCK (dCK). E, Cellular proliferation after 72 hours of treatment with gemcitabine was analyzed by a CellTiter-Glo Assay on the PANC-1 cells with dCK silenced compared with control cells with a siRNA scramble. F, Apoptosis of PANC-1 cells transfected with a siRNA scramble or against dCK was detected by measuring the levels of caspase- 3/7 activity after 72 hours of treatment with gemcitabine (50 nmol/L) or DMSO. Results are presented as fold-increase to untreated samples and as mean SD. Statistical significance was calculated by two-tailed Student t test (, P < 0.05). G, CellTiter-Glo Assay was used to assess the effects of SR-3029 with gemcitabine on growth inhibition at 72 hours in siRNA-transfected PANC-1 cells. Synergy between SR-3029 and gemcitabine was analyzed using the Chou–Talalay method. CI calculations were performed by Compusyn Software. Values < 1 indicated synergism, and > 1 indicated antagonism. The mean CI value is shown. H, Following a published method (38), the active metabolite of gemcitabine dFdCTP was quantified by liquid chromatography and mass spectrometry over time after incubation with 1 mmol/L of gemcitabine. Statistical significance was calculated by Mann–Whitney statistical test (, P < 0.01). I, PANC-1 cells were exposed with DMSO or 25 nmol/L SR-3029 for 24 hours, followed by 1 mmol/L of gemcitabine for 1 hour. dFdCTP metabolites were then measured the same way described above. Statistical significance was calculated using the Mann–Whitney statistical test. J, Graphical abstract representing the mechanism by which CK1d sensitizes PDA cells to gemcitabine activity.

AACRJournals.org Mol Cancer Ther; 19(8) August 2020 1631

Vena et al.

