DOCSLIB.ORG

Supplementary Information the Histone Methyltransferase MLL3

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Information the Histone Methyltransferase MLL3 Supplementary Information The histone methyltransferase MLL3 contributes to genome-scale circadian transcription Utham K. Valekunja, Rachel S. Edgar, Malgorzata Oklejewicz, Gijsbertus T. van der Horst, John S. O’Neill, Filippo Tamanini, Daniel J. Turner and Akhilesh B. Reddy* * Correspondence should be addressed to ABR Tel: +44 1223 769038 E-mail: [email protected] Included: Materials and Methods Supplementary Figures S1-S8 Supplementary Tables S1-S7 1 Materials & Methods Chromatin immunoprecipitation (ChIP) All animal experimentation was licensed by the Home Office under the Animals (Scientific Procedures) Act, 1987. Liver tissue was harvested from n=4 adult male C57Bl/6 mice once every 3 hours on the second cycle after transfer from 12L:12DR to DR:DR (L, light [220 µW cm-2] and DR, dim red light [< 5 µW cm-2]) and immediately frozen and then stored at -80°C prior to use. Prior to sampling, animals were stably entrained to a 12 h L: 12 h DR cycle for 3-4 weeks. Liver tissue (30mg per final ChIP) was rapidly chopped into small (approx. 5 mm x 5mm x 2.5mm cubes) whilst defrosting using a sterile scalpel and immediately submerged in 4% formaldehyde (Sigma) and incubated at room temperature with gentle shaking for 10 mins. Glycine (1.25M) was added to a final concentration of 125 mM and incubated for a further 10 mins to quench the formaldehyde. Tissue was then dounce homogenised briefly to break up the tissue and then passed through a 100 µm cell strainer (BD Biosciences) and a cell suspension harvested. The cells were washed in ice cold phosphate-buffered saline (PBS) and then incubated with 2ml Farnham Lysis Buffer (5 mM PIPES pH 8.0, 85 mM KCl, 0.5% NP40, Roche Complete Protease Inhibitor Cocktail) at 4oC for 15 mins to release nuclei. After spinning down, pelleted nuclei were then lysed with 1ml RIPA Buffer (1xPBS, 1% NP40, 0.5% Sodium Deoxycholate, 0.1% SDS, Roche Complete Protease Inhibitor Cocktail) and incubated for a further 15 mins at 4oC. Chromatin was sheared using a Diagenode Bioruptor at 4oC, using conditions optimised to produce 150-300bp fragments with the use of 15 ml Falcon tubes holding 2ml of lysate each (30 cycles of 30 secs on HIGH, 30 secs OFF). Sheared chromatin was transferred to 1.5 ml microcentrifuge tubes and spun at 14,000 rpm for 15 min at 4°C to pellet debris. Cleared supernatants were transferred to clean microcentrifuge tubes and 100 µl from each sample lysate was saved for use as an input control for sequencing and to check fragment size distribution. For each liver from n=4 animals per time-point, duplicate ChIPs were performed with each antibody. ChIP-grade antibodies were purchased from Abcam (UK): anti-H3K4me3 (ab8580), anti-H3K9me3 (ab8898) and anti-Histone H3 (ab1791). 50 µl of Protein G magnetic beads (Dynal/Invitrogen) were washed three times (in 1 ml 1XPBS/1% BSA) and 2 then incubated with 5 µg antibody in 300 µl volumes (diluted in PBS/BSA) for 4 hours at 4oC on a rotator. Excess, or non-specifically bound, antibody was removed by washing a further three times in PBS/BSA. The beads were then added to 900 µl of sheared chromatin in 1.5 ml DNA Lo-bind tubes (Eppendorf) and incubated at 4oC overnight with gentle rotation. Beads were washed six times in 1 ml LiCl Wash Buffer (100 mM Tris, 500 mM LiCl, 1% NP40, 1% Sodium Deoxycholate) for 3 min each, followed by a brief wash in Tris-EDTA (TE) buffer, pH 7.4. The beads were then suspended in TE, transferred to a clean microcentrifuge tube, and TE was removed. 