US007 271156 B2

(12) United States Patent (10) Patent No.: US 7,271,156 B2 Krieg et al. (45) Date of Patent: Sep. 18, 2007

(54) IMMUNOSTIMULATORY NUCLEIC ACIDS 6,544,518 B1 * 4/2003 Friede et al...... 424,184.1 6,653.292 B1* 11/2003 Krieg et al...... 514,44 (75) Inventors: Arthur M. Krieg, Wellesley, MA (US); 6,727,230 B1 4/2004 Hutcherson et al. Jörg Vollmer, Düsseldorf (DE): 6.821,957 B2 11/2004 Krieg et al. 6,943,240 B2 9, 2005 Bauer et al. Christian Schetter, Hilden (DE) 6,949,520 B1 9, 2005 Hartmann et al. Assignees: University of Iowa Research 2001/0044416 A1 11/2001 McCluskie et al. (73) 2002/009 1097 A1 7/2002 Bratzler et al. Foundation, Iowa City, IA (US); Coley 2002/0156033 A1 10, 2002 Bratzler et al. Pharmaceutical GmbH, Dusseldorf 2002/0164341 A1 11/2002 Davis et al. (DE) 2002fO165178 A1 11/2002 Schetter et al. Notice: 2002fO1981.65 A1 12/2002 Bratzler et al. (*) Subject to any disclaimer, the term of this 2003/0026782 A1 2/2003 Krieg et al. patent is extended or adjusted under 35 2003/0026801 A1 2/2003 Weiner et al. U.S.C. 154(b) by 0 days. 2003/0050261 A1 3/2003 Krieg et al. 2003/0050268 A1* 3/2003 Krieg et al...... 514,44 (21) Appl. No.: 10/314,578 2003/0055014 A1 3/2003 Bratzler 2003/009 1599 A1 5/2003 Davis et al. (22) Filed: Dec. 9, 2002 2003/010.0527 A1 5/2003 Krieg et al. 2003. O139364 A1 7/2003 Krieg et al. (65) Prior Publication Data 2003. O14831.6 A1 8/2003 Lipford et al. US 2003/0212026 A1 Nov. 13, 2003 2003/0148976 A1* 8/2003 Krieg et al...... 514,44 2003. O166001 A1 9/2003 Lipford Related U.S. Application Data 2003/0181406 A1* 9, 2003 Schetter et al...... 514,44 2003/019 1079 A1 10/2003 Krieg et al. (63) Continuation of application No. 09/669,187, filed on 2003/0212026 A1* 11/2003 Krieg et al...... 514,44 Sep. 25, 2000. 2003/022401.0 A1 12/2003 Davis et al. (60) Provisional application No. 60/227,436, filed on Aug. 23, 2000, provisional application No. 60/156,135, (Continued) filed on Sep. 27, 1999, provisional application No. 60/156,113, filed on Sep. 25, 1999. FOREIGN PATENT DOCUMENTS WO WO96.O2555 A1 2, 1996 (51) Int. C. WO WO98.37919 A1 * 9, 1998 (2006.01) WO WO98,401.00 9, 1998 (2006.01) WO WO99,56755 A1 11, 1999 (2006.01) WO WO99,58118 11, 1999 (2006.01) A 6LX 9/52 (2006.01) (Continued) AOIN 25/08 (2006.01) AOIN 43/04 (2006.01) OTHER PUBLICATIONS (52) U.S. Cl...... 514/44; 536/23.1536/25.3: Krieg et al. Immunopharmacology, 2000, 48:303-305.* 536/25.6; 424/408; 424/409: 424/422; 424/430; Tighe et al. J. Allergy Clin. Immunol. 2000, 106:124-134.* 424/434; 424/450; 424/457; 424/468; 424/490 McCluskie et al. Vaccine, 2001, 19:2657-2660.* (58) Field of Classification Search ...... 514/44; Jones et al. Vaccine, 1999, 17:3065-3071.* 536/23.1, 23.6, 23.4, 23.5, 23.51, 23.52, 536/24.3, 25.3, 25.6; 424/408,409, 422, (Continued) 424/430, 434, 450, 457, 468, 490 Primary Examiner Nita Minnifield See application file for complete search history. (74) Attorney, Agent, or Firm Wolf Greenfield & Sacks, (56) References Cited P.C. U.S. PATENT DOCUMENTS (57) ABSTRACT 5,663,153 9, 1997 Hutcherson et al. 5,723,335 3, 1998 Hutcherson et al. The invention relates to immunostimulatory nucleic acid 6,194,388 2, 2001 Krieg et al. compositions and methods of using the compositions. The 6,207,646 3, 2001 Krieg et al. T-rich nucleic acids contain poly T sequences and/or have 6,214,806 4, 2001 Krieg et al...... 514,44 greater than 25% T nucleotide residues. The TG nucleic 6,218,371 4, 2001 Krieg et al...... 514,44 acids have TG dinucleotides. The C-rich nucleic acids have 6,221,882 4, 2001 Macfarlane at least one poly-C region and/ore greater than 50% c 6,239,116 5, 2001 Krieg et al...... 514,44 nucleotides. These immunostimulatory nucleic acids func 6,339,068 1, 2002 Krieg et al...... 514,44 tion in a similar manner to nucleic acids containing CpG 6,399,630 6, 2002 Macfarlane 6,406,705 6, 2002 Davis et al...... 424,278.1 motifs. The invention also encompasses preferred CpG 6,429,199 8, 2002 Krieg et al...... 514,44 nucleic acids. 6.479,504 11, 2002 Macfarlane et al. 6,521,637 2, 2003 Macfarlane 33 Claims, 12 Drawing Sheets US 7,271,156 B2 Page 2

U.S. PATENT DOCUMENTS 2007/0037767 A1 2/2007 Bratzler et al...... 514,44

2003/0232074 12, 2003 Lipford et al. FOREIGN PATENT DOCUMENTS 2003/0232856 12, 2003 Macfarlane 2004/OOO9949 1, 2004 Krieg WO WO99, 61056 12/1999 2004.?003.0118 2, 2004 Wagner et al. WO WOOOO6588 A1 2, 2000 2004.0053880 3, 2004 Krieg ...... ------514,44 WO WOOO.75304 A1 12/2000 2004, OO67902 4, 2004 Bratzler et al. ------514,44 WO WO O1/22972 A2 * 4, 2001 2004, OO67905 4, 2004 Krieg WO WO O1/62909 A1 8, 2001 2004/OO87534 5, 2004 Krieg et al. WO WO O2/O69369 A2 * 9, 2002 2004/OO87538 5, 2004 Krieg et al. WO WO O3,O15711 A2 * 2/2003 2004/00924.72 5, 2004 Krieg ...... 514,44 WO WO 2004/OO7743 A2 1, 2004 2004/0106568 6, 2004 Krieg et al. ... 514/44 WO WO 2004/026888 A2 4/2004

2004/O131628 T/2004 Bratzler et al. . 424,184.1 WO WO 2004/094671 A2 11/2004 2004/O132685 T/2004 Krieg et al...... 514,44 2004/0142469 T/2004 Krieg et al. OTHER PUBLICATIONS 2004/O143112 T/2004 Krieg et al. 2004/O147468 T/2004 Krieg et al. Askenase, J. Allergy Clin. Immunol., 2000, 106:37-40.* 2004/O152649 8, 2004 Krieg ...... 514,44 Vollmer et al. Antisense and Nucleic Acid Drug Development, 2002, 2004/O152656 8, 2004 Krieg et al. 12:165-175.* 2004/O152657 8, 2004 Krieg et al. Weiner, J. Leukocyte Biology, 200, 68:455-463.* 2004O162258 8, 2004 Krieg et al. Agrawal et al. TRENDS in Molecular Medicine, 2002. 8/3:114 2004O162262 8, 2004 Krieg et al. 121.* 2004/O167089 8, 2004 Krieg et al. Gelfand, J. Allergy Clin. Immunol., 2004, 114:S135-S138.* 2004/0171150 9, 2004 Krieg et al. Saito et al. Immunology, 2001, 104:226-234.* 2004/0171571 9, 2004 Krieg et al. ------514,44 2004/O181045 9, 2004 Krieg et al. Taube et al. Int. Arch. Allergy Immunol., 2004, 135:173-186.* 2004/O198680 10, 2004 Krieg ...... 514,44 Asakura et al. International Archives of Allergy and Immunology, 2004/O198688 10, 2004 Krieg et al. 1998, 116:49-52.* 2004/02298.35 11, 2004 Krieg et al. Takeda et al., J. Exp. Med., Aug. 4, 1997, 186/3:449-454.* 2004/0234512 11, 2004 Wagner et al. Kataoka, et al., “Antitumor activity of synthetic oligonucleotides 2004/O235770 11, 2004 Davis et al...... 514,44 with sequences from cDNA encoding proteins of Mycobacterium 2004/O235774 11, 2004 Bratzler et al...... 514,44 bovis BCG”, Jpn. J. Cancer Res., 83:244-247 (1992). 2004/0235777 11/2004 Wagner et al. Krieg, et al., “Editorial:Phosphorothioate oligodeoxynucleotides: 2004/O235778 11, 2004 Wagner et al. antisense or anti-protein’?”. Anitsense Res. Devlp., 5:241 (1995). 2004/0266719 12, 2004 McCluskie et al. Krieg, A.M., "Leukocyte stimulation by oligodeoxynucleotides'. 2005, 0004061 1/2005 Krieg et al. Applied Antisense Oligonucleotide Technology, 24:431-448 (1998). 2005, 0004062 1/2005 Krieg et al. Sun, et al., “Mitogenicity of DNA from different organisms for 2005/OOO9774 1/2005 Krieg et al. murine B cells”. J. Immunol. 159:3119-3125 (1997(. 2005/OO32734 2, 2005 Davis et al. Krieg, et al., “Brief Communication: Oligodeoxynucleotide modi 2005/OO32736 2, 2005 Krieg et al. fications determine the magnitude of B cell stimulation by CpG 2005/OO37403 2, 2005 Krieg et al. motifs'. Antisense Nucleic Acid. Drug Developmen, 6:133-139 2005, 0037985 2, 2005 Krieg et al. (1996). 2005.0043529 2, 2005 Davis et al. Messina, et al., “Stimulation of in vitro murine lymphocyte prolif 2005.00492.15 3, 2005 Krieg et al. eration by bacterial DNA”, J. of Immunol., 147(6): 1759-1764 2005.0049216 3, 2005 Krieg et al. (1991). 2005.00546O1 3, 2005 Wagner et al. McIntyre, et al., “A sense phosphorothioate oligonucleotide directed 2005.00546O2 3, 2005 Krieg et al. to the intiation codon of transcription factor NF-kB p65 causes 2005/0059619 3, 2005 Krieg et al. sequence-specific immune stimulation'. Antisense Res. and 2005/00596.25 3, 2005 Krieg et al. Devlop., 3:309-322 (1993). 2005/0070491 3, 2005 Krieg et al. Hartmann, et al., “Mechanism and function of a newly identified 2005.00753O2 4, 2005 Hutcherson et al. CpG DNA motif in human primary b cells'. J. of Immunol. 2005. O080034 4, 2005 Standring et al...... 514.46 164:944-952 (2000). 2005, 0100983 5/2005 Bauer et al. Yi, et al., “CpG DNA rescues B cells from apoptosis by activating 2005/0101554 5/2005 Krieg et al. NFKB and preventing mitochondrial membrane potential disruption 2005/0101557 5/2005 Krieg et al. via a chloroquine-sensitive pathway. International Immunol. 2005/O119273 6, 2005 Lipford et al. 11(2):2015-2024 (1999). 2005/O123523 6, 2005 Krieg et al. Hartmann, et al., “Delineation of CpG phosphorothioate 2005/O 130911 6, 2005 Uhlmann et al. oligodeoxynucleotide for activating primate immune responses in 2005/O148537 7/2005 Krieg et al. vitro and in vivo”. J. of Immunol. 164:1617-1624 (2000). 2005, 0169888 8, 2005 Hartman et al. Pisetsky, et al., “The influence of base sequence on the immuno 2005/0171047 8, 2005 Krieg et al. logical properties of defined oligonucleotides'. Immunopharmacol 2005, 0181422 8, 2005 Bauer et al. ogy, 40: 199-208 (1998). 2005/O182O17 8, 2005 Krieg Tokunaga, et al., “A synthetic single-stranded DNA, poly(dG.dC), 2005/O1973 14 9, 2005 Krieg et al. induces interferon-O/3 activity, and Suppresses tumor growth', Jpn. 2005/0215500 9, 2005 Krieg et al. J. Cancer Res., 79:982-686 (1988). 2005/02155O1 9, 2005 Lipford et al. Tokunaga, et al., “Synthetic oligonucleotides with particular base 2005/0244410 11/2005 Bassiri et al...... 424,144.1 sequences from the cDNA encoding proteins of Mycobacterium 2005/0250716 11/2005 Schmidt et al...... 514,44 bovis BCG induce interferons and activate natural killer cells”, Jpn 2005/0260216 11/2005 Ashman et al...... 424,184.1 J. Cancer Res., 36(1):55-66 (1992). 2005/0267O57 12, 2005 Krieg ...... 514,44 Lipford, GB et al., CpG-containing synthetic oligonucleotides pro 2006/0229271 10, 2006 Krieg et al...... 514,44 mote B and cytotoxic T cell responses to protein antigen: a new 2006/0241076 10, 2006 Uhlmann et al...... 514,44 class of vaccine adjuvants, EurJ Immunol. 27(9): 2340 (1997). US 7,271,156 B2 Page 3

Goukassian et al., “Topical DNA Oligonucleotide Therapy Reduces Jain et al., CpG DNA and immunotherapy of allergic airway UV-induced Mutations and Photocarcinogenesis in Hairless Mice'. diseases. Clin Exp Allergy. Oct. 2003:33(10): 1330-5. PNAS, 101(11):3933-3938, 2004. Kline et al., DNA therapy for asthma. Curr Opin Allergy Clin Bohle et al. Oligodeoxynucleotides containing CpG motifs induce Immunol. Feb. 2002:2(1):69-73. IL-12, IL-18 and IFN-gamma production in cells from allergic Kline et al., Modulation of airway inflammation by CpG individuals and inhibit IgE synthesis in vitro. Eur J. Immunol. Jul. oligodeoxynucleotides in a murine model of asthma. J Immunol. 1999:29(7):2344-53. Mar. 15, 1998; 160(6):2555-9. Vollmer et al., Highly immunostimulatory CpG-free Metzger et al., Oligonucleotide therapy of allergic asthma. J Allergy oligodeoxynucleotides for activation of human leukocytes. Clin Immunol. Aug. 1999; 104(2 Pt 1):260-6. Antisense Nucleic Acid Drug Dev. Jun. 2002; 12(3):165-75. Satoh et al., The study of mechanisms in CpG Liang et al., Activation of human B cells by phosphorothioate oligodeoxynucleotides-induced aggravation in murine allergic con oligodeoxynucleotides. J Clin Invest. Sep. 1, 1996:98(5): 1119-29. tact dermititis to 2,4-dinitrofluorobenzene. Fukushima Igaku Zasshi. Agrawal et al., Novel immunomodulatory oligonucleotide prevent 2002:52(3):237-50. Abstract. development of allergic airway inflammation and airway hyper Silverman et al., Immunostimulatory DNA for asthma: better than responsiveness in asthma. Int Immunopharmacol. Jan. eating dirt. Am J Respir Cell Mol Biol. Jun. 2003:28(6):645-7. 2004;4(1): 127-38. Wohleben et al., Atopic disorders: a vaccine around the corner? Broide et al., Immunostimulatory DNA sequences inhibit IL-5, Trends Immunol. Nov. 2001:22(11):618-26. eosinophilic inflammation, and airway hyperresponsiveness in mice. J Immunol. Dec. 15, 1998; 161(12):7054-62. * cited by examiner U.S. Patent Sep. 18, 2007 Sheet 1 of 12 US 7,271,156 B2

NOADDITION O296 O295 O294 O293 O292 O29 O290 O289 O288 O287 O286 O979 O840 O242 O214 O240 O259 O968 O965 O233 O279 O280 O28 O216 O2143 O277 O283 O282 O278 O237 O27

O82 O758 i g U.S. Patent Sep. 18, 2007 Sheet 2 of 12 US 7,271,156 B2

STATISTICAL ANALYSIS MEAN STDDEV. STDERROR NUMBER MINIMUM MAXIMUM # MISSING o1758 46.70 - I - 46.70 46.70 3 O812 O2006 O O27 22.0 0.00 O.OO O237

O278 O282 O283 O277

O243 O26 20.55 1.48 1.05 O28 O28O O279 o2133 28.80 99 70 2 28.0 23.50 2 O965 92 O968 1.20 O259

O240 O24 o2142 220 13 80 2 2.30 22.90 2

O840 O1979 O286 35 O287 O5 2 o2188 20.70 4 0 2 20.60 20.80 2 O290 2.47 1.75 2 2010 23.60 O29 21.40 2.30

O292 1950 4. O O293 O294 22.30 O295 23.00 85 22.40 23.60 2

O296 1.25 NOADDITION 2.77 24.90 0. U.S. Patent Sep. 18, 2007 Sheet 3 of 12 US 7,271,156 B2

NOADDITION O296 ;: O295 O294 O293 O292 O29. O290 O289

O288 O287

3E o?l86 3 O1979 O840 O242 O24 O240 $E O259 3 o968 5. O965 O233 O279 O280 O28 O26 O243

O277 O283 O282 O278 O237 O27 O2006 O1812 O758 U.S. Patent Sep. 18, 2007 Sheet 4 of 12 US 7,271,156 B2

STATISTICAL ANALYSS MEAN STD, DEV. STD.ERROR NUMBER MINIMUM MAXIMUM E MISSING O758 57.60 7 5O 2 57.0 O812 20.70 O2O06 56.35 56.60 O27 4OOO 40.8O 2 O237 O278 2.00

O282 2 38.00 O283 35.30 3O 2 34.00 O277 25.00 O243 34.70 O26 O28) 44.25 O280 45.90 5.94

O233 53.75 50.70 56.80 2

O968 49.35 1.9 1.35 2 O259 7.92 5.60 2 420 2 O240 3.35 2 49,90 2 O24 4.0 2.90 2 E 44.50 O242 O840O979 EEEEEEEE58.30 60.70 2 O286 36.90 14 O O287 .78 55 2 26.60 O288 2 5 2 | 220 O289 1.20 85 2 2060 O290 O2191 O292 O293 57 40 O294 34.00 1.70 l2O o2195 27.30 27 90 2 26.40 28.20 2 O296 2.76 1.95 2 20.50 NOADDITION 2.77 1.38 4 1860 24.90 O Fig. 1D

U.S. Patent Sep. 18, 2007 Sheet 6 of 12 US 7,271,156 B2

Z ‘NOLIWHINEONOO|uu/6n

NOWOld 9 U.S. Patent Sep. 18, 2007 Sheet 7 of 12 US 7,271,156 B2

W/o 5162 OO 562 50 5627 51623 562 0.4 526 00 :35:2. 526 50 EiSESEiSisäissississis 5267 ES: 526 3 E3 526 O. 4. SiSS3535SEElišišS. 2137 00 237 50 237 7 237 3 237 0.4 27 OO :S::::::::::::35:S:::::::::::::::

277 i5:33:35: . 273 Ei:32:32:32:3: Es: 3.