immunoblot analysis) upon SR-3029 plus gemcitabine combination by an increase of dCK expression as shown by immunoblot analysis of treatment (Supplementary Fig. S2A). Similar results were obtained in PANC-1 and T24 tumor extracts (Fig. 4D; Supplementary Fig. S7C) additional pancreatic and bladder cancer cell lines (Supplementary consistent with our in vitro results. Fig. S2B and S2C). These results support the premise that CK1d inhibition potentiates gemcitabine efficacy in PDA and bladder cancer SR-3029 increases sensitivity to gemcitabine in an orthotopic cells by suppressing cellular growth and enhancing gemcitabine- pancreatic cancer mouse model induced apoptosis. The PANC-1 orthotopic mouse model was further used to investigate whether SR-3029 could sensitize pancreatic cancer to gemcita- CK1d inhibition induces upregulation of dCK, the rate-limiting bine cytotoxicity in vivo. A schematic representation of the treatment enzyme of gemcitabine metabolism schedule is shown in Fig. 5A. Combination treatment of SR-3029 To investigate molecular mechanisms responsible for gemcitabine (20 mg/kg i.p. injection) with gemcitabine (50 mg/kg i.p. injection sensitization by SR-3029, quantitative reverse transcription PCR twice a week) caused a greater inhibition of tumor growth (Fig. 5B) (qRT-PCR) analyses were performed on key genes that modulate compared with the single agents. The combination induced a greater gemcitabine uptake and metabolism. Our results revealed that effect on apoptosis as shown by cleaved PARP protein expression SR-3029 significantly upregulated the expression of dCK in PANC- (Fig. 5C). In addition, qRT-PCR and Western blot analyses revealed a 1(P < 0.001) and T24 cells (P < 0.01; Fig. 3A). We also performed significant upregulation of dCK mRNA and protein expression in SR- Western blot analyses to further analyze the effects of SR-3029 on dCK 3029/gemcitabine-treated mice, confirming our in vitro findings protein expression. Interestingly, increased protein levels of dCK were (Fig. 5D and 5E). Importantly, SR-3029 either alone or in combination observed when PANC-1 and T24 cells were treated with SR-3029, an with gemcitabine was well tolerated. effect that was further enhanced in combination with gemcitabine (Fig. 3B). A time-course analysis revealed a significant upregulation at Overexpression of dCK accumulates dFdCTP metabolite and 24 hours after drug administration (Supplementary Fig. S3). Further- enhances gemcitabine response more, while hENT1, the enzyme responsible for gemcitabine uptake To further elucidate the role of the dCK enzyme on gemcitabine inside the cell, was upregulated by SR-3029 in PANC-1 cells (Supple- sensitization, we transduced PANC-1 cells with a lentivirus-expressing mentary Fig. S4), protein expression of hENT1 was not upregulated dCK under the regulation of the constitutive promoter EIFa. The after combination treatment in PANC-1 cells (Supplementary Fig. S5). efficiency of dCK overexpression was confirmed by Western blot Notably, CDA expression, the gene responsible for gemcitabine deac- analysis (Fig. 6A). dCK-overexpressing PANC-1 cells led to reduced tivation, was not affected by SR-3029 treatment (Supplementary proliferation and enhanced apoptosis by gemcitabine (Fig. 6B Fig. S4). and 6C). In contrast, the antiproliferative activity of gemcitabine in To confirm that the effects of SR-3029 were due to on-target dCK-knocked down cell lines was diminished compared with cells inhibition of CK1d, PANC-1 cells were engineered to stably treated with scrambled siRNA (Fig. 6D and 6E). Similarly, gemcita- express a doxycycline-inducible shRNA directed against CK1d or