Transcriptional Regulation of Estrogen Receptor-A by P53 in Human Breast Cancer Cells

Published OnlineFirst April 7, 2009; DOI: 10.1158/0008-5472.CAN-08-3628

Research Article

Transcriptional Regulation of Estrogen Receptor-A by p53 in Human Breast Cancer Cells

Stephanie Harkey Shirley, Joyce E. Rundhaug, Jie Tian, Noirin Cullinan-Ammann, Isabel Lambertz, Claudio J. Conti, and Robin Fuchs-Young

The University of Texas M. D. Anderson Cancer Center, Science Park Research Division, Smithville, Texas

Abstract tumors, response to antiestrogen treatment, and disease-free Estrogen receptor A (ER) and p53 are critical prognostic survival (4, 5). In contrast, ER-negative tumors are more likely to indicators in breast cancer. Loss of functional p53 is recur, develop metastases, and to have markers of poor prognosis, including high tumor grade and proliferative index and inactivating correlated with poor prognosis, ER negativity, and resistance to antiestrogen treatment. Previously, we found that p53 mutations in p53 (4–12). genotype was correlated with ER expression and response to Mutations in the p53 tumor suppressor gene are frequently tamoxifen in mammary tumors arising in mouse mammary associated with human malignancies, including 20% to 40% of tumor virus–Wnt-1 transgenic mice. These results lead us to breast cancers (7, 8). Stabilization of wild-type (WT) p53 in hypothesize that p53 may regulate ER expression. To test this, response to DNA damage promotes cell cycle arrest and apoptosis, MCF-7 cells were treated with doxorubicin or ionizing whereas mutations in p53 lead to tumorigenesis and multiple drug radiation, both of which stimulated a 5-fold increase in p53 resistance in breast cancer (13–15). Like many other transcription expression. ER expression was also increased 4-fold over a 24- factors, regulation of gene expression by p53 is mediated both by h time frame. In cells treated with small interfering RNA direct binding to target gene promoters and interaction with other (siRNA) targeting p53, expression of both p53 and ER was nuclear proteins such as activator protein, CCAAT binding protein significantly reduced (>60%) by 24 h. Induction of ER by DNA- (CBP), and Sp1 (16, 17). The diverse nature of p53 target genes damaging agents was p53 dependent as either ionizing shows p53 involvement in various pathways, including cell cycle control (cyclin G and p21), angiogenesis (GD-AIF and thrombo- radiation or doxorubicin failed to up-regulate ER after treatment with p53-targeting siRNA. To further investigate spondin), DNA repair (GADD45), growth factor signaling (IGF- whether p53 directly regulates transcription of the ER gene BP3), and apoptosis (bax and FAS; ref. 16). promoter, MCF-7 cells were transiently transfected with a Animal experiments performed in our laboratory showed that wild-type (WT) p53 expression vector along with a luciferase p53 genotype correlated with ER expression and response to reporter containing the proximal promoter of ER. In cells tamoxifen in mammary tumors arising in mouse mammary tumor transfected with WT p53, transcription from the ER promoter virus–Wnt-1 transgenic mice. Compared with tumors in p53 WT (+/+) mice, both ER mRNA and protein were significantly reduced was increased 8-fold. Chromatin immunoprecipitation assays À showed that p53 was recruited to the ER promoter along with in tumors from p53 (+/ ) mice and further reduced in tumors that CARM1, CBP, c-Jun, and Sp1 and that this multifactor had a complete loss of p53 due to loss of heterozygosity, suggesting that expression of these two proteins is linked in mammary complexwas formed in a p53-dependent manner. These data 1 show that p53 regulates ER expression through transcrip- cancer. Therefore, we hypothesized that p53 regulates ER tional control of the ER promoter, accounting for their expression. This relationship would be expected to affect concordant expression in human breast cancer. [Cancer Res expression of prognostic factors, including ER and progesterone 2009;69(8):3405–14] receptor, as well as tumor development and progression. In this study, we report that p53 regulates expression of ER in breast cancer cells. Our results show that ER gene transcription is Introduction regulated by p53 binding to the proximal promoter in conjunction with other transcriptional cofactors, including CARM1, CBP, c-Jun, a Estrogen receptor (ER) plays a critical role in normal breast and Sp1. Our results also provide mechanistic insight into clinical development and is also involved in the pathogenesis of breast data demonstrating the coexpression of WT p53 and ER in human cancer (1, 2). ER expression defines a subset of cancer patients who, breast cancers (9–12). in general, have a better prognosis than patients with ER-negative tumors (3). Epidemiologic studies show a strong correlation Materials and Methods between ER expression and other positive indicators, such as lower tumor grade and proliferative index. In addition, there is a Tissue culture. MCF-7, MDA-MB-453, and ZR75.1 human breast cancer well-established relationship between ER expression in breast cells were maintained in phenol red–free DMEM or RPMI supplemented with 5% (v/v) fetal bovine serum (FBS) in 5% CO2 at 37jC. Cells were plated in phenol red–free DMEM/RMPI containing 5% (v/v) dextran-coated Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). Requests for reprints: Robin Fuchs-Young, The University of Texas M. D. Anderson Cancer Center, Science Park Research Division, Department of Carcinogenesis, P.O. Box 389, Smithville, TX 78957. Phone: 512-237-9547; Fax: 512-237-2990; E-mail: rfyoung@ mdanderson.org. 1 R. Fuchs-Young, I. Lambertz, J.K.L. Colby, S.H. Shirley, D. Johnston, L.A. I2009 American Association for Cancer Research. Donehower, S.D. Hursting. Evidence for interdependence of ER expression and p53 doi:10.1158/0008-5472.CAN-08-3628 genotype in mouse mammary tumors that respond to tamoxifen, in submission. www.aacrjournals.org 3405 Cancer Res 2009; 69: (8). April 15, 2009