2006 00

0 lo 20 30 4o 50 so 70 80 % CD86 POSITIVEB CELLS Fig. 4 U.S. Patent Sep. 18, 2007 Sheet 8 of 12 US 7,271,156 B2

W/O - 569 O. ES5 569 g3 569 O.4 Šiš 568 10 E 568 H 568 0.4 H 563 O 22 563 22 563 0.4 Z2 562 O 3: 562 is: 562 0.4 SS 294 O 294 21940.4 296 lo ZZZZZZZZZZZZZZZZZ 296 222222 296 0.4 Z. 2006 O 3 2006 $3. 2006 0.4 E. O 20 40 60 80 OO % CD86 POSITIVE BCELLS Fig. 5 U.S. Patent Sep. 18, 2007 Sheet 9 of 12 US 7,271,156 B2

w/o 204l 12 ZZZZ 20416 ZE 204 0.4 ZZ 2006 2.É.

O 20 40 60 8O % CD86 POSITIVE BCELLS Fig. 6 U.S. Patent Sep. 18, 2007 Sheet 10 of 12 US 7,271,156 B2

w/o 5126 - 2194 H S S, S. 283 YCd SZ 237

27 2006 E 20 30 40 50 60 % CD69 POSITIVENK CELLS Fig. 7

u?

l O CN WO l Y O H O H ?h O Cl sSS

2.5: 25: 50: U.S. Patent Sep. 18, 2007 Sheet 11 of 12 US 7,271,156 B2

W/O sias H o H 283

237

27

2006 F

5 6 7 8 9 O % CD69 POSITIVE NKT. CELLS Fig. 9

2 183

-- -T- - O 5 O 15 20 25 30 % CD80 POSITIVE MONOCYTES Fig. 10 U.S. Patent Sep. 18, 2007 Sheet 12 of 12 US 7,271,156 B2

W/o

S.O) LPS10 3. (W)5, 2137 CY O 2194 H N O 5 5126 H 2 S 2006 H -T- O 50 lOO 150 200 TNFa. (pg/ml) Fig.11

