DOCSLIB.ORG

Small Heat Shock Proteins and Neurodegeneration: Recent Developments

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Small Heat Shock Proteins and Neurodegeneration: Recent Developments BioMol Concepts 2018; 9: 94–102 Review Open Access Nikos Kourtis, Nektarios Tavernarakis* Small heat shock proteins and neurodegeneration: recent developments Journal xyz 2017; 1 (2): 122–135 https://doi.org/10.1515/bmc-2018-0009 received April 18, 2018; accepted June 25, 2018. (proteostasis). An evolutionary conserved cytoprotective The First Decade (1964-1972) mechanism is the heat shock response pathway [1, 2]. Abstract: Members of the small heat shock protein (sHSP) Prominent effectors of the heat shock response pathway family are molecularResearch chaperones Article with a critical role in the are molecular chaperones, which comprise of several maintenance of cellular homeostasis under unfavorable families categorized according to their molecular weight: conditions. MaxThe Musterman,chaperone properties Paul Placeholder of sHSPs HSP10, HSP40, HSP60, HSP70, HSP90, HSP100 and sHSP. prevent protein aggregation, and sHSP deregulation Chaperones are required for the maintenance of the native underlies theWhat pathology Is of So several Different diseases, including About structure of cellular proteins, protein translocation, neurodegenerativeNeuroenhancement? disorders. Recent evidence suggests assembly of functional protein complexes and protein that the clientele of sHSPs is broad, and the mechanisms of degradation. sHSPs are ATP-independent molecular sHSP-mediatedWas neuroprotection ist so andersdiverse. Nonetheless, am Neuroenhancement? the chaperones characterized by a small molecular mass crosstalk of sHSPs with the neurodegeneration-promoting ranging from 12 to 42 kDa [3] and a highly conserved signaling pathwaysPharmacological remains poorly and understood. Mental Here, Self-transformation we domain, called in the Ethic alpha-crystallin domain [4]. sHSPs survey recentComparison findings on the role and regulation of sHSPs display a dynamic behavior, and can exist in the form in neurodegenerativePharmakologische diseases. und mentale Selbstveränderungof monomers, dimers im and large multimeric complexes, exhibiting variability in subunit numbers (12 to >48) [5-7]. ethischen Vergleich Keywords: Alzheimer’s disease; Apoptosis; Heat sHSPs have a wide clientele and sHSP dysfunction shock response; Huntington’s disease; Inflammation; results in a broad range of pathologies, including https://doi.org/10.1515/xyz-2017-0010 Neurodegenerative pathologies; Parkinson’s disease; ischemia, myopathies, motor neuron disease, diabetes received February 9, 2013; accepted March 25, 2013; published online July 12, 2014 Protein aggregation; Proteostasis; sHSP. and cataracts [8-11]. The main function of sHSPs is Abstract: In the concept of the aesthetic formationto bind of knowledge to hydrophobic and its asregions soon of aggregation-prone as possible and success-oriented application, misfoldedinsights and proteins profits withoutand prevent the the formation of Introductionreference to the arguments developed around 1900.insoluble The mainaggregates investigation [12]. However,also association with includes the period between the entry into force andsHSPs the does presentation not lead in to its substrate current refolding to the native Organisms andversion. cells Theirare constantly function as exposed part of theto variousliterary portrayalstate [13-15]. and narrative Therefore, technique. the sHSP/substrate complexes act types of stress, such as environmental, metabolic or as intermediates that are further processed by the HSP70 Keywords: Function, transmission, investigation, principal, period pathophysiological stress. These disturbances result in and HSP90 chaperones [16-18]. Here, we highlight recent loss of integrity of the proteome, cellular dysfunction findings regarding the interplay between sHSP function Dedicated to Paul Placeholder and cell death. In the course of evolution, elaborate and neurodegeneration. molecular mechanisms were invented to counteract the detrimental effect of extrinsic and intrinsic stress factors on protein function,1 Studies and preserve and Investigationsprotein homeostasis The role of sHSPs in neurodegene- The main investigation also includes the periodrative between thepathologies entry into force and the presentation in its current version. Their function as part of the literary por- *Corresponding author: Nektarios Tavernarakis, Institute of trayal and narrative technique. Many devastating neurological disorders, such