200 µl of IP Elution Buffer (1% SDS and 100 mM NaHCO3) was added at room temperature and then the beads were incubated for 45 mins at 65oC with continuous shaking on a thermomixer (at 800 rpm). The eluate was then removed from the beads and incubated overnight at 65oC to reverse cross-linking. DNA was extracted using a Qiagen Minelute PCR purification kit (using 12 µl of Buffer EB to elute DNA) and then quantified using Picogreen assays (Invitrogen) in a microplate as per the manufacturer’s instructions. Input chromatin was reverse cross-linked in parallel and assayed with a Nanodrop spectrophotometer (because of the much higher DNA concentration) and a sample was run on a 2% agarose gel to check fragment size distributions were correct. Multiplex Library Preparation & Sequencing For H3K4me3, H3K9me3, Histone H3 and input DNA samples, these were prepared for sequencing on an Illumina Genome Analyzer II following the manufacturer’s recommended library preparation protocol using 50 ng of ChIPed DNA, except that a custom adapter was used, the PCR was performed using indexed reverse primers in a high-efficiency amplification step, and the size selection step was performed after the PCR (1-3). For MLL3 ChIP in liver tissue or mouse embryonic fibroblasts (MEFs), standard Illumina indexing primers were used, as per the manufacturer’s instructions. All libraries were multiplexed, and 4 indexed pooled samples (corresponding to four time-points, CT0, 6, 12, 18) sequenced per lane. Bioinformatics: Alignment and Peak Detection Analysis was performed using the Darwin Supercomputer of the University of Cambridge High Performance Computing Service (http://www.hpc.cam.ac.uk/), provided by Dell Inc. using Strategic Research Infrastructure Funding from the Higher Education Funding Council for England. Raw paired-end 50bp reads (in FASTQ format) were aligned to the UCSC mm9 genome build with Bowtie (http://bowtie-bio.sourceforge.net/index.shtml) using pre-built 3 indexes downloaded from the host website (4-6). Parameters were optimised to utilise the software’s multi-threading capabilities (we typically used a 128-core cluster for alignments). Alignment files were then converted from the standard Bowtie output format to ALN files (for use with Cisgenome) using a custom Perl script. Alignments were then analysed using a 2-sample comparison (ChIPed sample vs. Input control for each time-point) with Cisgenome v1, using a cut-off false discovery rate of 10% and a sliding window size of 100 (7-9). Output files were converted into various formats for browsing datasets and to display data. The Cisgenome and UCSC browsers were used for data visualisation, using custom tracks (1, 7, 10). Raw sequence data (FASTQ format), alignments (Bowtie format) and peak data (as Cisgenome/Affymetrix BAR format) are deposited on the NCBI GEO database (Accessions: GSE23550 and GSE37396) and are MINSEQE-compliant. Microarrays Total RNA was isolated from liver samples of C57/Bl6 mice over a circadian time course as previously described (4). Per time point, n=3 biological replicate samples were collected and processed individually. RNA from each individual biological replicate sample was hybridized on an Affymetrix mouse Gene ST1.0 microarray (Accession: GSE37396), using the manufacturer’s