Cancer Research charcoal-stripped FBS to ensure steroid-free conditions. At 60% to 80% the other was incubated with antibody and protein A/G beads (Pierce). confluence, cells were treated as indicated in figure legends. Doxorubicin After IP, beads were washed four times with IP buffer [0.1% SDS, 1% Triton was obtained from Tocris Bioscience. X-100, 2 mmol/L EDTA (pH 8), 150 mmol/L NaCl, and 20 mmol/L Tris-HCl]

P53 small interfering RNA constructs and expression vectors. The and eluted in sample elution buffer (1% SDS, 100 mmol/L NaHCO3). For small interfering (si)RNA constructs used were siGENOME SMARTpool PCR, the p21 promoter was used as a positive control (forward, siRNA reagents targeting p53 or negative controls, including scrambled CCAGCCCTTGGATGGTTT; reverse, GCCTCCTTTCTGTGCCTGA). Primers sequence and lamin A–targeting siRNA constructs (Thermo Fisher used for PCR from the ER promoter regions were as follows: À2094 to Scientific). For transfection using a 6-well plate, siRNA (from 20nmol/L À1941: forward, CTGCAAAATG CTCCCAAAGT; reverse, TGTTTGGTAT- stock) or plasmid DNA (from 1 Ag/AL stock) was mixed with Lipofectamine GAAAAGGTCACA; À350to À289: forward, GGGGAGATCTAACAGAAAGA- 2000 (Invitrogen) in serum-free DMEM with 1% bovine serum albumin. GAGACAA; reverse, CCCTAGATCTGTCTTTCGCG TTTAT, À128 to À40: After incubating for 15 min, solutions were added to the cells. Twenty-four forward, GGGAGATCTGCCTGGAGTGATGTTTAAG; reverse, TATGA- hours after transfection, cells were treated with doxorubicin (0–100 nmol/L) GATCTGGAGACCAGTACTTAAAG. Identical analyses on the human or ionizing radiation (0–16 Gy) as indicated in figure legends. The GAPDH, TATA binding protein, and a-actin promoters were included as WT (pC53-SN3) p53 expression vector was a kind gift from Dr. Bert controls (GAPDH: forward, GTCCACTGGCGTGTTCACCA; reverse- Vogelstein (Johns Hopkins University, Baltimore, MD; ref. 7). GTGGCAGTGATGGCATGGAC; TATA binding protein: forward, GACC- Luciferase assays. MCF-7 or MDA-MB-453 cells were transiently TATGCTCACACTTCTCATGG; reverse, GAACCTGCCCGACCTCACTGAA; cotransfected with a luciferase reporter construct containing the ER Actin, forward-TCGATATCCACGTGACATCCA; reverse, GCAGCATTTTTT- promoter and WT p53 expression vectors. The ERpromLuc vector was a TACCCCCTC). For ChIP studies with doxorubicin-treated cells, MCF-7 cells kind gift from Dr. Ronald Weigel (University of Iowa, Iowa City, Iowa; were treated with 50nmol/L doxorubicin 4 h before ChIP analysis. ref. 18) and contained the ER proximal promoter region from À3500 bp to Antibodies against CARM1, c-Jun, c-Fos, and Sp1 were from Upstate +210bp relative to the transcription start site. Approximately 5 Â 103 cells (Millipore). CBP and p53 antibodies were from Santa Cruz Biotechnologies. per well in a 96-well plate were transfected and/or treated as indicated. The HDM2 antibody was obtained from Cell Signaling Technologies, and Luciferase activity was measured using a luciferase assay kit (Promega). the RNA polymerase II antibody was obtained from Active Motif. Protein The assay was normalized by cotransfection of a pCMV-h-gal plasmid levels of p53 and associated cofactors were determined by immunoblot with (Clontech) and h-galactosidase activity was measured using a h-gal assay antibodies against p53, CARM1, CBP, c-Jun, c-Fos, HDM2, or Sp1 followed by kit (Galacto-Light; Applied Biosystems). The control empty vector used densitometry as described above. was pGL2 basic from Promega. Statistical analysis. All experiments were performed in triplicate. Western blot analysis. Cells were washed once with PBS. Modified Numerical data are expressed as mean F SD. Two group comparisons were radioimmunoprecipitation assay buffer [RIPA; 50mmol/L Tris-HCl (pH 8), analyzed by two-sided Student’s t test. Multiple group comparisons were 150 mmol/L NaCl, 1 mmol/L EDTA (pH 8), 1% NP40, 0.25% Na- analyzed with ANOVA tests. p value of <0.05 was considered significant. deoxycholate, 1 mg/mL protease inhibitor cocktail (Sigma-Aldrich), Statistical analysis was conducted and graphical representations of the data 1 mmol/L Na-orthovanadate, and 1 mmol/L NaF] was added to plates were plotted using Excel X for Mac. and cells scraped to harvest lysates. After a 15-min incubation on ice, cells were centrifuged at 15,000 rpm for 30 min at 4jC. The supernatant was collected and protein content was determined by BCA method (Pierce). Results Aliquots were run on SDS-PAGE using 10% acrylamide Criterion precast Ionizing radiation and doxorubicin up-regulate ER expression. gels (Bio-Rad). Proteins were then electroblotted onto a polyvinylidene To test whether activation of p53 affected ER gene expression, difluoride membrane (Pierce). After blocking the membrane with 5% dry MCF-7 cells were treated with ionizing radiation or doxorubicin, milk in PBS with 0.1% Tween 20, blots were probed with an antibody to p53 both of which are known to increase expression of p53 by stabili- (DO-1; Santa Cruz Biotechnologies), ER from Zymed (Invitrogen), or glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Abcam). Secondary zing the protein (20). Figure 1 shows results obtained after treat- A B C D antibodies used were as follows: horseradish peroxidase–conjugated anti- ment with ionizing radiation ( and ) or doxorubicin ( and ). rabbit IgG (Cell Signaling Technologies) for ER and GAPDH or horseradish A 3-fold induction in p53 mRNA was detected at 4 hours after 8 Gy peroxidase–conjugated anti-mouse IgG (Santa Cruz Biotechnologies) for of ionizing radiation, reaching a peak, 8-fold induction by 12 hours p53. Enhanced chemiluminescence was then used to visualize protein and decreasing again by 24 hours (Fig. 1A). Ionizing radiation bands (Super Signal West Pico; Pierce). The image was captured on an similarly induced ER mRNA, although with a delayed time frame. Image Station 440CF (Kodak Digital Science) using Kodak ID v3.6 software Ionizing radiation (8 Gy) stimulated a 3-fold increase in ER mRNA (Kodak Scientific Imaging Systems), and protein expression was analyzed by 8 hours, which reached a maximum 6-fold induction by 12 hours using ImageQuant TL software (Amersham Biosciences). Western blots of and was maintained through 24 hours (Fig. 1A). ER, p53, and GAPDH were quantified by densitometry. Target protein bands In addition to the effect on p53 mRNA, ionizing radiation were normalized to the GAPDH band in the same sample and then normalized to the untreated control to calculate the fold change. stimulated a 6-fold induction in p53 protein over a 12-hour time B Real-time quantitative PCR. RNA was extracted from whole cells using frame (Fig. 1 ) with maximal expression at 8 hours after treatment. the Absolutely RNA kit, following manufacturer’s instructions (Agilent Ionizing radiation stimulated a concordant increase in ER protein Technologies). cDNAs were synthesized from 5 Ag of total RNA using expression and results showed a 5-fold induction in ER protein random hexamers (Promega) and reverse transcriptase (Invitrogen Corp.). over the same time frame with maximal induction at 8 hours. Real-time quantitative PCR was performed using the ABI Prizm 7700 Protein expression in ionizing radiation–treated groups was Sequence Detection System (Applied Biosystems). The primers and probes significantly different from the untreated control ( p V 0.01). were obtained from Taqman Gene Expression Assays (Applied Biosystems). Although there was a trend toward dose response, the difference Samples were run in duplicate on the same plate. Target gene expression between the three doses did not achieve statistical significance. was normalized to the reference gene, TATA binding protein, then The kinetics of ER induction are consistent with published results normalized to the untreated control to determine the fold change. Chromatin immunoprecipitation assay. Chromatin immunoprecipi- for p21, another p53-responsive gene (21–23). Similar results were tation (ChIP) assays were performed essentially as described (19). Briefly, observed with the chemotherapeutic agent, doxorubicin. P53 8 Â 106 cells were cross-linked with 1% formaldehyde for 10min at 25 jC mRNA expression was significantly up-regulated by half an hour and lysed in RIPA buffer. The precleared extract was sonicated to produce ( p V 0.006) and reached a peak 7-fold induction at 8 hours 500-bp fragments and split into 2 portions; 1 was used for control input and ( p V 0.005) after doxorubicin treatment (Fig. 1C). ER mRNA

