Supplementary Information The histone methyltransferase MLL3 contributes to genome-scale circadian transcription Utham K. Valekunja, Rachel S. Edgar, Malgorzata Oklejewicz, Gijsbertus T. van der Horst, John S. O’Neill, Filippo Tamanini, Daniel J. Turner and Akhilesh B. Reddy* * Correspondence should be addressed to ABR Tel: +44 1223 769038 E-mail: [email protected] Included: Materials and Methods Supplementary Figures S1-S8 Supplementary Tables S1-S7 1 Materials & Methods Chromatin immunoprecipitation (ChIP) All animal experimentation was licensed by the Home Office under the Animals (Scientific Procedures) Act, 1987. Liver tissue was harvested from n=4 adult male C57Bl/6 mice once every 3 hours on the second cycle after transfer from 12L:12DR to DR:DR (L, light [220 µW cm-2] and DR, dim red light [< 5 µW cm-2]) and immediately frozen and then stored at -80°C prior to use. Prior to sampling, animals were stably entrained to a 12 h L: 12 h DR cycle for 3-4 weeks. Liver tissue (30mg per final ChIP) was rapidly chopped into small (approx. 5 mm x 5mm x 2.5mm cubes) whilst defrosting using a sterile scalpel and immediately submerged in 4% formaldehyde (Sigma) and incubated at room temperature with gentle shaking for 10 mins. Glycine (1.25M) was added to a final concentration of 125 mM and incubated for a further 10 mins to quench the formaldehyde. Tissue was then dounce homogenised briefly to break up the tissue and then passed through a 100 µm cell strainer (BD Biosciences) and a cell suspension harvested. The cells were washed in ice cold phosphate-buffered saline (PBS) and then incubated with 2ml Farnham Lysis Buffer (5 mM PIPES pH 8.0, 85 mM KCl, 0.5% NP40, Roche Complete Protease Inhibitor Cocktail) at 4oC for 15 mins to release nuclei. After spinning down, pelleted nuclei were then lysed with 1ml RIPA Buffer (1xPBS, 1% NP40, 0.5% Sodium Deoxycholate, 0.1% SDS, Roche Complete Protease Inhibitor Cocktail) and incubated for a further 15 mins at 4oC. Chromatin was sheared using a Diagenode Bioruptor at 4oC, using conditions optimised to produce 150-300bp fragments with the use of 15 ml Falcon tubes holding 2ml of lysate each (30 cycles of 30 secs on HIGH, 30 secs OFF). Sheared chromatin was transferred to 1.5 ml microcentrifuge tubes and spun at 14,000 rpm for 15 min at 4°C to pellet debris. Cleared supernatants were transferred to clean microcentrifuge tubes and 100 µl from each sample lysate was saved for use as an input control for sequencing and to check fragment size distribution. For each liver from n=4 animals per time-point, duplicate ChIPs were performed with each antibody. ChIP-grade antibodies were purchased from Abcam (UK): anti-H3K4me3 (ab8580), anti-H3K9me3 (ab8898) and anti-Histone H3 (ab1791). 50 µl of Protein G magnetic beads (Dynal/Invitrogen) were washed three times (in 1 ml 1XPBS/1% BSA) and 2 then incubated with 5 µg antibody in 300 µl volumes (diluted in PBS/BSA) for 4 hours at 4oC on a rotator. Excess, or non-specifically bound, antibody was removed by washing a further three times in PBS/BSA. The beads were then added to 900 µl of sheared chromatin in 1.5 ml DNA Lo-bind tubes (Eppendorf) and incubated at 4oC overnight with gentle rotation. Beads were washed six times in 1 ml LiCl Wash Buffer (100 mM Tris, 500 mM LiCl, 1% NP40, 1% Sodium Deoxycholate) for 3 min each, followed by a brief wash in Tris-EDTA (TE) buffer, pH 7.4. The beads were then suspended in TE, transferred to a clean microcentrifuge tube, and TE was removed. 