DOCSLIB.ORG

Autosomal Dominant Distal Hereditary Motor Neuropathy Type II: a Korean Family Without Sequence Variation in HSPB1 and HSPB8

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Autosomal Dominant Distal Hereditary Motor Neuropathy Type II: a Korean Family Without Sequence Variation in HSPB1 and HSPB8 Neurology Asia 2012; 17(3) : 235 – 237 Autosomal dominant distal hereditary motor neuropathy type II: a Korean family without sequence variation in HSPB1 and HSPB8 1Sang-Soo Lee, 1So-Young Moon, 1Ji-Seon Kim, 2Chang-Seok Ki 1Department of Neurology, Chungbuk National University College of Medicine, Chungbuk; 2Department of Laboratory Medicine and Genetics, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea Abstract Distal hereditary motor neuropathy (dHMN) is a heterogeneous group of disorders characterized by weakness and wasting of distal limb muscles without overt sensory abnormalities. Recently, autosomal dominant dHMN has been mapped to chromosome 12q24 and 7q11-q21. We present a family with autosomal dominant adult onset dHMN type II consisting of fi ve affected individuals spanning three generations. They developed mild symmetrical distal lower limb weakness, muscle wasting, and severe foot deformity after the third decade. Genetic analysis showed no support for linkage to chromosome 12q24 and 7q11-q21 in our family. These fi ndings further demonstrate a genetic heterogeneity within dHMN type II. INTRODUCTION nerve involvement and no cerebellar or pyramidal signs. The weakness and atrophy only affected Distal hereditary motor neuropathy (dHMN), distal lower limbs. The weakness of ankle also called the spinal type of Charcot-Marie- dorsifl exion was modest, but the pes cavus was Tooth disease or distal spinal muscular atrophy, prominent. Sensory and autonomic symptoms represents a rare and exclusive motor neuropathy were absent and deep tendon refl exes were normal. of clinically and genetically heterogeneous Nerve conduction studies showed normal motor conditions caused by degeneration of motor and sensory conduction with slightly decreased neurons leading to distal muscle weakness and amplitudes of compound muscle action potentials. muscle wasting. A classifi cation in seven types The amplitudes of sensory action potentials were based upon mode of inheritance, age at onset, and normal. Electromyography in the tibialis anterior, prevalent involvement of upper or lower limbs has gastrocnemius, and extensor digitorum brevis been made.1 Out of seven types, dHMN type IIA muscles disclosed high amplitude, long duration, is caused by mutation in the gene encoding heat- and polyphasic motor unit potentials without shock 22-kD protein-8 (HSPB8) on chromosome active spontaneous activities, which are indicative 12q24 and type IIB is caused by mutation in of longstanding neuropathy. Serum creatine kinase the gene encoding heat-shock 27-kD protein-1 was not elevated. We found 5 affected members (HSPB1) on chromosome 7q11-q21.2-5 in his family, where the phenotype segregates We report a Korean family with autosomal as an autosomal dominant trait (Figure 1). The dominant dHMN type II in which the disease sister of the proband also showed prominent pes started after the age of 20 years. Gene testing cavus and leg muscle atrophy without upper limb had excluded mutation in HSPB1, HSPB8 and involvement. The son of the proband had only superoxide dismutase genes. minimal distal limb weakness without atrophy and electromyography showed mild neurogenic CASE REPORT changes. A sural nerve specimen for histological A 46-year-old man (proband) visited our clinic analysis was not taken because of normal sensory because of frequent stumbling along the street. nerve action potentials and conduction velocities. Neurological symptoms started around his early DNA was isolated from the peripheral blood of thirties. He denied diabetes, chronic alcoholism, the two affected patients and unaffected members or drug exposure history. There was no cranial using standard methods. The HSPB1 gene for Address correspondence to: Sang-Soo Lee MD, Department of Neurology, Chungbuk National University College of Medicine, 52 Naesudong-ro, Cheongju- si, Chungbuk, 361-711, Korea. Phone: 82-43-269-6336, Fax: 82-43-275-7591, E-mail: [email protected] 235 Neurology Asia September 2012 Figure 1. Pedigree of a Korean family with distal hereditary motor neuropathy type II Symbols: squares, males; circles, females; fi lled, affected; white, normal; slashes, deceased; arrow, proband. 