bine-induced apoptosis was also reduced in dCK knockdown cells a scrambled control. qRT-PCR and Western blot analyses were (Fig. 6F), consistent with the important role of dCK in mediating the performed to determine the efficiency of the knockdown upon gemcitabine response. Finally, downregulation of dCK rescued the treatment of these cells with doxycycline (Fig. 3C and 3D). synergistic antiproliferative effects produced by SR-3029 plus gemci- Inducible knockdown of CK1d in PANC-1 cells resulted in a tabine combination (Fig. 6G), confirming that one of the mechanisms significant increase of dCK mRNA (Fig. 3E) and protein expres- by which SR-3029 sensitizes cells to gemcitabine treatment is through sion compared with control cells (Fig. 3D), consistent with the upregulation of dCK. effect caused by SR-3029. Importantly, CK1d knockdown resulted Finally, because dCK catalyzes the first phosphorylation step in in inhibition of cell growth survival in both PANC-1 and T24 cells, gemcitabine activation, leading to the formation of the active metab- as measured by a colony formation assay (Supplementary Fig S6), olite dFdCTP, we sought to determine whether the amount of gemci- confirming that CK1d kinase plays a role in PDA and bladder tabine's active metabolite was affected by dCK overexpression. We cancer cell survival. performed mass spectrometry analyses to quantify dFdCTP on cells treated with 1 mmol/L gemcitabine. Our results demonstrated an SR-3029 inhibits PDA and bladder cancer growth in vivo accumulation of active metabolites after treatment with gemcitabine To assess tumor progression after SR-3029 treatment in vivo, (Fig 6H). This accumulation was significantly higher in the dCK- PANC-1 cells that stably express luciferase were orthotopically overexpressing PANC-1 cells. Next, we quantified the amount of implanted into the pancreas of 6-week-old athymic nude mice. Tumor dFdCTP in PANC-1 cells treated with SR-3029 for 24 hours prior to growth was monitored weekly by bioluminescent imaging (Fig. 4A). 6 hours gemcitabine treatment compared with cells that were treated Six weeks after treatment, the mice were sacrificed and their tumors with gemcitabine alone. Our results showed that treatment with SR- excised, measured, and weighed. Treatment with SR-3029 (20 mg/kg i. 3029/gemcitabine tended to increase the dFdCTP in PANC-1 cells p. injection) caused a significant decrease in tumor volume (Fig. 4B) (Fig. 6I). The change in active metabolite did not reach significance; and weight (Fig. 4C). No apparent signs of toxicity or changes in body this could be explained by the fact that cells overexpressing dCK weight were observed in the animals, as reported in our previous exhibited a greater quantity of dCK protein compared with cells treated studies (28). Similar results involving tumor growth inhibition upon with SR-3029. These results further suggest that gemcitabine sensiti- SR-3029 administration were observed in the T24 bladder cancer zation by SR-3029 occurs through an increase in the expression of orthotopic model (Supplementary Fig S7A and S7B). Western blot dCK, which itself tends to accumulate the intracellular amount of analysis from tumor tissues demonstrated a significant increase in gemcitabine's active metabolite (Graphical abstract Fig. 6J). We believe apoptosis in SR-3029–treated tumors compared with vehicle-treated that inhibition of CK1d-induced enhancement of gemcitabine cyto- tumors as shown by the levels of cleaved PARP expression (Fig. 4D). toxicity involves additional mechanisms, which are under investiga- Importantly, the antitumor effect of SR-3029 in vivo was accompanied tion in our laboratory.