w/o sS. LPSl . f a 21941 s 21371 S g 526 Z S 2006

O 200 400 600 IL-6 (pg/ml) Fig. 12 US 7,271,156 B2 1. 2 IMMUNOSTIMULATORY NUCLEIC ACIDS Several past investigators have looked at whether the nucleotide content of ODN may have effects independently RELATED APPLICATIONS of the sequence of the ODN. Interestingly, antisense ODN have been found to be generally enriched in the content of This application claims priority to U.S. Non-Provisional GG, CCC, CC, CAC, and CG sequences, while having Patent Application No. 09/669,187, filed Sep. 25, 2000, reduced frequency of TT or TCC nucleotide sequences which claims priority under 35 U.S.C. S 119 to U.S. Provi compared to what would be expected if base usage were sional Patent Application Nos. 60/156,113, filed Sep. 25, random (Smetsers et al., 1996 Antisense Nucleic Acid Drug 1999, 60/156,135, filed Sep. 27, 1999, and No. 60/227,436, Develop. 6:63-67). This raised the possibility that the over filed Aug. 23, 2000, the entire contents of which are hereby 10 represented sequences may comprise preferred targeting incorporated by reference. elements for antisense oligonucleotides or visa versa. One reason to avoid the use of thymidine-rich ODN for antisense FIELD OF THE INVENTION experiments is that degradation of the ODN by nucleases present in cells releases free thymidine which competes with The present invention relates generally to immunostimu 15 H-thymidine which is frequently used in experiments to latory nucleic acids, compositions thereof and methods of assess cell proliferation (Matson et al., 1992 Antisense using the immunostimulatory nucleic acids. Research and Development 2:325-330). BACKGROUND OF THE INVENTION SUMMARY OF THE INVENTION Bacterial DNA has immune stimulatory effects to activate The present invention relates in part to pyrimidine rich B cells and natural killer cells, but vertebrate DNA does not (Py-rich) and in some embodiments thymidine (T) rich (Tokunaga, T., et al., 1988. Jpn. J. Cancer Res. 79:682-686: immunostimulatory nucleic acids which do not require the Tokunaga, T., et al., 1984, JNCI 72:955-962: Messina, J. P. presence of a CpG motif. The present invention also relates et al., 1991, J. Immunol. 147: 1759-1764; and reviewed in 25 in part to the discovery that nucleic acids which contain a TG Krieg. 1998. In: Applied Oligonucleotide Technology, C. A. dinucleotide motif are also immunostimulatory. The inven Stein and A. M. Krieg, (Eds.), John Wiley and Sons, Inc., tion is based in part on the unexpected finding that nucleic New York, N.Y., pp. 431-448). It is now understood that acid sequences which do not contain CpG motifs are immu these immune stimulatory effects of bacterial DNA are a nostimulatory. It was discovered upon analysis of the result of the presence of unmethylated CpG dinucleotides in 30 immune stimulation properties of many nucleic acid particular base contexts (CpG motifs), which are common in sequences that these sequences may be Py-rich e.g., T-rich bacterial DNA, but methylated and underrepresented in or that they may contain TG motifs. It was also discovered vertebrate DNA (Krieg et al., 1995 Nature 374:546-549; that these sequences preferentially activate non-rodent Krieg, 1999 Biochim. Biophys. Acta 93321:1-10). The immune cells. The Py-rich and TG sequences are only immune stimulatory effects of bacterial DNA can be mim 35 minimally immunostimulatory with respect to rodent icked with synthetic oligodeoxynucleotides (ODN) contain immune cells, compared to non-rodent immune cells. Thus, ing these CpG motifs. Such CpG ODN have highly stimu it is possible according to the methods of the invention to latory effects on human and murine leukocytes, inducing B induce an immune response in a non-rodent subject by cell proliferation; cytokine and immunoglobulin secretion; administering Py-rich or TG immunostimulatory nucleic natural killer (NK) cell lytic activity and IFN-y secretion: 40 acids. The Py-rich and TG immunostimulatory nucleic acids and activation of dendritic cells (DCs) and other antigen of the invention may optionally include CpG motifs. These presenting cells to express costimulatory molecules and findings have important implications for the clinical devel secrete cytokines, especially the Th1-like cytokines that are opment of immunostimulatory CpG containing and non important in promoting the development of Th1-like T cell CpG containing nucleic acids. responses. These immune stimulatory effects of native phos 45 In one aspect the invention is a pharmaceutical compo phodiester backbone CpG ODN are highly CpG specific in sition comprising an effective amount for stimulating an that the effects are essentially abolished if the CpG motif is immune response of isolated Py-rich or TG immunostimu methylated, changed to a GpC, or otherwise eliminated or latory nucleic acids, and a pharmaceutically acceptable altered (Krieg et al., 1995 Nature 374:546-549; Hartmannet carrier. In other aspects the invention is a composition of al, 1999 Proc. Natl. Acad. Sci USA96:9305-10). Phosphodi 50 matter, comprising an isolated Py-rich or TG immunostimu ester CpG ODN can be formulated in lipids, alum, or other latory nucleic acid. In other embodiments, the immuno types of vehicles with depot properties or improved cell stimulatory nucleic acid may be T-rich. In still other embodi uptake in order to enhance the immune stimulatory effects ments, the immunostimulatory nucleic acid may be T-rich (Yamamoto et al., 1994 Microbiol. Immunol. 38:831-836; and also have at least one TG motif. Gramzinski et al., 1998 Mol. Med. 4:109-118). 55 Preferably the Py-rich nucleic acid is a T-rich nucleic acid. In early studies, it was thought that the immune stimula In some embodiments the T-rich immunostimulatory nucleic tory CpG motif followed the formula purine-purine-CpG acid is a poly T nucleic acid comprising 5' TTTT3'. In yet pyrimidine-pyrimidine (Krieg et al., 1995 Nature 374:546 other embodiments the poly T nucleic acid comprises 5' X 549; Pisetsky, 1996.J. Immunol. 156:421-423; Hacker et al., X-TTTTX X3' wherein X, X2, X and X are nucleotides. 1998 EMBO.J. 17:6230-6240; Lipford et al., 1998 Trends in 60 In some embodiments XX is TT and/or XX is TT. In Microbiol. 6:496-500). However, it is now clear that mouse other embodiments XX is selected from the group con lymphocytes respond quite well to phosphodiester CpG sisting of TA, TG, TC, AT. AA, AG, AC, CT, CC, CA, CG, motifs that do not follow this “formula” (Yi et al., 1998 J. GT, GG, GA, and GC; and/or XX is selected from the Immunol. 160:5898-5906) and the same is true of human B group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, cells and dendritic cells (Hartmann et al., 1999 Proc. Natl. 65 CA, CG, GT, GG, GA, and G.C. Acad. Sci USA 96:9305-10; Liang, 1996 J. Clin. Invest. The T-rich immunostimulatory nucleic acid may have 98:1119-1129). only a single poly T motif or it may have a plurality of poly US 7,271,156 B2 3 4 T nucleic acid motifs. In some embodiments the T-rich sequences of at least 3 contiguous C nucleotide residues or immunostimulatory nucleic acid comprises at least 2, at least is free of two poly A sequences of at least 3 contiguous A 3, at least 4, at least 5, at least 6, at least 7, or at least 8 T nucleotide residues. In other embodiments the Py-rich or TG motifs. In other embodiments it comprises at least 2, at least immunostimulatory nucleic acid comprises a nucleotide 3, at least 4, at least 5, at least 6, at least 7, or at least 8 CpG composition of greater than 25% C or greater than 25% A. motifs. In preferred embodiments the plurality of CpG In yet other embodiments the Py-rich or TG immunostimu motifs and poly T motifs are interspersed. latory nucleic acid is free of poly-C sequences, poly-G In yet other embodiments at least one of the plurality of sequences or poly-A sequences. poly T motifs comprises at least 3, at least 4, at least 5, at A poly G nucleic acid in some embodiments is selected least 6, at least 7, at least 8, or at least 9 contiguous T 10 from the group consisting of SEQ ID NO: 5, 6, 73, 215, nucleotide residues. In other embodiments the plurality of 267-269, 276, 282, 288, 297-299, 355, 359, 386, 387, 444, poly T motifs is at least 3 motifs and wherein at least 3 476,531, 557-559, 733, 768, 795, 796,914-925, 928-931, motifs each comprises at least 3 contiguous T nucleotide 933-936, and 938. In other embodiments the poly G nucleic residues or the plurality of poly T motifs is at least 4 motifs acid includes a sequence selected from the group consisting and wherein the at least 4 motifs each comprises at least 3 15 of SEQID NO: 67, 80-82, 141, 147,148, 173, 178, 183,185, contiguous T nucleotide residues. 214, 224, 264, 265, 315, 329, 434, 435, 475,519, 521-524, In some cases the T-rich immunostimulatory nucleic acid 526, 527, 535, 554, 565,609, 628, 660, 661, 662,725, 767, may be free of poly T motifs but may rather comprise a 825, 856, 857, 876, 892, 909, 926,927, 932, and 937. nucleotide composition of greater than 25% T. In other According to another aspect of the invention, the immu embodiments the T-rich immunostimulatory nucleic acids nostimulatory nucleic acids may be defined as those which have poly T motifs and also comprise a nucleotide compo possess a TG motif, herein referred to as TG immunostimu sition of greater than 25% T. In preferred embodiments the latory nucleic acids. The TG nucleic acid in one embodiment T-rich immunostimulatory nucleic acid comprises a nucle contains at least one TG dinucleotide having a sequence otide composition of greater than 35% T. greater than 40% including at least the following formula: 5"NXTGXN3'. T. greater than 50% T. greater than 60% T. greater than 80% 25 In related embodiments, N is a nucleic acid sequence T, or greater than 90% T. nucleotide residues. In important composed of a number of nucleotides ranging from (11-N) embodiments, the nucleic acid is at least 50% T. to (21-N) and N is a nucleic acid sequence composed of a The T-rich and TG immunostimulatory nucleic acids can number of nucleotides ranging from (11-N) to (21-N). In have any length greater than 7 nucleotides, but in some a preferred embodiment, X is thymidine. embodiments can be between 8 and 100 nucleotide residues 30 In other embodiments, the TG nucleic acid has at least the in length. In preferred embodiments the T-rich immuno following formula: 5' X XTGX X 3". In yet another stimulatory nucleic acid comprises at least 20 nucleotides, at embodiment, the TG nucleic acid comprises the following least 24 nucleotides, at least 27, nucleotides, or at least 30 sequence: 5'NXXTGXXN3'. In a related embodiment, nucleotides. In preferred embodiments, the TG immuno N is a nucleic acid sequence composed of a number of stimulatory nucleic acid is between 15 and 25 nucleotides in 35 nucleotides ranging from (9-N) to (19-N) and N is a length. The T-rich and TG immunostimulatory nucleic acids nucleic acid sequence composed of a number of nucleotides may be single stranded or double stranded. ranging from (9-N) to (19-N). In one preferred embodi In one preferred embodiment, the immunostimulatory ment, X is thymidine. XX are nucleotides which may be nucleic acid has a T-rich region located in the middle of its selected from the group consisting of GT, GG, GA, AA, AT, length (i.e., an approximately equal number of nucleotides 40 AG, CT, CA, CG, TA and TT, and XX are nucleotides flank the T-rich region on the 5' and 3' ends). which may be selected from the group consisting of TT, CT, The Trich nucleic acid in some embodiments is selected AT AG, CG, TC, AC, CC, TA, AA, and CA. In some from the group consisting of SEQID NO: 59-63, 73-75, 142, preferred embodiments, X is a thymidine. In important 215, 226, 241, 267-269, 282, 301, 304, 330, 342, 358, embodiments, XX are nucleotides selected from the group 370-372, 393, 433, 471, 479, 486, 491, 497, 503, 556-558, 45 consisting of TT, TC, TA and TG. In other embodiments 567, 694, 793-794, 797, 833, 852, 861, 867, 868,882, 886, XX are GA or GT and XX are TT. In yet other embodi 905, 907,908, and 910-913. In other embodiments the Trich ments X or X or both are purines and X or X or both are nucleic acids are sequence selected from the group consist pyrimidines or XX are Gp A and X or X or both are ing of SEQ ID NO: 64, 98, 112, 146, 185, 204, 208, 214, pyrimidines. In one embodiment X is a T and X is a 224, 233, 244, 246, 247, 258, 262, 263,265, 270-273, 300, 50 pyrimidine. 305,316, 317,343, 344, 350, 352,354, 374,376, 392,407, In one embodiment the 5' X XTGXX 3' sequence of 411-413, 429-432, 434, 435, 443, 474, 475, 498-501, 518, the TG nucleic acid or the entire length or some fragment 687, 692, 693, 804, 862, 883, 884, 888, 890, and 891. thereof of the TG nucleic acid is a non-palindromic In other embodiments the Py-rich immunostimulatory sequence, and in other embodiments it is a palindromic nucleic acid is a C-rich nucleic acid. An immunostimulatory 55 Sequence. C-rich nucleic acid is a nucleic acid including at least one In some preferred embodiments, the TG nucleic acid is and preferably at least 2 poly-C regions or which includes also T-rich. 50% or greater C nucleotides. The Py-rich and TG immunostimulatory nucleic acids in The Py-rich and TG immunostimulatory nucleic acids some embodiments have a nucleotide backbone which may include one or more CpG motifs. The motifs may be 60 includes at least one backbone modification, such as a methylated or unmethylated. In other embodiments the phosphorothioate modification. The nucleotide backbone Py-rich and TG immunostimulatory nucleic acids are free of may be chimeric, or preferably the nucleotide backbone is one or more CpG dinucleotides. entirely modified. In one preferred embodiment, the immu In other embodiments the Py-rich and TG immunostimu nostimulatory nucleic acid has a poly T motif and a phos latory nucleic acids also include poly-A, poly G, and/or poly 65 phorothioate backbone. C motifs. In yet other embodiments the Py-rich or TG In another aspect the invention is a composition of an immunostimulatory nucleic acid is free of two poly C immunostimulatory nucleic acid, in the form of a Py-rich or US 7,271,156 B2 5 6 a TG nucleic acid, and an antigen, wherein the nucleic acid In another embodiment, the Py-rich or TG. oligonucle is free of unmethylated CpG motifs. otide is free of a CpG motifs. This embodiment of the Another composition of the invention is a Py-rich or TG invention also involves pharmaceutical compositions and immunostimulatory nucleic acid and an anti-microbial kits which contain both a CpG oligonucleotide (which can agent, wherein the Py-rich or TG nucleic acid is free of 5 be free of poly T and TG motifs and not be T-rich) and a unmethylated CpG motifs. Preferably the anti-microbial Py-rich and/or TG. oligonucleotide physically separate from agent is selected from the group consisting of an anti-viral the CpG oligonucleotide. The pharmaceutical preparations agent, an anti-parasitic agent, an anti-bacterial agent and an are in effective amounts and typically include pharmaceu anti-fungal agent. tically acceptable carriers, all as set forth in detail herein A composition of a Sustained release device including a 10 with respect to Py-rich and TG oligonucleotides. The kits Py-rich and/or TG immunostimulatory nucleic acid, wherein include at least one container containing an oligonucleotide the Py-rich and/or TG nucleic acid is free of unmethylated which is a Py-rich or TG. oligonucleotide (or some combi CpG motifs, is provided according to another aspect of the invention. nation thereof). The same container, or in other embodi 15 ments, a second container, may contain an oligonucleotide The invention also includes nutritional Supplements of a with a CpG motif, which may be free of Py-rich and/or TG Py-rich or TG immunostimulatory nucleic acid in a delivery motifs. The kit also contains instructions for administering device selected from the group consisting of a capsule, a pill, the oligonucleotides to a subject. The kits also may include and a sublingual tablet, wherein the Py-rich or TG nucleic acid is free of unmethylated CpG motifs. a container containing a solvent or a diluent. It should be understood that when it is useful to administer In Summary, as if fully recited herein, a CpG oligonucle a Py-rich e.g., poly T, T-rich, C-rich, or TG. oligonucleotide otide physically separate from the Py-rich or TG. oligonucle and a CpG oligonucleotide, it may also be desirable to otide can be used together with the Py-rich or TG. oligo co-administer a Py-rich or a TG. oligonucleotide together nucleotides in the methods, compositions and products with a physically separate CpG. Py-rich or TG. oligonucle described above. otide. Alternatively, the CpG. Py-rich or TG motif may be 25 The invention relates in other aspects to immunostimu present on the same contiguous nucleic acid as the Py-rich latory oligonucleotides which have chimeric backbones and or TG. oligonucleotide. In yet a further embodiment, all or which do not require the presence of a CpG motif. The some combination of Py-rich, TG and CpG nucleic acids invention is based in part on the discovery that nucleic acid may be co-administered either on separate nucleic acids or sequences which did not contain CpG motifs were immu in the same nucleic acid molecule. By co-administer it is 30 nostimulatory, and that those which have chimeric back intended that the nucleic acids be administered close enough bones have unexpectedly enhanced immune stimulating in time to one another to achieve a combined benefit of both properties. Thus the invention in one aspect relates to a oligonucleotides, preferably more than the benefit achieved composition of an oligonucleotide having a formula: 5' by administering each of the oligonucleotides alone at the 35 YNZNY 3', wherein Y and Y are, independent of one same dose. another, nucleic acid molecules having between 1 and 10 CpG oligonucleotides have, in general, the formula nucleotides, wherein Y includes at least one modified 5'XXCGXX3', wherein X, X, X and X are nucle internucleotide linkage and Y, includes at least one modified otides and wherein at least the C of CpG is unmethylated. internucleotide linkage and wherein N and N are nucleic Preferred CpG oligonucleotides are 8-100 nucleotides in 40 acid molecules, each independent of one another, having length and have modified back bones. Particular structures between 0 and 5 nucleotides, but wherein NZN has at least are detailed in the published PCT applications, U.S. appli 6 nucleotides in total and wherein the nucleotides of NZN cations and references cited herein, the disclosures of which have a phosphodiester backbone, and wherein Z is an are incorporated herein in their entirety. In one embodiment, immunostimulatory nucleic acid motif but does not include the CpG oligonucleotide is free of poly T and TG motifs and 45 a CG. In one embodiment Z is a nucleic acid sequence is not T-rich. selected from the group consisting of TTTT, TG, and a In other embodiments, the CpG oligonucleotide has a sequence wherein at least 50% of the bases of the sequence sequence selected from the group consisting of SEQID NO: are Ts. 1, 3, 4, 14-16, 18-24, 28, 29, 33-46, 49, 50, 52-56,58, 64-67, In some embodiments Y and/or Y have between 3 and 69, 71, 72, 76-87, 90,91, 93, 94, 96, 98, 102-124, 126-128, 50 8 nucleotides. In other embodiments Y and/or Y are 131-133, 136-141, 146-150, 152-153, 155-171, 173-178, comprised of at least three Gs, at least four Gs, least seven 180-186, 188-198, 201, 203-214, 216-220, 223, 224, 227 Gs, or all Gs. In other embodiments Y and/or Y are 240, 242-256, 258, 260-265, 270-273, 275, 277-281, 286 selected from the group consisting of TCGTCG, 287, 292, 295-296, 300, 302, 305-307, 309-312, 314-317, TCGTCGT, and TCGTCGTT (SEQ ID NO:1145). In yet 320-327, 329, 335, 337-341, 343-352, 354, 357, 361-365, 55 other embodiments Y and/or Y, include at least one, two, 367-369, 373-376, 378-385, 388-392,394, 395, 399, 401 three, four, or five poly-A, poly-T, or poly-C sequences. 404, 406-426, 429-433, 434–437, 439, 441-443, 445, 447, The center nucleotides (NZN) of the formula 448, 450, 453-456, 460-464, 466-469, 472-475, 477, 478, YNZNY have phosphodiester internucleotide linkages 480, 483-485, 488, 489, 492, 493, 495-502, 504-505, 507 and Y and Y have at least one modified internucleotide 509, 511, 513-529, 532-541, 543-555, 564-566, 568-576, 60 linkage. In some embodiments Y and/or Y have at least 578, 580,599, 601-605, 607-611, 613-615, 617, 619-622, two modified internucleotide linkages. In other embodi 625-646, 648-650, 653-664, 666-697, 699-706, 708, 709, ments Y and/or Y have between two and five modified 711-716, 718-732, 736, 737, 739-744, 746, 747, 749-761, internucleotide linkages. In yet other embodiments Y has 763, 766–767, 769, 772-779, 781-783, 785-786, 7900792, two modified internucleotide linkages and Y has five modi 798-799, 804-808, 810, 815, 817, 818, 820-832, 835-846, 65 fied internucleotide linkages or Y has five modified inter 849-850, 855-859, 862, 865, 872, 874-877, 879-881, 883 nucleotide linkages and Y has two modified internucleotide 885, 888-904, and 909-913. linkages. The modified internucleotide linkage, in some US 7,271,156 B2 7 8 embodiments is a phosphorothioate modified linkage, a YNZNY, in a delivery device selected from the group phosphorodithioate modified linkage or a p-ethoxy modified consisting of a capsule, a Sublingual tablet, and a pill. linkage. In another aspect the compositions described above also Portions of the formula YNZNY may optionally form include an immunostimulatory nucleic acid having an unm a palindrome. Thus, in some embodiments the nucleotides of 5 ethylated CG dinucleotide, a TG dinucleotide or a Py-rich NZN form a palindrome. In some embodiments the pal sequence wherein the immunostimulatory nucleic acid hav indrome is not a direct repeat. In yet other embodiments the ing an unmethylated CG dinucleotide, a TG dinucleotide or nucleotides of NZN do not form a palindrome. a Py-rich sequence has a different sequence than the oligo According to other embodiments NZN has a sequence nucleotide comprising 5' YNZNY 3'. of nucleotides selected from the group consisting of GATTT 10 In Some embodiments the immunostimulatory nucleic TATCGTC (SEQ ID NO: 1098); TCGATTTTTCGA (SEQ acid having an unmethylated CG dinucleotide, a TG dinucle ID NO: 1099); TCATTTTTATGA (SEQ ID NO: 1100); otide or a Py-rich sequence has a completely phosphodiester GTTTTTTACGAC (SEQID NO: 1101); TCAATTTTTTGA backbone and in other embodiments the immunostimulatory (SEQ ID NO: 1102); ACGTTTTTACGT (SEQ ID NO: nucleic acid having an unmethylated CG dinucleotide, a TG 1103); TCGTTTTTACGA (SEQ ID NO: 1104); 15 dinucleotide or a Py-rich sequence has a modified backbone, TCGATTTTTACGTCGA (SEQ ID NO: 1105); AATTTTT which optionally may have internucleotide linkages selected TAACGTT (SEQ ID NO: 1106); TCGTTTTTTAACGA from the group consisting of phosphorothioate, phospho (SEQ ID NO: 1107); ACGTTTTTTAACGT (SEQ ID NO: rodithioate, and p-ethoxy. 