as Molecular Biology and Biotechnology, Foundation for Research and Technology Hellas, Heraklion 70013, Crete, Greece; Department of Alzheimer’s, Parkinson’s, Creutzfeldt Jacobs and Basic Sciences, Faculty of Medicine, University of Crete, Heraklion amyotrophic lateral sclerosis (ALS), are characterized 71003, Crete, Greece,*Max Musterman:E-mail: [email protected] Institute of Marine Biology, National Taiwanby aggregation Ocean University, and 2 Pei-Ningprecipitation of misfolded proteins. Nikos Kourtis: DepartmentRoad Keelung of Pathology20224, Taiwan and Laura(R.O.C), and e-mail: Isaac [email protected] are key players of the proteostasis network, and Perlmutter CancerPaul Center, Placeholder: NYU School Institute of Medicine, of Marine New Biology, York, NationalNY Taiwantheir Oceanability University, to interact 2 Pei-Ning with aggregation-prone proteins 10016, USA Road Keelung 20224, Taiwan (R.O.C), e-mail: [email protected] Journal xyz 2017; 1 (2): 122–135 Open Access. © Open 2018 Access. Nikos © Kourtis, 2017 Mustermann Nektarios Tavernarakis,and Placeholder, published published by by De De Gruyter.Gruyter. This work work is is licensed under the Creative Commons Attribution-NonCommercial-NoDerivativeslicensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License. 4.0 License. The First Decade (1964-1972) Research Article Max Musterman, Paul Placeholder What Is So Different About Neuroenhancement? Was ist so anders am Neuroenhancement? Pharmacological and Mental Self-transformation in Ethic Comparison Pharmakologische und mentale Selbstveränderung im ethischen Vergleich https://doi.org/10.1515/xyz-2017-0010 received February 9, 2013; accepted March 25, 2013; published online July 12, 2014 Abstract: In the concept of the aesthetic formation of knowledge and its as soon as possible and success-oriented application, insights and profits without the reference to the arguments developed around 1900. The main investigation also includes the period between the entry into force and the presentation in its current version. Their function as part of the literary portrayal and narrative technique. Keywords: Function, transmission, investigation, principal, period Dedicated to Paul Placeholder 1 Studies and Investigations The main investigation also includes the period between the entry into force and the presentation in its current version. Their function as part of the literary por- trayal and narrative technique. *Max Musterman: Institute of Marine Biology, National Taiwan Ocean University, 2 Pei-Ning Road Keelung 20224, Taiwan (R.O.C), e-mail: [email protected] Paul Placeholder: Institute of Marine Biology, National Taiwan Ocean University, 2 Pei-Ning Road Keelung 20224, Taiwan (R.O.C), e-mail: [email protected] Open Access. © 2017 Mustermann and Placeholder, published by De Gruyter. This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License. sHSPs in neurodegeneration 95 highlights the therapeutic potential of these heat shock for glial fibrillary acidic protein (GFAP). In AxD mouse proteins [19]. The deposition of fibrillar α-Synuclein models, overexpression of HSPB5 has a protective effect (α-syn) into inclusion bodies in the neuronal cell body or [37] and restores the defective proteasomal degradation processes is a pathological hallmark of neurodegenerative of mutant GFAP [38], suggesting that this sHSP may disorders, collectively known as synucleinopathies [20]. serve as a therapeutic target in astropathology. In spinal The expression of sHSPs is significantly increased in and bulbar muscular atrophy, a disease characterized the presence of cellular stress [21], and sHSPs have been by abnormally long polyglutamine tract (polyQ) in colocalized with α-syn in inclusion bodies [22, 23]. The mutant androgen receptor (ARpolyQ), HSPB8 promotes capacity of sHSPs to prevent α-syn aggregation depends motorneuron survival of patients by restoring autophagic on the kinetics of the aggregation process. Factors that flux and removing misfolded aggregates of ARpolyQ [39]. increase the rate of aggregation, such as disease-related Charcot-Marie-Tooth (CMT) is the most common mutations, gene amplification, or macromolecular inherited peripheral neuropathy. Missense mutations crowding, may alter the kinetics of α-syn aggregation in HSPB8 and HSPB1 have been implicated in CMT in cells, thus overwhelming the protective capacity pathogenesis [40-42]. HSPB8 knockout mice are viable of sHSPs due to reduced availability of aggregation- and display normal locomotor performances [43]. The combating chaperone subunits [24, 25]. HSPB1 (known list of mutations affecting the function of these sHSPs also as HSP27) binds along the surface of α-syn fibrils continues to grow [44, 45]. Transgenic mice expressing and inhibits their growth by blocking elongation [26]. In mutant HSPB1 developed features of CMT [46, 47] and addition to HSPB1, HSPB5 (αB-crystallin) also reduces displayed decreased a-tubulin acetylation and defective the aggregation of α-syn in in vitro assays [27]. Another axonal transport of mitochondria [46]. Intriguingly,