1632 Mol Cancer Ther; 19(8) August 2020 MOLECULAR CANCER THERAPEUTICS

Targeting CK1d in Pancreatic and Bladder Cancer

Discussion Gemcitabine (dFdC) is converted into its active metabolite dFdCTP by a series of phosphorylation steps initiated by dCK (11). In this study, PDA, the most common malignancy of the pancreas, is a lethal we confirmed that dCK overexpression was associated with increased disease (7). Although the chemotherapeutic agent gemcitabine, the intracellular accumulation of gemcitabine's active metabolite, cornerstone of neoadjuvant and adjuvant chemotherapy in PDA dFdCTP, and as such, dCK-overexpressing cells exhibit higher sen- since 1997, exerts initial clinical efficacy (9), resistance to treatment sitivity to gemcitabine treatment. To further support the premise that rapidly occurs, limiting its full antitumor effect (41). Pharmacologic CK1d-induced upregulation of dCK is a mechanism of gemcitabine inhibitors of the main oncogenic drivers that are known to be sensitization, we examined the levels of dFdCTP using mass spec- altered in PDA, such as EGFR, RAS, or MEK, have shown little trometry. Notably, dCK overexpression induced accumulation of success in the clinic, either as single agents or in combination with dFdCTP, as did the gemcitabine/SR-3029 combination treatment. chemotherapy, resulting in no or minimal statistically significant These findings are consistent with the observation that dCK upregula- difference in overall and progression-free survival (19, 42, 43). For tion mediated by CK1d inhibition is a molecular mechanism of this reason, there has been a great interest in focusing on emerging gemcitabine sensitivity. strategies of therapeutic intervention. Novel approaches beyond Given the aggressive phenotype of the disease and the adverse side- chemotherapies include manipulating the immune system, target- effects caused by currently available treatments for patients with PDA, ing the tumor microenvironment, or developing molecules against there is an urgent need to identify predictive biomarkers to improve low-prevalence alterations present in PDAs (7, 44). In addition, patient's response to treatment. Analyses of pancreatic cancer expres- targeted therapies able to increase gemcitabine sensitivity by mod- sion data have revealed a statistically significant correlation between a ulating its metabolic pathway have been discovered and shown to be higher overall survival rate and lower expression of CK1d, revealing effective in preclinical studies (45). the therapeutic potential of targeting this gene. Furthermore, the same CK1d is overexpressed in a variety of malignances and its expression patient data revealed a negative correlation between CK1d and dCK is associated with aggressive invasive disease and metastasis, and it expression (Supplementary Fig. S8). Given these preliminary findings, represents an exploitable therapeutic target for cancer treat- further investigation into whether CK1d expression could be used as a ment (21, 23, 28, 29, 36). Notably, CK1d inhibition elicits significant prognostic biomarker of gemcitabine responsiveness in the clinic is antitumor activity in triple-negative breast cancer models by repression highly warranted. of the Wnt/b-catenin pathway (28). Previous studies in PDAC have Prior clinical trials that focused on enhancing the response reported higher intensity staining of CK1d in higher grade, poorly to gemcitabine treatment have not substantially improved the differentiated tumors compared with lower grade tumors (30). overall survival rate of patients with PDA, and the combination Similarly, we observe significant overexpression of CK1d in higher treatments that have demonstrated antitumor activity, unfortunate- grade PDAC, supporting the premise that CK1d expression is ly, have limited use in the clinic due to their high toxicity (4, 49). associated with aggressive disease and that pharmacologic inhibi- Therefore, treatment outcomes of patients with PDA remain tion of CK1d could be exploited as a novel target to inhibit PDA extremely poor. There is a need to explore novel mechanism- tumor growth. In this study, we have used human pancreatic cancer directed strategies to guide therapeutic interventions that will cell lines and an orthotopic mouse model to explore the therapeutic replace or lower the doses of currently available chemotherapies efficacy of targeting CK1d. In addition, we have tested CK1d to improve treatment response. Our preclinical data demonstrate targeting in bladder cancer models, in which gemcitabine is also that our CK1d inhibitor, SR-3029, induces significant antitumor an important choice of therapy (46). activity against PDA and bladder cancer models, and we have CK1d is overexpressed in a subset of human pancreatic and bladder uncovered a new mechanism for the synergistic antitumor effects cancer cell lines and inhibition of CK1d by SR-3029 strongly sensitizes of the combination of gemcitabine and SR-3029 that deserves pancreatic and bladder cancer cell lines to gemcitabine treatment. further investigation in the clinical setting. Interestingly, we reveal that inhibition of CK1d increased the expression of dCK, the rate-limiting enzyme that catalyzes the conversion of Disclosure of Potential Conflicts of Interest fi gemcitabine into its active metabolite. Furthermore, we con rm P. McDonald is a co-founder of and reports receiving a commercial research d that genetic silencing of CK1 also resulted in increased mRNA and grant from Cadw Therapeutics. D. Duckett is a founder of and reports receiving protein levels of dCK, along with reduced pancreatic and bladder acommercialresearchgrantfromCadw Therapeutics, and has ownership cancer cell survival. Notably, preclinical and clinical data have pro- interest in a patent. No potential conflicts of interest were disclosed by the vided strong evidence that high dCK expression is associated with other authors. improved survival after gemcitabine treatment (18, 47, 48), consistent with the observation that upregulation of dCK expression by CK1d Authors’ Contributions inhibition is one of the mechanisms augmenting the antitumor activity Conception and design: F. Vena, S. Bayle, D. Duckett of gemcitabine. Development of methodology: F. Vena, S. Bayle, A. Nieto, S.S. Sansil, D. Duckett Importantly, our in vivo results indicate that SR-3029/gemcitabine Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): F. Vena, S. Bayle, A. Nieto, S.M. Frydman, S.S. Sansil, A. Monastyrskyi treatment effectively delays tumor growth in an orthotopic pancreatic Analysis and interpretation of data (e.g., statistical analysis, biostatistics, mouse model. In addition, tumors from mice treated with SR-3029, computational analysis): F. Vena, S. Bayle, A. Nieto, V. Quereda, M. Aceti, alone or in combination with gemcitabine displayed significant upre- S.M. Frydman, S.S. Sansil, M. Teng, D. Duckett gulation of dCK expression, confirming our mechanistic in vitro Writing, review, and/or revision of the manuscript: F. Vena, S. Bayle, A. Nieto, findings. Understanding the mechanisms by which CK1d controls V. Quereda, S.S. Sansil, P. McDonald, W.R. Roush, M. Teng, D. Duckett the expression of dCK is important to further improve gemcitabine Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): S. Bayle, W. Grant sensitization. Studies to identify the transcriptional master regulators Study supervision: D. Duckett and possible posttranscriptional mechanisms that modulate dCK Other (led the development of SR-3029, the lead CK1d inhibitor used in this expression via CK1d are currently underway in the lab. study): W.R. Roush