7q11 and the HSPB8 for 12q24 loci, that are family. Taken together with available information, associated with different type of dHMN, were in all patients, the weakness and atrophy started screened by direct sequencing, but no mutation in leg or foot muscles between 20 and early was found. All genes were sequenced on their thirty years of age. The weakness was confi ned all coding exons and exon-intron boundaries. A to the lower limbs in spite of the lapse of time. molecular analysis for mutation in the superoxide The proband of this family, who is 49 years old dismutase gene was also performed. There was now, has neither symptom nor sign of upper limb no mutation in the tested genes. involvement. The youngest patient showed only some diffi culties in heel walking. They did not DISCUSSION show any involvement of the CNS, including pyramidal tract signs or hyporefl exia even several The diagnosis of dHMN in this family is years after symptom onset, while on the other supported by the absence of sensory symptoms hand the pes cavus deformities were prominent. and of sensory involvement on nerve conduction However, there were no patients who became studies. Additionally, a distal myopathic process wheelchair dependent in the latest stage of the was ruled out by the chronic neurogenic changes disease. Compared to our family, arefl exia, in the needle electromyography and the presence involvement of upper limbs, and absence of pes of pes cavus which is characteristic of Charcot- cavus were not uncommon in the Belgian family, Marie-Tooth disease in the patients with full- so called the prototype of dHMN type II.2 The blown symptoms. These fi ndings are in keeping functional disabilities in our family are not more nd with the guidelines proposed by the 2 Workshop severe than in most CMT1A families nor the 6 of European Charcot-Marie-Tooth Consortium. Belgian family. Affected patients in the Russian Furthermore, these patients may be distinguished family, who were reported to have a mutation with certainty from Charcot-Marie-Tooth type I in the gene encoding 27-kDa small HSPB1(also and II by normal sensory conduction velocities called HSP27), had depressed or absent refl exes and normal sensory action potentials. Given the and distal sensory abnormalities.3 Other Korean clinical features, electrophysiological fi ndings, and patients also showed upper limb involvement and inheritance pattern of the disease, these patients arefl exia, but on the other hand they did not have must have dHMN type II. However, establishing pes cavus at all.5 The phenotype in our family is the onset of a very slowly progressive disease is strictly compatible with the original description often diffi cult. In this family, the youngest patient of dHMN type II by Harding1 and is similar to showed a slight diffi culty with heel walking on the phenotype reported in Japan as a sporadic clinical examination and mild neurogenic changes case with HSP27 mutation.4 The only difference on electromyography. Regarding the onset of is younger age at onset in the Japanese patient. symptoms, we agree that the division into type It has now become evident that some dHMN I and II of autosomal dHMN with onset in the subtypes have unusual features or associated 7 lower limbs is somewhat artifi cial. symptoms. To what extent the involvement is Several clinical features are unique in this always exclusively motor system is still a matter 236 of debate since some minor sensory abnormalities 2. Irobi J, Van Impe K, Seeman P, et al. Hot spot residue have been described. Although these features in small heat-shock protein 22 causes distal motor and signs often show intra-familial variability, neuropathy. Nat Genet 2004; 36:597-601. 3. Evgrafov OV, Mersiyanova I, Irobi J, et al. Mutant they represent essential hallmarks of particular small heat-shock protein 27 causes axonal Charcot- dHMN subtypes. Therefore, the study of additional Marie-Tooth disease and distal hereditary motor patients in a family may be useful to clearly defi ne neuropathy. Nat Genet 2004; 36:602-6. the clinical dHMN subtype. Recent molecular 4. Kijima K, Numakura C, Goto T, et al. Small heat genetic studies have confi rmed the accuracy of shock protein 27 mutation in a Japanese patient with this classifi cation by showing that the clinical distal hereditary motor neuropathy. J Hum Genet complexity has indeed a genetic basis. Even 2005; 50:473-6. 5. Chung KW, Kim S, Cho SY, et al. Distal hereditary clinically homogenous dHMN subtypes turn motor neuropathy in Korean patients with a small out to be genetically heterogeneous. Although heat shock protein 27 mutation. Exp Mol Med 2008; we did not fi nd any mutations of alleged heat 40:304-12. shock protein genes in this family, there is 6. De Jonghe P, Timmerman V, Van Broeckhoven C. some genetic possibilities. A change in gene 2nd workshop of the European CMT Consortium: rd copy number, gene rearrangement such as large 53 ENMC International workshop on classifi cation deletion/duplication, mutation in promoter gene and diagnostic guidelines for Charcot-Marie-Tooth type2 (CMT-HMSN II) and distal hereditary motor or deep intronic mutation rather than a known neuropathy (distal HMN-spinal CMT). Neuromuscul sequence variation could be suggested. A direct Disord 1998; 8:426-31. sequencing of the coding exon cannot fi nd these 7. De Angelis MV, Gatta V, Stuppia L, Passamonti L, variations. Another possibility is that a gene of Gambi D, Uncini A. Autosomal dominant distal spinal this family is not linked to 12q24 and 7q11-q21. muscular atrophy: an Italian family not linked to It remains to be established how frequent these 12q24 and 7p14. Neuromuscul Disord 2002; 12:26-30. 8. Passamonti L, Muglia M, Magariello A, et al.