Cancer Res 2009; 69: (8). April 15, 2009 3406 www.aacrjournals.org

Transcriptional Regulation of ERa in Breast Cancer Cells expression was increased 2-fold by 4 hours and reached a 6-fold To investigate functional effects of the up-regulation of ER by induction by 8 hours. Doxorubicin also affected p53 and ER protein p53, progesterone receptor was evaluated as a downstream target expression. Treatment stimulated a 5-fold induction in p53 and a 4- of ER. Detectable increases in progesterone receptor mRNA were fold induction in ER protein expression compared with vehicle- observed by 8 hours after doxorubicin treatment ( p V 0.005; treated cells ( p V 0.03; Fig. 1D). A partial dose response was Fig. 1C). Expression of p21, a downstream target of p53, was also observed, with the 10nmol/L treatment group being significantly significantly up-regulated by doxorubicin, starting at half an hour different from both the 50and 100nmol/Lgroups, but no after doxorubicin treatment and reaching a 7-fold peak by 8 hours, difference was observed between the 50and 100nmol/Lgroups. mirroring the kinetics of p53 mRNA induction.

Figure 1. Up-regulation of p53 by ionizing radiation (IR) or doxorubicin (dox) stimulates increased ER expression in MCF-7cells. A, ionizing radiation treatment increased p53 and ER mRNA as determined by real-time quantitative PCR. *, p < 0.05 for 8 Gy, at indicated times, versus nonirradiated control by Student’s t test. B, treatment of MCF-7cells with ionizing radiation induced time- and dose-dependent increases in p53 protein expression accompanied by correspondin g increases in ER protein. *, p < 0.05 for all ionizing radiation doses versus nonirradiated control by ANOVA. C, doxorubicin increased p53 and ER mRNA levels by 0.5 and 4 h, respectively, as determined by real-time quantitative PCR. Message levels of downstream target genes of p53 (p21) and ER (PR, progesterone receptor) were induced with similar kinetics. *, p < 0.05 for target genes at indicated times versus untreated control by ANOVA. D, treatment of MCF-7cells with doxorubicin induced a time- and dose-dependent increase in p53 protein expression accompanied by corresponding increases in ER. *, p < 0.05 for 10 nmol/L dose versus untreated control; **, p < 0.05 for 50 and 100 nmol/L doses versus both 10 nmol/L and untreated control by ANOVA. Graphical results represent the means of three independent experiments, with representative Western blots shown; error bars indicate standard deviations. www.aacrjournals.org 3407 Cancer Res 2009; 69: (8). April 15, 2009

