(Allium Cepa L.) and Welsh Onion (A

Plant Breed. Biotech. 2019 (June) 7(2):151~160 Online ISSN: 2287-9366 https://doi.org/10.9787/PBB.2019.7.2.151 Print ISSN: 2287-9358 RESEARCH ARTICLE

Development of Molecular Markers for Distinguishing Onion (Allium cepa L.) and Welsh Onion (A. fistulosum L.) Based on Polymorphic Mitochondrial Genome Sequences

Bongju Kim, Sunggil Kim* Department of Horticulture, Biotechnology Research Institute, Chonnam National University, Gwangju 61186, Korea

ABSTRACT During seed production of onion (Allium cepa L.) and Welsh onion (A. fistulosum L.) cultivars, seeds are inadvertently cross-contaminated with each other. However, it is difficult to identify cross-contaminated seeds by visual examination since seed and seedling morphologies of onion and Welsh onion are almost identical. To develop molecular markers for distinguishing onion and Welsh onion at early seedling stages, polymorphic mitochondrial genome sequences between two species were isolated. Using complete mitochondrial genome sequences of onions as references, genome walking was performed to isolate polymorphic Welsh onion sequences. Unlike conserved 3ʹ sequences flanking the atp9 gene, the 5ʹ flanking sequences were completely different between onion and Welsh onion mitochondrial genomes. A simple PCR marker was developed on the basis of polymorphic 5ʹ flanking regions of atp9, and a high resolution melting (HRM) marker was developed based on one of single nucleotide polymorphisms (SNPs) in the 3ʹ flanking regions. A total of 41 onion and 19 Welsh onion cultivars were analyzed using these two molecular markers. Results showed that the onion-specific marker genotype was detected only in onion cultivars, and vice versa. To estimate distribution of onion-specific and Welsh onion-specific organizations of atp9 among Allium species, 14 Allium species related to onion and Welsh onion were analyzed. Results showed that specific organizations were conserved among closely related species of onion and Welsh onion, respectively, implying that there might be no intraspecific variation in the atp9 organizations. Keywords Onion (Allium cepa L.), Welsh onions (Allium fistulosum L.), Molecular marker, High resolution melting (HRM), Seed quality control

INTRODUCTION and to protect plant breeders’ rights (Yamashita et al. 2010;

Cebeci and Hanci 2016). To produce F1 hybrid seeds of The genus Allium consists of more than 700 species. onions and Welsh onion varieties, cytoplasmic male- Among them, approximately 20 species have been cul- sterility (CMS) has been used for genetic emasculation of tivated for foods and medicinal plants (Friesen and Klaas maternal parents (Colombo and Galmarini 2017). CMS is 1998; van Raamsdonk et al. 2003). Onion (Allium cepa L.) defined as inability to produce viable pollen grains due to is the second most important vegetable in the world aberrant genes in mitochondrial genomes and is widely following tomato (Griffiths et al. 2002). Welsh onion (A. distributed in many plant species (Laser and Lersten 1972). fistulosum L.) is an important vegetable in East Asian Induction of CMS by aberrant mitochondrial genes is re- countries such as Korea, Japan, and China (Brewster 2008). lated with unusual features of plant mitochondrial genomes

In the case of onion and Welsh onion, proportions of F1 (Schnable and Wise 1998; Budar et al. 2003; Hanson and hybrid cultivars has been increasing to exploit hybrid vigor Bentolila 2004; Kim and Zhang 2018).

Received May 2, 2019; Revised May 18, 2019; Accepted May 18, 2019; Published June 1, 2019 *Corresponding author Sunggil Kim, [email protected], Tel: +82-62-530-2061, Fax: +82-62-530-2069

Copyright ⓒ 2019 by the Korean Society of Breeding Science This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 152 ∙ Plant Breed. Biotech. 2019 (June) 7(2):151~160