200 µl of IP Elution Buffer (1% SDS and 100 mM NaHCO3) was added at room temperature and then the beads were incubated for 45 mins at 65oC with continuous shaking on a thermomixer (at 800 rpm). The eluate was then removed from the beads and incubated overnight at 65oC to reverse cross-linking. DNA was extracted using a Qiagen Minelute PCR purification kit (using 12 µl of Buffer EB to elute DNA) and then quantified using Picogreen assays (Invitrogen) in a microplate as per the manufacturer’s instructions. Input chromatin was reverse cross-linked in parallel and assayed with a Nanodrop spectrophotometer (because of the much higher DNA concentration) and a sample was run on a 2% agarose gel to check fragment size distributions were correct. Multiplex Library Preparation & Sequencing For H3K4me3, H3K9me3, Histone H3 and input DNA samples, these were prepared for sequencing on an Illumina Genome Analyzer II following the manufacturer’s recommended library preparation protocol using 50 ng of ChIPed DNA, except that a custom adapter was used, the PCR was performed using indexed reverse primers in a high-efficiency amplification step, and the size selection step was performed after the PCR (1-3). For MLL3 ChIP in liver tissue or mouse embryonic fibroblasts (MEFs), standard Illumina indexing primers were used, as per the manufacturer’s instructions. All libraries were multiplexed, and 4 indexed pooled samples (corresponding to four time-points, CT0, 6, 12, 18) sequenced per lane. Bioinformatics: Alignment and Peak Detection Analysis was performed using the Darwin Supercomputer of the University of Cambridge High Performance Computing Service (http://www.hpc.cam.ac.uk/), provided by Dell Inc. using Strategic Research Infrastructure Funding from the Higher Education Funding Council for England. Raw paired-end 50bp reads (in FASTQ format) were aligned to the UCSC mm9 genome build with Bowtie (http://bowtie-bio.sourceforge.net/index.shtml) using pre-built 3 indexes downloaded from the host website (4-6). Parameters were optimised to utilise the software’s multi-threading capabilities (we typically used a 128-core cluster for alignments). Alignment files were then converted from the standard Bowtie output format to ALN files (for use with Cisgenome) using a custom Perl script. Alignments were then analysed using a 2-sample comparison (ChIPed sample vs. Input control for each time-point) with Cisgenome v1, using a cut-off false discovery rate of 10% and a sliding window size of 100 (7-9). Output files were converted into various formats for browsing datasets and to display data. The Cisgenome and UCSC browsers were used for data visualisation, using custom tracks (1, 7, 10). Raw sequence data (FASTQ format), alignments (Bowtie format) and peak data (as Cisgenome/Affymetrix BAR format) are deposited on the NCBI GEO database (Accessions: GSE23550 and GSE37396) and are MINSEQE-compliant. Microarrays Total RNA was isolated from liver samples of C57/Bl6 mice over a circadian time course as previously described (4). Per time point, n=3 biological replicate samples were collected and processed individually. RNA from each individual biological replicate sample was hybridized on an Affymetrix mouse Gene ST1.0 microarray (Accession: GSE37396), using the manufacturer’s protocol. Microarray Data Analysis Microarray analysis