1108); GATTTTTATCGTC (SEQ ID NO: 1109); GAC In one embodiment immunostimulatory nucleic acid hav GATTTTTCGTC (SEQ ID NO: 1110); GATTT ing an unmethylated CG dinucleotide has a formula com TAGCTCGTC (SEQ ID NO: 1111); GATTTTTACGTC prising: 5' XXCGXX 3' wherein X, X, X and X are (SEQ ID NO: 1112); ATTTTATCGT (SEQ ID NO: 1113): nucleotides. In other embodiments the immunostimulatory AACGATTTTTCGTT (SEQ ID NO: 1114): nucleic acid sequence includes at least the following for TCACTTTTGTGA (SEQ ID NO: 1115); TCGTATTTTA mula: 5' TCNTXXCGXX 3' wherein N is a nucleic acid (SEQ ID NO: 1116); ACTTTTGTACCGGT (SEQ ID NO: 25 sequence composed of from about 0-25 nucleotides, wherein 1117); TCGATTTTTCGACGTCGA (SEQ ID NO: 1118); at least one nucleotide has a modified internucleotide link ACGATTTTTCGT (SEQ ID NO: 1119); GATGATCGTC age, and wherein the nucleic acid has less than or equal to (SEQ ID NO: 1120); TCGATGTCGA (SEQ ID NO: 1121); 100 nucleotides. According to some embodiments XX are TCATGTATGA (SEQ ID NO: 1122); GTGTTACGAC nucleotides selected from the group consisting of: GT, GG, (SEQ ID NO: 1123); TCAATGTTGA (SEQ ID NO: 1124); 30 GA and AA and XX are nucleotides selected from the ACGTGTACGT (SEQ ID NO: 1125); TCGTGTACGA group consisting of TT, CT or GT. In a preferred embodi (SEQ ID NO: 1126); TCGATGTACGTCGA (SEQ ID NO: ment XX are GA and XX are TT. 1127); AATGTTAACGTT (SEQ ID NO: 1128); TCGTGT In another embodiment the immunostimulatory nucleic TAACGA (SEQ ID NO: 1129); ACGTGTTAACGT (SEQ acid sequence having an unmethylated CG dinucleotide ID NO: 1130); GATGTATCGTC (SEQ ID NO: 1131); 35 includes at least one of the following sequences: ATC GACGATGTCGTC (SEQ ID NO: 1132); GAT GACTCTCGAGCGTTCTC (SEQ ID No. 15); TCCAT GAGCTCGTC (SEQ ID NO: 1133); GATGTACGTC (SEQ GTCGGTCCTGCTGAT (SEQ ID No. 32); TCCATGTCG ID NO: 1134); ATGATCGT (SEQID NO: 1135): AACGAT GTZCTGATGCT (SEQ ID No. 31); GTCGTT (SEQ ID NO: 1136); TCACTGGTGA (SEQ ID ATCGACTCTCGAGCGTTZTC (SEQID No. 18); TCCAT NO: 1137); TCGTATGA (SEQ ID NO: 1138); ACTGG 40 GTCGGTCCTGATGCT (SEQ ID No. 28); GGGGGG TACCGGT (SEQID NO: 1139); TCGATGTCGACGTCGA (SEQ ID No. 12); TCCATGACGGTCCTGATGCT (SEQ (SEQ ID NO: 1140); and ACGATGTCGT (SEQ ID NO: ID No. 35); TCCATGGCGGTCCTGATGCT (SEQ ID No. 1141). 34); TCCATGACGTTCCTGATGCT (SEQ ID No. 7); The composition may optionally include a pharmaceutical TCCATGTCGTTCCTGATGCT (SEQ ID No. 38); carrier and/or be formulated in a delivery device. In some 45 GGGGTCAGTCTTGACGGGG (SEQID No. 41); TCCAT embodiments the delivery device is selected from the group GTCGCTCCTGATGCT (SEQ ID No. 37); TCCATGTC consisting of cationic lipids, cell permeating proteins, and GATCCTGATGCT (SEQ ID No. 36); TCCATGCCGGTC sustained release devices. In one preferred embodiment the CTGATGCT (SEQ ID No. 33): Sustained release device is a biodegradable polymer. In TCCATAACGTTCCTGATGCT (SEQ ID No. 3); TCCAT another embodiment the Sustained release device is a micro 50 GACGTTCCTGATGCT (SEQ ID No. 7); TCCAT particle. GACGTCCCTGATGCT (SEQID No. 39); TCCATCACGT In another aspect the invention is a composition of an GCCTGATGCT (SEQ ID No. 48); immunostimulatory oligonucleotide having the formula TCCATGACGTTCCTGACGTT (SEQ ID No. 10); YNZNY, and an antigen. ATGACGTTCCTGACGTT (SEQ ID No. 70); TCTC 55 CCAGCGCGCGCCAT (SEQ ID No. 72); TCCATGTCGT Another composition of the invention is an immunostimu TCCTGTCGTT (SEQ ID No. 73); TCCATAGCGTTC latory oligonucleotide having the formula YNZN.Y., and CTAGCGTT (SEQ ID No. 74): an anti-microbial therapeutic agent. Preferably the anti TCCTGACGTTCCTGACGTT (SEQ ID No. 76); TCCT microbial therapeutic agent is selected from the group GTCGTTCCTGTCGTT (SEQ ID No. 77); TCCTGTCGT consisting of an anti-viral agent, an anti-parasitic agent, an 60 TCCTTGTCGTT (SEQ ID No. 52), TCCTTGTCGTTCCT anti-bacterial agent, or an anti-fungal agent. GTCGTT (SEQ ID No 121); A composition of a Sustained release device including an TCCTGTCGTTTTTTGTCGTT (SEQ ID No. 208); immunostimulatory oligonucleotide having the formula TCGTCGCTGTTGTCGTTTCTT (SEQ ID No. 120): YNZNY, is provided according to another aspect of the TCCATGCGTTGCGTTGCGTT (SEQ ID No. 81); invention. 65 TCCACGACGTTTTCGACGTT (SEQ ID No. 82); The invention also includes nutritional Supplements of an TCGTCGTTGTCGTTGTCGTT (SEQ ID No. 47); immunostimulatory oligonucleotide having the formula TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID No. 46); US 7,271,156 B2 9 10 TCGTCGTTGTCGTTTTGTCGTT (SEQ ID No. 49); and TG nucleic acids may also be used to activate an GCGTGCGTTGTCGTTGTCGTT (SEQ ID No. 56); immune cell. Such as a leukocyte, a dendritic cell, and an NK TGTCGTTTGTCGTTTGTCGTT (SEQ ID No. 48); cell. The activation can be performed in vivo, in vitro, or ex TGTCGTTGTCGTTGTCGTTGTCGTT (SEQ ID No. 84); Vivo, i.e., by isolating an immune cell from the Subject, TGTCGTTGTCGTTGTCGTT (SEQ ID No. 50): 5 contacting the immune cell with an effective amount to TCGTCGTCGTCGTT (SEQ ID No. 51); and TGTCGT activate the immune cell of the Py-rich or TG immunostimu TGTCGTT (SEQ ID No. 85). In another embodiment the latory nucleic acid and re-administering the activated immunostimulatory nucleic acid having a Py-rich or TG immune cell to the subject. In some embodiments the sequence is a nucleic acid as described above. dendritic cell expresses a cancer antigen. The dendritic cell In another aspect the invention relates to pharmaceutical 10 can be exposed to the cancer antigen ex vivo. compositions and kits which contain both an oligonucleotide The immune response produced by Py-rich or TG nucleic having the formula YNZNY and a CpG oligonucleotide acids may also result in induction of cytokine production, (which optionally may be free of poly T and TG motifs and e.g., production of IL-6, IL-12, IL-18 TNF, IFN-O. and not be Py-rich), a Py-rich and/or TG. oligonucleotide physi IFN-Y. cally separate from the oligonucleotide having the formula 15 In still another embodiment, the Py-rich and TG nucleic YNZN.Y.. The pharmaceutical preparations are in effec acids are useful for treating cancer. The Py-rich and TG tive amounts and typically include pharmaceutically accept nucleic acids are also useful according to other aspects of the able carriers, all as set forth in detail herein. The kits include invention in preventing cancer (e.g., reducing a risk of at least one container containing an oligonucleotide having developing cancer) in a Subject at risk of developing a the formula YNZNY. The same container, or in other 20 cancer. The cancer may be selected from the group consist embodiments, a second container, may contain an oligo ing of biliary tract cancer, breast cancer, cervical cancer, nucleotide with a CpG motif, which optionally may be free choriocarcinoma, colon cancer, endometrial cancer, gastric of Py-rich and/or TG motifs and/or a Py-rich or TG. oligo cancer, intraepithelial neoplasms, lymphomas, liver cancer, nucleotide (or some combination thereof). The kit also lung cancer (e.g. Small cell and non-small cell), melanoma, contains instructions for administering the oligonucleotides 25 neuroblastomas, oral cancer, ovarian cancer, pancreas can to a subject. The kits also may include a container containing cer, prostate cancer, rectal cancer, sarcomas, thyroid cancer, a solvent or a diluent. and renal cancer, as well as other carcinomas and sarcomas. In Summary, as if fully recited herein, an oligonucleotide In some important embodiments, the cancer is selected from having the formula YNZNY, which is physically separate the group consisting of bone cancer, brain and CNS cancer, from the CpG. Py-rich or TG. oligonucleotide can be used 30 connective tissue cancer, esophageal cancer, eye cancer, together with the CpG. Py-rich, TG oligonucleotides, in the Hodgkin’s lymphoma, larynx cancer, oral cavity cancer, skin methods, compositions and products described herein. cancer, and testicular cancer. In another aspect the invention relates to a pharmaceutical Py-rich and TG nucleic acids may also be used for composition including at least two oligonucleotides of the increasing the responsiveness of a cancer cell to a cancer invention, wherein the at least two oligonucleotides have 35 therapy (e.g., an anti-cancer therapy), optionally when the different sequences from one another and a pharmaceutically Py-rich or TG immunostimulatory nucleic acid is adminis acceptable carrier. tered in conjunction with an anti-cancer therapy. The anti A vaccine formulation is provided according to another cancer therapy may be a chemotherapy, a vaccine (e.g., an aspect of the invention. The vaccine includes any of the in vitro primed dendritic cell vaccine or a cancer antigen compositions of the invention in combination with an anti- 40 vaccine) or an antibody based therapy. This latter therapy gen. may also involve administering an antibody specific for a According to another aspect of the invention a method of cell Surface antigen of for example, a cancer cell, wherein stimulating an immune response is provided. The method the immune response results in antigen dependent cellular involves administering a Py-rich or a TG immunostimula cytotoxicity (ADCC). In one embodiment, the antibody may tory nucleic acid to a non-rodent Subject in an amount 45 be selected from the group consisting Ributaxin, Herceptin, effective to induce an immune response in the non-rodent Quadramet, Panorex, IDEC-Y2B8, BEC2, C225, Oncolym, subject. Preferably the Py-rich or TG immunostimulatory SMART M195, ATRAGEN, Ovarex, Bexxar, LDP-03, ior nucleic acid is administered orally, locally, in a Sustained t6, MDX-210, MDX-11, MDX-22, OV103,3622W94, anti release device, mucosally to a mucosal Surface, systemi VEGF, Zenapax, MDX-220, MDX-447, MELIMMUNE-2, cally, parenterally, or intramuscularly. When the Py-rich or 50 MELIMMUNE-1, CEACIDE, Pretarget, NovoMAb-G2, TG immunostimulatory nucleic acid is administered to the TNT, Gliomab-H, GNI-250, EMD-72000, LymphoCide, mucosal surface it may be delivered in an amount effective CMA 676, Monopharm-C, 4B5, ior egfr3, ior c5, BABS, for inducing a mucosal immune response or a systemic anti-FLK-2, MDX-260, ANA Ab, SMART ID10 Ab, immune response. In preferred embodiments the mucosal SMART ABL 364 Ab and ImmuRAIT-CEA. Surface is selected from the group consisting of an oral, 55 Thus, according to some aspects of the invention, a nasal, rectal, vaginal, and ocular surface. Subject having cancer or at risk of having a cancer is In some embodiments the method includes exposing the administered an immunostimulatory nucleic acid and an Subject to an antigen wherein the immune response is an anti-cancer therapy. In some embodiments, the anti-cancer antigen-specific immune response. The antigen may be therapy is selected from the group consisting of a chemo encoded by a nucleic acid vector which can be delivered to 60 therapeutic agent, an immunotherapeutic agent and a cancer the Subject. In some embodiments the antigen is selected vaccine. The chemotherapeutic agent may be selected from from the group consisting of a tumor antigen, a viral antigen, the group consisting of methotrexate, Vincristine, adriamy a bacterial antigen, a parasitic antigen and a peptide antigen. cin, cisplatin, non-Sugar containing chloroethylnitrosoureas, Py-rich and TG immunostimulatory nucleic acids are 5-fluorouracil, mitomycin C, bleomycin, doxorubicin, dac capable of provoking a broad spectrum of immune response. 65 arbazine, taxol, fragyline, Meglamine GLA, valrubicin, car For instance these immunostimulatory nucleic acids can be mustaine and poliferposan, MM1270, BAY 12-9566, RAS used to redirect a Th2 to a Th1 immune response. Py-rich famesyl transferase inhibitor, famesyl transferase inhibitor, US 7,271,156 B2 11 12 MMP, MTA/LY231514, LY264618/Lometexol, Glamolec, In still another embodiment of the methods directed to CI-994, TNP-470, Hycamtin/Topotecan, PKC412, Valspo preventing or treating cancer, the Subject may be further dar/PSC833, Novantrone/Mitroxantrone, Metaret/Suramin, administered interferon-C. Batimastat, E7070, BCH-4556, CS-682, 9-AC, AG3340, The invention in other aspects relates to methods for AG3433, Incel/VX-710, VX-853, ZD0101, ISI641, ODN preventing disease in a subject. The method involves admin 698, TA 2516/Marmistat, BB2516/Marmistat, CDP 845, istering to the subject a Py-rich or a TG immunostimulatory D2163, PD183805, DX8951f. Lemonal DP 2202, FK 317, nucleic acid on a regular basis to promote immune system Picibanil/OK-432, AD 32/Valrubicin, Metastron/strontium responsiveness to prevent disease in the Subject. Examples derivative, Temodal/Temozolomide, Evacet/liposomal of diseases or conditions sought to be prevented using the 10 prophylactic methods of the invention include microbial doxorubicin, Yewtaxan/Placlitaxel, Taxol/Paclitaxel, infections (e.g., sexually transmitted diseases) and anaphy Xeload/Capecitabine. Furtulon/Doxifluridine, Cyclopax/ lactic shock from food allergies. oral paclitaxel, Oral Taxoid, SPU-077/Cisplatin, HMR In other aspects, the invention is a method for inducing an 1275/Flavopiridol, CP-358 (774)/EGFR, CP-609 innate immune response by administering to the Subject a (754)/RAS oncogene inhibitor, BMS-182751/oral platinum, 15 Py-rich or a TG immunostimulatory nucleic acid in an UFT(Tegafur/Uracil), Ergamisol/Levamisole, Eniluracil/ amount effective for activating an innate immune response. 776C85/5FU enhancer, Campto/Levamisole, Camptosar/ According to another aspect of the invention a method for Irinotecan, TumodeX/Ralitrexed, Leustatin/Cladribine, treating or preventing a viral or retroviral infection is Paxex/Paclitaxel, Doxil/liposomal doxorubicin, CaelyX/li provided. The method involves administering to a subject posomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/ having or at risk of having a viral or retroviral infection, an Epirubicin, DepoCyt, ZD1839, LU 79553/Bis-Naphtalim effective amount for treating or preventing the viral or ide, LU 103793/Dolastain, Caetyx/liposomal doxorubicin, retroviral infection of any of the compositions of the inven Gemzar/Gemcitabine, ZD 0473/Anormed, YM 116, Iodine tion. In some embodiments the virus is caused by a hepatitis seeds, CDK4 and CDK2 inhibitors, PARP inhibitors, virus, HIV, hepatitis B, hepatitis C, herpes virus, or papil D4809/Dexifosamide, Ifes/MesneX/Ifosamide, Vumon/ 25 lomavirus. Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, A method for treating or preventing a bacterial infection Vepeside/Etoposide, ZD 9331, Taxotere/Docetaxel, pro drug is provided according to another aspect of the invention. The of guanine arabino side, Taxane Analog, nitrosoureas, alky method involves administering to a subject having or at risk lating agents such as melphelan and cyclophosphamide, of having a bacterial infection, an effective amount for Aminoglutethimide, Asparaginase, BuSulfan, Carboplatin, 30 treating or preventing the bacterial infection of any of the compositions of the invention. In one embodiment the Chlorombucil, Cytarabine HCl, Dactinomycin, Daunorubi bacterial infection is due to an intracellular bacteria. cin HCl, Estramustine phosphate sodium, Etoposide (VP16 In another aspect the invention is a method for treating or 213), Floxuridine, Fluorouracil (5-FU), Flutamide, Hydrox preventing a parasite infection by administering to a subject yurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a. 35 having or at risk of having a parasite infection, an effective Alfa-2b, Leuprolide acetate (LHRH-releasing factor ana amount for treating or preventing the parasite infection of logue), Lomustine (CCNU), Mechlorethamine HCl (nitro gen mustard), Mercaptopurine, Mesna, Mitotane (o.p'- any of the compositions of the invention. In one embodiment DDD), Mitoxantrone HCl, Octreotide, Plicamycin, the parasite infection is due to an intracellular parasite. In Procarbazine HCl, Streptozocin, Tamoxifen citrate, another embodiment the parasite infection is due to a Thioguanine. Thiotepa, Vinblastine Sulfate, Amsacrine 40 non-helminthic parasite. (m-AMSA), Azacitidine, Erthropoietin, Hexameth In some embodiments the Subject is a human and in other ylmelamine (HMM), Interleukin 2, MitoguaZone (methyl embodiments the subject is a non-human vertebrate selected GAG; methylglyoxal bis-guanylhydrazone: MGBG), Pen from the group consisting of a dog, cat, horse, cow, pig, goat, tostatin (2'deoxycoformycin), Semustine (methyl-CCNU), fish, monkey, chicken, and sheep. 45 In yet another aspect, the invention is a method for Teniposide (VM-26) and Vindesine sulfate, but it is not so treating or preventing asthma, by administering to a subject limited. having or at risk of having asthma, an effective amount for The immunotherapeutic agent may be selected from the treating or preventing the asthma of any of the compositions group consisting of Ributaxin, Herceptin, Quadramet, Pan of the invention. In one embodiment the asthma is allergic orex, IDEC-Y2B8, BEC2, C225, Oncolym, SMART M195, 50 asthma. ATRAGEN, Ovarex, Bexxar, LDP-03, ior té, MDX-210, In another aspect the invention relates to a method for MDX-1, MDX-22, OV103, 3622W94, anti-VEGF, Zena treating or preventing allergy. The method involves admin pax, MDX-220, MDX-447, MELIMMUNE-2, MELIM istering to a subject having or at risk of having allergy, an MUNE-1, CEACIDE, Pretarget, NovoMAb-G2, TNT, effective amount for treating or preventing the allergy of any Gliomab-H, GNI-250, EMD-72000, LymphoCide, CMA 55 of the compositions of the invention. 676, Monopharm-C, 4B5, ior egfr3, ior c5. BABS, anti A method for treating or preventing an immune deficiency FLK-2, MDX-260, ANA Ab, SMART 1D10 Ab, SMART is provided according to another aspect of the invention. The ABL 364 Ab and ImmuRAIT-CEA, but it is not so limited. method involves administering to a subject having or at risk The cancer vaccine may be selected from the group of an immune deficiency, an effective amount for treating or consisting of EGF, Anti-idiotypic cancer vaccines, Gp75 60 preventing the immune deficiency of any of the composi antigen, GMK melanoma vaccine, MGV ganglioside con tions of the invention. jugate vaccine, Her2/neu, Ovarex, M-Vax, O-Vax, L-Vax, In another aspect the invention relates to a method for STn-KHL theratope, BLP25 (MUC-1), liposomal idiotypic inducing a TH1 immune response by administering to a vaccine, Melacine, peptide antigen vaccines, toxinfantigen Subject any of the compositions of the invention in an vaccines, MVA-based vaccine, PACIS, BCG vacine, TA 65 effective amount to produce a TH1 immune response. HPV, TA-CIN, DISC-virus and ImmuCyst/TheraCys, but it In one embodiment the methods of the invention involve is not so limited. administering an oligonucleotide of formula 5'YNZNY US 7,271,156 B2 13 14 3' and an immunostimulatory nucleic acid having an unm In another embodiment, the asthma/allergy medicament is ethylated CG dinucleotide a TG dinucleotide or a T-rich a medicament selected from the group consisting of PDE-4 sequence. In an embodiment the oligonucleotide comprising inhibitor, Bronchodilator/beta-2 agonist, K+ channel opener, 5'YNZNY 3' is administered separately from the immu VLA-4 antagonist, Neurokin antagonist, TXA2 synthesis nostimulatory nucleic acid. In some embodiments the oli inhibitor, Xanthanine, Arachidonic acid antagonist, 5 gonucleotide comprising 5' YNZNY 3' and the immu lipoxygenase inhibitor, Thromboxin A2 receptor antagonist, nostimulatory nucleic acid are administered on an Thromboxane A2 antagonist, Inhibitor of 5-lipox activation alternating weekly schedule and in other embodiments the protein, and Protease inhibitor, but is not so limited. In some oligonucleotide comprising 5'YNZNY, 3' and the immu important embodiments, the asthma/allergy medicament is a nostimulatory nucleic acid are administered on an alternat 10 Bronchodilator/beta-2 agonist selected from the group con ing biweekly schedule. sisting of salmeterol, salbutamol, terbutaline, D2522/for The invention provides in another aspect a composition, moterol, fenoterol, and orciprenaline. comprising an immunostimulatory nucleic acid and an anti In another embodiment, the asthma/allergy medicament is cancer therapy, formulated in a pharmaceutically-acceptable a medicament selected from the group consisting of Anti carrier and in an effective amount to treat a cancer or to 15 histamines and Prostaglandin inducers. In one embodiment, reduce the risk of developing a cancer. In important embodi the anti-histamine is selected from the group consisting of ments, the immunostimulatory nucleic acid is selected from loratidine, cetirizine, buclizine, ceterizine analogues, fex the group consisting of a T-rich nucleic acid, a TG nucleic ofenadine, terfenadine, desloratadine, norastemizole, epi acid and a C-rich nucleic acid. nastine, ebastine, ebastine, astemizole, levocabastine, The invention further provides a kit comprising a first aZelastine, tranilast, terfenadine, mizolastine, betatastine, container housing an immunostimulatory nucleic acid and at CS 560, and HSR 609. In another embodiment, the Pros least one other container (e.g., a second container) housing taglandin inducer is S-5751. a an anti-cancer therapy, and instructions for use. In one In yet another embodiment, the asthma/allergy medica embodiment, the kit further comprises interferon-C, which ment is selected from the group consisting of Steroids and may be separately housed in yet another container (e.g., a 25 Immunomodulators. The immunomodulators may be third container). In an important embodiment, the kit com selected from the group consisting of anti-inflammatory prises a Sustained-release vehicle containing an immuno agents, leukotriene antagonists, IL4 muteins, Soluble IL-4 stimulatory nucleic acid, and at least one container housing receptors, Immunosuppressants, anti-IL-4 antibodies, IL-4 an anti-cancer therapy, and instructions for timing of admin antagonists, anti-IL-5 antibodies, soluble IL-13 receptor-Fc istration of the anti-cancer therapy. The immunostimulatory 30 fusion proteins, anti-IL-9 antibodies, CCR3 antagonists, nucleic acid may be selected from the group consisting of a CCR5 antagonists, VLA-4 inhibitors, and Downregulators Py-rich nucleic acid, a TG nucleic acid and a CpG nucleic of IgE, but are not so limited. In one embodiment, the acid, wherein the CpG nucleic acid has a nucleotide downregulator of IgE is an anti-IgE. sequence comprising SEQ ID NO: 246. In another embodiment, the Steroid is selected from the The invention further provides a method for preventing or 35 group consisting of beclomethasone, fluticasone, tramcino treating asthma or allergy, comprising administering an lone, budesonide, and budesonide. In still a further embodi immunostimulatory nucleic acid and an asthma/allergy ment, the Immunosuppressant is a Tolerizing peptide vac medicament in an effective amount to treat or prevent the cine. asthma or allergy. In important embodiments, the immuno In one embodiment, the immunostimulatory nucleic acid stimulatory nucleic acid is selected from the group consist 40 is administered concurrently with the asthma/allergy medi ing of a T-rich nucleic acid, a TG nucleic acid and a C-rich cament. In another embodiment, the Subject is an immuno nucleic acid. compromised subject The immunostimulatory nucleic acids to be administered In one embodiment the immunostimulatory nucleic acid is to a subject in the methods disclosed herein relating to