protocol. Microarray Data Analysis Microarray analysis was performed using GeneSpring GX 11, with intensity values being normalized using the Robust Multi-array Average (RMA) algorithm. Data from a recent high-temporal resolution microarray study performed by the Hogenesch and Panda laboratories was used to determine the transcriptional profiles of genes with rhythmic histone methylation patterns (7). Genes with statistically significant ChIP-seq peaks at each time- point were checked against a list of rhythmic transcripts and their Affymetrix IDs, COSOPT/Fisher G-test q-values and period estimates were obtained (see Supplementary Table 1). Data were obtained from the NCBI GEO database (Accession: GSE11923) and the associated paper (2, 7). Validation of ChIP with Real-time PCR (qPCR) We performed ChIP on a separate set of liver samples (from animals from the same cohort) using 5 µg per ChIP of the anti-histone antibodies above, and also normal rabbit IgG (Cell Signaling Technology #2729) as a negative control for comparison. We performed real-time 4 PCR using SYBR green master mix (Applied Biosystems) with primers as below. Compared to IgG and input chromatin, all gave a significant (approx. 5-10 fold) enrichment at the positive loci examined, and no enrichment at selected negative loci. Primers were designed with Primer3Plus software using its standard parameters for qPCR, with an amplicon length of 75-125 bp: Histone Time- Forward Primer Reverse Primer Closest Gene Amplicon point size H3K4me3 CT0 TACATGCCAGCGAACAAGAC GCCTAATTGCAGGGAGAAAC Defb7 122 H3K4me3 CT0 TCTGCCTCCTTCAGCAAATC CATCGTTGGTACGGTTCAAG Pdia4 92 H3K4me3 CT6 CCTCCGTTGCCTGAGAGAC GGAGACATAGCTGGGTGGTC Tmem64 94 H3K4me3 CT6 TACACAGATCCTGGGCCTTC CAGCAAAACGCTGAGAACAA A930016P21Rik 96 H3K4me3 CT12 TCATCTAGATTGCGCGACAC TAGATAGTGGCGGGGTTCTG Ipo9 76 H3K4me3 CT12 GCAAGGAGGGAGAAGACACA CGAAGGGTCTCTGAATGCTC Aftph 112 H3K4me3 CT18 CGTGGACCTCACAACATCAT TGGGCTGAACCCAACTTTAC Ndufb5 102 H3K4me3 CT18 GAGGAAGAGGGACCAAAACC GGTTGTTGACACGGACTCCT Tcf25 79 H3K9me3 CT0 CCCTGTCTCGAAAAACCAAA TGGCCATGACAATACCAAAA Zc3h7a 95 H3K9me3 CT0 TGCCTTGAGGAAATGAGCTT CCAGACCACCCAAGCTTAAA 3110007F17Rik 79 H3K9me3 CT6 TCCTTGCCATATTCCAGGTC GAGAAACATCCACTTGACAACG Alkbh8 97 H3K9me3 CT6 GAGGTCCTTGGTCCTGTGAA TCCTCCATCCACCCATTTTA Rbmy1a1 82 H3K9me3 CT12 GACATGAGAGGGAGGGACTG TATGCCCTCATTGCACTTCA C230081A13Rik 93 H3K9me3 CT12 GCCATGCATGTCTAAGTACGC GCGACCAAAGGAACCATAAC Pgk2 81 H3K9me3 CT18 GCATCCATCCCTGAAAAGAC CTGAGACTCACGTTTTCCTTCC Sp110 100 H3K9me3 CT18 TCGGAGGGAACCAGCTACTA CCAGAGGAAACTCTGGTGGA 4631422O05Rik 113 Real-time PCR (qPCR) for gene expression analysis RNA from individual livers (see above ChIP methods) was extracted with TRIzol reagent (Invitrogen) and purified with RNAeasy Mini Kits (Qiagen). Total RNA was then used for reverse transcription via a High Capacity cDNA Archive Kit (Applied Biosystems). The resulting cDNA was then diluted 1:5 and used in duplicate 10 µl PCR reactions according to the manufacturer’s protocol (TaqMan Gene Expression Master Mix, Applied Biosystems) with validated Taqman Gene Expression Assays (Applied Biosystems). For control reactions, mouse β-actin mRNA was amplified from the same samples. Real-time PCR was performed with an ABI 7900HT (Applied Biosystems) system. The relative levels of each mRNA were calculated by the 2-ΔΔCt method (Ct stands for the cycle number at which the signal reaches the threshold of detection) and normalized to the corresponding β-actin mRNA levels.