Unlike single and circular chloroplast genomes, in vivo sequences, polymorphic organizations between onion and structures of plant mitochondrial genomes remain contro- Welsh onion mitochondrial genomes were identified in this versial (Backert et al. 1997; Oldenburg and Bendich 2001; study to develop molecular markers for distinguishing Allen et al. 2007; Sloan 2013; Skippington et al. 2015). In onion and Welsh onion at early seedling stages. Since seed particular, multipartite subgenomes are commonly present, and seedling morphologies of onion and Welsh onion are and rearrangements among subgenomes have actively oc- hard to distinguish by visual examination, molecular mark- curred through repeat sequence-mediated recombination ers for distinguishing two species are required to identify (Small et al. 1989; Albert et al. 1998; Kmiec et al. 2006; cross-contaminated seeds of onion or Welsh onion culti- Woloszynska and Trojanowski 2009). As a result, organiz- vars during the quality control process of harvested seeds. ations of plant mitochondrial genomes are highly variable However, no report on development of such molecular among related species and even at the intraspecific level markers for distinction of onion and Welsh onion has been (Sakai and Imamura 1993; Bellaoui et al. 1998; Janska et al. published yet. Cross-contamination of seeds of onion and 1998; Arrieta-Montiel et al. 2001; Kim et al. 2007). Mi- Welsh onion sometimes occurs during harvesting seeds in tochondrial genes responsible for CMS are considered to the fields and cleaning harvested seeds at seed conditioning be created by such dynamic rearrangements of plant facilities. mitochondrial genomes (Hanson and Bentolila 2004; Kim and Zhang 2018). CMS in onions is relatively well characterized compared MATERIALS AND METHODS to Welsh onions. Two kinds of CMS (CMS-S and CMS-T) have been reported in the previous studies (Jones and Plant materials and total genomic DNA extraction Emsweller 1936; Jones and Clarke 1943; Berninger 1965; A male-fertile (2702B) and a male-sterile (2702A) Welsh Schweisguth 1973). Almost complete mitochondrial ge- onion breeding lines were used to identify polymorphic nome sequences of normal, CMS-S, and CMS-T cyto- mitochondrial genome organizations between onions and plasms have recently been reported (Kim et al. 2016, Welsh onions. A cetyl trimethylammonium bromide (CTAB) 2019). A chimeric gene, orf725 was suggested to be a causal method (Doyle and Doyle 1987) was used to extract total gene for CMS in both CMS-S and CMS-T cytoplasms. genomic DNAs from leaf tissues of two breeding lines after Compared with normal male-fertile cytoplasm, CMS-S male-fertility phenotypes had been confirmed. A total of 41 mitochondrial genome was highly variable, and many poly- onion and 19 Welsh onion cultivars were used to validate morphisms have been found (Kim et al. 2016). Meanwhile, reliability of molecular markers developed in this study. there were only three single nucleotide polymorphisms Lists of onion and Welsh onion cultivars analyzed in this (SNPs) between normal and CMS-T mitochondrial geno- study are shown in Supplementary Tables S1 and S2, me sequences, except for orf725 which was detected only respectively. Total genomic DNAs were extracted from in the CMS-T cytoplasm (Kim et al. 2019). seedlings of three-to-four leaf stages using a CTAB met- One type of CMS was discovered from Welsh onion hod. A total of 14 Allium species closely related to onion accessions (Moue and Uehara 1985), but this CMS has not and Welsh onion were used to estimate distribution of been widely used in F1 hybrid breeding due to susceptibility specific atp9 organizations. A list of these Allium species is to several diseases (Yamashita et al. 2010). Another type of shown in Supplementary Table S3. One accession for each CMS has been produced by introduction of cytoplasm of A. Allium species was used. Total genomic DNAs extracted galanthum (Yamashita et al. 1999). However, molecular by a previous study (Kim 2013) were used. genetic information about mitochondrial genome sequences and CMS-inducing genes are very limited in Welsh Identification of conserved mitochondrial genomic onions. regions among three onion cytoplasm types Using well characterized onion mitochondrial genome To identify conserved syntenic blocks among three onion Marker Development for Distinguishing Onion and Welsh Onion ∙ 153