AACRJournals.org Mol Cancer Ther; 19(8) August 2020 1633

Vena et al.

Acknowledgments The costs of publication of this article were defrayed in part by the This work was supported by RO1CA223823 and the Translational Research Core payment of page charges. This article must therefore be hereby marked advertisement and the Bioinformatics core at the H. Lee Moffitt Cancer Center & Research Institute, in accordance with 18 U.S.C. Section 1734 solely to indicate an NCI designated Comprehensive Cancer Center (P30-CA076292) as well as a NIH this fact. NCI NRSA postdoctoral fellowship (F32CA200105; to A. Monastyrskyi). Editorial assistance was provided by the Moffitt Cancer Center's Scientific Editing Department by Dr. Paul Fletcher and Daley Drucker. No compensation was given beyond their Received October 17, 2019; revised March 6, 2020; accepted May 14, 2020; regular salaries. We thank Dr. John Cleveland for input and editing of the manuscript. published first May 19, 2020.

References 1. Lindsay MA. Target discovery. Nat Rev Drug Discov 2003;2:831–8. polyps formation via a Wnt/beta-catenin independent mechanism. Int J Cancer 2. Shawver LK, Slamon D, Ullrich A. Smart drugs: tyrosine kinase inhibitors in 2007;120:1005–12. cancer therapy. Cancer Cell 2002;1:117–23. 22. Rodriguez N, Yang J, Hasselblatt K, Liu S, Zhou Y, Rauh-Hain JA, et al. Casein 3. Nevala-Plagemann C, Hidalgo M, Garrido-Laguna I. From state-of-the-art kinase I epsilon interacts with mitochondrial proteins for the growth and survival treatments to novel therapies for advanced-stage pancreatic cancer. Nat Rev of human ovarian cancer cells. EMBO Mol Med 2012;4:952–63. Clin Oncol 2020;17:108–23. 23. Knippschild U, Wolff S, Giamas G, Brockschmidt C, Wittau M, Wurl PU, et al. 4. Conroy T, Desseigne F, Ychou M, Bouche O, Guimbaud R, Becouarn Y, et al. The role of the casein kinase 1 (CK1) family in different signaling pathways FOLFIRINOX versus gemcitabine for metastatic pancreatic cancer. N Engl J Med linked to cancer development. Onkologie 2005;28:508–14. 2011;364:1817–25. 24. Knippschild U, Gocht A, Wolff S, Huber N, Lohler J, Stoter M. The casein kinase 5. Hidalgo M, Cascinu S, Kleeff J, Labianca R, Lohr JM, Neoptolemos J, et al. 1 family: participation in multiple cellular processes in eukaryotes. Cell Signal Addressing the challenges of pancreatic cancer: future directions for improving 2005;17:675–89. outcomes. Pancreatology 2015;15:8–18. 25. Price MA. CKI, there's more than one: casein kinase i family members in wnt and 6. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2018. CA Cancer J Clin 2018;68: hedgehog signaling. Genes Dev 2006;20:399–410. 7–30. 26. Del Valle-Perez B, Arques O, Vinyoles M, de Herreros AG, Dunach M. 7. Kleeff J, Korc M, Apte M, La Vecchia C, Johnson CD, Biankin AV, et al. Coordinated action of CK1 isoforms in canonical wnt signaling. Mol Cell Biol Pancreatic cancer. Nat Rev Dis Primers 2016;2:16022. 2011;31:2877–88. 8. Garrido-Laguna I, Hidalgo M. Pancreatic cancer: from state-of-the-art treat- 27. Schittek B, Sinnberg T. Biological functions of casein kinase 1 isoforms and ments to promising novel therapies. Nat Rev Clin Oncol 2015;12:319–34. putative roles in tumorigenesis. Mol Cancer 2014;13:231. 9. Burris HA 3rd, Moore MJ, Andersen J, Green MR, Rothenberg ML, Modiano 28. Rosenberg LH, Lafitte M, Quereda V, Grant W, Chen W, Bibian M, et al. MR, et al. Improvements in survival and clinical benefit with gemcitabine as first- Therapeutic targeting of casein kinase 1delta in breast cancer. Sci Transl Med line therapy for patients with advanced pancreas cancer: a randomized trial. 2015;7:318ra202. J Clin Oncol 1997;15:2403–13. 29. Knippschild U, Kruger€ M, Richter J, Xu P, García-Reyes B, Peifer C, et al. The 10. Chiaravalli M, Reni M, O'Reilly EM. Pancreatic ductal adenocarcinoma: state-of- CK1 family: contribution to cellular stress response and its role in carcinogenesis. the-art 2017 and new therapeutic strategies. Cancer Treat Rev 2017;60:32–43. Front Oncol 2014;4:96. 11. Mini E, Nobili S, Caciagli B, Landini I, Mazzei T. Cellular pharmacology of 30. Brockschmidt C, Hirner H, Huber N, Eismann T, Hillenbrand A, Giamas G, et al. gemcitabine. Ann Oncol 2006;17:v7–12. Anti-apoptotic and growth-stimulatory functions of CK1 delta and epsilon in 12. Huang P, Plunkett W. Induction of apoptosis by gemcitabine. Semin Oncol 1995; ductal adenocarcinoma of the pancreas are inhibited by IC261 in vitro and 22:19–25. in vitro. Gut 2008;57:799–806. 