Load more

Recommended publications
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals
    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
    [Show full text]
  • Inherited Neuropathies
    407 Inherited Neuropathies Vera Fridman, MD1 M. M. Reilly, MD, FRCP, FRCPI2 1 Department of Neurology, Neuromuscular Diagnostic Center, Address for correspondence Vera Fridman, MD, Neuromuscular Massachusetts General Hospital, Boston, Massachusetts Diagnostic Center, Massachusetts General Hospital, Boston, 2 MRC Centre for Neuromuscular Diseases, UCL Institute of Neurology Massachusetts, 165 Cambridge St. Boston, MA 02114 and The National Hospital for Neurology and Neurosurgery, Queen (e-mail: [email protected]). Square, London, United Kingdom Semin Neurol 2015;35:407–423. Abstract Hereditary neuropathies (HNs) are among the most common inherited neurologic Keywords disorders and are diverse both clinically and genetically. Recent genetic advances have ► hereditary contributed to a rapid expansion of identifiable causes of HN and have broadened the neuropathy phenotypic spectrum associated with many of the causative mutations. The underlying ► Charcot-Marie-Tooth molecular pathways of disease have also been better delineated, leading to the promise disease for potential treatments. This chapter reviews the clinical and biological aspects of the ► hereditary sensory common causes of HN and addresses the challenges of approaching the diagnostic and motor workup of these conditions in a rapidly evolving genetic landscape. neuropathy ► hereditary sensory and autonomic neuropathy Hereditary neuropathies (HN) are among the most common Select forms of HN also involve cranial nerves and respiratory inherited neurologic diseases, with a prevalence of 1 in 2,500 function. Nevertheless, in the majority of patients with HN individuals.1,2 They encompass a clinically heterogeneous set there is no shortening of life expectancy. of disorders and vary greatly in severity, spanning a spectrum Historically, hereditary neuropathies have been classified from mildly symptomatic forms to those resulting in severe based on the primary site of nerve pathology (myelin vs.
    [Show full text]
  • Prognostic Significance of Autophagy-Relevant Gene Markers in Colorectal Cancer
    ORIGINAL RESEARCH published: 15 April 2021 doi: 10.3389/fonc.2021.566539 Prognostic Significance of Autophagy-Relevant Gene Markers in Colorectal Cancer Qinglian He 1, Ziqi Li 1, Jinbao Yin 1, Yuling Li 2, Yuting Yin 1, Xue Lei 1 and Wei Zhu 1* 1 Department of Pathology, Guangdong Medical University, Dongguan, China, 2 Department of Pathology, Dongguan People’s Hospital, Southern Medical University, Dongguan, China Background: Colorectal cancer (CRC) is a common malignant solid tumor with an extremely low survival rate after relapse. Previous investigations have shown that autophagy possesses a crucial function in tumors. However, there is no consensus on the value of autophagy-associated genes in predicting the prognosis of CRC patients. Edited by: This work screens autophagy-related markers and signaling pathways that may Fenglin Liu, Fudan University, China participate in the development of CRC, and establishes a prognostic model of CRC Reviewed by: based on autophagy-associated genes. Brian M. Olson, Emory University, United States Methods: Gene transcripts from the TCGA database and autophagy-associated gene Zhengzhi Zou, data from the GeneCards database were used to obtain expression levels of autophagy- South China Normal University, China associated genes, followed by Wilcox tests to screen for autophagy-related differentially Faqing Tian, Longgang District People's expressed genes. Then, 11 key autophagy-associated genes were identified through Hospital of Shenzhen, China univariate and multivariate Cox proportional hazard regression analysis and used to Yibing Chen, Zhengzhou University, China establish prognostic models. Additionally, immunohistochemical and CRC cell line data Jian Tu, were used to evaluate the results of our three autophagy-associated genes EPHB2, University of South China, China NOL3, and SNAI1 in TCGA.