Load more

Recommended publications
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals
    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
    [Show full text]
  • Inherited Neuropathies
    407 Inherited Neuropathies Vera Fridman, MD1 M. M. Reilly, MD, FRCP, FRCPI2 1 Department of Neurology, Neuromuscular Diagnostic Center, Address for correspondence Vera Fridman, MD, Neuromuscular Massachusetts General Hospital, Boston, Massachusetts Diagnostic Center, Massachusetts General Hospital, Boston, 2 MRC Centre for Neuromuscular Diseases, UCL Institute of Neurology Massachusetts, 165 Cambridge St. Boston, MA 02114 and The National Hospital for Neurology and Neurosurgery, Queen (e-mail: [email protected]). Square, London, United Kingdom Semin Neurol 2015;35:407–423. Abstract Hereditary neuropathies (HNs) are among the most common inherited neurologic Keywords disorders and are diverse both clinically and genetically. Recent genetic advances have ► hereditary contributed to a rapid expansion of identifiable causes of HN and have broadened the neuropathy phenotypic spectrum associated with many of the causative mutations. The underlying ► Charcot-Marie-Tooth molecular pathways of disease have also been better delineated, leading to the promise disease for potential treatments. This chapter reviews the clinical and biological aspects of the ► hereditary sensory common causes of HN and addresses the challenges of approaching the diagnostic and motor workup of these conditions in a rapidly evolving genetic landscape. neuropathy ► hereditary sensory and autonomic neuropathy Hereditary neuropathies (HN) are among the most common Select forms of HN also involve cranial nerves and respiratory inherited neurologic diseases, with a prevalence of 1 in 2,500 function. Nevertheless, in the majority of patients with HN individuals.1,2 They encompass a clinically heterogeneous set there is no shortening of life expectancy. of disorders and vary greatly in severity, spanning a spectrum Historically, hereditary neuropathies have been classified from mildly symptomatic forms to those resulting in severe based on the primary site of nerve pathology (myelin vs.
    [Show full text]
  • Prognostic Significance of Autophagy-Relevant Gene Markers in Colorectal Cancer
    ORIGINAL RESEARCH published: 15 April 2021 doi: 10.3389/fonc.2021.566539 Prognostic Significance of Autophagy-Relevant Gene Markers in Colorectal Cancer Qinglian He 1, Ziqi Li 1, Jinbao Yin 1, Yuling Li 2, Yuting Yin 1, Xue Lei 1 and Wei Zhu 1* 1 Department of Pathology, Guangdong Medical University, Dongguan, China, 2 Department of Pathology, Dongguan People’s Hospital, Southern Medical University, Dongguan, China Background: Colorectal cancer (CRC) is a common malignant solid tumor with an extremely low survival rate after relapse. Previous investigations have shown that autophagy possesses a crucial function in tumors. However, there is no consensus on the value of autophagy-associated genes in predicting the prognosis of CRC patients. Edited by: This work screens autophagy-related markers and signaling pathways that may Fenglin Liu, Fudan University, China participate in the development of CRC, and establishes a prognostic model of CRC Reviewed by: based on autophagy-associated genes. Brian M. Olson, Emory University, United States Methods: Gene transcripts from the TCGA database and autophagy-associated gene Zhengzhi Zou, data from the GeneCards database were used to obtain expression levels of autophagy- South China Normal University, China associated genes, followed by Wilcox tests to screen for autophagy-related differentially Faqing Tian, Longgang District People's expressed genes. Then, 11 key autophagy-associated genes were identified through Hospital of Shenzhen, China univariate and multivariate Cox proportional hazard regression analysis and used to Yibing Chen, Zhengzhou University, China establish prognostic models. Additionally, immunohistochemical and CRC cell line data Jian Tu, were used to evaluate the results of our three autophagy-associated genes EPHB2, University of South China, China NOL3, and SNAI1 in TCGA.