Load more

Recommended publications
  • ATF4 Promotes Angiogenesis and Neuronal Cell Death and Confers Ferroptosis in a Xct-Dependent Manner
    OPEN Oncogene (2017) 36, 5593–5608 www.nature.com/onc ORIGINAL ARTICLE ATF4 promotes angiogenesis and neuronal cell death and confers ferroptosis in a xCT-dependent manner D Chen1,2,ZFan1,3, M Rauh4, M Buchfelder5, IY Eyupoglu1,5 and N Savaskan1,5,6 Activating transcription factor 4 (ATF4) is a critical mediator of metabolic and oxidative homeostasis and cell survival. ATF4 is elevated in response to diverse microenvironmental stresses, including starvation, ER stress damages and exposure to toxic factors. Here we show that ATF4 expression fosters the malignancy of primary brain tumors (WHO grade III and IV gliomas) and increases proliferation and tumor angiogenesis. Hence, ATF4 expression promotes cell migration and anchorage-independent cell growth, whereas siRNA-mediated knockdown of ATF4 attenuates these features of malignancy in human gliomas. Further experiments revealed that ATF4-dependent tumor promoting effects are mediated by transcriptional targeting the glutamate antiporter xCT/SCL7A11 (also known as system Xc-). Thus, xCT is elevated as a consequence of ATF4 activation. We further found evidence that ATF4-induced proliferation can be attenuated by pharmacological or genetic xCT inhibition and ferroptosis inducers such as sorafenib, erastin and GPx4 inhibitor RSL3. Further, fostered xCT expression promotes cell survival and growth in ATF4 knockdown cells. Moreover, increased xCT levels ameliorate sorafenib and erastin-induced ferroptosis. Conversely, ATF4 knockdown renders cells susceptible for erastin, sorafenib and RSL3-induced ferroptosis. We further identified that ATF4 promotes tumor-mediated neuronal cell death which can be alleviated by xCT inhibition. Moreover, elevated ATF4 expression in gliomas promotes tumor angiogenesis. Noteworthy, ATF4-induced angiogenesis could be diminished by ferroptosis inducers erastin and by GPx4 inhibitor RSL3.
    [Show full text]
  • ALS2CR2 (STRADB) 406-418) Goat Polyclonal Antibody – AP08962PU-N
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for AP08962PU-N ALS2CR2 (STRADB) 406-418) Goat Polyclonal Antibody Product data: Product Type: Primary Antibodies Applications: ELISA, IHC, WB Recommended Dilution: ELISA: 1/32000. Immunohistochemistry on Paraffin Sections: 3.75 µg/ml. Western Blot: 1 - 3 µg/ml. Reactivity: Canine, Human Host: Goat Clonality: Polyclonal Immunogen: Synthetic peptide from C-terminus of human ALS2CR2 Specificity: This antibody reacts to STE20-Related Kinase Adaptor Beta (STRADB/ALS2CR2) at aa 406-418. It is expected to recognise both human isoforms: ILPIP-alpha (NP_061041.2) and ILPIP-beta (AAF71042.1). Formulation: Tris saline buffer, pH 7.3, 0.5% BSA, 0.02% sodium azide State: Aff - Purified State: Liquid purified Ig Concentration: lot specific Purification: Immunoaffinity Chromatography Conjugation: Unconjugated Storage: Store the antibody undiluted at 2-8°C for one month or (in aliquots) at -20°C for longer. Avoid repeated freezing and thawing. Stability: Shelf life: one year from despatch. Database Link: Entrez Gene 55437 Human Q9C0K7 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 ALS2CR2 (STRADB) 406-418) Goat Polyclonal Antibody – AP08962PU-N Background: Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2, is connected to transferase/kinase activity and ATP binding, it has recently been shown to interact with XIAP, a member of the IAP (Inhibitor of Apoptosis) protein family.
    [Show full text]
  • A Cell Line P53 Mutation Type UM
    A Cell line p53 mutation Type UM-SCC 1 wt UM-SCC5 Exon 5, 157 GTC --> TTC Missense mutation by transversion (Valine --> Phenylalanine UM-SCC6 wt UM-SCC9 wt UM-SCC11A wt UM-SCC11B Exon 7, 242 TGC --> TCC Missense mutation by transversion (Cysteine --> Serine) UM-SCC22A Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC22B Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC38 Exon 5, 132 AAG --> AAT Missense mutation by transversion (Lysine --> Asparagine) UM-SCC46 Exon 8, 278 CCT --> CGT Missense mutation by transversion (Proline --> Alanine) B 1 Supplementary Methods Cell Lines and Cell Culture A panel of ten established HNSCC cell lines from the University of Michigan series (UM-SCC) was obtained from Dr. T. E. Carey at the University of Michigan, Ann Arbor, MI. The UM-SCC cell lines were derived from eight patients with SCC of the upper aerodigestive tract (supplemental Table 1). Patient age at tumor diagnosis ranged from 37 to 72 years. The cell lines selected were obtained from patients with stage I-IV tumors, distributed among oral, pharyngeal and laryngeal sites. All the patients had aggressive disease, with early recurrence and death within two years of therapy. Cell lines established from single isolates of a patient specimen are designated by a numeric designation, and where isolates from two time points or anatomical sites were obtained, the designation includes an alphabetical suffix (i.e., "A" or "B"). The cell lines were maintained in Eagle's minimal essential media supplemented with 10% fetal bovine serum and penicillin/streptomycin.