the a T-rich nucleic acid. In a related embodiment, the T-rich 45 prevention and treatment of asthma/allergy are as described nucleic acid has a nucleotide sequence selected from the for other method aspects of the invention. group consisting of SEQ ID NO: 59-63, 73-75, 142, 215, In another aspect, the invention provides a kit comprising 226, 241, 267-269,282,301, 304, 330, 342, 358, 370-372, a first container housing an immunostimulatory nucleic acid, 393, 433, 471, 479, 486, 491,497, 503, 556-558, 567, 694, 793-794, 797, 833, 852, 861, 867, 868, 882, 886, 905, 907, and at least another container (e.g., a second container) 908, and 910-913. In other embodiments the T-rich nucleic 50 housing an asthma/allergy medicament, and instructions for acids are sequence selected from the group consisting of use. The immunostimulatory nucleic acid useful in the kit is SEQID NO: 64, 98, 112, 146, 185,204, 208,214, 224, 233, as described herein. In important embodiments, the immu 244, 246, 247, 258, 262, 263,265, 270-273, 300, 305,316, nostimulatory nucleic acid is selected from the group con 317, 343, 344, 350, 352, 354, 374,376, 392, 407, 411-413, sisting of a T-rich nucleic acid, a TG nucleic acid and a 55 C-rich nucleic acid. In another important embodiment, the 429-432, 434, 435, 443, 474, 475, 498-501, 518, 687, 692, kit comprises a Sustained-release vehicle containing an 693, 804, 862, 883, 884, 888, 890, and 891. immunostimulatory nucleic acid, and at least one container In yet a further related embodiment, the T-rich nucleic housing an asthma/allergy medicament, and instructions for acid is not a TG nucleic acid. In yet still another embodi timing of administration of the asthma/allergy medicament. ment, the T-rich nucleic acid is not a CpG nucleic acid. 60 The asthma/allergy medicament may be selected from the In one embodiment, the immunostimulatory nucleic acid group of asthma/allergy medicaments described in the fore is a TG nucleic acid. In a further related embodiment, the TG going methods directed towards the prevention or treatment nucleic acid is not a T-rich nucleic acid. In another related of asthma/allergy. embodiment, the TG nucleic acid is not a CpG nucleic acid. In yet another aspect, the invention provides a composi In one embodiment, the immunostimulatory nucleic acid 65 tion, comprising an immunostimulatory nucleic acid and an is a CpG nucleic acid, wherein the CpG nucleic acid has a asthma/allergy medicament, formulated in a pharmaceuti nucleotide sequence comprising SEQ ID NO: 246. cally-acceptable carrier and in an effective amount for US 7,271,156 B2 15 16 preventing or treating an immune response associated with FIG. 3 is a graph comparing the abilities of ODN 2188. exposure to a mediator of asthma or allergy. The immuno ODN 2189, ODN 2190 and ODN 2182 to stimulate B cell stimulatory nucleic acid may be selected from the group of proliferation at concentrations ranging from 0.2 g/ml to 20 immunostimulatory nucleic acids described for the forego g/ml. ing methods and compositions. In important embodiments, FIG. 4 is a bar graph depicting dose-dependent B cell the immunostimulatory nucleic acid is selected from the activation induced by non-CpG ODN. PBMC of a blood group consisting of a T-rich nucleic acid, a TG nucleic acid donor were incubated with the indicated concentrations of and a C-rich nucleic acid. The asthma/allergy medicament ODNs 2006 (SEQID NO.: 246), 2117 (SEQ ID NO. 358), may be selected from the group consisting of asthma medi 2137 (SEQ ID NO.: 886), 5126 (SEQ ID NO.: 1058) and caments and allergy medicaments as described in the fore 10 5162 (SEQ ID NO. 1094) and stained with mAb for CD 19 going methods and compositions. (B cell marker) and CD86 (B cell activation marker, B7-2). In still a further aspect, the invention provides a compo Expression was measured by flow cytometry. sition comprising an immunostimulatory nucleic acid FIG. 5 is a bar graph depicting stimulation of B cells by selected from the group consisting of SEQ ID NO: 95-136, a diverse set of non-CpG ODNs. PBMC of one representa SEQ ID NO: 138-152, SEQ ID NO: 154-222, SEQID NO: 15 tive donor were stimulated by 0.4 ug/ml, 1.0 ug/ml or 10.0 224-245, SEQID NO: 247-261, SEQID NO: 263-299, SEQ ug/ml of the following ODNs: 2006 (SEQ ID NO. 246), ID NO: 301, SEQID NO:303-4109, SEQID NO: 414-420, 21.96 (SEQ ID NO.: 913), 2194 (SEQ ID NO.: 911), 5162 SEQ ID NO: 424, SEQ ID NO: 426-947, SEQ ID NO: (SEQID NO.: 1094), 5163 (SEQID NO.: 1095), 5168 (SEQ 959-1022, SEQID NO: 1024-1093, and a pharmaceutically ID NO.: 1096) and 5169 (SEQ ID NO. 1097) and expres acceptable carrier. Preferably the immunostimulatory sion of the activation marker CD86 (B7-2) on CD19 nucleic acid is present in the composition in an effective positive B cells was measured by flow cytometry. amount. In one embodiment, the immunostimulatory nucleic FIG. 6 is a bar graph depicting B cell activation by acid is present in an effective amount to induce an immune non-CpG ODNs 1982 and 2041. PBMC were incubated with response. In another embodiment, the immunostimulatory the indicated concentrations of ODN 2006 (SEQ ID NO. nucleic acid is present in an effective amount to prevent or 25 246), 1982 (SEQID NO.: 225) and 2041 (SEQID NO.: 282) treat cancer. In yet a further embodiment, the immunostimu and B cell activation (expression of the activation marker latory nucleic acid is present in an effective amount to CD86) was measured by flow cytometry. prevent or treat asthma/allergy. The invention also provides FIG. 7 is a bar graph depicting NK cells are activated by kits comprising any of the foregoing immunostimulatory non-CpG ODNs. PBMC were incubated with 6 g/ml of the nucleic acid compositions, and instructions for use. 30 following ODNs: 2006 (SEQ ID NO.: 246), 2117 (SEQ ID In another aspect the invention includes a composition of NO. 358), 2137 (SEQ ID NO.: 886), 2183 (SEQ ID NO.: an immunostimulatory nucleic acid consisting essentially of: 433), 2194 (SEQ ID NO.: 911) and 5126 (SEQ ID NO.: 5' MTCGTCGTTM 3' wherein at least one of the Cs is 1058) and stained with mAb for CD3 (T cell marker), CD56 unmethylated, wherein M1 is a nucleic acid having at least (NK cell marker) and CD69 (early activation marker). one nucleotide, wherein M is a nucleic acid having between 35 Expression of CD69 on CD56-positive NK cells was mea 0 and 50 nucleotides, and wherein the immunostimulatory sured by flow cytometry. nucleic acid has less than 100 nucleotides. FIG. 8 is a bar graph depicting NK-mediated cytotoxicity In yet other aspects the invention relates to a pharmaceu is enhanced by non-CpG ODN. NK-mediated lysis of K-562 tical composition of an immunostimulatory nucleic acid target cells was measured after over night incubation of comprising: 5'TCGTCGTT3' wherein at least one of the Cs 40 is unmethylated, wherein the immunostimulatory nucleic PBMC with 6 g/ml of the ODN 2006 (SEQID NO. 246), acid has less than 100 nucleotides and a phosphodiester 2194 (SEQ ID NO.: 911) and 5126 (SEQ ID NO. 1058). backbone, and a Sustained release device. In some embodi FIG. 9 is a bar graph depicting NKT cells can be activated ments the Sustained release device is a microparticle. In by non-CpG ODN. PBMC of one representative donor were other embodiments the composition includes an antigen. 45 incubated with 6 g/ml ODN 2006 (SEQID NO. 246), 2117 Each of the limitations of the invention can encompass (SEQ ID NO. 358), 2137 (SEQ ID NO.: 886), 2183 (SEQ various embodiments of the invention. It is, therefore, antici ID NO. 433), 2194 (SEQ ID NO.: 911) and 5126 (SEQ ID NO.: 1058) for 24 h and activation of NKT cells was pated that each of the limitations of the invention involving measured by flow cytometry after staining of cells with mAb any one element or combinations of elements can be for CD3 (T cell marker), CD56 (NK cell marker) and CD69 included in each aspect of the invention. 50 (early activation marker). BRIEF DESCRIPTION OF THE DRAWINGS FIG. 10 is a bar graph depicting stimulation of monocytes by different CpG and non-CpG ODN. PBMC were incu FIG. 1A is a histogram of the expression of CD86 (Y-axis) bated with 6 g/ml 2006 (SEQID NO.: 246), 2117 (SEQ ID by CD19+ cells following exposure of these cells to the 55 NO. 358), 2137 (SEQ ID NO.: 886), 2178 (SEQ ID NO.: oligonucleotides shown on the X-axis at a concentration of 428), 2183 (SEQ ID NO. 433), 2194 (SEQ ID NO.: 911), 0.15 lug/ml. 5126 (SEQ ID NO.: 1058) and 5163 (SEQ ID NO.: 1095) FIG. 1B is a table with the data from FIG. 1A. and stained for CD14 (monocyte marker) and CD80 (B7-1, FIG. 1C is a histogram of the expression of CD86 (Y-axis) activation marker). Expression was measured by flow by CD19+ cells following exposure of these cells to the 60 cytometry. oligonucleotides shown on the X-axis at a concentration of FIG. 11 is a bar graph depicting release of TNFC. upon 0.30 ug/ml. culture of human cells with non-CpG ODN. PBMC were FIG. 1D is a table with the data from FIG. 1C. cultured for 24 h with or without 6 g/ml of the indicated FIG. 2 is a graph comparing the abilities of ODN 2137, ODNs or 1 lug/ml LPS as positive control and TNFC. ODN 2177, ODN 2200 and ODN 2202 to stimulate B cell 65 measured by ELISA. proliferation at concentrations ranging from 0.2 ug/ml to 20 FIG. 12 is a bar graph depicting release of IL-6 after g/ml. culture with non-CpG ODNs shows the same pattern as for US 7,271,156 B2 17 18 TNFC. PBMC were cultured with the indicated ODNs (1.0 otide residues. A nucleic acid having a poly-T sequence ug/ml) and IL-6 was measured in the Supernatants by includes at least four Ts in a row, such as 5'TTTT3'. ELISA. Preferably the T-rich nucleic acid includes more than one poly T sequence. In preferred embodiments the T-rich DETAILED DESCRIPTION nucleic acid may have 2, 3, 4, etc poly T sequences. Such as oligonucleotide #2006 (SEQ ID NO:246). One of the most The invention in one aspect involves the finding that highly immunostimulatory T-rich oligonucleotides discov pyrimidine (Py) rich and preferably thymidine (T) rich ered according to the invention is a nucleic acid composed nucleic acids as well as nucleic acids that contain TG entirely of T nucleotide residues, e.g., oligonucleotide #2183 dinucleotide motifs are effective in mediating immune 10 (SEQ ID NO:433). Other T-rich nucleic acids according to stimulatory effects. It was known in the prior art that CpG the invention have a nucleotide composition of greater than containing nucleic acids are therapeutic and prophylactic 25% T nucleotide residues, but do not necessarily include a compositions that stimulate the immune system to treat poly T sequence. In these T-rich nucleic acids the T nucle cancer, infectious diseases, allergy, asthma and other disor otide resides may be separated from one another by other ders and to help protect against opportunistic infections 15 types of nucleotide residues, i.e., G, C, and A. In some following cancer chemotherapies. The strong yet balanced, embodiments the T-rich nucleic acids have a nucleotide cellular and humoral immune responses that result from composition of greater than 35%, 40%, 50%, 60%, 70%, CpG stimulation reflect the body's own natural defense 80%, 90%, and 99%, T nucleotide residues and every integer system against invading pathogens and cancerous cells. CpG % in between. Preferably the T-rich nucleic acids have at sequences, while relatively rare in human DNA are com least one poly T sequence and a nucleotide composition of monly found in the DNA of infectious organisms such as greater than 25% T nucleotide residues. bacteria. The human immune system has apparently evolved It was discovered according to the invention that the T to recognize CpG sequences as an early warning sign of content of an ODN has a dramatic effect on the immune infection, and to initiate an immediate and powerful immune stimulatory effect of the ODN and that T-rich ODN can response against invading pathogens without causing 25 activate multiple human immune cell types in the absence of adverse reactions frequently seen with other immune stimu any CpG motifs. An oligonucleotide having a 3' poly-T latory agents. Thus CpG containing nucleic acids, relying on region and 25'CGs e.g., ODN 2181 (SEQ ID NO:431) is this innate immune defense mechanism, can utilize a unique highly immune stimulatory. An oligonucleotide of similar and natural pathway for immune therapy. The effects of CpG length, ODN 2116 (SEQ ID NO:357) which contains two nucleic acids on immune modulation were discovered by the 30 CG dinucleotides at the 5' end and a poly-C region at the 3' inventor of the instant patent application and have been end was also immune stimulatory but to a lesser extent than described extensively in co-pending patent applications, the T-rich oligonucleotide using standard experimental con such as U.S. patent application Ser. No. 08/386,063, now ditions. Thus, although C and T have almost identical U.S. Pat. No. 6,194,388, filed on Feb. 7, 1995 (and related structures, their effects on the immune properties of an ODN PCT US95/01570); Ser. No. 08/738,652, now U.S. Pat. No. 35 are varied. They both are capable of inducing an immune 6,207,646, filed on Oct. 30, 1996; Ser. No. 08/960,774, now response but to different extents. Thus both T-rich and C-rich U.S. Pat. No. 6,429,199, filed on Oct. 30, 1997 (and related oligonucleotides are useful according to the invention, but PCT/US97/19791, WO 98/18810); Ser. No. 09/191,170 filed T-rich oligonucleotides are preferred. Furthermore, if the T on Nov. 13, 1998: Ser. No. 09/030,701, now U.S. Pat. No. content of the ODN is reduced by incorporating other bases 6.214,806, filed on Feb. 25, 1998 (and related PCT/US98/ 40 Such as G, A, or C, then the immune stimulatory effects are 03678; Ser. No. 09/082,649, now U.S. Pat. No. 6,339,068, reduced (ODN #2188 (SEQ ID NO:905), 2190 (SEQ ID filed on May 20, 1998 (and related PCT/US98/10408): Ser. NO:907), 2191 (SEQ ID NO:908), and 2193 (SEQ ID No. 09/325,193, now U.S. Pat. No. 6,405,705, filed on Jun. NO:910)). 3, 1999 (and related PCT/US98/04703); Ser. No. 09/286, A C-rich nucleic acid is a nucleic acid molecule having at 098, now U.S. Pat. No. 6,218,371, filed on Apr. 2, 1999 (and 45 least one or preferably at least two poly-C regions or which related PCT/US99/07335): Ser. No. 09/306.281 filed on is composed of at least 50% C nucleotides. A poly-C region May 6, 1999 (and related PCT/US99/09863). The entire is at least four C residues in a row. Thus a poly-C region is contents of each of these patents and patent applications is encompassed by the formula 5'CCCC 3'. In some embodi hereby incorporated by reference. ments it is preferred that the poly-C region have the formula The findings of the instant invention are applicable to all 50 5'CCCCCC 3'. Other C-rich nucleic acids according to the of the above described uses of CpG containing nucleic acids invention have a nucleotide composition of greater than 50% as well as any other known use for CpG nucleic acids. The C nucleotide residues, but do not necessarily include a poly invention involves, in one aspect, the discovery that Py-rich C sequence. In these C-rich nucleic acids the C nucleotide and preferably T-rich and TG nucleic acids have similar residues may be separated from one another by other types immune stimulatory properties to CpG oligonucleotides 55 of nucleotide residues, i.e., G, T, and A. In some embodi regardless of whether a CpG motif is present. Thus the ments the C-rich nucleic acids have a nucleotide composi invention is useful for any method for stimulating the tion of greater than 60%, 70%, 80%, 90%, and 99%, C immune system using Py-rich or TG nucleic acids. It was nucleotide residues and every integer % in between. Pref also discovered Surprisingly according to the invention that erably the C-rich nucleic acids have at least one poly C chimeric oligonucleotides which lack a CpG motif are 60 sequence and a nucleotide composition of greater than 50% immune stimulatory and have many of the same prophylac C nucleotide residues, and in some embodiments are also tic and therapeutic activities as a CpG oligonucleotide. T-rich. APy-rich nucleic acid is a T-rich or C-rich immunostimu As shown in the Examples, several ODN previously latory nucleic acid. In some embodiments T-rich nucleic believed to be non-immunostimulatory, including two acids are preferred. A T-rich nucleic acid is a nucleic acid 65 ODNs SEQID NO.: 225 and SEQ ID NO.: 282 previously which includes at least one poly T sequence and/or which described to be non-stimulatory and mainly used as control has a nucleotide composition of greater than 25% T. nucle ODNs (Takahashi, T., M. Nieda, Y. Koezuka, A. Nicol, S.A. US 7,271,156 B2 19 20 Porcelli, Y. Ishikawa, K. Tadokoro, H. Hirai, and T. Juji. of 9 to 19. In some embodiments, XX are GpA or GpT and 2000. Analysis of human VA24+CD4+NKT cells activated XX are TpT. In other embodiments X or X or both are by a-glycosylceramide-pulsed monocyte-derived dendritic purines and X or X or both are pyrimidines or XX are cells. J. Immunol. 164:4458) were found to be immuno Gp A and X or X or both are pyrimidines. In one preferred stimulatory. Our experiments, demonstrated that these embodiment, XX are nucleotides selected from the group ODNs can stimulate B cells, although at higher concentra consisting of TpT, TpC and Tp.A. tions compared to CpG ODNs (FIG. 6). A long Poly TODN The immunostimulatory nucleic acid may be any size (30mer) induced, at least in Some experiments, comparable (i.e., length) provided it is at least 4 nucleotides. In important strong activation of B cells to one of the strongest CpG ODN embodiments, the immunostimulatory nucleic acids have a activators of B cells. These experiments also revealed the 10 length in the range of between 6 and 100. In still other surprising finding that even Poly C ODNs can lead to embodiments, the length is in the range of between 8 and 35 stimulation of B cells. nucleotides. Preferably, the TG oligonucleotides range in Immunostimulation by these ODNs, however, was not size from 15 to 25 nucleotides. limited to human B cells. Different experimental assays The size (i.e., the number of nucleotide residues along the clearly demonstrated in addition that monocytes, NK cells 15 length of the nucleic acid) of the immunostimulatory nucleic and even NKT cells can be activated by such non-CpG acid may also contribute to the stimulatory activity of the ODNs (FIGS. 7-10). In contrast to Poly T and Poly C nucleic acid. It has been discovered, Surprisingly that even sequences, immunostimulation by Poly A sequences (at least for highly immune stimulating immunostimulatory nucleic for monocytes, B and NK cells) was not achieved. Interest acids, the length of the nucleic acid influences the extent of ingly it was found that the introduction of a CpG motif into immunostimulation that can be achieved. It has been dem SEQID NO.: 225 enhanced the immunostimulatory activity onstrated that increasing the length of a T-rich nucleic acid whereas the elongation with a Poly T stretch did not enhance up to 24 nucleotides causes increased immune stimulation. immunostimulation. This suggests that CpG and T-rich The experiments presented in the examples demonstrate that ODN may operate through different mechanisms or path when the length of the T-rich nucleic acid is increased from ways. It is also possible that insertion of a poly-T motif into 25 18 to 27 nucleotides the ability of the nucleic acid to a different position of SEQ ID NO.: 225 may result in a stimulate an immune response is increased significantly change in immunostimulatory properties. (compare ODN #2194, 2183,2195, and 2196 decreasing in A“TG nucleic acid' or a “TG immunostimulatory nucleic size from 27-18 nucleotides). Increasing the length of the acid as used herein is a nucleic acid containing at least one nucleic acid up to 30 nucleotides had a dramatic impact on TpG dinucleotide (thymidine-guanine dinucleotide 30 the biological properties of the nucleic acid but increasing sequence, i.e. “TG DNA” or DNA containing a 5' thymidine the length beyond 30 nucleotides did not appear to further followed by 3" guanosine and linked by a phosphate bond) influence the immune stimulatory effect (e.g., compare ODN and activates a component of the immune system. 