    [Show full text]
  • HSPB8 Gene Heat Shock Protein Family B (Small) Member 8
    HSPB8 gene heat shock protein family B (small) member 8 Normal Function The HSPB8 gene provides instructions for making a protein called heat shock protein beta-8 (also called heat shock protein 22). This protein is a member of the heat shock protein family, which helps protect cells under adverse conditions such as infection, inflammation, exposure to toxins, elevated temperature, injury, and disease. Heat shock proteins block signals that lead to programmed cell death. In addition, they appear to be involved in activities such as cell movement (motility), stabilizing the cell's structural framework (the cytoskeleton), folding and stabilizing newly produced proteins, and repairing damaged proteins. Heat shock proteins also appear to play a role in the tensing of muscle fibers (muscle contraction). Heat shock protein beta-8 is found in cells throughout the body and is particularly abundant in nerve cells. While its function is not well understood, it seems to interact with a related protein called heat shock protein beta-1, produced from the HSPB1 gene. In nerve cells, heat shock protein beta-1 helps to organize a network of molecular threads called neurofilaments that maintain the diameter of specialized extensions called axons. Maintaining proper axon diameter is essential for the efficient transmission of nerve impulses. The specific role that heat shock protein beta-8 plays in axons is unclear. Health Conditions Related to Genetic Changes Charcot-Marie-Tooth disease MedlinePlus Genetics provides information about Charcot-Marie-Tooth disease Distal hereditary motor neuropathy, type II Researchers have identified at least five HSPB8 gene mutations that cause a condition called distal hereditary motor neuropathy, type II.
    [Show full text]
  • Autosomal Dominant Late-Onset Spinal Motor Neuronopathy Is Linked to a New Locus on Chromosome 22Q11.2-Q13.2
    European Journal of Human Genetics (2012) 20, 1193–1196 & 2012 Macmillan Publishers Limited All rights reserved 1018-4813/12 www.nature.com/ejhg SHORT REPORT Autosomal dominant late-onset spinal motor neuronopathy is linked to a new locus on chromosome 22q11.2-q13.2 Sini Penttila¨*,1, Manu Jokela2, Peter Hackman3, Anna Maija Saukkonen4, Jari Toivanen4 and Bjarne Udd1,3,5 Spinal muscular atrophies (SMAs) are hereditary disorders characterized by degeneration of lower motor neurons. Different SMA types are clinically and genetically heterogeneous and many of them show significant phenotypic overlap. We recently described the clinical phenotype of a new disease in two Finnish families with a unique autosomal dominant late-onset lower motor neuronopathy. The studied families did not show linkage to any known locus of hereditary motor neuron disease and thus seemed to represent a new disease entity. For this study, we recruited two more family members and performed a more thorough genome-wide scan. We obtained significant linkage on chromosome 22q, maximum LOD score being 3.43 at marker D22S315. The linked area is defined by flanking markers D22S686 and D22S276, comprising 18.9 Mb. The region harbours 402 genes, none of which is previously known to be associated with SMAs. This study confirms that the disease in these two families is a genetically distinct entity and also provides evidence for a founder mutation segregating in both pedigrees. European Journal of Human Genetics (2012) 20, 1193–1196; doi:10.1038/ejhg.2012.76; published online 25 April 2012 Keywords: motor neuron disease; spinal muscular atrophy; linkage analysis INTRODUCTION LMNA16 and TRPV417 or to be linked to 3q13.118 or 14q32.19 Spinal muscular atrophies (SMAs) are hereditary disorders character- Mutations in many of these genes cause several allelic disorders.