    [Show full text]
  • 1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
    Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN.
    [Show full text]
  • Endoglin Protein Interactome Profiling Identifies TRIM21 and Galectin-3 As
    cells Article Endoglin Protein Interactome Profiling Identifies TRIM21 and Galectin-3 as New Binding Partners 1, 1, 2, Eunate Gallardo-Vara y, Lidia Ruiz-Llorente y, Juan Casado-Vela y , 3 4 5 6, , María J. Ruiz-Rodríguez , Natalia López-Andrés , Asit K. Pattnaik , Miguel Quintanilla z * 1, , and Carmelo Bernabeu z * 1 Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas (CSIC), and Centro de Investigación Biomédica en Red de Enfermedades Raras (CIBERER), 28040 Madrid, Spain; [email protected] (E.G.-V.); [email protected] (L.R.-L.) 2 Bioengineering and Aerospace Engineering Department, Universidad Carlos III and Centro de Investigación Biomédica en Red Enfermedades Neurodegenerativas (CIBERNED), Leganés, 28911 Madrid, Spain; [email protected] 3 Centro Nacional de Investigaciones Cardiovasculares (CNIC), 28029 Madrid, Spain; [email protected] 4 Cardiovascular Translational Research, Navarrabiomed, Complejo Hospitalario de Navarra (CHN), Universidad Pública de Navarra (UPNA), IdiSNA, 31008 Pamplona, Spain; [email protected] 5 School of Veterinary Medicine and Biomedical Sciences, and Nebraska Center for Virology, University of Nebraska-Lincoln, Lincoln, NE 68583, USA; [email protected] 6 Instituto de Investigaciones Biomédicas “Alberto Sols”, Consejo Superior de Investigaciones Científicas (CSIC), and Departamento de Bioquímica, Universidad Autónoma de Madrid (UAM), 28029 Madrid, Spain * Correspondence: [email protected] (M.Q.); [email protected] (C.B.) These authors contributed equally to this work. y Equal senior contribution. z Received: 7 August 2019; Accepted: 7 September 2019; Published: 13 September 2019 Abstract: Endoglin is a 180-kDa glycoprotein receptor primarily expressed by the vascular endothelium and involved in cardiovascular disease and cancer.