    [Show full text]
  • HSPB8 Gene Heat Shock Protein Family B (Small) Member 8
    HSPB8 gene heat shock protein family B (small) member 8 Normal Function The HSPB8 gene provides instructions for making a protein called heat shock protein beta-8 (also called heat shock protein 22). This protein is a member of the heat shock protein family, which helps protect cells under adverse conditions such as infection, inflammation, exposure to toxins, elevated temperature, injury, and disease. Heat shock proteins block signals that lead to programmed cell death. In addition, they appear to be involved in activities such as cell movement (motility), stabilizing the cell's structural framework (the cytoskeleton), folding and stabilizing newly produced proteins, and repairing damaged proteins. Heat shock proteins also appear to play a role in the tensing of muscle fibers (muscle contraction). Heat shock protein beta-8 is found in cells throughout the body and is particularly abundant in nerve cells. While its function is not well understood, it seems to interact with a related protein called heat shock protein beta-1, produced from the HSPB1 gene. In nerve cells, heat shock protein beta-1 helps to organize a network of molecular threads called neurofilaments that maintain the diameter of specialized extensions called axons. Maintaining proper axon diameter is essential for the efficient transmission of nerve impulses. The specific role that heat shock protein beta-8 plays in axons is unclear. Health Conditions Related to Genetic Changes Charcot-Marie-Tooth disease MedlinePlus Genetics provides information about Charcot-Marie-Tooth disease Distal hereditary motor neuropathy, type II Researchers have identified at least five HSPB8 gene mutations that cause a condition called distal hereditary motor neuropathy, type II.
    [Show full text]
  • Autosomal Dominant Late-Onset Spinal Motor Neuronopathy Is Linked to a New Locus on Chromosome 22Q11.2-Q13.2
    European Journal of Human Genetics (2012) 20, 1193–1196 & 2012 Macmillan Publishers Limited All rights reserved 1018-4813/12 www.nature.com/ejhg SHORT REPORT Autosomal dominant late-onset spinal motor neuronopathy is linked to a new locus on chromosome 22q11.2-q13.2 Sini Penttila¨*,1, Manu Jokela2, Peter Hackman3, Anna Maija Saukkonen4, Jari Toivanen4 and Bjarne Udd1,3,5 Spinal muscular atrophies (SMAs) are hereditary disorders characterized by degeneration of lower motor neurons. Different SMA types are clinically and genetically heterogeneous and many of them show significant phenotypic overlap. We recently described the clinical phenotype of a new disease in two Finnish families with a unique autosomal dominant late-onset lower motor neuronopathy. The studied families did not show linkage to any known locus of hereditary motor neuron disease and thus seemed to represent a new disease entity. For this study, we recruited two more family members and performed a more thorough genome-wide scan. We obtained significant linkage on chromosome 22q, maximum LOD score being 3.43 at marker D22S315. The linked area is defined by flanking markers D22S686 and D22S276, comprising 18.9 Mb. The region harbours 402 genes, none of which is previously known to be associated with SMAs. This study confirms that the disease in these two families is a genetically distinct entity and also provides evidence for a founder mutation segregating in both pedigrees. European Journal of Human Genetics (2012) 20, 1193–1196; doi:10.1038/ejhg.2012.76; published online 25 April 2012 Keywords: motor neuron disease; spinal muscular atrophy; linkage analysis INTRODUCTION LMNA16 and TRPV417 or to be linked to 3q13.118 or 14q32.19 Spinal muscular atrophies (SMAs) are hereditary disorders character- Mutations in many of these genes cause several allelic disorders.