was performed using GeneSpring GX 11, with intensity values being normalized using the Robust Multi-array Average (RMA) algorithm. Data from a recent high-temporal resolution microarray study performed by the Hogenesch and Panda laboratories was used to determine the transcriptional profiles of genes with rhythmic histone methylation patterns (7). Genes with statistically significant ChIP-seq peaks at each time- point were checked against a list of rhythmic transcripts and their Affymetrix IDs, COSOPT/Fisher G-test q-values and period estimates were obtained (see Supplementary Table 1). Data were obtained from the NCBI GEO database (Accession: GSE11923) and the associated paper (2, 7). Validation of ChIP with Real-time PCR (qPCR) We performed ChIP on a separate set of liver samples (from animals from the same cohort) using 5 µg per ChIP of the anti-histone antibodies above, and also normal rabbit IgG (Cell Signaling Technology #2729) as a negative control for comparison. We performed real-time 4 PCR using SYBR green master mix (Applied Biosystems) with primers as below. Compared to IgG and input chromatin, all gave a significant (approx. 5-10 fold) enrichment at the positive loci examined, and no enrichment at selected negative loci. Primers were designed with Primer3Plus software using its standard parameters for qPCR, with an amplicon length of 75-125 bp: Histone Time- Forward Primer Reverse Primer Closest Gene Amplicon point size H3K4me3 CT0 TACATGCCAGCGAACAAGAC GCCTAATTGCAGGGAGAAAC Defb7 122 H3K4me3 CT0 TCTGCCTCCTTCAGCAAATC CATCGTTGGTACGGTTCAAG Pdia4 92 H3K4me3 CT6 CCTCCGTTGCCTGAGAGAC GGAGACATAGCTGGGTGGTC Tmem64 94 H3K4me3 CT6 TACACAGATCCTGGGCCTTC CAGCAAAACGCTGAGAACAA A930016P21Rik 96 H3K4me3 CT12 TCATCTAGATTGCGCGACAC TAGATAGTGGCGGGGTTCTG Ipo9 76 H3K4me3 CT12 GCAAGGAGGGAGAAGACACA CGAAGGGTCTCTGAATGCTC Aftph 112 H3K4me3 CT18 CGTGGACCTCACAACATCAT TGGGCTGAACCCAACTTTAC Ndufb5 102 H3K4me3 CT18 GAGGAAGAGGGACCAAAACC GGTTGTTGACACGGACTCCT Tcf25 79 H3K9me3 CT0 CCCTGTCTCGAAAAACCAAA TGGCCATGACAATACCAAAA Zc3h7a 95 H3K9me3 CT0 TGCCTTGAGGAAATGAGCTT CCAGACCACCCAAGCTTAAA 3110007F17Rik 79 H3K9me3 CT6 TCCTTGCCATATTCCAGGTC GAGAAACATCCACTTGACAACG Alkbh8 97 H3K9me3 CT6 GAGGTCCTTGGTCCTGTGAA TCCTCCATCCACCCATTTTA Rbmy1a1 82 H3K9me3 CT12 GACATGAGAGGGAGGGACTG TATGCCCTCATTGCACTTCA C230081A13Rik 93 H3K9me3 CT12 GCCATGCATGTCTAAGTACGC GCGACCAAAGGAACCATAAC Pgk2 81 H3K9me3 CT18 GCATCCATCCCTGAAAAGAC CTGAGACTCACGTTTTCCTTCC Sp110 100 H3K9me3 CT18 TCGGAGGGAACCAGCTACTA CCAGAGGAAACTCTGGTGGA 4631422O05Rik 113 Real-time PCR (qPCR) for gene expression analysis RNA from individual livers (see above ChIP methods) was extracted with TRIzol reagent (Invitrogen) and purified with RNAeasy Mini Kits (Qiagen). Total RNA was then used for reverse transcription via a High Capacity cDNA Archive Kit (Applied Biosystems). The resulting cDNA was then diluted 1:5 and used in duplicate 10 µl PCR reactions according to the manufacturer’s protocol (TaqMan Gene Expression Master Mix, Applied Biosystems) with validated Taqman Gene Expression Assays (Applied Biosystems). For control reactions, mouse β-actin mRNA was amplified from the same samples. Real-time PCR was performed with an ABI 7900HT (Applied Biosystems) system. The relative levels of each mRNA were calculated by the 2-ΔΔCt method (Ct stands for the cycle number at which the signal reaches the threshold of detection) and normalized to the corresponding β-actin mRNA levels.