    [Show full text]
  • Cacybp (NM 009786) Mouse Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR202748 Cacybp (NM_009786) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Cacybp (NM_009786) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Cacybp Synonyms: SIP Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MR202748 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTTCCGTTTTGGAAGAGTTGCAGAAAGACCTAGAAGAGGTCAAAGTATTGCTGGAAAAGTCCACTA GGAAAAGACTACGTGATACTCTTACAAGTGAAAAGTCCAAGATTGAGACGGAACTCAAGAACAAGATGCA ACAGAAGTCGCAGAAGAAACCAGAACTTGATAATGAAAAGCCAGCTGCTGTGGTTGCTCCTCTTACAACA GGATACACCGTGAAAATCAGTAATTATGGATGGGATCAGTCAGATAAGTTTGTGAAAATCTACATTACCT TGACTGGCGTCCATCAGGTGCCCACTGAGAACGTGCAGGTGCACTTCACAGAGAGGTCATTTGATCTTCT GGTAAAAAACCTCAATGGCAAGAATTACTCCATGATTGTGAACAATCTTTTGAAACCTATCTCTGTGGAA AGCAGTTCAAAAAAAGTCAAGACTGATACAGTAATTATTCTATGTAGAAAGAAAGCAGAAAACACAAGAT GGGACTACTTAACACAGGTGGAAAAGGAATGCAAAGAGAAAGAAAAGCCTTCCTACGACACGGAGGCAGA CCCTAGTGAGGGATTAATGAATGTTCTAAAGAAAATTTATGAAGACGGAGACGATGATATGAAGCGAACC ATTAATAAAGCGTGGGTGGAATCCAGAGAGAAGCAAGCCAGAGAAGACACGGAATTT ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online
    [Show full text]
  • Decreased Expression of the Id3gene at 1P36.1 in Ovarian
    British Journal of Cancer (2001) 84(3), 352–359 © 2001 Cancer Research Campaign doi: 10.1054/ bjoc.2000.1620, available online at http://www.idealibrary.com on http://www.bjcancer.com Decreased expression of the Id3 gene at 1p36.1 in ovarian adenocarcinomas JM Arnold1, SC Mok2, D Purdie1 and G Chenevix-Trench1,3 1The Queensland Institute of Medical Research, PO Box Royal Brisbane Hospital, Herston, Queensland, Australia, 4029; 2Laboratory of Gynecologic Oncology, Department of Obstetrics, Gynecology and Reproduction Biology, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; 3Department of Pathology, University of Queensland, St Lucia, Brisbane, Australia, 4067 Summary The molecular events that drive the initiation and progression of ovarian adenocarcinoma are not well defined. We have investigated changes in gene expression in ovarian cancer cell lines compared to an immortalized human ovarian surface epithelial cell line (HOSE) using a cDNA array. We identified 17 genes that were under-expressed and 10 genes that were over-expressed in the cell lines compared to the HOSE cells. One of the genes under-expressed in the ovarian cancer cell lines, Id3, a transcriptional inactivator, was selected for further investigation. Id3 mRNA was expressed at reduced levels in 6 out of 9 ovarian cancer cell lines compared to the HOSE cells while at the protein level, all 7 ovarian cancer cell lines examined expressed the Id3 protein at greatly reduced levels. Expression of Id3 mRNA was also examined in primary ovarian tumours and was found in only 12/38 (32%) cases. A search was conducted for mutations of Id3 in primary ovarian cancers using single stranded conformation polymorphism (SSCP) analysis.
    [Show full text]
  • UNIVERSITY of CALIFORNIA RIVERSIDE Investigations Into The
    UNIVERSITY OF CALIFORNIA RIVERSIDE Investigations into the Role of TAF1-mediated Phosphorylation in Gene Regulation A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Cell, Molecular and Developmental Biology by Brian James Gadd December 2012 Dissertation Committee: Dr. Xuan Liu, Chairperson Dr. Frank Sauer Dr. Frances M. Sladek Copyright by Brian James Gadd 2012 The Dissertation of Brian James Gadd is approved Committee Chairperson University of California, Riverside Acknowledgments I am thankful to Dr. Liu for her patience and support over the last eight years. I am deeply indebted to my committee members, Dr. Frank Sauer and Dr. Frances Sladek for the insightful comments on my research and this dissertation. Thanks goes out to CMDB, especially Dr. Bachant, Dr. Springer and Kathy Redd for their support. Thanks to all the members of the Liu lab both past and present. A very special thanks to the members of the Sauer lab, including Silvia, Stephane, David, Matt, Stephen, Ninuo, Toby, Josh, Alice, Alex and Flora. You have made all the years here fly by and made them so enjoyable. From the Sladek lab I want to thank Eugene, John, Linh and Karthi. Special thanks go out to all the friends I’ve made over the years here. Chris, Amber, Stephane and David, thank you so much for feeding me, encouraging me and keeping me sane. Thanks to the brothers for all your encouragement and prayers. To any I haven’t mentioned by name, I promise I haven’t forgotten all you’ve done for me during my graduate years.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Genome-Wide Transcriptional Sequencing Identifies Novel Mutations in Metabolic Genes in Human Hepatocellular Carcinoma DAOUD M