mitochondrial genomes, complete mitochondrial genome dure consisted of an initial denaturation step at 95℃ for 5 sequences produced in the previous studies (Kim et al. minutes; 40 cycles at 95℃ for 30 seconds, 65℃ for 30 2016, 2019) were used. A single circular sequence of CMS-S seconds, and 72℃ for 1 minute, and a final 10 minute (GenBank accession: KU318712) and four scaffold se- extension step at 72℃. PCR products were visualized on quences of normal mitochondrial genome (GenBank ac- 1.5% agarose gels after ethidium bromide staining. cessions MH548362-MH548365) were compared. In the For analysis of an HRM marker, HRM analysis was case of CMS-T whose mitochondrial genome sequences performed in 20-μL reaction mixture containing 0.05 μg were almost identical to those of normal cytoplasm, add- template, 2.0 μL 10× PCR buffer, 1.0 μL forward primer itional organization flanking orf725 depicted by Kim et al. (10 μM), 1.0 μL reverse primer (10 μM), 1.0 μL dNTPs (10 (2019) was used for comparison. mM each), 0.25 U Taq polymerase (Prime Tag DNA polymerase; GeNet Bio), and 1.0 μL 100-fold diluted Genome walking and sequencing of PCR products SYTO®9 green fluorescent nucleic acid stain (Thermo Genome walking was performed to obtain flanking Fisher Scientific, Waltham, MA, USA). Primer sequences sequences of atp9 of both male-fertile and male-sterile are shown in Table 1. Welsh onion breeding lines (2702B and 2702A) using a PCR amplification was carried out with a condition Universal GenomeWalker kit (Clontech, Palo Alto, CA, consisting of an initial denaturation step at 95℃ for 10 USA) according to the manufacturer’s instruction. PCR minutes and 45 cycles at 95℃ for 10 seconds, 60℃ for 5 products of genome walking were visualized on 1.5% seconds, and 72℃ for 5 seconds. Next, PCR products were agarose gels after ethidium bromide staining. Next, PCR heated to 95℃ with a ramp rate of 4.4℃/s, cooled to 40℃ products were purified using a QIAquick PCR Purification with a ramp rate of 2.2℃/s, and heated again to 65℃ with kit (QIAGEN, Valencia, CA, USA). Sequencing of PCR a ramp rate of 2.2℃/s. Normalized HRM curves and peaks products was performed by a specialized company (Macro- were obtained with a LightCycler® 96 system (Roche Mo- gen, Seoul, Republic of Korea). lecular Systems, Pleasanton, CA, USA) by melting from 65 to 97℃ at a rate of 0.07℃/s. Analysis of molecular markers using simple PCR amplification and high resolution melting (HRM) Construction of phylogenetic trees analysis Nucleotide sequences of atp9 and its 3ʹ flanking regions For analysis of a simple PCR marker, PCR amplification of three onions (normal, CMS-T, and CMS-S) and two was performed in a 10 μL reaction mixture containing 0.05 Welsh onion breeding lines (2702B and 2702A) were used μg template, 1.0 μL 10× PCR buffer, 0.2 μL of two forward to estimate phylogenetic relationship of these sequences. primers, M1-F1 and M1-F2 (10 μM), 0.2 μL reverse Onion sequences were obtained from complete mitochon- primer, M1-R1 (10 μM), 0.2 μL dNTPs (10 mM each), and drial genome sequences (Kim et al. 2016, 2019). To con- 0.25 U Taq DNA polymerase (Prime Tag DNA poly- struct a phylogenetic tree of 16 Allium species, chloroplast merase; GeNet Bio, Nonsan, Republic of Korea). Primer sequences between rps16 and trnQ were used. These chloro- sequences are shown in Table 1. PCR amplification proce- plast sequences of 16 Allium species were obtained from a

Table 1. Primer sequences of molecular markers developed in this study. Primer name Primer sequence (5ʹ to 3ʹ) Molecular marker Size of PCR products M1-F1 GGTCCCTAGGCGCGTAAATACCCCAGT Simple PCR marker 730 bp (Onions) M1-F2 TAAAGCTGGCAAGAGGAGACCGATCCA 325 bp (Male-sterile Welsh onion) M1-R1 GAGCAAAGCCCAAAATGGCATAACCA 327 bp (Male-fertile Welsh onion) M2-F1 TTCCTTAGAGCTATGAATTGTGTGA HRM marker 52 bp M2-R1 TTAACCACTTAACCGAGAACAGT 154 ∙ Plant Breed. Biotech. 2019 (June) 7(2):151~160