2179 to 2006). In one embodiment the invention provides a TG nucleic It has been shown that TG nucleic acids ranging in length acid represented by at least the formula: 35 from 15 to 25 nucleotides in length may exhibit an increased immune stimulation. Thus, in one aspect, the invention provides an oligonucleotide that is 15-27 nucleotides in wherein X and X are nucleotides and N is any nucle length (i.e., an oligonucleotide that is 15, 16, 17, 18, 19, 20, otide and N and N are nucleic acid sequences composed of 21, 22, 23, 24, 25, 26 or 27 nucleotides in length) that may any number of N provided that the sum total of N and N, 40 be a T-rich nucleic acid or may be a TG nucleic acid, or may is in the range of 11 to 21. As an example, if N is 5, then be both a T-rich and a TG nucleic acid. In one embodiment, N may be 6 (leading to a total length for the oligonucleotide the oligonucleotide is not a T-rich nucleic acid nor is it a TG of 15 nucleotides). The TG may be located anywhere within nucleic acid. In other embodiments, the oligonucleotide does the oligonucleotide stretch, including the 5' end, the center not have a CG motif. The invention similarly provides and the 3' end. Thus, N may be zero through to 21, 45 oligonucleotides that are 15-27 nucleotides in length, oligo inclusive, provided that N is appropriately chosen to give a nucleotides that are 18-25 nucleotides in length, oligonucle sum of N and N equal to 11 through to 21, inclusive. otides that are 20-23 nucleotides in length, and oligonucle Similarly, N may be zero through to 21, inclusive, provided otides that are 23-25 nucleotides in length. Any of the that the sum total of N and N equals 11 to 21, inclusive. In foregoing embodiments relating to oligonucleotides 15-27 Some embodiments X is adenine, guanine, or thymidine and 50 in length also relate to the oligonucleotides of these differing X is cytosine, adenine, or thymidine. In one preferred lengths. The invention further embraces the use of any of embodiment, X is thymidine. In other embodiments X is these foregoing oligonucleotides in the methods recited cytosine and/or X is guanine. In other embodiments, as herein. discussed herein, the nucleic acid may encompass other Although a maximal level of immune stimulation is motifs, provided it is long enough to do so. 55 achieved with some T-rich nucleic acids when the nucleic In other embodiments the TG nucleic acid is represented acid is 24-30 nucleotide residues in length, as well as with by at least the formula: some TG nucleic acids that range from 15 to 25 nucleotides in length, shorter or longer immunostimulatory nucleic acids can also be used according to the methods of the invention. wherein X, X2, X, and X are nucleotides. In some 60 For facilitating uptake into cells immunostimulatory nucleic embodiments, XX are nucleotides selected from the group acids preferably have a minimum length of 6 nucleotide consisting of GpT, GpG, Gp A, ApA, ApT, ApG. CpT, Cp.A, residues. Nucleic acids of any size greater than 6 nucleotides Tp.A and TpT; and XX are nucleotides selected from the (even many kb long) are capable of inducing an immune group consisting of TpT, CpT, ApT, ApG, TpC, ApC, CpC, response according to the invention if Sufficient immuno Tp A, ApA, and CpA: N is any nucleotide and N and N are 65 stimulatory motifs are present, since larger nucleic acids are nucleic acid sequences composed of any number of nucle degraded inside of cells. Preferably the immunostimulatory otides provide that the sum total of N and N is in the range nucleic acids are in the range of between 8 and 100 and in US 7,271,156 B2 21 22 Some embodiments T-rich containing immunostimulatory was already highly T-rich the immune stimulating properties nucleic acids are between 24 and 40 nucleotides in length of the poly-T addition was diluted somewhat, although not and TG containing immunostimulatory nucleic acids are completely. This finding has important implications for the between 15 and 25 nucleotides in length. use of poly-A regions. Thus in Some embodiments the In one embodiment the T-rich nucleic acid is represented immunostimulatory nucleic acids include a poly-A region by at least the formula: and in other embodiments they do not. Some of the immunostimulatory nucleic acids of the invention include one or more CG motifs. The presence of wherein X, X2, X, and X are nucleotides. In one CG motifs in the immunostimulatory nucleic acids also has embodiment XX is TT and/or XX is TT. In another 10 an influence on the biological activity of the nucleic acids. embodiment XX are any one of the following nucleotides If the total length of an immunostimulatory nucleic acid is TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT, GG, GA, 20 nucleotide residues or less, then CpG motifs are impor and GC; and XX are any one of the following nucleotides tant in determining the immune effect of the nucleic acid, TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT, GG, GA, and methylation of these motifs reduces the potency of the and G.C. 15 immune stimulatory effects of the nucleic acid. If the length In some embodiments it is preferred that the immuno of the immunostimulatory nucleic acid is increased to 24, stimulatory nucleic acids do not contain poly-C (CCCC), or then the immune stimulatory effects of the nucleic acid poly-A (AAAA). In other embodiments it is preferred that become less dependent on the CpG motifs, and are no longer the immunostimulatory nucleic acid include poly-C, poly-A, abolished by methylation of the CpG motifs or by their poly-G (GGGG) or multiple GGs. In particular poly-G or inversion to GC dinucleotides, provided the other immune multiple GG motifs have dramatic effects on some immu stimulatory properties described herein are present. nostimulatory nucleic acids. The effect of these non-T For example, ODN 2006 (SEQ ID NO:246) is a highly sequences depends in part on the status of the nucleic acid immune stimulatory T-rich nucleic acid of 24 nucleotide backbone. For instance, if the nucleic acid has a phosphodi residues in length with four CpG dinucleotides. However, ester backbone or a chimeric backbone the inclusion of these 25 ODN 2117 (SEQID NO:358), in which the CpG motifs are sequences in the nucleic acid will only have minimal if any methylated is also highly immune stimulatory. ODN 2137 effect on the biological activity of the nucleic acid. If the (SEQ ID NO:886), in which the CpG motifs of ODN 2006 backbone is completely phosphorothioate (or other phos are inverted to GpC, and which as a result possesses six TG phate modification) or significantly phosphorothioate then dinucleotides is also immune stimulatory. The immune the inclusion of these sequences may have more influence on 30 stimulatory effects of nucleic acids such as ODN 2117 and the biological activity or the kinetics of the biological 2137 are regulated by their T and TG content. Each of these activity, causing a decrease in potency of the T-rich and TG three nucleic acids is T-rich and ODN 2137 is additionally immunostimulatory nucleic acids. TG rich. If their T content is reduced by inserting other bases Although C-rich nucleic acids have been demonstrated to such as A (ODN 2117 (SEQ ID NO:358)) or if their TG have immune stimulating properties, insertion of Poly-C 35 content is reduced by substituting TG with AG, then the sequences into a T-rich nucleic acid in a manner that would immune stimulatory effects are somewhat reduced. In reduce the relative proportion of T nucleotides in the nucleic another example, a nucleic acid 24 nucleotides in length in acid can have a negative impact on the nucleic acid. which all of the positions are randomized has only a modest Although applicants are not bound by a proposed mecha immune stimulatory effect (ODN 2182 (SEQ ID NO:432)). nism, it is believed that the immune system has developed 40 Likewise, a nucleic acid 24 nucleotides in length with other a mechanism for distinguishing nucleic acids having differ nucleotide compositions have variable immune stimulatory ent nucleotide properties, possibly resulting from different effects, depending on their T content (ODN 2188 (SEQ ID sets of binding proteins which recognize different sequences NO:905), 2189 (SEQ ID NO:906), 2190 (SEQID NO:907), or specific binding proteins which recognize all the immu 2191 (SEQ ID NO:908), 2193 (SEQ ID NO:910), 2183 nostimulatory sequences but with different affinities. In 45 (SEQID NO:433), and 2178 (SEQID NO:428)). ODN 2190 general nucleic acids including unmethylated CpG motifs which contains TGT motifs is more immune stimulatory are the most immunostimulatory, followed by T-rich nucleic than ODN 2202 which possesses TGG motifs. Thus, in some acids, TG nucleic acids and C-rich nucleic acids. This embodiments, TGT motifs are preferred. In still other generalization, however, has many exceptions. For instance embodiments, the number of TG motifs is important in that a strong T-rich nucleic acid like SEQ ID NO.: 886 is more 50 an increase in the number of TG motifs leads to an increase immune stimulatory in Some assays than Some CpG con in immune stimulation. Some preferred TG nucleic acids taining nucleic acids (e.g., a phosphorothioate CpG nucleic contain at least three TG motifs. acid containing a single CpG motif). Examples of CpG nucleic acids include but are not limited It has also been discovered that the addition of a poly-A to those listed in Table A, such as SEQID NO: 1, 3, 4, 14-16, tail to an immunostimulatory nucleic acid can enhance the 55 18-24, 28, 29, 33-46, 49, 50, 52-56, 58, 64-67, 69, 71, 72, activity of the nucleic acid. It was discovered that when a 76-87, 90,91, 93, 94, 96, 98, 102-124, 126-128, 131-133, highly immune stimulatory CpG nucleic acid (SEQID NO. 136-141, 146-150, 152-153, 155-171, 173-178, 180-186, 246) was modified with the addition of a poly-A tail 188-198, 201, 203-214, 216-220, 223, 224, 227-240, 242 (AAAAAA) or a poly-T tail (TTTTTT), the resultant oli 256, 258, 260-265, 270-273, 275, 277-281, 286-287, 292, gonucleotides increased in immune stimulatory activity. The 60 295-296, 300, 302, 305-307, 309-312, 314-317, 320-327, ability of the poly-A tail and the poly-T tail to increase the 329, 335, 337-341, 343-352, 354, 357, 361-365, 367-369, immunostimulating properties of the oligonucleotide was 373-376, 378-385, 388-392,394, 395, 399, 401–404, 406 very similar. SEQ ID NO. 246 is a T-rich oligonucleotide. 426, 429-433, 434-437, 439, 441-443, 445, 447, 448, 450, It is likely that if poly-A and poly-T tails are added to a 453-456, 460-464, 466-469, 472-475, 477, 478, 480, 483 nucleic acid which is not T-rich, it would have a bigger 65 485, 488, 489, 492, 493, 495-502, 504-505, 507-509, 511, impact on the immune stimulating capability of the nucleic 513-529, 532-541, 543-555, 564-566, 568-576, 578, 580, acid. Since the poly-T tail was added to a nucleic acid that 599, 601-605, 607-611, 613-615, 617, 619-622, 625-646, US 7,271,156 B2 23 24 648-650, 653-664, 666-697, 699-706, 708, 709, 711-716, Poly G nucleic acids preferably are nucleic acids having 718–732, 736, 737, 739-744, 746, 747, 749-761, 763, 766 the following formulas: 767, 769, 772-779, 781-783, 785-786, 7900792, 798-799, 804-808, 810, 815, 817, 818, 820-832, 835-846, 849-850, 855-859, 862, 865, 872, 874-877, 879-881, 883-885, 888 wherein X, X2, X, and X are nucleotides. In preferred 904, and 909-913. embodiments at least one of X and X are a G. In other In some embodiments of the invention the immunostimu embodiments both of X and X are a G. In yet other latory nucleic acids include CpG dinucleotides and in other embodiments the preferred formula is 5' GGGNGGG 3', or embodiments the immunostimulatory nucleic acids are free 5' GGGNGGGNGGG 3' wherein N represents between 0 of CpG dinucleotides. The CpG dinucleotides may be 10 and 20 nucleotides. In other embodiments the poly G nucleic methylated or unmethylated. A nucleic acid containing at acid is free of unmethylated CG dinucleotides, such as, for least one unmethylated CpG dinucleotide is a nucleic acid example, the nucleic acids listed below as SEQID NO: 5, 6, molecule which contains an unmethylated cytosine-guanine 73, 215, 267-269, 276, 282, 288, 297-299, 355, 359, 386, dinucleotide sequence (i.e. “CpG DNA or DNA containing 387, 444, 476,531, 557-559, 733, 768, 795, 796,914-925, an unmethylated 5' cytosine followed by 3" guanosine and 15 928-931, 933-936, and 938. In other embodiments the poly linked by a phosphate bond) and activates the immune G nucleic acid includes at least one unmethylated CG system. A nucleic acid containing at least one methylated dinucleotide, such as, for example, the nucleic acids listed CpG dinucleotide is a nucleic acid which contains a methy above as SEQID NO: 67, 80-82, 141, 147, 148, 173, 178, lated cytosine-guanine dinucleotide sequence (i.e., a methy 183, 185,214, 224, 264, 265, 315, 329, 434, 435, 475,519, lated 5' cytosine followed by a 3" guanosine and linked by a 521-524,526, 527, 535, 554, 565, 609, 628, 660, 661, 662, phosphate bond). 725, 767, 825,856, 857,876, 892, 909, 926,927, 932, and Examples of Trich nucleic acids that are free of CpG 937. nucleic acids include but are not limited to those listed in The terms “nucleic acid' and "oligonucleotide' are used Table A, such as SEQ ID NO: 59-63, 73-75, 142, 215, 226, interchangeably to mean multiple nucleotides (i.e. mol 241, 267-269,282,301, 304, 330, 342, 358, 370-372, 393, 25 ecules comprising a Sugar (e.g. ribose or deoxyribose) linked 433, 471, 479, 486, 491, 497, 503, 556-558, 567, 694, to a phosphate group and to an exchangeable organic base, 793-794, 797, 833, 852, 861, 867, 868, 882, 886, 905, 907, which is either a Substituted pyrimidine (e.g. cytosine (C), 908, and 910-913. Examples of T rich nucleic acids that thymidine (T) or uracil (U)) or a substituted purine (e.g. include CpG nucleic acids include but are not limited to adenine (A) or guanine (G)). As used herein, the terms refer those listed in Table A, such as SEQ ID NO: 64, 98, 112, 30 to oligoribonucleotides as well as oligodeoxyribonucle 146, 185, 204, 208, 214, 224, 233, 244, 246, 247, 258, 262, otides. The terms shall also include polynucleosides (i.e. a 263,265, 270-273, 300, 305,316, 317, 343, 344, 350, 352, polynucleotide minus the phosphate) and any other organic 354, 374, 376, 392, 407, 411-413, 429-432, 434, 435, 443, base containing polymer. Nucleic acid molecules can be 474, 475, 498-501, 518, 687, 692, 693, 804, 862, 883, 884, obtained from existing nucleic acid sources (e.g., genomic 888, 890, and 891. 35 or cDNA), but are preferably synthetic (e.g. produced by The immunostimulatory nucleic acids can be double nucleic acid synthesis). Stranded or single-stranded. Generally, double-stranded The terms nucleic acid and oligonucleotide also encom molecules are more stable in Vivo, while single-stranded pass nucleic acids or oligonucleotides with Substitutions or molecules have increased immune activity. Thus in some 40 modifications, such as in the bases and/or Sugars. For aspects of the invention it is preferred that the nucleic acid example, they include nucleic acids having backbone Sugars be single stranded and in other aspects it is preferred that the which are covalently attached to low molecular weight nucleic acid be double stranded. organic groups other than a hydroxyl group at the 3' position The term T-rich nucleic acid and TG nucleic acid, as used and other than a phosphate group at the 5' position. Thus herein, refers to an immunostimulatory T-rich nucleic acid 45 modified nucleic acids may include a 2'-O-alkylated ribose and an immunostimulatory TG nucleic acid, respectively, group. In addition, modified nucleic acids may include unless otherwise indicated. The T-rich nucleic acid Sugars such as arabinose instead of ribose. Thus the nucleic sequences of the invention are those broadly described acids may be heterogeneous in backbone composition above as well as the nucleic acids shown in Table A that have thereby containing any possible combination of polymer at least one poly T motif and/or have a composition of 50 units linked together Such as peptide-nucleic acids (which greater than 25% T or preferably 35% nucleotide residues. have amino acid backbone with nucleic acid bases). In some The C-rich nucleic acids are those having at least one and embodiments, the nucleic acids are homogeneous in back preferably at least two poly-C regions. The TG nucleic acids bone composition. Nucleic acids also include substituted of the invention are those broadly described above as well as purines and pyrimidines such as C-5 propyne modified bases the specific nucleic acids shown in Table A that have at least 55 (Wagner et al., Nature Biotechnology 14:840-844, 1996). one TG motif. Purines and pyrimidines include but are not limited to The nucleic acids of the invention may, but need not, also adenine, cytosine, guanine, thymidine, 5-methylcytosine, include a poly G motif. Poly G containing nucleic acids are 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopu also immunostimulatory. A variety of references, including rine, hypoxanthine, and other naturally and non-naturally Pisetsky and Reich, 1993 Mol. Biol. Reports, 18:217-221; 60 occurring nucleobases, Substituted and unsubstituted aro Krieger and Herz, 1994, Ann. Rev. Biochem., 63:601-637; matic moieties. Other such modifications are well known to Macaya et al., 1993, PNAS, 90:3745-3749; Wyatt et al., those of skill in the art. 1994, PNAS, 91:1356-1360; Rando and Hogan, 1998. In For use in the instant invention, the nucleic acids of the Applied Antisense Oligonucleotide Technology, ed. Krieg invention can be synthesized de novo using any of a number and Stein, p. 335-352; and Kimura et al., 1994, J. Biochem. 65 of procedures well known in the art. For example, the 116,991-994 also describe the immunostimulatory proper b-cyanoethyl phosphoramidite method (Beaucage, S. L., and ties of poly G nucleic acids. Caruthers, M. H., Tet. Let. 22:1859, 1981); nucleoside US 7,271,156 B2 25 26 H-phosphonate method (Garegg et al., Tet. Let. 27:4051 The compositions of the invention may optionally be 4054, 1986; Froehler et al., Nucl. Acid. Res. 14:5399-5407, chimeric oligonucleotides. The chimeric oligonucleotides 1986, ; Garegg et al., Tet. Let. 27:4055-4058, 1986, Gaffney are oligonucleotides having a formula: 5'YNZNY 3'.Y et al., Tet. Let. 29:2619-2622, 1988). These chemistries can and Y are nucleic acid molecules having between 1 and 10 be performed by a variety of automated nucleic acid syn nucleotides. Y and Y each include at least one modified thesizers available in the market. These nucleic acids are internucleotide linkage. Since at least 2 nucleotides of the referred to as synthetic nucleic acids. Alternatively, T-rich chimeric oligonucleotides include backbone modifications and/or TG dinucleotides can be produced on a large scale in these nucleic acids are an example of one type of “stabilized plasmids, (see Sambrook, T., et al., “Molecular Cloning: A immunostimulatory nucleic acids.” Laboratory Manual, Cold Spring Harbor laboratory Press, 10 With respect to the chimeric oligonucleotides, Y and Y New York, 1989) and separated into smaller pieces or are considered independent of one another. This means that administered whole. Nucleic acids can be prepared from each of Y and Y may or may not have different sequences existing nucleic acid sequences (e.g., genomic or cDNA) and different backbone linkages from one anther in the same using known techniques, such as those employing restriction molecule. The sequences vary, but in some cases Y and Y enzymes, exonucleases or endonucleases. Nucleic acids 15 have a poly-G sequence. A poly-G sequence refers to at least prepared in this manner are referred to as isolated nucleic 3 Gs in a row. In other embodiments the poly-G sequence acid. An isolated nucleic acid generally refers to a nucleic refers to at least 4, 5, 6, 7, or 8 Gs in a row. In other acid which is separated from components which it is nor embodiments Y and Y may be TCGTCG, TCGTCGT, or mally associated with in nature. As an example, an isolated TCGTCGTT (SEQID NO: 1145). Y and Y may also have nucleic acid may be one which is separated from a cell, from a poly-C, poly-T, or poly-A sequence. In some embodiments a nucleus, from mitochondria or from chromatin. The terms Y and/or Y, have between 3 and 8 nucleotides. Py-rich nucleic acids and TG nucleic acids encompasses N and N are nucleic acid molecules having between 0 both synthetic and isolated Py-rich nucleic acids and TG and 5 nucleotides as long as NZN has at least 6 nucleotides nucleic acids. in total. The nucleotides of NZN have a phosphodiester For use in vivo, the Py-rich and TG nucleic acids may 25 backbone and do not include nucleic acids having a modified optionally be relatively resistant to degradation (e.g., are backbone. stabilized). A “stabilized nucleic acid molecule' shall mean Z is an immunostimulatory nucleic acid motif but does a nucleic acid molecule that is relatively resistant to in vivo not include a CG. For instance, Z may be a nucleic acid a degradation (e.g. via an exo- or endo-nuclease). Stabiliza T-rich sequence, e.g. including a TTTT motif or a sequence tion can be a function of length or secondary structure. 30 wherein at least 50% of the bases of the sequence are Ts or Nucleic acids that are tens to hundreds of kbs long are Z may be a TG sequence. relatively resistant to in vivo degradation. For shorter The center nucleotides (NZN) of the formula nucleic acids, secondary structure can stabilize and increase YNZNY, have phosphodiester internucleotide linkages their effect. For example, if the 3' end of an nucleic acid has and Y and Y have at least one, but may have more than one self-complementarity to an upstream region, so that it can 35 or even may have all modified internucleotide linkages. In fold back and form a sort of stem loop structure, then the preferred embodiments Y and/or Y have at least two or nucleic acid becomes stabilized and therefore exhibits more between two and five modified internucleotide linkages or activity. Y has two modified internucleotide linkages and Y has five Alternatively, nucleic acid stabilization can be accom modified internucleotide linkages or Y has five modified plished via phosphate backbone modifications. Preferred 40 internucleotide linkages and Y has two modified internucle stabilized nucleic acids of the instant invention have a otide linkages. The modified internucleotide linkage, in modified backbone. It has been demonstrated that modifi Some embodiments is a phosphorothioate modified linkage, cation of the nucleic acid backbone provides enhanced. a phosphorodithioate modified linkage or a p-ethoxy modi activity of the Py-rich and TG nucleic acids when admin fied linkage. istered in vivo. These stabilized structures are preferred 45 Modified backbones such as phosphorothioates may be because the Py-rich and TG molecules of the invention have synthesized using automated techniques employing either at least a partial modified backbone. Py-rich and TG con phosphoramidate or H-phosphonate chemistries. Aryl-and structs having phosphorothioate linkages provide maximal alkyl-phosphonates can be made, e.g., as described in U.S. activity and protect the nucleic acid from degradation by Pat. No. 4,469,863; and alkylphosphotriesters (in which the intracellular exo- and endo-nucleases. Other modified 50 charged oxygen moiety is alkylated as described in U.S. Pat. nucleic acids include phosphodiester modified nucleic acids, No. 5,023.243 and European Patent No. 092.574) can be combinations of phosphodiester and phosphorothioate prepared by automated Solid phase synthesis using commer nucleic acid, methylphosphonate, methylphosphorothioate, cially available reagents. Methods for making other DNA phosphorodithioate, p-ethoxy, and combinations thereof. backbone modifications and substitutions have been Each of these combinations and their particular effects on 55 described (Uhlmann, E. and Peyman, A., Chem. Rev. 90:544, immune cells is discussed in more detail with respect to CpG 1990; Goodchild, J., Bioconjugate Chem. 1:165, 1990). nucleic acids in PCT Published Patent Applications PCT/ Other stabilized nucleic acids include: nonionic DNA US95/01570 (WO 96/02555) and PCT/US97/19791 (WO analogs, such as alkyl- and aryl-phosphates (in which the 98/18810) claiming priority to U.S. Ser. No. 08/386,063, charged phosphonate oxygen is replaced by an alkyl or aryl now U.S. Pat. No. 6,194,388, and Ser. No. 08/960,774, now 60 group), phosphodiester and alkylphosphotriesters, in which U.S. Pat. No. 6,239,116, filed on Feb. 7, 1995 and Oct. 30, the charged oxygen moiety is alkylated. Nucleic acids which 1997 respectively, the entire contents of which are hereby contain diol. Such as tetraethyleneglycol or hexaethyleneg incorporated by reference. It is believed that these modified lycol, at either or both termini have also been shown to be nucleic acids may show more stimulatory activity due to Substantially resistant to nuclease degradation. enhanced nuclease resistance, increased cellular uptake, 65 In the case when the Py-rich or TG nucleic acid is increased protein binding, and/or altered intracellular local administered in conjunction with an antigen which is ization. encoded in a nucleic acid vector, it is preferred that the US 7,271,156 B2 27 28 backbone of the Py-rich or TG nucleic acid be a chimeric phorothioate backbone but that the plasmid be associated combination of phosphodiester and phosphorothioate (or with a vehicle that delivers it directly into the cell, thus other phosphate modification). The cell may have a problem avoiding the need for cellular uptake. Such vehicles are taking up a plasmid vector in the presence of completely known in the art and include, for example, liposomes and phosphorothioate nucleic acid. Thus when both a vector and gene guns. a nucleic acid are delivered to a subject, it is preferred that The nucleic acids described herein as well as various the nucleic acid have a chimeric backbone or have a phos control nucleic acids are presented below in Table A.