    CANCER GENOMICS & PROTEOMICS 11 : 1-12 (2014) Genome-wide Transcriptional Sequencing Identifies Novel Mutations in Metabolic Genes in Human Hepatocellular Carcinoma DAOUD M. MEERZAMAN 1,2 , CHUNHUA YAN 1, QING-RONG CHEN 1, MICHAEL N. EDMONSON 1, CARL F. SCHAEFER 1, ROBERT J. CLIFFORD 2, BARBARA K. DUNN 3, LI DONG 2, RICHARD P. FINNEY 1, CONSTANCE M. CULTRARO 2, YING HU1, ZHIHUI YANG 2, CU V. NGUYEN 1, JENNY M. KELLEY 2, SHUANG CAI 2, HONGEN ZHANG 2, JINGHUI ZHANG 1,4 , REBECCA WILSON 2, LAUREN MESSMER 2, YOUNG-HWA CHUNG 5, JEONG A. KIM 5, NEUNG HWA PARK 6, MYUNG-SOO LYU 6, IL HAN SONG 7, GEORGE KOMATSOULIS 1 and KENNETH H. BUETOW 1,2 1Center for Bioinformatics and Information Technology, National Cancer Institute, Rockville, MD, U.S.A.; 2Laboratory of Population Genetics, National Cancer Institute, National Cancer Institute, Bethesda, MD, U.S.A.; 3Basic Prevention Science Research Group, Division of Cancer Prevention, National Cancer Institute, Bethesda, MD, U.S.A; 4Department of Biotechnology/Computational Biology, St. Jude Children’s Research Hospital, Memphis, TN, U.S.A.; 5Department of Internal Medicine, University of Ulsan College of Medicine, Asan Medical Center, Seoul, Korea; 6Department of Internal Medicine, University of Ulsan College of Medicine, Ulsan University Hospital, Ulsan, Korea; 7Department of Internal Medicine, College of Medicine, Dankook University, Cheon-An, Korea Abstract . We report on next-generation transcriptome Worldwide, liver cancer is the fifth most common cancer and sequencing results of three human hepatocellular carcinoma the third most common cause of cancer-related mortality (1). tumor/tumor-adjacent pairs.
    [Show full text]
  • CNOT4 Antibody (Pab)
    21.10.2014CNOT4 antibody (pAb) Rabbit Anti-Human/Mouse/Rat CCR4-NOT Transcription Complex Subunit 4 (NOT4, NOT4H) Instruction Manual Catalog Number PK-AB718-4813 Synonyms CNOT4 Antibody: CCR4-NOT transcription complex subunit 4, NOT4, NOT4H Description CNOT4 is a component of the CCR4-NOT transcription complex, a complex that is implicated in the repression of RNA polymerase II transcription. In the CCR4-NOT complex, CNOT4 acts as an E3 ubiquitin-protein ligase and interacts with a subset of E2 ubiquitin-conjugating enzymes through a unique C4C4 RING domain. This E3 ligase activity was shown to be dependent on the selective and specific interaction with the ubiquitin conjugating enzyme UbcH5B. In yeast, mutations in CNOT4 that prevented its interaction with the UbcH5B homolog UBC4 caused increased sensitivity to hydroxyurea, heat shock, and hygromycin B, suggesting that CNOT4 and UbcH5B are involved in stress response in vivo. Multiple isoforms of CNOT4 are known to exist. Quantity 100 µg Source / Host Rabbit Immunogen CNOT4 antibody was raised against a 19 amino acid peptide near the amino terminus of the human CNOT4. Purification Method Affinity chromatography purified via peptide column. Clone / IgG Subtype Polyclonal antibody Species Reactivity Human, Mouse, Rat Specificity Formulation Antibody is supplied in PBS containing 0.02% sodium azide. Reconstitution During shipment, small volumes of antibody will occasionally become entrapped in the seal of the product vial. For products with volumes of 200 μl or less, we recommend gently tapping the vial on a hard surface or briefly centrifuging the vial in a tabletop centrifuge to dislodge any liquid in the container’s cap.
    [Show full text]
  • (P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation
    Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds.
    [Show full text]