previous study (Kim 2013). In both cases of mitochondrial morphologies of cotyledons (Fig. 1B, 1D). Therefore, mo- and chloroplast genome sequences, nucleotide sequences lecular markers for distinguishing onion and Welsh onion were aligned using BioEdit software (Hall 1999). Gaps in at early seedling stages would be useful to test whether the alignment were removed using Gblocks software onion or Welsh onion seeds are contaminated with each (Castresana 2000). Phylogenetic trees were constructed other and to estimate proportions of contamination in seeds using MEGA version 7 (Kumar et al. 2016) with a neighbor- which are sampled for quality control. joining method. Node support of the phylogenetic tree was For universal application of molecular markers to all assessed by 1,000 bootstrap replicates. onion and Welsh onion cultivars, differential regions in mitochondrial genomes were selected as target sequences for development of molecular markers. Complete onion RESULTS mitochondrial genome sequences of normal (339,180 bp), CMS-T (359,188 bp), and CMS-S (316,363 bp) cytoplasms Identification of onion-specific and welsh (Kim et al. 2016, 2019) were compared to screen the genes onion-specific regions in mitochondrial genome whose 5ʹ and 3ʹ flanking sequences were conserved among sequences three onion mitochondrial genomes. Among them, the atp9 During the process of seed production of cultivars, seeds gene was selected as a target gene for marker development, of onion and Welsh onion are sometimes mixed with each since flanking regions of atp9 was prone to be involved in other. However, contaminated seeds cannot be distinguish- frequent mtDNA rearrangements. For an example, partial ed by morphological difference. Seed morphologies of sequences of atp9 was involved in creation of a chimeric onion and Welsh onions were almost indistinguishable by gene, orf725 in onions (Kim et al. 2009). visual examination (Fig. 1A, 1C). Furthermore, it was Genome walking was performed to isolate flanking difficult to distinguish onions and Welsh onions based on sequences of atp9 in mitochondrial genomes of Welsh onions. From a male-fertile Welsh onion, 527-bp 5ʹ and 755-bp 3ʹ flanking sequences were obtained (Fig. 2). Al- though 3ʹ flanking sequences of onions and Welsh onions showed more than 98% nucleotide sequence identity, the 5ʹ flanking sequences were completely different between onions and Welsh onions (Fig. 2). The partial (485 bp) sequences covering the 5ʹ flanking region of Welsh onion atp9 were identified from onion mitochondrial genome of the CMS-S cytoplasm. Although this 485-bp region showed 100% nucleotide sequence identity with corresponding onion sequences, this region was separated from atp9 with a distance of 152,572 bp in onion mitochondrial genome of the CMS-S cytoplasm (GenBank accession: KU318712). Based on the flanking sequences of atp9 in a male-fertile Welsh onion, homologous sequences were isolated from a male-sterile Welsh onion. The organization was identical to that of the male-fertile Welsh onion, but there were two SNPs and one 2-bp InDel between male-fertile and male- Fig. 1. Seed and cotyledon morphologies of onion and sterile Welsh onions. In the case of onions, sequences Welsh onion. (A) Onion seeds. (B) 14-day-old onion cotyledons. (C) Welsh onion seeds. (D) 14-day- flanking atp9 were identical between normal and CMS-T old Welsh onion cotyledons. cytoplasms, but there were two SNPs in the 5ʹ flanking Marker Development for Distinguishing Onion and Welsh Onion ∙ 155

Fig. 2. Organizations of mitochondrial genome sequences flanking the atp9 genes in onion and Welsh onion. Arrow- shaped boxes indicate genes and 5ʹ-to-3ʹ direction. Homologous regions connected with vertical lines are shown with same patterns or colors. The nucleotides on vertical arrows indicate genotypes of the SNP used in developing an HRM marker. Horizontal arrows indicate primer-binding sites.