Cancer Research

These results show that increased p53 mRNA expression also significantly downregulated by p53-targeting siRNA during this preceded changes in ER mRNA levels and suggest that p53 regulates timeframe (Fig. 2A, bottom). As expected, transfection of a ER expression, thereby contributing to downstream signaling scrambled sequence siRNA construct did not affect expression of pathways. p53, p21, or ER mRNA. Suppression of p53 is associated with down-regulation of ER Addition of p53-targeting siRNA also decreased p53 protein expression. As our results showed that ER expression was expression by 50% within 12 hours and 80% by 24 hours, compared increased after doxorubicin or ionizing radiation, p53-targeting with vehicle-treated controls ( p V 0.005; Fig. 2B). ER protein siRNA constructs were transfected into MCF-7 cells to determine if expression levels were unchanged at 12 hours but decreased 60% p53 was required for regulation of ER expression. Addition of by 24 hours after treatment with the p53 siRNA. Reduced levels p53-targeting siRNA resulted in significant decreases in p53 mRNA of both proteins persisted for 96 hours after siRNA transfection (Fig. 2A, top) as well as a reduction in the message level of its (Fig. 2B). Nontargeting scrambled sequence and lamin A–targeting downstream target, p21 (Fig. 2A, middle). ER mRNA expression was siRNA did not affect expression of either p53 or ER proteins (data

Figure 2. Targeted knockdown of p53 decreases expression of ER in MCF-7cells. A, real-time quantitative PCR analyses show decreased expression of p53, p21, and ER mRNA 24 h after treatment with p53-targeting siRNA. *, p < 0.05 for siRNA-treated cells versus vehicle-treated or scrambled sequence siRNA–treated controls, as determined by Student’s t test. B, Western blot analyses showed down-regulation of both p53 and ER by treatment with 20 to 100 nmol/L p53-targeting siRNA. P53-targeting siRNA constructs inhibited p53 protein expression by f60%, which was accompanied by a 50% decrease in ER expression, as determined by densitometry of Western blots. *, p < 0.05 for all siRNA doses versus mock-transfected control by ANOVA. Graphical results represent the means of three independent experiments, with representative Western blots shown; error bars indicate standard deviations.

Cancer Res 2009; 69: (8). April 15, 2009 3408 www.aacrjournals.org

Transcriptional Regulation of ERa in Breast Cancer Cells

Figure 3. The effects of DNA-damaging agents on ER expression are p53 dependent. Treatment with 20 nmol/L siRNA 24 h before irradiation abrogated the stimulatory effect of 8 Gy ionizing radiation (A) or 50 nmol/L doxorubicin (B) on both p53 and ER protein expression. *, p < 0.05 for ionizing radiation/doxorubicin-treated groups versus untreated control; **, p < 0.05 for p53-targeting siRNA-treated groups versus untreated control by ANOVA. Graphical results represent the means of three independent experiments, with representative Western blots shown, error bars indicate standard deviations. not shown). These results indicate that targeted depletion of Similarly, we detected an 8-fold induction of p53 protein at p53 resulted in reduced ER expression at both the message and 12 hours and a coincident 7-fold increase in ER expression after protein levels. doxorubicin treatment (Fig. 3B). Treatment of cells with p53- The effects of doxorubicin and ionizing radiation on ER targeting siRNA reduced ER protein expression by >50%, similar to expression are p53 dependent. To further investigate the results reported in Fig. 2. However, when cells were depleted of p53 mechanism of p53 regulation of ER expression, MCF-7 cells were by siRNA before doxorubicin or ionizing radiation treatment, ER first transfected with p53-targeting siRNA and then exposed to induction was completely blocked, indicating that up-regulation of ionizing radiation or doxorubicin. Consistent with the results in ER was p53 dependent. Fig. 1, ionizing radiation stimulated a 5-fold induction of p53 Similar results were obtained with ZR75.1 human breast cancer protein expression over a 12-hour time frame, which was cells, which also express ER and have WT p53. In the ZR75.1 cell accompanied by a 4-fold induction in ER protein (Fig. 3A). line, as in MCF-7s, the up-regulation of ER by doxorubicin was www.aacrjournals.org 3409 Cancer Res 2009; 69: (8). April 15, 2009

Cancer Research p53-dependent and targeted depletion of p53 with siRNA resulted siRNA was transfected into untreated MCF-7 cells. Addition of in decreased ER protein expression (Supplementary Fig. S1). p53-targeting siRNA resulted in a 48% ( p = 0.009) decrease in basal P53 regulates the ER proximal promoter. We then transfected expression of the ERpromLuc construct (Fig. 4A, inset). These data MCF-7 cells with a luciferase reporter construct containing the support our earlier results showing that ER expression was proximal promoter of the ER gene (ERpromLuc; ref. 18) with or decreased after siRNA-mediated knockdown of p53 (Fig. 3) and without the pC53-SN3 WT p53 expression vector (7) to determine show that p53 contributes to basal as well as doxorubicin-inducible whether p53 directly controls transcription of the ER gene ER expression. promoter. Treatment with 50nmol/L doxorubicin increased p53 To better define the effect of p53 on transcriptional activity of expression (Fig. 1D) and also induced a 3-fold increase in luciferase the ER gene promoter, experiments were also conducted in the activity (Fig. 4A) compared with vehicle ( p < 0.001). As shown in p53-null MDA-MB-453 breast cancer cell line. In the absence of Fig. 4A, addition of the WT p53 expression vector pC53-SN3 endogenous p53, doxorubicin treatment was unable to induce ER stimulated an 8-fold increase in luciferase expression ( p < 0.001), promoter activity in these cells (Fig. 4B). However, addition of WT which was further increased to 12-fold by treatment with p53 (pC53-SN3) stimulated a 5-fold increase in luciferase activity, doxorubicin ( p < 0.001 compared with ERpromLuc alone). which was enhanced to 14-fold by doxorubicin, compared with the Experimental controls including the ERpromLuc vector alone or ERpromLuc vector alone. These results show that p53 regulated ER in combination with the empty pGL2 basic vector (Fig. 4A and B) expression in breast cancer cells by increasing transcriptional did not induce luciferase expression above basal levels. activity at the proximal promoter. To determine if p53 could regulate not only inducible activity of P53 binds to the ER promoter. To investigate the mechanism the ER promoter, but also basal transcription, the p53 targeting whereby p53 regulates the ER gene promoter activity, ChIP assays