TABLE A

SEQ ID NO : ODN SEQUENCE BACKBONE

1 to tcc cagogtgcgc.cat s ataatccagottgaaccalag ataatcgacgttcaa.gcaag taccgc.gtgcg accotct ggggagggit

ggggagggg ggtgaggtg to catgtzgttcctgatgct gctaccttagzgtga to catgazgttcc tatgct to catgacgttcztgatgct gctagazgittagtgt agctccatggtgctcactg cc acgtogaccct caggc ga gcacatcgtc.ccgcago.cga gtcactcgtggtacctoga gttggatacaggccagacitttgttg gattcaacttgcgct catcttaggc accatggacgaactottt coccitc

20 accatggacgagctdtttcc ccto

21 accatggacgacctgtttcc ccto

22 accatggacgtactgtttcc ccto

23 accatggacggtotgtttcc ccto

24 accatggacgttctgtttcc ccto

25 cc acticacatctgctgctccacaag

26 acttctoatagtc.cctttggtocag

27 to catgagctitcctgagtct

28 gaggaaggigiggaigacgt

29 gtgaatic gttcicggglict

30 aaaaaa.

31 cc cccd.

32 ctgtca

33 togtag

34 togtgg

US 7,271,156 B2 33 34

TABLE A-continued

SEQ ID NO : ODN SEQUENCE BACKBONE

12 totcccagogtg.cgccttitt SOS

13 gctandcghhagc

14 to ctgacgttccc

15 ggalagacgttaga

16 to citgacgittaga

17 to agaccago tiggtogggtottcct ga

18 to aggaac acco gaccagotggtotga

19 gctagt cqatago

20 gctagt cqctago

21 gcttgacgtotago

22 gcttgacgtttagc

23 gcttgacgtoaa.gc

24 gctagacgtttagc

25 to catgacattcctgatgct

26 gctagacgtotago

27 ggctatotic gttcc tag cc

28 ggctatotcgatcCtagcc

29 ct catgggtttct coaccalag

30 cittggtggaga aaccoatgag

31 to catgacgttcc tagttct

32 cc.gctitcc toccagatgagctdatg

33 catgagct catctggaggaag.cgg

34 ccagatgagct catgggtttctoc

35 ggagaaac coatgagct catctgg

36 agcatcaggaacgacatgga

37 to catgacgttcctgacgtt la

38 gC gC gC gC gcgc.gc.gc.gc.g

39

40 titccaatcagocccaccc.gctctgg.ccccacccto accotcca O

41 tggagggtgagggtggggccagagcgggtggggctgattggaa O

42 to aaatgtgggattittoccatgagtct

43 agacticatgggaaaatc.ccacatttga

44 tgccaagtgctgagt cactaataaaga

45 totttattagtgacticago acttggca

46 tgcaggaagtc.cgggttitt cocca accocco

47 ggggggttggggaaaa.cccgg actitcCtgca

48 gggg acttitcc.gctgggg acttitcCagggggacttitcc SOS

49 to catgacgttccitctocatgacgttccitctocatgacgttcc to O

US 7,271,156 B2 71 72

TABLE A-continued

SEQ ID NO : ODN SEQUENCE BACKBONE

843 cc acgtgg accitctago O

844 to agaccacgtggtogggtgttcc to a

845 to aggaac acco gaccacgtggtotga

846 catttccacgattitccca

847 titccitctotgcaagagact

848 tgitatctotctgaaggact

849 ataaag.cgaaactagoag cagtttic

85 O gaaactgctgctagtttc.gctittat

851 tgcc caaagaggaaaatttgtttcatacag

852 citgitatgaaacaa atttitcct citttgggca

853 ttagggittagggittagg gtt SS

854 to catgagctitcctgatgct SS

855 aaaacatgacgttcaaaaaa SS

856 aaaa.catgacgttcgggggg SS

857 gggg catgagctt.cgggggg SOS

858 citaggctgacgtcatcaagctagt

859 totgacgtcatctgacgttggctgacgtct

860 ggaattagtaatagatatagaagtt

861 tittaccttittataalacatalactaaaacaaa.

862 gc gtttittttittgcg

863 attatctaatcaaaac attaacaaa.

864 totatoccaggtggttcctgttag

865 bitccatgacgttcct gatgct

866 bitccatgagctitcct gatgct

867 titttitttitttitttf

868 titttitttitttitttf SO

869 ctagottgatgagcticago.cgctag

870 ttcagttgttcttgctgcttagctaa

871 to catgagctitcctgagtct

872 ctagoggctgacgtoatcaatctag

873 tgctagotgtgcc totacct

874 atgctaaaggacgtoac attgca

875 tgcaatgttgacgtcc tittagcat

876 gtaggggacttitc.cgagctic gagatccitatg

877 cataggatcto gagctoggaaagttcc cctac

878 citgtcaggaactgcaggta agg

879 cataacataggaatatttacticcitc.gc citccagotccaagaaaggacg

881 gaagtttctggtaagttctt.cg

US 7,271,156 B2 83 84

TABLE A-continued

SEQ ID NO : ODN SEQUENCE BACKBONE

O74 gggtcgtcgtcgtggggggg SOS

O75 ggggacgatcgtcggggggg SOS

O76 ggggacgt.cgt.cgtgggggg SOS

O77 ggggtogacgt.cgacgt.cgaggggggg SOS

O78 ggggalacc.gcggttggggggg SOS

O79 ggggacgacgt.cgtggggggg SOS

O8O togtogtogtogtogtggggggg SOS

O81 to ctg.ccggggaagt s

O82 to citgcaggggaagt O83 to Ctgaaggggaagt

O84 to citgg.cgggcaagt O85 to citgg.cgggtaagt

O86 to citgg.cgggaaagt O87 to cqgg.cggggaagt

O88 togggg.cggggaagt O89 to CC gg.cggggaagt

O90 gggggacgttggggg

O91 ggggttttittttittgggggg SOS

O92 gggg CCCCCCCCCC gggggg SOS

O93 ggggttgttgttgttgggggg SOS

O95 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa.

O96 cococccd.ccc.cccd.cccd.ccc.cccd.cccd.