plified in both onions and Welsh onions when PCR am- plifications were performed using a combination of three primers (Fig. 4A). In addition, an optimal HRM marker was designed using one of the SNPs between onion and Welsh onion in the 3ʹ flanking region of atp9 (Fig. 2). Normalized melting curves and peaks of onion and Welsh onions were clearly separated (Fig. 4B). To validate appli- cability of simple PCR and HRM markers, 41 onion and 19 Welsh onion cultivars were tested using these two molecular markers. As expected, onion-specific PCR products Fig. 3. Phylogenetic tree constructed using nucleotide se- and HRM peaks were observed in all tested onion cultivars quences of atp9 and its 3ʹ flanking sequences of (Supplementary Table S1). Likewise, marker types speci- onions and Welsh onions. MS: male-sterile, MF: male-fertile. fic to Welsh onion were detected only in Welsh onion cultivars (Supplementary Table S2). region between normal and CMS-S cytoplasms. When onion and Welsh onion sequences were compared, there Distribution of onion and Welsh onion-specific were six SNPs and two InDels, implying that interspecific sequences flanking the atp9 gene in closely related genetic distances between onion and Welsh onions were Allium species longer than intraspecific distances (Fig. 3). To ascertain the time when rearrangements in the 5ʹ flanking regions of atp9 have been arisen in onion or Welsh Development of molecular markers for distinguishing onion mitochondrial genomes, 14 Allium species related onion and Welsh onion with onion and Welsh onion were analyzed with the simple To develop a simple PCR marker, a common reverse PCR marker. The onion-specific PCR products were am- primer (M1-R1) was designed on the atp9 coding se- plified in five (A. praemixtum, A. vavilovii, A. dictyoprasum, quences, and one Welsh onion-specific forward primer A. roylei, and A. galanthum) closely related Allium species, (M1-F1) and another onion-specific forward primer (M1- while Welsh onion-specific PCR products were amplified F2) were designed on the unique regions, respectively (Fig. in three (A. altaicum, A. ledebourianum, and A. schoeno- 2). Single PCR products with expected sizes were am- prasum) closely related Allium species (Fig. 5). In the case 156 ∙ Plant Breed. Biotech. 2019 (June) 7(2):151~160

Fig. 4. Molecular markers for distinguishing onion and Welsh onion. (A) PCR products of the simple PCR marker. N: normal, T: CMS-T, S: CMS-S, MF: male-fertile, MS: male-sterile. (B) Normalized HRM curve and peak patterns of the HRM marker. Six samples from each onion and Welsh onion were used for validation of the HRM marker. of relatively distantly related species, PCR products were onion-specific organizations of atp9 might have existed in generally not as intense as closely related species due to common ancestors of these related Allium species. possible mismatches on primer-binding sites (Fig. 5B), and even no PCR product could be amplified in A. amphibolum. Despite low efficiency of PCR amplification, the onion- DISCUSSION specific PCR product was observed in A. saxatile, but the Welsh onion-specific PCR products were amplified in A. Development of reliable molecular markers for hymenorrhizum and A. oreoprasum. Interestingly, both distinguishing onion and Welsh onion based on onion-specific and Welsh onion-specific PCR products polymorphic mitochondrial genome sequences were identified in A. bidentatum and A. splendens (Fig. 5B). Polymorphisms in mitochondrial genome sequences These results implied that both onion-specific and Welsh were used to develop molecular markers for distinguishing Marker Development for Distinguishing Onion and Welsh Onion ∙ 157

Fig. 5. Distribution of onion-specific and Welsh onion-specific atp9 organizations among closely related Allium species. (A) Phylogenetic tree of 16 Allium species constructed using chloroplast genome sequences between rps16 and trnQ. Blue and red circles indicate onion-specific and Welsh onion-specific atp9 organizations, respectively. (B) PCR products of 16 Allium species amplified using the simple PCR marker. 1: onion (Normal), 2: onion (CMS-T), 3: A. praemixtum, 4: A. dictyoprasum, 5: A. vavilovii, 6: A. roylei, 7: onion (CMS-S), 8: A. galanthum, 9: A. altaicum, 10: A. ledebourianum, 11: A. fistulosum, 12: A. schoenoprasum, 13: A. splendens, 14: A. hymenorrhizum, 15: A. saxatile, 16: A. bidentatum, 17: A. amphibolum, 18: A. oreoprasum. onion and Welsh onion in this study. Since nuclear genome of normal, CMS-T, and CMS-S cytoplasms of onions were sequences are assumed to be highly variable depending on reported in our previous studies (Kim et al. 2015, 2016, accessions and cultivars, it might be difficult to develop 2019). molecular markers which can be applied to all varieties. Compared with highly variable mitochondrial genomes, Therefore, mitochondrial or chloroplast genomes are likely the content and organization of genes were conserved to be suitable for development of universal markers. among three onion chloroplast genomes (Kim et al. 2015). Complete chloroplast and mitochondrial genome sequences In contrast, organizations of normal and CMS-S mito- 158 ∙ Plant Breed. Biotech. 2019 (June) 7(2):151~160