Figure 4. Addition of exogenous WT p53 up-regulates ER promoter activity. A, MCF-7cells were transfected with 2 Ag ER promoter–driven luciferase vector (ERpromLuc) either with or without cotransfection of the WT p53 expression vector, pC53-SN3. Cells were treated with 50 nmol/L doxorubicin 24 h after transfection. Luciferase activity was determined 12 h later. The promoter-less pGL2 basic vector was used as a negative control. *, p < 0.05 for designated treatments versus ERpromLuc alone, by Student’s t test. Inset, MCF-7cells were transfected with p53-targeting siRNA 24 h before transfection with the ERpromLuc vector and luciferase expression was measured 24 h later. *, p < 0.05 for p53 siRNA versus vehicle-treated control or scrambled sequence–treated cells by Student’s t test. B, MDA-MB-453 cells, which lack both ER and functional p53 expression, were treated as described for A.*,p < 0.05 for designated treatments versus ERpromLuc alone by Student’s t test. Graphical results represent the means of three independent experiments, with representative Western blots shown; error bars indicate standard deviations.

Cancer Res 2009; 69: (8). April 15, 2009 3410 www.aacrjournals.org

Transcriptional Regulation of ERa in Breast Cancer Cells

Figure 5. p53 recruitment to the proximal ER promoter is enhanced after doxorubicin treatment. A, p53 associated with the ER promoter in three regions, but recruitment to the region À128 to À40 bp upstream of the transcriptional start site is enhanced by 50 nmol/L doxorubicin treatment. Recruitment to the promoter region for p21 was used as a positive control and promoters for a-actin and TATA binding protein (TBP) genes were used as negative control regions. B, in ChIP assays, p53 coimmunoprecipitated with CARM1, CBP, c-Jun, c-Fos, HDM2, and Sp1. C, ChIP assays using CARM1, Sp1, c-Jun, and CBP antibodies verified that each of these cofactors was also recruited to the À128 to À40 bp region of the ER promoter after doxorubicin treatment. Pretreatment of MCF-7cells with 20 nmol/L p53-targeting siRNA, but not nontargeting siRNA, blocked association of each of these cofactors to the À128 to À40 bp region of the ER promoter in response to 50 nmol/L doxorubicin (dox/siRNA versus dox lanes). D, ChIP assays using a RNA pol II antibody verified that this component of the basal transcription machinery was recruited to the À128 to À40 bp region of the ER promoter after doxorubicin treatment. IB, immunoblot. were used. A recent report indicates that the sequences between recruited to the À128 to À40bp region of the proximal promoter in À350bp to À289 bp and À128 bp to À40bp upstream of the response to doxorubicin (Fig. 5A). P53 was also detected at the transcriptional start site are involved in transcriptional activity of distal regions of the ER promoter (À2094 to À1941 bp and À350to the ER gene (24). Accordingly, three promoter regions were À289 bp), but these associations were not altered by doxorubicin investigated in these experiments, including the previously treatment. As anticipated, after exposure to doxorubicin, p53 was identified À350to À289 and À128 to À40bp sequences, as well also immunoprecipitated at the p21 promoter but not at the as a further upstream sequence spanning from À2094 to À1941 bp. a-actin or TATA binding protein gene promoters. Because our results showed that doxorubicin treatment up- To identify additional members of the ER-regulating transcrip- regulated ER mRNA in MCF-7 cells (Fig. 1D), we reasoned that tional complex, coimmunoprecipitations were conducted using this treatment would stimulate p53 recruitment to the ER antibodies that target several potential cofactors. It was recently promoter. ChIP assays using a p53 antibody showed that p53 was reported that CARM-1, CBP, and p53 coimmunoprecipitate in www.aacrjournals.org 3411 Cancer Res 2009; 69: (8). April 15, 2009

Cancer Research

Figure 6. Schematic representation of the ER promoter. Bent arrow, the transcriptional start site. Shaded boxes represent regions targeted by primer sets. A, AP-1 response elements; C, CBP response elements; S, Sp1 response elements; and T, TATA box sequences. Transcription factor consensus sequences were identified using the web-based Transcription Element Search System program (24, 42, 43).