    [Show full text]
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
    [Show full text]
  • Small Heat Shock Proteins and Neurodegeneration: Recent Developments
    BioMol Concepts 2018; 9: 94–102 Review Open Access Nikos Kourtis, Nektarios Tavernarakis* Small heat shock proteins and neurodegeneration: recent developments Journal xyz 2017; 1 (2): 122–135 https://doi.org/10.1515/bmc-2018-0009 received April 18, 2018; accepted June 25, 2018. (proteostasis). An evolutionary conserved cytoprotective The First Decade (1964-1972) mechanism is the heat shock response pathway [1, 2]. Abstract: Members of the small heat shock protein (sHSP) Prominent effectors of the heat shock response pathway family are molecularResearch chaperones Article with a critical role in the are molecular chaperones, which comprise of several maintenance of cellular homeostasis under unfavorable families categorized according to their molecular weight: conditions. MaxThe Musterman,chaperone properties Paul Placeholder of sHSPs HSP10, HSP40, HSP60, HSP70, HSP90, HSP100 and sHSP. prevent protein aggregation, and sHSP deregulation Chaperones are required for the maintenance of the native underlies theWhat pathology Is of So several Different diseases, including About structure of cellular proteins, protein translocation, neurodegenerativeNeuroenhancement? disorders. Recent evidence suggests assembly of functional protein complexes and protein that the clientele of sHSPs is broad, and the mechanisms of degradation. sHSPs are ATP-independent molecular sHSP-mediatedWas neuroprotection ist so andersdiverse. Nonetheless, am Neuroenhancement? the chaperones characterized by a small molecular mass crosstalk of sHSPs with the neurodegeneration-promoting ranging from 12 to 42 kDa [3] and a highly conserved signaling pathwaysPharmacological remains poorly and understood. Mental Here, Self-transformation we domain, called in the Ethic alpha-crystallin domain [4]. sHSPs survey recentComparison findings on the role and regulation of sHSPs display a dynamic behavior, and can exist in the form in neurodegenerativePharmakologische diseases.
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • Exome Sequencing in Amyotrophic Lateral Sclerosis Implicates a Novel Gene, DNAJC7, Encoding a Heat-Shock Protein
    ARTICLES https://doi.org/10.1038/s41593-019-0530-0 Corrected: Publisher Correction Exome sequencing in amyotrophic lateral sclerosis implicates a novel gene, DNAJC7, encoding a heat-shock protein Sali M. K. Farhan 1,2,3*, Daniel P. Howrigan 1,2,3, Liam E. Abbott1,2,3, Joseph R. Klim 4, Simon D. Topp 5, Andrea E. Byrnes1,2,3, Claire Churchhouse1,2,3, Hemali Phatnani6, Bradley N. Smith5, Evadnie Rampersaud7, Gang Wu 7, Joanne Wuu8, Aleksey Shatunov9, Alfredo Iacoangeli9,10, Ahmad Al Khleifat9, Daniel A. Mordes4, Sulagna Ghosh3,4, ALSGENS Consortium27, FALS Consortium27, Project MinE Consortium27, CReATe Consortium27, Kevin Eggan 3,4, Rosa Rademakers11, Jacob L. McCauley 12,13, Rebecca Schüle14, Stephan Züchner12,13, Michael Benatar8, J. Paul Taylor15,16, Michael Nalls17,18, Marc Gotkine19, Pamela J. Shaw20, Karen E. Morrison21, Ammar Al-Chalabi 9,22, Bryan Traynor17,23, Christopher E. Shaw5,24, David B. Goldstein 25, Matthew B. Harms26, Mark J. Daly 1,2,3 and Benjamin M. Neale 1,2,3* To discover novel genes underlying amyotrophic lateral sclerosis (ALS), we aggregated exomes from 3,864 cases and 7,839 ancestry-matched controls. We observed a significant excess of rare protein-truncating variants among ALS cases, and these variants were concentrated in constrained genes. Through gene level analyses, we replicated known ALS genes including SOD1, NEK1 and FUS. We also observed multiple distinct protein-truncating variants in a highly constrained gene, DNAJC7. The signal in DNAJC7 exceeded genome-wide significance, and immunoblotting assays showed depletion of DNAJC7 protein in fibroblasts in a patient with ALS carrying the p.Arg156Ter variant.