chondrial genomes were highly rearranged with 31 synte- cultivars. Cross-contamination of seeds might happen at nic blocks (Kim et al. 2019). Therefore, mitochondrial two stages of seed production. First, seeds can be con- genomes were selected to develop a simple PCR marker of taminated during harvest in seed production fields if onion which genotypes could be analyzed using agarose gels and Welsh onion fields are closely located. Second, seeds without expensive equipment. In addition, the SNP posi- can be inadvertently introduced during cleaning and con- tioned on the 3ʹ region of atp9 was used to develop an HRM ditioning of harvested seeds at seed conditioning facilities. marker optimal for high-throughput analysis. Unless seeds are completely removed from a series of To estimate the time when rearrangements in the 5ʹ equipment at seed conditioning factories, cross-contamin- region of atp9 have occurred, 14 Allium species relatively ation is inevitable. Therefore, molecular markers develop- closely related to onion and Welsh onion were analyzed ed in this study can be efficiently used to detect cross- using the simple PCR marker developed in this study (Fig. 5). contaminated seeds during quality control process. Onion-specific and Welsh onion-specific PCR products Although all tested onion and Welsh onion cultivars were amplified in five and four Allium species which were contained their own cytoplasms in this study, some onion closely related to onion and Welsh onion, respectively. or Welsh onion accessions have been produced by inter- However, both onion-specific and Welsh onion-specific specific crosses between different Allium species. For PCR products were detected among four relatively dis- examples, onion accessions resistant to downy mildew tantly related Allium species. have been produced by interspecific crosses between onion It is hypothesized that both onion-specific and Welsh and A. roylei (Kofoet et al. 1990; van der Meer and de Vries onion-specific organizations of atp9 might have existed in 1990). In addition, CMS Welsh onions have been produced common ancestors of these 14 Allium species. ‘Hetero- by interspecific crosses between A. galanthum and Welsh plasmy’, defined as presence of more than one type of onions (Yamashita et al. 1999). Since hybrid plants are mitochondrial genomes in an organism is considered to be known to be produced between onions and other Allium a common state of plant mitochondrial genomes (Kmiec et species such as A. galanthum, A. fistulosum, A. vavilovii, al. 2006; Gualberto and Newton 2017). However, during and A. roylei (van Raamsdonk et al. 2003), supplementary divergence of Allium species, the onion-specific organiz- molecular markers for detecting such interspecific hybrids ation is assumed to be predominant in onions and five are required to be developed in the future. related species. A similar phenomenon might occur in Welsh onion and three related species. Since the onion- specific organization was observed in normal and CMS-S ACKNOWLEDGEMENTS cytoplasms of onions and even in five related Allium species, the Welsh onion-specific PCR products may not This research was supported by Korea Institute of be amplified in any onion varieties, indicating high reli- Planning and Evaluation for Technology in Food, Agri- ability of molecular markers developed in this study. In culture and Forestry (IPET) through Agriculture, Food and fact, no Welsh onion-specific PCR products were am- Rural Affairs Research Center Support Program (Vege- plified in all tested onion cultivars in this study. table Breeding Research Center) funded by the Ministry of Agriculture, Food and Rural Affairs (710011-03), Golden Application of molecular markers for distinguishing Seed Project (Center for Horticultural Seed Development, onion and Welsh onion in seed production of onion No 213007-05-3-SBB10), and a grant from the Next-Gene- and Welsh onion cultivars ration BioGreen 21 Program (Plant Molecular Breeding Since seed and seedling morphologies of onion and Center No. PJ013400). The authors thank Ji-wha Hur, Welsh onion are almost indistinguishable by visual exam- Jeong-Ahn Yoo, and Su-jung Kim for their dedicated tech- ination (Fig. 1), cross-contaminated seeds cannot be identi- nical assistance. fied during seed production of onion and Welsh onion Marker Development for Distinguishing Onion and Welsh Onion ∙ 159