    [Show full text]
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • Exome Sequencing in Amyotrophic Lateral Sclerosis Implicates a Novel Gene, DNAJC7, Encoding a Heat-Shock Protein
    ARTICLES https://doi.org/10.1038/s41593-019-0530-0 Corrected: Publisher Correction Exome sequencing in amyotrophic lateral sclerosis implicates a novel gene, DNAJC7, encoding a heat-shock protein Sali M. K. Farhan 1,2,3*, Daniel P. Howrigan 1,2,3, Liam E. Abbott1,2,3, Joseph R. Klim 4, Simon D. Topp 5, Andrea E. Byrnes1,2,3, Claire Churchhouse1,2,3, Hemali Phatnani6, Bradley N. Smith5, Evadnie Rampersaud7, Gang Wu 7, Joanne Wuu8, Aleksey Shatunov9, Alfredo Iacoangeli9,10, Ahmad Al Khleifat9, Daniel A. Mordes4, Sulagna Ghosh3,4, ALSGENS Consortium27, FALS Consortium27, Project MinE Consortium27, CReATe Consortium27, Kevin Eggan 3,4, Rosa Rademakers11, Jacob L. McCauley 12,13, Rebecca Schüle14, Stephan Züchner12,13, Michael Benatar8, J. Paul Taylor15,16, Michael Nalls17,18, Marc Gotkine19, Pamela J. Shaw20, Karen E. Morrison21, Ammar Al-Chalabi 9,22, Bryan Traynor17,23, Christopher E. Shaw5,24, David B. Goldstein 25, Matthew B. Harms26, Mark J. Daly 1,2,3 and Benjamin M. Neale 1,2,3* To discover novel genes underlying amyotrophic lateral sclerosis (ALS), we aggregated exomes from 3,864 cases and 7,839 ancestry-matched controls. We observed a significant excess of rare protein-truncating variants among ALS cases, and these variants were concentrated in constrained genes. Through gene level analyses, we replicated known ALS genes including SOD1, NEK1 and FUS. We also observed multiple distinct protein-truncating variants in a highly constrained gene, DNAJC7. The signal in DNAJC7 exceeded genome-wide significance, and immunoblotting assays showed depletion of DNAJC7 protein in fibroblasts in a patient with ALS carrying the p.Arg156Ter variant.
    [Show full text]
  • The Small Heat Shock Protein B8 (HSPB8) Modulates Proliferation and Migration of Breast Cancer Cells
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 6), pp: 10400-10415 Research Paper The small heat shock protein B8 (HSPB8) modulates proliferation and migration of breast cancer cells Margherita Piccolella1, Valeria Crippa1,2, Riccardo Cristofani1, Paola Rusmini1, Mariarita Galbiati1, Maria Elena Cicardi1, Marco Meroni1, Nicola Ferri3, Federica F. Morelli4, Serena Carra4, Elio Messi1,*, Angelo Poletti1,* 1Dipartimento di Scienze Farmacologiche e Biomolecolari (DiSFeB), Centro di Eccellenza sulle Malattie Neurodegenerative, Università degli Studi di Milano, Milano, Italy 2C. Mondino National Neurological Institute, Pavia, Italy 3Dipartimento di Scienze del Farmaco, Università degli Studi di Padova, Padova, Italy 4Dipartimento di Scienze Biomediche, Metaboliche e Neuroscienze, Università di Modena e Reggio Emilia, Modena, Italy *These authors have contributed equally to this work Correspondence to: Angelo Poletti, email: [email protected] Keywords: breast cancer, HSPB8, proliferation, migration, MCF-7 cells Received: June 30, 2016 Accepted: December 12, 2016 Published: January 02, 2017 ABSTRACT Breast cancer (BC) is one of the major causes of cancer death in women and is closely related to hormonal dysregulation. Estrogen receptor (ER)-positive BCs are generally treated with anti hormone therapy using antiestrogens or aromatase inhibitors. However, BC cells may become resistant to endocrine therapy, a process facilitated by autophagy, which may either promote or suppress tumor expansion. The autophagy facilitator HSPB8 has been found overexpressed in some BC. Here we found that HSPB8 is highly expressed and differentially modulated by natural or synthetic selective ER modulators (SERMs), in the triple-positive hormone-sensitive BC (MCF-7) cells, but not in triple-negative MDA-MB-231 BC cells.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name heat shock protein 8 Gene Symbol Hspb8 Organism Mouse Gene Summary Description Not Available Gene Aliases AU018630, AW413033, Cryac, D5Ucla4, E2IG1, H11, H11K, HSP20-like, HSP22 RefSeq Accession No. NC_000071.6, NT_078458.7 UniGene ID Mm.21549 Ensembl Gene ID ENSMUSG00000041548 Entrez Gene ID 80888 Assay Information Unique Assay ID qMmuCIP0030083 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSMUST00000036991 Amplicon Context Sequence TGTATTTTCTTGGTGAAGTTCTTGGAGACAATCCCACCTTCCTGCTGCTTCTCTTC ATGTTTGCCTGAAACTTCCACGTATCCATCCTTGGTCTTTACCATCAGCTC Amplicon Length (bp) 77 Chromosome Location 5:116415407-116422155 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 97 R2 0.9997 cDNA Cq 21.61 cDNA Tm (Celsius) 80.5 gDNA Cq 39.65 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Hspb8, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • The Heterooligomerization of Human Small Heat Shock Proteins Is Controlled by Conserved Motif Located in the N-Terminal Domain