13. Ciccolini J, Dahan L, Andre N, Evrard A, Duluc M, Blesius A, et al. Cytidine 31. Mazzoldi EL, Pasto A, Ceppelli E, Pilotto G, Barbieri V, Amadori A, et al. Casein deaminase residual activity in serum is a predictive marker of early severe kinase 1 delta regulates cell proliferation, response to chemotherapy and toxicities in adults after gemcitabine-based chemotherapies. J Clin Oncol 2010; migration in human ovarian cancer cells. Front Oncol 2019;9:1211. 28:160–5. 32. Frierson HF Jr, El-Naggar AK, Welsh JB, Sapinoso LM, Su AI, Cheng J, et al. 14. Frese KK, Neesse A, Cook N, Bapiro TE, Lolkema MP, Jodrell DI, et al. nab- Large scale molecular analysis identifies genes with altered expression in salivary Paclitaxel potentiates gemcitabine activity by reducing cytidine deaminase levels adenoid cystic carcinoma. Am J Pathol 2002;161:1315–23. in a mouse model of pancreatic cancer. Cancer Discov 2012;2:260–9. 33. Varghese RT, Young S, Pham L, Liang Y, Pridham KJ, Guo S, et al. Casein kinase 15. Marechal R, Bachet JB, Mackey JR, Dalban C, Demetter P, Graham K, et al. Levels 1 epsilon regulates glioblastoma cell survival. Sci Rep 2018;8:13621. of gemcitabine transport and metabolism proteins predict survival times of 34. Relles D, Sendecki J, Chipitsyna G, Hyslop T, Yeo CJ, Arafat HA. Circadian gene patients treated with gemcitabine for pancreatic adenocarcinoma. Gastroenter- expression and clinicopathologic correlates in pancreatic cancer. J Gastrointest ology 2012;143:664–74.e6. Surg 2013;17:443–50. 16. Hammam K, Saez-Ayala M, Rebuffet E, Gros L, Lopez S, Hajem B, et al. Dual 35. Richter J, Ullah K, Xu P, Alscher V, Blatz A, Peifer C, et al. Effects of altered protein kinase and nucleoside kinase modulators for rationally designed poly- expression and activity levels of CK1delta and varepsilon on tumor growth and pharmacology. Nat Commun 2017;8:1420. survival of colorectal cancer patients. Int J Cancer 2015;136:2799–810. 17. Kroep JR, Loves WJ, van der Wilt CL, Alvarez E, Talianidis I, Boven E, et al. 36. Monastyrskyi A, Nilchan N, Quereda V,NoguchiY,RuizC,GrantW,etal. Pretreatment deoxycytidine kinase levels predict in vivo gemcitabine sensitivity. Development of dual casein kinase 1delta/1epsilon (CK1delta/epsilon) Mol Cancer Ther 2002;1:371–6. inhibitors for treatment of breast cancer. Bioorg Med Chem 2018;26: 18. Sebastiani V, Ricci F, Rubio-Viqueira B, Kulesza P, Yeo CJ, Hidalgo M, et al. 590–602. Immunohistochemical and genetic evaluation of deoxycytidine kinase in pan- 37. Chou TC. Drug combination studies and their synergy quantification using the creatic cancer: relationship to molecular mechanisms of gemcitabine resistance Chou-Talalay method. Cancer Res 2010;70:440–6. and survival. Clin Cancer Res 2006;12:2492–7. 38. Nishi R, Yamauchi T, Ueda T. A new, simple method for quantifying gemcitabine 19. Moore MJ, Goldstein D, Hamm J, Figer A, Hecht JR, Gallinger S, et al. Erlotinib triphosphate in cancer cells using isocratic high-performance liquid chroma- plus gemcitabine compared with gemcitabine alone in patients with advanced tography. Cancer Sci 2006;97:1274–8. pancreatic cancer: a phase III trial of the National Cancer Institute of Canada 39. Huang H, Acquaviva L, Berry V, Bregman H, Chakka N, O'Connor A, et al. Clinical Trials Group. J Clin Oncol 2007;25:1960–6. Structure-based design of potent and selective ck1gamma inhibitors. ACS Med 20. Orth M, Metzger P, Gerum S, Mayerle J, Schneider G, Belka C, et al. Pancreatic Chem Lett 2012;3:1059–64. ductal adenocarcinoma: biological hallmarks, current status, and future 40. Fryer RA, Barlett B, Galustian C, Dalgleish AG. Mechanisms underlying perspectives of combined modality treatment approaches. Radiat Oncol 2019; gemcitabine resistance in pancreatic cancer and sensitisation by the iMiD 14:141. lenalidomide. Anticancer Res 2011;31:3747–56. 21. Tsai IC, Woolf M, Neklason DW, Branford WW, Yost HJ, Burt RW, et al. 41. Kim MP, Gallick GE. Gemcitabine resistance in pancreatic cancer: picking the Disease-associated casein kinase i delta mutation may promote adenomatous key players. Clin Cancer Res 2008;14:1284–5.