REFERENCES Genet. Resour. Crop Ev. 45: 511-523. Griffiths G, Trueman L, Crowther T, Thomas B, Smith B. Albert B, Godelle B, Gouyon PH. 1998. Evolution of the plant 2002. Onions-A global benefit to health. Phytother. Res. mitochondrial genome: dynamics of duplication and de- 16: 603-615. letion of sequences. J. Mol. Evol. 46: 155-158. Gualberto JM, Newton KJ. 2017. Plant mitochondrial genomes: Allen JO, Fauron CM, Mink P, Roark L, Oddiraju S, Lin GN, dynamics and mechanisms of mutation. Annu. Rev. Plant et al. 2007. Comparisons among two fertile and three Biol. 68: 225-252. male-sterile mitochondrial genomes of maize. Genetics Hall TA. 1999. BioEdit: a user-friendly biological sequence 177: 1173-1192. alignment editor and analysis program for Window 95/ Arrieta-Montiel M, Lyznik A, Woloszynska M, Janska H, 98/NT. Nucl. Acids Symp. Ser. 41: 95-98. Tohme J, Mackenzie SA. 2001. Tracing evolutionary and Hanson MR, Bentolila S. 2004. Interactions of mitochondrial developmental implications of mitochondrial stoichio- and nuclear genes that affect male gametophyte develop- metric shifting in the common bean. Genetics 158: 851- ment. Plant Cell 16: S154-S169. 864. Janska H, Sarria R, Woloszynska M, Arrieta-Montiel M, Backert S, Neilsen BL, Börner T. 1997. The mystery of the Mackenzie SA. 1998. Stoichiometric shifts in the com- rings: structure and replication of mitochondrial genomes mon bean mitochondrial genome leading to male sterility from higher plants. Trends Plant Sci. 2: 477-483. and spontaneous reversion to fertility. Plant Cell 10: Bellaoui M, Martin-Canadell A, Pelletier G, Budar F. 1998. 1163-1180. Low-copy-number molecules are produced by recombi- Jones HA, Clarke A. 1943. Inheritance of male sterility in the nation, actively maintained and can be amplified in the onion and the production of hybrid seed. Proc. Amer. mitochondrial genome of Brassicaceae: relationship to Soc. Hort. Sci. 43: 189-194. reversion of the male sterile phenotype in some cybrids. Jones HA, Emsweller SL. 1936. A male-sterile onion. Proc. Mol. Gen. Genet. 257: 177-185. Am. Soc. Hort. Sci. 34: 582-585. Berninger E. 1965. Contribution à l’étude de la sterilité mâle Kim B, Kim K, Yang T, Kim S. 2016. Completion of the de l’oignon (Allium cepa L.). Ann. Amélior. Plantes 15: mitochondrial genome sequence of onion (Allium cepa 183-199. L.) containing the CMS-S male-sterile cytoplasm and

Brewster JL. 2008. Onions and other vegetable Alliums. CAB identification of an independent event of the ccmFN gene international, Wallingford, UK. split. Curr. Genet. 62: 873-885. Budar F, Touzet P, De Paepe R. 2003. The nucleo-mitochon- Kim B, Yang T, Kim S. 2019. Identification of a gene respon- drial conflict in cytoplasmic male sterilities revised. sible for cytoplasmic male-sterility in onions (Allium Genetica 117: 3-16. cepa L.) using comparative analysis of mitochondrial Castresana J. 2000. Selection of conserved blocks from multi- genome sequences of two recently diverged cytoplasms. ple alignments for their use in phylogenetic analysis. Theor. Appl. Genet. 132: 313-322. Mol. Biol. Evol. 17: 540-552. Kim S, Lee E, Cho DY, Han T, Bang H, Patil BS, et al. 2009. Cebeci E, Hanci F. 2016. Male sterility applications in Allium. Identification of a novel chimeric gene, orf725, and its Acta. Hortic. 1145: 51-55. use in development of a molecular marker for distingui- Colombo N, Galmarini CR. 2017. The use of genetic, manual shing three cytoplasm types in onion (Allium cepa L.). and chemical methods to control pollination in vegetable Theor. Appl. Genet. 118: 433-441. hybrid seed production: a review. Plant Breeding 136: Kim S, Lim H, Park S, Cho K, Sung S, Oh D, et al. 2007. 287-299. Identification of a novel mitochondrial genome type and Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure development of molecular makers for cytoplasm classi- for small quantities of fresh leaf tissue. Phytochem. Bull. fication in radish (Raphanus sativus L.). Theor. Appl. 19: 11-15. Genet. 115: 1137-1145. Friesen N, Klaas M. 1998. Origin of some minor vegetatively Kim S, Park J, Yang T. 2015. Comparative analysis of the propagated Allium crops studied with RAPD and GISH. complete chloroplast genome sequences of a normal 160 ∙ Plant Breed. Biotech. 2019 (June) 7(2):151~160