    International Journal of Molecular Sciences Article The Heterooligomerization of Human Small Heat Shock Proteins Is Controlled by Conserved Motif Located in the N-Terminal Domain Vladislav M. Shatov 1, Sergei V. Strelkov 2 and Nikolai B. Gusev 1,* 1 Department of Biochemistry, School of Biology, Moscow State University, Moscow 119991, Russian; [email protected] 2 Laboratory for Biocrystallography, Department of Pharmaceutical and Pharmacological Sciences, KU Leuven, 3000 Leuven, Belgium; [email protected] * Correspondence: [email protected] Received: 19 May 2020; Accepted: 12 June 2020; Published: 15 June 2020 Abstract: Ubiquitously expressed human small heat shock proteins (sHsps) HspB1, HspB5, HspB6 and HspB8 contain a conserved motif (S/G)RLFD in their N-terminal domain. For each of them, we prepared mutants with a replacement of the conserved R by A (R/A mutants) and a complete deletion of the pentapeptide (D mutants) and analyzed their heterooligomerization with other wild-type (WT) human sHsps. We found that WT HspB1 and HspB5 formed heterooligomers with HspB6 only upon heating. In contrast, both HspB1 mutants interacted with WT HspB6 even at low temperature. HspB1/HspB6 heterooligomers revealed a broad size distribution with equimolar ratio suggestive of heterodimers as building blocks, while HspB5/HspB6 heterooligomers had an approximate 2:1 ratio. In contrast, R/A or D mutants of HspB6, when mixed with either HspB1 or HspB5, resulted in heterooligomers with a highly variable molar ratio and a decreased HspB6 incorporation. No heterooligomerization of HspB8 or its mutants with either HspB1 or HspB5 could be detected. Finally, R/A or D mutations had no effect on heterooligomerization of HspB1 and HspB5 as analyzed by ion exchange chromatography.
    [Show full text]
  • The Role of HSPB8, a Component of the Chaperone-Assisted Selective Autophagy Machinery, in Cancer
    cells Review The Role of HSPB8, a Component of the Chaperone-Assisted Selective Autophagy Machinery, in Cancer Riccardo Cristofani † , Margherita Piccolella † , Valeria Crippa, Barbara Tedesco, Marina Montagnani Marelli , Angelo Poletti *,‡ and Roberta M. Moretti ‡ Dipartimento di Scienze Farmacologiche e Biomolecolari (DiSFeB), Dipartimento di Eccellenza 2018–2022, Università degli Studi di Milano, 20133 Milan, Italy; [email protected] (R.C.); [email protected] (M.P.); [email protected] (V.C.); [email protected] (B.T.); [email protected] (M.M.M.); [email protected] (R.M.M.) * Correspondence: [email protected]; Tel.: +39-02-5031-8215 † These authors contributed equally to this work. ‡ These authors contributed equally to this work. Abstract: The cellular response to cancer-induced stress is one of the major aspects regulating cancer development and progression. The Heat Shock Protein B8 (HSPB8) is a small chaperone involved in chaperone-assisted selective autophagy (CASA). CASA promotes the selective degradation of proteins to counteract cell stress such as tumor-induced stress. HSPB8 is also involved in (i) the cell division machinery regulating chromosome segregation and cell cycle arrest in the G0/G1 phase and (ii) inflammation regulating dendritic cell maturation and cytokine production. HSPB8 expression and role are tumor-specific, showing a dual and opposite role. Interestingly, HSPB8 may be involved in the acquisition of chemoresistance to drugs. Despite the fact the mechanisms of HSPB8-mediated CASA activation in tumors need further studies, HSPB8 could represent an important factor in cancer induction and progression and it may be a potential target for anticancer treatment in specific types Citation: Cristofani, R.; Piccolella, of cancer.
    [Show full text]