1634 Mol Cancer Ther; 19(8) August 2020 MOLECULAR CANCER THERAPEUTICS

Targeting CK1d in Pancreatic and Bladder Cancer

42. Goldstein D, El-Maraghi RH, Hammel P, Heinemann V, Kunzmann V, Sastre J, 46. Kerr M, Scott HE, Groselj B, Stratford MR, Karaszi K, Sharma NL, et al. et al. nab-Paclitaxel plus gemcitabine for metastatic pancreatic cancer: long-term Deoxycytidine kinase expression underpins response to gemcitabine in bladder survival from a phase III trial. J Natl Cancer Inst 2015;107:dju413. cancer. Clin Cancer Res 2014;20:5435–45. 43. Ottaiano A, Capozzi M, De Divitiis C, De Stefano A, Botti G, Avallone A, et al. 47. Xiong J, Altaf K, Ke N, Wang Y, Tang J, Tan C, et al. dCK expression and gene Gemcitabine monotherapy versus gemcitabine plus targeted therapy in polymorphism with gemcitabine chemosensitivity in patients with pancreatic advanced pancreatic cancer: a meta-analysis of randomized phase III trials. ductal adenocarcinoma: a strobe-compliant observational study. Medicine 2016; Acta Oncol 2017;56:377–83. 95:e2936. 44. Teague A, Lim KH, Wang-Gillam A. Advanced pancreatic adenocarcinoma: a 48. Ashida R, Nakata B, Shigekawa M, Mizuno N, Sawaki A, Hirakawa K, et al. review of current treatment strategies and developing therapies. Ther Adv Med Gemcitabine sensitivity-related mRNA expression in endoscopic ultrasound- Oncol 2015;7:68–84. guided ﬁne-needle aspiration biopsy of unresectable pancreatic cancer. J Exp 45. Vena F, Li Causi E, Rodriguez-Justo M, Goodstal S, Hagemann T, Hartley JA, Clin Cancer Res 2009;28:83. et al. The MEK1/2 inhibitor pimasertib enhances gemcitabine efﬁcacy in 49. Ryan DP, Kulke MH, Fuchs CS, Grossbard ML, Grossman SR, Morgan JA, et al. pancreatic cancer models by altering ribonucleotide reductase subunit-1 A phase II study of gemcitabine and docetaxel in patients with metastatic (RRM1). Clin Cancer Res 2015;21:5563–77. pancreatic carcinoma. Cancer 2002;94:97–103.

AACRJournals.org Mol Cancer Ther; 19(8) August 2020 1635

Targeting Casein Kinase 1 Delta Sensitizes Pancreatic and Bladder Cancer Cells to Gemcitabine Treatment by Upregulating Deoxycytidine Kinase

Francesca Vena, Simon Bayle, Ainhoa Nieto, et al.

Mol Cancer Ther 2020;19:1623-1635. Published OnlineFirst May 19, 2020.

Updated version Access the most recent version of this article at: doi:10.1158/1535-7163.MCT-19-0997

Supplementary Access the most recent supplemental material at: Material http://mct.aacrjournals.org/content/suppl/2020/05/19/1535-7163.MCT-19-0997.DC1

Cited articles This article cites 48 articles, 16 of which you can access for free at: http://mct.aacrjournals.org/content/19/8/1623.full#ref-list-1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mct.aacrjournals.org/content/19/8/1623. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.