male-fertile cytoplasm and two different cytoplasms con- Schweisguth B. 1973. Étude d’un nouveau type de stérilité ferring cytoplasmic male sterility in onion (Allium cepa male chez l’oignon, Allium cepa L. Ann. Amélior. Plantes L.). J. Hortic. Sci. Biotechnol. 90: 459-468. 23: 221-233. Kim S. 2013. Identification of hypervariable chloroplast Skippington E, Barkman TJ, Rice DW, Palmer JD. 2015. intergenic sequences in onion (Allium cepa L.) and their Miniaturized mitogenome of the parasitic plant Viscum use to analyse the origins of male-sterile onion cytotypes. scurruloideum is extremely divergent and dynamic and J. Hortic. Sci. Biotechnol. 88: 187-194. has lost all nad genes. Proc. Natl. Acad. Sci. U. S. A. 112: Kim Y, Zhang D. 2018. Molecular control of male fertility for E3515-E3524. crop hybrid breeding. Trends Plant Sci. 23: 53-65. Sloan DB. 2013. One ring to rule them all? Genome se- Kmiec B, Woloszynska M, Janska H. 2006. Heteroplasmy as quencing provides new insights into the 'master circle' a common state of mitochondrial genetic information in model of plant mitochondrial DNA structure. New Phy- plants and animals. Curr. Genet. 50: 149-159. tol. 200: 978-985. Kofoet A, Kik C, Wietsma WA, de Vries JN. 1990. Inheri- Small I, Suffolk R, Leaver CJ. 1989. Evolution of plant mito- tance of resistance to downy mildew (Peronospora destruc- chondrial genomes via substoichiometric intermediates. tor [Berk.] Casp.) from Allium roylei Stearn in the Cell 58: 69-76. backcross Allium cepa L. X (A. roylei X A. cepa). Plant van der Meer QP, de Vries JN. 1990. An interspecific cross Breeding 105: 144-149. between Allium roylei Stearn and Allium cepa L., and its Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular backcross to A. cepa. Euphytica 47: 29-31. evolutionary genetics analysis version 7.0 for bigger van Raamsdonk LWD, Ensink W, van Heusden AW, Vrielink- datasets. Mol. Biol. Evol. 33: 1870-1874. van Ginkel M, Kik C. 2003. Biodiversity assessment Laser KD, Lersten NR. 1972. Anatomy and cytology of based on cpDNA and crossability analysis in selected microsporogenesis in cytoplasmic male sterile angio- species of Allium subgenus Rhizirideum. Theor. Appl. sperms. Bot. Rev. 38: 425-454. Genet. 107: 1048-1058. Moue T, Uehara T. 1985. Inheritance of cytoplasmic male Woloszynska M, Trojanowski D. 2009. Counting mtDNA sterility in Allium fistulosum L. (Welsh onion). J. Jpn. molecules in Phaseolus vulgaaris: sublimons are con- Soc. Hortic. Sci. 53: 432-437. stantly produced by recombination via short repeats and Oldenburg DJ, Bendich AJ. 2001. Mitochondrial DNA from undergo rigorous selection during substoichiometric the Liverwort Marchantia polymorpha: Circularly per- shifting. Plant Mol. Biol. 70: 511-521. muted linear molecules, head-to-tail concatemers, and a Yamashita K, Arita H, Tashiro Y. 1999. Cytoplasm of a wild 5’ protein. J. Mol. Biol. 310: 549-562. species, Allium galanthum Kar. et Kir., is useful for Sakai T, Imamura J. 1993. Evidence for a mitochondrial developing the male sterile line of A. fistulosum L. J. Jpn. sub-genome containing radish AtpA in a Brassica napus Soc. Hort. Sci. 68: 788-797. cybrid. Plant Sci. 90: 95-103. Yamashita K, Tsukazaki H, Kojima A, Ohara T, Wako T. Schnable PS, Wise RP. 1998. The molecular basis of cyto- 2010. Inheritance mode of male sterility in bunching plasmic male sterility and fertility restoration. Trends onion (Allium fistulosum L.) accessions. Euphytica 173: Plant Sci. 3: 175-180. 357-367.