glutathione S-transferase pull-down assays and cooperatively bind transiently expressed p53 increased transcriptional activation of at the GADD45 gene promoter (25). Furthermore, in silico analyses the ER gene promoter in luciferase assays. Furthermore, p53 was identified activating transcription factor (AP-1), CBP, and Sp1 recruited to the ER gene promoter as a part of a regulatory response elements within the ER promoter regions described above complex that included CARM1, CBP, c-Jun, and Sp1. Our analysis of (Fig. 6). As shown in Fig. 5B, CARM1, CBP, c-Jun, and Sp1 were the ER promoter showed that although there are response detected in complexes immunoprecipitated with p53 antibody after elements for Sp1, AP-1, and CBP, no p53 consensus response doxorubicin treatment. In contrast, the amount of HDM2 protein element was present in the proximal promoter, suggesting that coimmunoprecipated with p53 decreased after doxorubicin treat- p53 regulates the ER gene through protein-protein interactions ment, consistent with its role as a negative regulator of p53 (24). Furthermore, our data demonstrate that p53 was required for expression (26, 27). Interestingly, c-Fos did not coimmunoprecipi- assembly of this complex as well as for induction of ER expression tate with p53 after doxorubicin treatment, indicating that c-Jun by doxorubicin. was associated with the p53 either as a homodimer or with AP-1 There is accumulating evidence of crosstalk between growth proteins other than c-Fos, perhaps with other members of the Jun, promoting and growth prohibiting pathways, such as those Fos, AP-1, or JDP families. demonstrated here involving ER and p53. Evidence indicates that ChIP assays, using antibodies directed against CARM1, CBP, ER signaling increases expression and nuclear accumulation of c-Jun, and Sp1, revealed that these four proteins were also recruited p53 in vitro and in vivo (28–30). Recapitulation of the hormonal to the À128 to À40bp region of the ER promoter after treatment milieu of pregnancy by exposing rats to estrogen plus progester- with doxorubicin (Fig. 5C). Like p53, binding of all of these one induces nuclear accumulation of p53 in mammary epithelium cofactors with upstream promoter regions of ER (À2094 to À1941 and protects against carcinogen challenge (31–33). Although this and À350to À289) was not altered by doxorubicin treatment (data literature represents substantial evidence that ER regulates p53 not shown). expression, the converse regulation of ER by p53 has not been To determine whether p53 was required for binding of CARM1, studied and a mechanism linking ER expression with WT p53 is CBP, c-Jun, and Sp1 to the ER promoter, MCF-7 cells were treated virtually unexplored. Although clinical and epidemiologic studies with p53-targeting siRNA constructs followed by ChIP analysis. As have shown that ER-positive human breast cancers express WT shown in Fig. 5C, doxorubicin did not stimulate p53/CARM1/CBP/ p53 and tumors with inactivating mutations in p53 tend to be ER c-Jun/Sp1 complex formation or DNA binding in cells transfected negative, evidence for a direct transcriptional mechanism has with p53 siRNA, indicating that p53 was required for assembly of been lacking. Results presented here show that p53 regulates the the complex on the À128 to À40bp region of the ER promoter. To ER promoter in breast cancer cells and provide a possible further demonstrate that the À128 to À40bp region of the ER explanation for the epidemiologic findings that ER expression is gene promoter is critical for p53-mediated induction of transcrip- associated with WT p53 in human breast cancers. tional activity, the association of RNA polymerase II was assessed. P53 is a widely recognized tumor suppressor gene, which limits Pol II binding to the À128 to À40promoter was enhanced after proliferation by inducing cell cycle arrest or apoptosis (34, 35). doxorubicin treatment (Fig. 5D, Dox lane) and, as expected, pol II Intriguingly, recent reports suggest that p53 may also play a role in was not recruited to the upstream regions (À350to À289; À2094 regulating genes involved in promotion of cell growth. Specifically, to À1941) of the promoter after doxorubicin treatment. These p53 mediates induction of cyclooxygenase-2, transforming growth results further show that the À128 to À40bp region is involved factor-a, and heparin-binding epidermal growth factor–like growth in doxorubicin-induced, p53-mediated transcription of the ER factor, all of which stimulate growth of normal and neoplastic cells promoter. (36–38). Furthermore, it has recently been reported that ER and p53 are associated on the promoter of vascular endothelial growth factor receptor to cooperatively enhance transcriptional activation Discussion (39). Consistent with these reports, our data suggest the presence of In this study, up-regulation of p53 by DNA-damaging agents, a functional link between the tumor suppressor p53 and growth- such as ionizing radiation or doxorubicin, resulted in increased promoting ER signaling pathways. ER mRNA and protein expression, whereas siRNA-mediated p53 The regulation of ER transcription is complex, involving knockdown reduced ER expression. P53 was shown to directly multiple independent promoters and several alternative 5¶ exons. regulate the ER promoter, as both endogenous as well as Although it has previously been shown that Sp1 (40) and GATA-3

Cancer Res 2009; 69: (8). April 15, 2009 3412 www.aacrjournals.org

Transcriptional Regulation of ERa in Breast Cancer Cells

(41) are critical regulators of ER expression, the role of p53 in tumor progression coincident with loss of functional p53 (47, 48). mediating expression of ER remains virtually unstudied. Our Similarly, in human carriers of BRCA1/2 mutations, breast tumors results show that despite the lack of a p53 consensus sequence, tend to be ER negative, have mutated p53, and have a poorer p53 bound to the proximal ER gene promoter along with CARM1, prognosis than tumors with WT BRCA (49). CBP, c-Jun, and Sp1. Dox stimulated the p53-dependent assembly Our studies have identified a transcriptional mechanism that of the transcription complex at the À128 bp to À40bp region of explains the observed correlation between p53 function and ER the ER proximal promoter but not at the more distal regions. expression in human breast cancers. In this report, we demonstrate When considered along with the data showing that p53 siRNA that p53 regulates ER expression, providing a mechanism to reduced luciferase in untreated MCF-7 cells, these results suggest explain the concordance of WT p53 and ER expression and the that the À2094 to À1941 and À350to À289 regions may be high frequency of ER negativity observed in tumors with p53 responsible for basal transcription from the ER promoter, whereas mutations. Furthermore, these findings suggest that early muta- the À128 to À40bp region is involved in p53-inducible activity. It tions and/or loss of functional p53 during tumorigenesis may lead has previously been reported that transcription from this proximal to ER-negative breast cancers, which has consequences on tumor promoter region [termed ‘‘promoter A’’ by Kos and colleagues (42) progression and response to antihormonal therapies. and including the À128 to À40bp region studied here] predominates in ER-positive breast cancer cells (43, 44), but little is known regarding why this promoter region is preferentially Disclosure of Potential Conflicts of Interest used. The results presented here indicate that p53 plays a role in No potential conflicts of interest were disclosed. use of promoter A in ER-positive breast cancers, potentially contributing to the reported overexpression of ER in postme- nopausal breast cancer compared with normal mammary tissue Acknowledgments (18, 43, 45). Received 9/19/08; revised 1/15/09; accepted 1/19/09; published OnlineFirst 4/7/09. One of the unexplained features of breast tumors with mutations Grant support: Susan G. Komen Breast Cancer Foundation BCTR0201390 (R.F. Young), Ruth L. Kirschstein National Research Service Award/Departmental Training in p53 is that they frequently lack ER expression, which is corre- grant CA09480 (S.H. Shirley), National Institute of Environmental Health Sciences lated with lack of response to tamoxifen and poor prognosis Center for Research on Environmental Disease (ES07784), and National Cancer Institute Cancer Center Support (CA16672). (9–12, 46). This is noteworthy as the molecular mechanisms The costs of publication of this article were defrayed in part by the payment of page responsible for the ER-negative phenotype are not well-understood charges. This article must therefore be hereby marked advertisement in accordance but may include progressive loss of ER. Consistent with this is the with 18 U.S.C. Section 1734 solely to indicate this fact. We thank Dr. Bert Vogelstein for providing the p53 expression vectors and observation that in transgenic mice with BRCA1 mutations, early Dr. Ronald Weigel for the ER promoter luciferase construct, as well as Dr. S.S. Lange mammary lesions are ER positive, but expression is lost during for critical reading of the manuscript.