    [Show full text]
  • The Small Heat Shock Protein B8 (HSPB8) Modulates Proliferation and Migration of Breast Cancer Cells
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 6), pp: 10400-10415 Research Paper The small heat shock protein B8 (HSPB8) modulates proliferation and migration of breast cancer cells Margherita Piccolella1, Valeria Crippa1,2, Riccardo Cristofani1, Paola Rusmini1, Mariarita Galbiati1, Maria Elena Cicardi1, Marco Meroni1, Nicola Ferri3, Federica F. Morelli4, Serena Carra4, Elio Messi1,*, Angelo Poletti1,* 1Dipartimento di Scienze Farmacologiche e Biomolecolari (DiSFeB), Centro di Eccellenza sulle Malattie Neurodegenerative, Università degli Studi di Milano, Milano, Italy 2C. Mondino National Neurological Institute, Pavia, Italy 3Dipartimento di Scienze del Farmaco, Università degli Studi di Padova, Padova, Italy 4Dipartimento di Scienze Biomediche, Metaboliche e Neuroscienze, Università di Modena e Reggio Emilia, Modena, Italy *These authors have contributed equally to this work Correspondence to: Angelo Poletti, email: [email protected] Keywords: breast cancer, HSPB8, proliferation, migration, MCF-7 cells Received: June 30, 2016 Accepted: December 12, 2016 Published: January 02, 2017 ABSTRACT Breast cancer (BC) is one of the major causes of cancer death in women and is closely related to hormonal dysregulation. Estrogen receptor (ER)-positive BCs are generally treated with anti hormone therapy using antiestrogens or aromatase inhibitors. However, BC cells may become resistant to endocrine therapy, a process facilitated by autophagy, which may either promote or suppress tumor expansion. The autophagy facilitator HSPB8 has been found overexpressed in some BC. Here we found that HSPB8 is highly expressed and differentially modulated by natural or synthetic selective ER modulators (SERMs), in the triple-positive hormone-sensitive BC (MCF-7) cells, but not in triple-negative MDA-MB-231 BC cells.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name heat shock protein 8 Gene Symbol Hspb8 Organism Mouse Gene Summary Description Not Available Gene Aliases AU018630, AW413033, Cryac, D5Ucla4, E2IG1, H11, H11K, HSP20-like, HSP22 RefSeq Accession No. NC_000071.6, NT_078458.7 UniGene ID Mm.21549 Ensembl Gene ID ENSMUSG00000041548 Entrez Gene ID 80888 Assay Information Unique Assay ID qMmuCIP0030083 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSMUST00000036991 Amplicon Context Sequence TGTATTTTCTTGGTGAAGTTCTTGGAGACAATCCCACCTTCCTGCTGCTTCTCTTC ATGTTTGCCTGAAACTTCCACGTATCCATCCTTGGTCTTTACCATCAGCTC Amplicon Length (bp) 77 Chromosome Location 5:116415407-116422155 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 97 R2 0.9997 cDNA Cq 21.61 cDNA Tm (Celsius) 80.5 gDNA Cq 39.65 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Hspb8, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • The Heterooligomerization of Human Small Heat Shock Proteins Is Controlled by Conserved Motif Located in the N-Terminal Domain
    International Journal of Molecular Sciences Article The Heterooligomerization of Human Small Heat Shock Proteins Is Controlled by Conserved Motif Located in the N-Terminal Domain Vladislav M. Shatov 1, Sergei V. Strelkov 2 and Nikolai B. Gusev 1,* 1 Department of Biochemistry, School of Biology, Moscow State University, Moscow 119991, Russian; [email protected] 2 Laboratory for Biocrystallography, Department of Pharmaceutical and Pharmacological Sciences, KU Leuven, 3000 Leuven, Belgium; [email protected] * Correspondence: [email protected] Received: 19 May 2020; Accepted: 12 June 2020; Published: 15 June 2020 Abstract: Ubiquitously expressed human small heat shock proteins (sHsps) HspB1, HspB5, HspB6 and HspB8 contain a conserved motif (S/G)RLFD in their N-terminal domain. For each of them, we prepared mutants with a replacement of the conserved R by A (R/A mutants) and a complete deletion of the pentapeptide (D mutants) and analyzed their heterooligomerization with other wild-type (WT) human sHsps. We found that WT HspB1 and HspB5 formed heterooligomers with HspB6 only upon heating. In contrast, both HspB1 mutants interacted with WT HspB6 even at low temperature. HspB1/HspB6 heterooligomers revealed a broad size distribution with equimolar ratio suggestive of heterodimers as building blocks, while HspB5/HspB6 heterooligomers had an approximate 2:1 ratio. In contrast, R/A or D mutants of HspB6, when mixed with either HspB1 or HspB5, resulted in heterooligomers with a highly variable molar ratio and a decreased HspB6 incorporation. No heterooligomerization of HspB8 or its mutants with either HspB1 or HspB5 could be detected. Finally, R/A or D mutations had no effect on heterooligomerization of HspB1 and HspB5 as analyzed by ion exchange chromatography.
    [Show full text]