References 11. Berns EM, Foekens JA, Vossen R, et al. Complete 21. Al-Mohanna MA, Al-Khalaf HH, Al-Yousef N, Abous- sequencing of TP53 predicts poor response to systemic sekhra A. The p16INK4a tumor suppressor controls 1. Heldring N, Pike A, Andersson S, et al. Estrogen therapy of advanced breast cancer. Cancer Res 2000;60: p21WAF1 induction in response to ultraviolet light. receptors: How do they signal and what are their targets. 2155–62. Nucleic Acids Res 2007;35:223–33. Physiol Rev 2007;87:905–31. 12. Anderson WF, Jatoi I, Devesa SS. Distinct breast cancer 22. Chin PL, Momand J, Pfeifer GP. In vivo evidence for 2. Katzenellenbogen BS, Katzenellenbogen JA. Estrogen incidence and prognostic patterns in the NCI’s SEER binding of p53 to consensus binding sites in the p21 and receptor transcription and transactivation: Estrogen program: suggesting a possible link between etiology and GADD45 genes in response to ionizing radiation. receptor a and estrogen receptor h: regulation by outcome. Breast Cancer Res Treat 2005;90:127–37. Oncogene 1997;15:87–99. selective estrogen receptor modulators and importance 13. Petitjean A, Mathe E, Kato S, et al. Impact of mutant 23. O’Hagan HM, Ljungman M. Phosphorylation and in breast cancer. Breast Cancer Res 2000;2:335–44. 3. Lower EE, Glass EL, Bradley DA, Blau R, Heffelfinger S. p53 functional properties on TP53 mutation patterns and nuclear accumulation are distinct events contributing to Impact of metastatic estrogen receptor and progester- tumor phenotype: lessons from recent developments in the activation of p53. Mutat Res 2004;546:7–15. one receptor status on survival. Breast Cancer Res Treat the IARC TP53 database. Hum Mutat 2007;28:622–9. 24. Angeloni SV, Martin MB, Garcia-Morales P, Castro- 2005;90:65–70. 14. Olivier M, Langerod A, Carrieri P, et al. The clinical Galache MD, Ferragut JA, Saceda M. Regulation of a 4. Knight WA, Livingston RB, Gregory EJ, McGuire WL. value of somatic TP53 gene mutations in 1,794 patients estrogen receptor- expression by the tumor suppres- Estrogen receptor as an independent prognostic factor with breast cancer. Clin Cancer Res 2006;12:1157–67. sor gene p53 in MCF-7 cells. J Endocrinol 2004;180: for early recurrence in breast cancer. Cancer Res 1977; 15. Espinosa JM, Emerson BM. Transcriptional regula- 497–504. 37:4669–71. tion by p53 through intrinsic DNA/chromatin binding 25. An W, Kim J, Roeder RG. Ordered cooperative 5. Horwitz KB, McGuire WL. Studies on mechanisms of and site-directed cofactor recruitment. Mol Cell 2001;8: functions of PRMT1, p300, and CARM1 in transcrip- estrogen and antiestrogen action in human breast 57–69. tional activation by p53. Cell 2004;117:735–48. cancer. Recent Results Cancer Res 1980;71:45–58. 16. Velculescu VE, El-Deiry WS. Biological and clinical 26. Kastan MB, Onyekwere O, Sidransky D, Vogelstein B, 6. Clark GM, Wenger CR, Beardslee S, et al. How to importance of the p53 tumor suppressor gene. Clin Craig RW. Participation of p53 protein in the cellular integrate steroid hormone receptor, flow cytometric, Chem 1996;42:858–68. response to DNA damage. Cancer Res 1991;51:6304–11. and other prognostic information in regard to primary 17. Yuan ZM, Huang Y, Ishiko T, et al. Role for p300 in 27. Pawlik TM, Keyomarsi K. Role of cell cycle in breast cancer. Cancer 1993;71:2157–62. stabilization of p53 in the response to DNA damage. mediating sensitivity to radiotherapy. Int J Radiat Oncol 7. Baker SJ, Markowitz S, Fearon ER, Willson JK, J Biol Chem 1999;274:1883–6. Biol Phys 2004;59:928–42. Vogelstein B. Suppression of human colorectal carcino- 18. deConinck EC, McPherson LA, Weigel RJ. Transcrip- 28. Hurd C, Dinda S, Khattree N, Moudgil VK. Estrogen- ma cell growth by wild-type p53. Science 1990;249:912–5. tional regulation of estrogen receptor in breast carci- dependent and independent activation of the P1 8. Hollstein M, Sidransky D, Vogelstein B, Harris CC. p53 nomas. Mol Cell Biol 1995;15:2191–6. promoter of the p53 gene in transiently transfected mutations in human cancers. Science 1991;253:49–53. 19. Orlando V, Strutt H, Paro R. Analysis of chromatin breast cancer cells. Oncogene 1999;18:1067–72. 9. Bhargava V, Thor A, Deng G, et al. The association of structure by in vivo formaldehyde cross-linking. Meth- 29. Sayeed A, Konduri SD, Liu W, Bansal S, Li F, Das GM. p53 immunopositivity with tumor proliferation and ods 1997;11:205–14. Estrogen receptor a inhibits p53-mediated transcrip- other prognostic indicators in breast cancer. Mod Pathol 20. Siu WY, Lau A, Arooz T, Chow JP, Ho HT, Poon RY. tional repression: implications for the regulation of 1994;7:361–8. Topoisomerase poisons differentially activate DNA apoptosis. Cancer Res 2007;67:7746–55. 10. Coles C, Condie A, Chetty U, Steel CM, Evans HJ, damage checkpoints through ataxia-telangiectasia mu- 30. Yu CL, Driggers P, Barrera-Hernandez G, Nunez SB, Prosser J. p53 mutations in breast cancer. Cancer Res tated-dependent and -independent mechanisms. Mol Segars JH, Cheng S. The tumor suppressor p53 is a 1992;52:5291–8. Cancer Ther 2004;3:621–32. negative regulator of estrogen receptor signaling www.aacrjournals.org 3413 Cancer Res 2009; 69: (8). April 15, 2009

Cancer Research

pathways. Biochem Biophys Res Commun 1997;239: 37. Shin TH, Paterson AJ, Kudlow JE. p53 stimulates estrogen receptor in breast carcinoma. Cell Growth 617–20. transcription from the human transforming growth Differ 1995;6:707–11. 31. Becker KA, Lu S, Dickinson ES, et al. Estrogen and factor a promoter: a potential growth-stimulatory role 44. Grandien K, Backdahl M, Ljunggren O, Gustafsson JA, progesterone regulate radiation-induced p53 activity in for p53. Mol Cell Biol 1995;15:4694–701. Berkenstam A. Estrogen target tissue determines mammary epithelium through TGF-h-dependent path- 38. Han JA, Kim JI, Ongusaha PP, et al. P53-mediated alternative promoter utilization of the human estrogen ways. Oncogene 2005;24:6345–53. induction of Cox-2 counteracts p53- or genotoxic stress- receptor gene in osteoblasts and tumor cell lines. 32. Kuperwasser C, Pinkas J, Hurlbut GD, Naber SP, induced apoptosis. EMBO J 2002;21:5635–44. Endocrinology 1995;136:2223–9. Jerry DJ. Cytoplasmic sequestration and functional 39. Menendez D, Inga A, Snipe J, Krysiak O, Schonfelder 45. Ricketts D, Turnbull L, Ryall G, et al. Estrogen and repression of p53 in the mammary epithelium is G, Resnick MA. A single-nucleotide polymorphism in a progesterone receptors in the normal female breast. reversed by hormonal treatment. Cancer Res 2000;60: half-binding site creates p53 and estrogen receptor Cancer Res 1991;51:1817–22. 2723–9. control of vascular endothelial growth factor receptor 1. 46. Antman KH, Rowlings PA, Vaughan WP, et al. High- 33. Sivaraman L, Conneely OM, Medina D, O’Malley BW. Mol Cell Biol 2007;27:2590–600. dose chemotherapy with autologous hematopoietic p53 is a potential mediator of pregnancy and hormone- 40. deGraffenried LA, Hilsenbeck SG, Fuqua SA. Sp1 is stem-cell support for breast cancer in North America. induced resistance to mammary carcinogenesis. Proc essential for estrogen receptor a gene transcription. J Clin Oncol 1997;15:1870–9. Natl Acad Sci U S A 2001;98:12379–84. J Steroid Biochem Mol Biol 2002;82:7–18. 47. Li W, Xiao C, Vonderhaar BK, Deng CX. A role of 34. Levine AJ. p53, the cellular gatekeeper for growth and 41. Eeckhoute J, Keeton EK, Lupien M, Krum SA, Carroll estrogen/ERa signaling in BRCA1-associated tissue- division. Cell 1997;88:323–31. JS, Brown M. Positive cross-regulatory loop ties GATA-3 specific tumor formation. Oncogene 2007;26:7204–12. 35. Rozan LM, El-Deiry WS. p53 downstream target to estrogen receptor a expression in breast cancer. 48. Xu X, Wagner KU, Larson D, et al. Conditional genes and tumor suppression: a classical view in Cancer Res 2007;67:6477–83. mutation of Brca1 in mammary epithelial cells results in evolution. Cell Death Differ 2007;14:3–9. 42. Kos M, Reid G, Denger S, Gannon F. Minireview: blunted ductal morphogenesis and tumour formation. 36. Deb SP, Munoz RM, Brown DR, Subler MA, Deb S. genomic organization of the human ERa gene promoter Nat Gnet 1999;22:37–43. Wild-type human p53 activates the human epidermal region. Mol Endocrinol 2001;15:2057–63. 49. Gasco M, Yulug IG, Crook T. TP53 mutations in growth factor receptor promoter. Oncogene 1994;9: 43. Weigel RJ, Crooks DL, Iglehart JD, deConinck EC. familial breast cancer: functional aspects. Hum Mutat 1341–9. Quantitative analysis of the transcriptional start sites of 2003;21:301–6.

Cancer Res 2009; 69: (8). April 15, 2009 3414 www.aacrjournals.org

Transcriptional Regulation of Estrogen Receptor-α by p53 in Human Breast Cancer Cells

Stephanie Harkey Shirley, Joyce E. Rundhaug, Jie Tian, et al.

Cancer Res 2009;69:3405-3414. Published OnlineFirst April 7, 2009.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-08-3628

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2009/04/06/0008-5472.CAN-08-3628.DC1

Cited articles This article cites 49 articles, 22 of which you can access for free at: http://cancerres.aacrjournals.org/content/69/8/3405.full#ref-list-1

Citing articles This article has been cited by 9 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/69/8/3405.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/69/8/3405. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.