O97 cgc.gc.gc.gc.gc.gc.gc.gc.gc.gc.gc.gc.gc.gc.g

While CpG effects in mice are well characterized, infor 17:6230, Yi A. K., and Krieg A. M. 1998. Rapid induction mation regarding the human system is limited. CpG phos 45 of mitogen-activated protein kinases by immune stimulatory phorothioate oligonucleotides with strong stimulatory activ CpG DNA. J Immunol. 161:4493). ity in the mouse system show lower activity on human and The preferred non-rodent motif is 5' TCGTCGTT3'. Base other non-rodent immune cells. In the examples the devel exchanges within the most potent 8mer CpG motif (5 opment of a potent human CpG motif and the characteriza TCGTCGTT 3') diminished the activity of the oligonucle tion of its effects and mechanisms of action on human 50 otide. The thymidines at the 5' and the 3' position of this primary B-cells is described. DNA containing this CpG motif were more important than the thymidine at the middle motif strongly stimulated primary human B-cells to prolif position. An adenine or guanosine at the middle position erate, to produce IL-6 and to express increased levels of produced a decrease in the activity. CD86, CD40, CD54 and MHC II. It increased DNA binding Of note, our studies demonstrate that one human CpG activity of the transcription factors NFKB and AP-1, as well 55 motif within a phosphodiester oligonucleotide (2080) is as phosphorylation of the stress activated protein kinases sufficient to produce the maximal effect, and that additional JNK and p38, and the transcription factor ATF-2. B-cell CpG motifs (2059) did not further enhance the activity. The signaling pathways activated by CpG DNA were different oligonucleotide with the 8mer motif 5' TCG TCG TT 3' from those activated by the B-cell receptor which activated (2080) containing two CpG dinucleotides showed the high ERK and a different isoform of JNK, but did not activate p38 60 est activity in the studies. Replacement of the bases flanking and ATF-2. In general the data on CpG DNA-initiated signal the two CpG dinucleotides (5' position, middle position, 3 transduction are consistent with those obtained in mice position) reduced the activity of this sequence. Both CpG (Hacker H., Mischak H., Miethke T., Liptay S., Schmid R. dinucleotides within the 8mer CpG motif were required for Sparwasser T., Heeg K. Lipford G. B., and Wagner H. 1998. the optimal activity (2108, 2106). Cytidine methylation of CpG-DNA-specific activation of antigen-presenting cells 65 the CpG dinucleotides (2095) abolished the activity of 2080, requires stress kinase activity and is preceded by non while methylation of an unrelated cytidine (2094) did not. specific endocytosis and endosomal maturation. Embo J The addition of two CpG motifs into the sequence of 2080 US 7,271,156 B2 85 86 resulting in 2059 did not further increase the activity of the passes the use of the immunostimulatory nucleic acids for phosphodiester oligonucleotide. The sequence of 2080 with the treatment of a Subject having an infection, an allergy, a phosphorothioate backbone (2116) demonstrated less asthma, or a cancer. activity, Suggesting that additional CpG motifs are preferred A Subject having an infection is a Subject that has been for a potent phosphorothioate oligonucleotide. 5 exposed to an infectious pathogen and has acute or chronic It has been discovered according to the invention that the detectable levels of the pathogen in the body. The immu immunostimulatory nucleic acids have dramatic immune nostimulatory nucleic acids can be used with an antigen to stimulatory effects on human cells such as NK cells, B cells, mount an antigen specific systemic or mucosal immune and DCs in vitro. It has been demonstrated that that the in response that is capable of reducing the level of or eradi vitro assays used herein predict in vivo effectiveness as a 10 cating the infectious pathogen. An infectious disease, as vaccine adjuvant in non-rodent vertebrates (Example 12), used herein, is a disease arising from the presence of a Suggesting that immunostimulatory nucleic acids are effec foreign microorganism in the body. It is particularly impor tive therapeutic agents for human vaccination, cancer immu tant to develop effective vaccine strategies and treatments to notherapy, asthma immunotherapy, general enhancement of protect the body's mucosal Surfaces, which are the primary immune function, enhancement of hematopoietic recovery 15 site of pathogenic entry. following radiation or chemotherapy, and other immune A subject having an allergy is a subject that has or is at modulatory applications. risk of developing an allergic reaction in response to an allergen. An allergy refers to acquired hypersensitivity to a Thus the immunostimulatory nucleic acids are useful in Substance (allergen). Allergic conditions include but are not Some aspects of the invention as a prophylactic vaccine for limited to eczema, allergic rhinitis or coryza, hay fever, the treatment of a subject at risk of developing an infection conjunctivitis, bronchial asthma, urticaria (hives) and food with an infectious organism or a cancer in which a specific allergies, and other atopic conditions. cancer antigen has been identified or an allergy or asthma Currently, allergic diseases are generally treated by the where the allergen or predisposition to asthma is known. The injection of Small doses of antigen followed by Subsequent immunostimulatory nucleic acids can also be given without 25 increasing dosage of antigen. It is believed that this proce the antigen or allergen for shorter term protection against dure induces tolerization to the allergen to prevent further infection, allergy or cancer, and in this case repeated doses allergic reactions. These methods, however, can take several will allow longer term protection. A subject at risk as used years to be effective and are associated with the risk of side herein is a Subject who has any risk of exposure to an effects such as anaphylactic shock. The methods of the infection causing pathogen or a cancer or an allergen or a 30 invention avoid these problems. risk of developing cancer. For instance, a subject at risk may Allergies are generally caused by IgE antibody generation be a subject who is planning to travel to an area where a against harmless allergens. The cytokines that are induced particular type of infectious agent is found or it may be a by Systemic or mucosal administration of immunostimula subject who through lifestyle or medical procedures is tory nucleic acids are predominantly of a class called Thl exposed to bodily fluids which may contain infectious 35 (examples are IL-12 and IFN-Y) and these induce both organisms or directly to the organism or even any subject humoral and cellular immune responses. The types of anti living in an area where an infectious organism or an allergen bodies associated with a Th1 response are generally more has been identified. Subjects at risk of developing infection protective because they have high neutralization and also include general populations to which a medical agency opSonization capabilities. The other major type of immune recommends vaccination with a particular infectious organ 40 response, which is associated with the production of IL-4, ism antigen. If the antigen is an allergen and the Subject IL-5 and IL-10 cytokines, is termed a Th2 immune response. develops allergic responses to that particular antigen and the Th2 responses involve predominately antibodies and these Subject may be exposed to the antigen, i.e., during pollen have less protective effect against infection and some Th2 season, then that Subject is at risk of exposure to the antigen. isotypes (e.g., IgE) are associated with allergy. In general, it A Subject at risk of developing an allergy to asthma includes 45 appears that allergic diseases are mediated by Th2 type those Subjects that have been identified as having an allergy immune responses while Th1 responses provide the best or asthma but that don’t have the active disease during the protection against infection, although excessive Th1 immunostimulatory nucleic acid treatment as well as Sub responses are associated with autoimmune disease. Based on jects that are considered to be at risk of developing these the ability of the immunostimulatory nucleic acids to shift diseases because of genetic or environmental factors. 50 the immune response in a Subject from a Th2 (which is A subject at risk of developing a cancer is one who is who associated with production of IgE antibodies and allergy) to has a high probability of developing cancer. These Subjects a Th1 response (which is protective against allergic reac include, for instance, Subjects having a genetic abnormality, tions), an effective dose for inducing an immune response of the presence of which has been demonstrated to have a a immunostimulatory nucleic acid can be administered to a correlative relation to a higher likelihood of developing a 55 Subject to treat or prevent an allergy. cancer and Subjects exposed to cancer causing agents such Thus, the immunostimulatory nucleic acids have signifi as tobacco, asbestos, or other chemical toxins, or a subject cant therapeutic utility in the treatment of allergic and who has previously been treated for cancer and is in apparent non-allergic conditions such as asthma. Th2 cytokines, espe remission. When a Subject at risk of developing a cancer is cially IL-4 and IL-5 are elevated in the airways of asthmatic treated with an antigen specific for the type of cancer to 60 Subjects. These cytokines promote important aspects of the which the Subject is at risk of developing and a immuno asthmatic inflammatory response, including IgE isotope stimulatory nucleic acid, the subject may be able to kill the Switching, eosinophil chemotaxis and activation and mast cancer cells as they develop. If a tumor begins to form in the cell growth. Th1 cytokines, especially IFN-Y and IL-12, can Subject, the Subject will develop a specific immune response suppress the formation of Th2 clones and production of Th2 against the tumor antigen. 65 cytokines. Asthma refers to a disorder of the respiratory In addition to the use of the immunostimulatory nucleic system characterized by inflammation, narrowing of the acids for prophylactic treatment, the invention also encom airways and increased reactivity of the airways to inhaled US 7,271,156 B2 87 88 agents. Asthma is frequently, although not exclusively asso carcinoma, preputial carcinoma, connective tissue neoplasia ciated with atopic or allergic symptoms. and mastocytoma (in horses); hepatocellular carcinoma (in A subject having a cancer is a Subject that has detectable Swine); lymphoma and pulmonary adenomatosis (in sheep); cancerous cells. The cancer may be a malignant or non pulmonary sarcoma, lymphoma, Rous sarcoma, reticulen malignant cancer. Cancers or tumors include but are not dotheliosis, fibrosarcoma, nephroblastoma, B-cell lym limited to biliary tract cancer, brain cancer, breast cancer, phoma and lymphoid leukosis (in avian species); retinoblas cervical cancer, choriocarcinoma; colon cancer, endometrial toma, hepatic neoplasia, lymphosarcoma (lymphoblastic cancer, esophageal cancer, gastric cancer, intraepithelial lymphoma), plasmacytoid leukemia and Swimbladder Sar neoplasms; lymphomas; liver cancer; lung cancer (e.g. Small coma (in fish), caseous lumphadenitis (CLA): chronic, infec cell and non-Small cell); melanoma; neuroblastomas; oral 10 tious, contagious disease of sheep and goats caused by the cancer, ovarian cancer, pancreas cancer, prostate cancer, bacterium Corynebacterium pseudotuberculosis, and conta rectal cancer, sarcomas; skin cancer; testicular cancer, thy gious lung tumor of sheep caused by jaagsiekte. roid cancer; and renal cancer, as well as other carcinomas The Subject is exposed to the antigen. As used herein, the and sarcomas. In one embodiment the cancer is hairy cell term exposed to refers to either the active step of contacting leukemia, chronic myelogenous leukemia, cutaneous T-cell 15 the Subject with an antigen or the passive exposure of the leukemia, multiple myeloma, follicular lymphoma, malig subject to the antigen in vivo. Methods for the active nant melanoma, squamous cell carcinoma, renal cell carci exposure of a subject to an antigen are well-known in the art. noma, prostate carcinoma, bladder cell carcinoma, or colon In general, an antigen is administered directly to the Subject carcinoma. by any means such as intravenous, intramuscular, oral, A Subject according to the invention is a non-rodent transdermal, mucosal, intranasal, intratracheal, or Subcuta Subject. A non-rodent Subject shall mean a human or verte neous administration. The antigen can be administered sys brate animal including but not limited to a dog, cat, horse, temically or locally. Methods for administering the antigen cow, pig, sheep, goat, chicken, primate, e.g., monkey, and and the immunostimulatory nucleic acid are described in fish (aquaculture species), e.g. salmon, but specifically more detail below. A subject is passively exposed to an excluding rodents such as rats and mice. 25 antigen if an antigen becomes available for exposure to the Thus, the invention can also be used to treat cancer and immune cells in the body. A subject may be passively tumors in non human Subjects. Cancer is one of the leading exposed to an antigen, for instance, by entry of a foreign causes of death in companion animals (i.e., cats and dogs). pathogen into the body or by the development of a tumor cell Cancer usually strikes older animals which, in the case of expressing a foreign antigen on its surface. house pets, have become integrated into the family. Forty 30 The methods in which a subject is passively exposed to an five '% of dogs older than 10 years of age, are likely to antigen can be particularly dependent on timing of admin succumb to the disease. The most common treatment options istration of the immunostimulatory nucleic acid. For include Surgery, chemotherapy and radiation therapy. Others instance, in a Subject at risk of developing a cancer or an treatment modalities which have been used with some infectious disease or an allergic or asthmatic response, the Success are laser therapy, cryotherapy, hyperthermia and 35 Subject may be administered the immunostimulatory nucleic immunotherapy. The choice of treatment depends on type of acid on a regular basis when that risk is greatest, i.e., during cancer and degree of dissemination. Unless the malignant allergy season or after exposure to a cancer causing agent. growth is confined to a discrete area in the body, it is difficult Additionally the immunostimulatory nucleic acid may be to remove only malignant tissue without also affecting administered to travelers before they travel to foreign lands normal cells. 40 where they are at risk of exposure to infectious agents. Malignant disorders commonly diagnosed in dogs and Likewise the immunostimulatory nucleic acid may be cats include but are not limited to lymphosarcoma, osteosa administered to Soldiers or civilians at risk of exposure to rcoma, mammary tumors, mastocytoma, brain tumor, mela biowarfare to induce a systemic or mucosal immune noma, adenosquamous carcinoma, carcinoid lung tumor, response to the antigen when and if the Subject is exposed to bronchial gland tumor, bronchiolar adenocarcinoma, 45 it. fibroma, myxochondroma, pulmonary sarcoma, neurosar An antigen as used herein is a molecule capable of coma, osteoma, papilloma, retinoblastoma, Ewings sar provoking an immune response. Antigens include but are not coma, Wilm's tumor, Burkitt's lymphoma, microglioma, limited to cells, cell extracts, proteins, polypeptides, pep neuroblastoma, osteoclastoma, oral neoplasia, fibrosarcoma, tides, polysaccharides, polysaccharide conjugates, peptide osteosarcoma and rhabdomyosarcoma. Other neoplasias in 50 and non-peptide mimics of polysaccharides and other mol dogs include genital squamous cell carcinoma, transmiss ecules, Small molecules, lipids, glycolipids, carbohydrates, able veneral tumor, testicular tumor, seminoma, Sertoli cell viruses and viral extracts and muticellular organisms such as tumor, hemangiopericytoma, histiocytoma, chloroma parasites and allergens. The term antigen broadly includes (granulocytic sarcoma), corneal papilloma, corneal squa any type of molecule which is recognized by a host immune mous cell carcinoma, hemangiosarcoma, pleural mesothe 55 system as being foreign. Antigens include but are not limited lioma, basal cell tumor, thymoma, stomach tumor, adrenal to cancer antigens, microbial antigens, and allergens. gland carcinoma, oral papillomatosis, hemangioendothe A cancer antigen as used herein is a compound. Such as a lioma and cystadenoma. Additional malignancies diagnosed peptide or protein, associated with a tumor or cancer cell in cats include follicular lymphoma, intestinal lymphosar Surface and which is capable of provoking an immune coma, fibrosarcoma and pulmonary Squamous cell carci 60 response when expressed on the Surface of an antigen noma. The ferret, an ever-more popular house pet is known presenting cell in the context of an MHC molecule. Cancer to develop insulinoma, lymphoma, sarcoma, neuroma, pan antigens can be prepared from cancer cells either by pre creatic islet cell tumor, gastric MALT lymphoma and gastric paring crude extracts of cancer cells, for example, as adenocarcinoma. described in Cohen, et al., 1994, Cancer Research, 54:1055, Neoplasias affecting agricultural livestock include leuke 65 by partially purifying the antigens, by recombinant technol mia, hemangiopericytoma and bovine ocular neoplasia (in ogy, or by de novo synthesis of known antigens. Cancer cattle); preputial fibrosarcoma, ulcerative squamous cell antigens include but are not limited to antigens that are US 7,271,156 B2 89 90 recombinantly expressed, an immunogenic portion of, or a fringers, Clostridium tetani, Enterobacter aerogenes, Kleb whole tumor or cancer. Such antigens can be isolated or siella pneumoniae, Pasturella multocida, Bacteroides sp., prepared recombinantly or by any other means known in the Fusobacterium nucleatum, Streptobacillus moniliformis, art. Treponema pallidium, Treponema pertenue, Leptospira, A microbial antigen as used herein is an antigen of a Rickettsia, and Actinomyces israelli. microorganism and includes but is not limited to virus, Examples of fungi include Cryptococcus neoformans, bacteria, parasites, and fungi. Such antigens include the Histoplasma capsulatum, Coccidioides immitis, Blastomy intact microorganism as well as natural isolates and frag ces dermatitidis, Chlamydia trachomatis, Candida albicans. ments or derivatives thereof and also synthetic compounds Other infectious organisms (i.e., protists) include Plasmo which are identical to or similar to natural microorganism 10 dium spp. Such as Plasmodium falciparum, Plasmodium antigens and induce an immune response specific for that malariae, Plasmodium ova/e, and Plasmodium vivax and microorganism. A compound is similar to a natural micro Toxoplasma gondii. Blood-borne and/or tissues parasites organism antigen if it induces an immune response (humoral include Plasmodium spp., Babesia microti, Babesia diver and/or cellular) to a natural microorganism antigen. Such gens, Leishmania tropica, Leishmania spp., Leishmania antigens are used routinely in the art and are well known to 15 braziliensis, Leishmania donovani, Trypanosoma gambi those of ordinary skill in the art. ense and Trypanosoma rhodesiense (African sleeping sick Examples of viruses that have been found in humans ness), Trypanosoma Cruzi (Chagas disease), and Toxo include but are not limited to: Retroviridae (e.g. human plasma gondii. immunodeficiency viruses, such as HIV-1 (also referred to Other medically relevant microorganisms have been as HTLV-III, LAV or HTLV-III/LAV, or HIV-III; and other described extensively in the literature, e.g., see C. G. A isolates, such as HIV-LP: Picornaviridae (e.g. polio viruses, Thomas, Medical Microbiology, Bailliere Tindall, Great hepatitis A virus; enteroviruses, human Coxsackie viruses, Britain 1983, the entire contents of which is hereby incor rhinoviruses, echoviruses); Calciviridae (e.g. Strains that porated by reference. cause gastroenteritis); Togaviridae (e.g. equine encephalitis Although many of the microbial antigens described above viruses, rubella viruses); Flaviridae (e.g. dengue viruses, 25 relate to human disorders, the invention is also useful for encephalitis viruses, yellow fever viruses); Coronoviridae treating other nonhuman vertebrates. Nonhuman vertebrates (e.g. coronaviruses); Rhabdoviradae (e.g. vesicular stoma are also capable of developing infections which can be titis viruses, rabies viruses); Coronaviridae (e.g. coronavi prevented or treated with the Immunostimulatory nucleic ruses); Rhabdoviridae (e.g. vesicular stomatitis viruses, acids disclosed herein. For instance, in addition to the rabies viruses); Filoviridae (e.g. ebola viruses); Paramyx 30 treatment of infectious human diseases, the methods of the oviridae (e.g. parainfluenza viruses, mumps virus, measles invention are useful for treating infections of animals. virus, respiratory syncytial virus); Orthomyxoviridae (e.g. As used herein, the term treat, treated, or treating when influenza viruses); Bungaviridae (e.g. Hantaan viruses, used with respect to an infectious disease refers to a pro bunga viruses, phleboviruses and Nairo viruses); Arena phylactic treatment which increases the resistance of a viridae (hemorrhagic fever viruses); Reoviridae (e.g. reovi 35 subject (a subject at risk of infection) to infection with a ruses, orbiviurses and rotaviruses); Birnaviridae; Hepad pathogen or, in other words, decreases the likelihood that the naviridae (Hepatitis B virus); Parvovirida (parvoviruses): subject will become infected with the pathogen as well as a Papovaviridae (papilloma viruses, polyoma viruses); Aden treatment after the subject (a subject who has been infected) oviridae (most adenoviruses); Herpesviridae (herpes sim has become infected in order to fight the infection, e.g., plex virus (HSV) 1 and 2, varicella Zoster virus, cytomega 40 reduce or eliminate the infection or prevent it from becom lovirus (CMV), herpes virus; Poxyiridae (variola viruses, ing worse. vaccinia viruses, pox viruses); and Iridoviridae (e.g. African Many vaccines for the treatment of non-human verte Swine fever virus); and unclassified viruses (e.g. the etio brates are disclosed in Bennett, K. Compendium of Veteri logical agents of Spongiform encephalopathies, the agent of nary Products, 3rd ed. North American Compendiums, Inc., delta hepatitis (thought to be a defective satellite of hepatitis 45 1995. As discussed above, antigens include infectious B virus), the agents of non-A, non-B hepatitis (class 1 inter microbes such as virus, parasite, bacteria and fungi and nally transmitted; class 2 parenterally transmitted (i.e. fragments thereof, derived from natural Sources or syntheti Hepatitis C); Norwalk and related viruses, and astroviruses). cally. Infectious viruses of both human and non-human Both gram negative and gram positive bacteria serve as vertebrates, include retroviruses, RNA viruses and DNA antigens in vertebrate animals. Such gram positive bacteria 50 viruses. This group of retroviruses includes both simple include, but are not limited to, Pasteurella species, Staphy retroviruses and complex retroviruses. The simple retrovi lococci species, and Streptococcus species. Gram negative ruses include the Subgroups of B-type retroviruses, C-type bacteria include, but are not limited to, Escherichia coli, retroviruses and D-type retroviruses. An example of a Pseudomonas species, and Salmonella species. Specific B-type retrovirus is mouse mammary tumor virus (MMTV). examples of infectious bacteria include but are not limited 55 The C-type retroviruses include Subgroups C-type group A to, Helicobacter pyloris, Borelia burgdorferi, Legionella (including Rous sarcoma virus (RSV), avian leukemia virus pneumophilia, Mycobacteria sps (e.g. M. tuberculosis, M. (ALV), and avian myeloblastosis virus (AMV)) and C-type avium, M. intracellulare, M. kansai, M. gordonae), Staphy group B (including feline leukemia virus (FeLV), gibbon ape lococcus aureus, Neisseria gonorrhoeae, Neisseria menin leukemia virus (GALV), spleen necrosis virus (SNV), gitidis, Listeria monocytogenes, Streptococcus pyogenes 60 reticuloendotheliosis virus (RV) and simian sarcoma virus (Group A Streptococcus), Streptococcus agalactiae (Group (SSV)). The D-type retroviruses include Mason-Pfizer mon B Streptococcus), Streptococcus (viridans group), Strepto key virus (MPMV) and simian retrovirus type 1 (SRV-1). coccus faecalis, Streptococcus bovis, Streptococcus (anaero The complex retroviruses include the subgroups of lentivi bic sps.). Streptococcus pneumoniae, pathogenic Campylo ruses, T-cell leukemia viruses and the foamy viruses. Len bacter sp., Enterococcus sp., Haemophilus influenzae, 65 tiviruses include HIV-1, but also include HIV-2, SIV, Visna Bacillus antracis, corynebacterium diphtheriae, corynebac virus, feline immunodeficiency virus (FIV), and equine terium sp., Erysipelothrix rhusiopathiae, Clostridium per infectious anemia virus (EIAV). The T-cell leukemia viruses US 7,271,156 B2 91 92 include HTLV-1, HTLV-II, simian T-cell leukemia virus dae, including the genus Orthopoxyirus (Variola major, (STLV), and bovine leukemia virus (BLV). The foamy Variolaminor, Monkey pox Vaccinia, Cowpox, Buffalopox, viruses include human foamy virus (HFV), simian foamy Rabbitpox, Ectromelia), the genus Leporipoxyirus virus (SFV) and bovine foamy virus (BFV). (Myxoma, Fibroma), the genus Avipoxyirus (Fowlpox, other Examples of other RNA viruses that are antigens in avian poxyirus), the genus Capripoxyirus (sheeppox, goat vertebrate animals include, but are not limited to, members poX), the genus Suipoxyirus (Swinepox), the genus ParapoX of the family Reoviridae, including the genus Orthoreovirus yirus (contagious postular dermatitis virus, pseudocowpox, (multiple serotypes of both mammalian and avian retrovi bovine papular stomatitis virus); the family Iridoviridae ruses), the genus Orbivirus (Bluetongue virus, Eugenangee (African swine fever virus, Frog viruses 2 and 3, Lympho virus, Kemerovo virus, African horse sickness virus, and 10 cystis virus of fish); the family Herpesviridae, including the Colorado Tick Fever virus), the genus Rotavirus (human alpha-Herpesviruses (Herpes Simplex Types 1 and 2, Vari rotavirus, Nebraska calf diarrhea virus, simian rotavirus, cella-Zoster, Equine abortion virus, Equine herpes virus 2 bovine or ovine rotavirus, avian rotavirus); the family Picor and 3. pseudorabies virus, infectious bovine keratoconjunc naviridae, including the genus Enterovirus (poliovirus, Cox tivitis virus, infectious bovine rhinotracheitis virus, feline sackie Virus A and B, enteric cytopathic human orphan 15 rhinotracheitis virus, infectious laryngotracheitis virus) the (ECHO) viruses, hepatitis A virus, Simian enteroviruses, Beta-herpesviruses (Human cytomegalovirus and cytome Murine encephalomyelitis (ME) viruses, Poliovirus muris, galoviruses of Swine and monkeys); the gamma-herpesvi Bovine enteroviruses, Porcine enteroviruses, the genus Car ruses (Epstein-Barr virus (EBV), Marek’s disease virus, diovirus (Encephalomyocarditis virus (EMC), Mengovirus), Herpes saimiri, Herpesvirus ateles, Herpesvirus Sylvilagus, the genus Rhinovirus (Human rhinoviruses including at least guinea pig herpes virus, Lucke tumor virus); the family 113 subtypes; other rhinoviruses), the genus Apthovirus Adenoviridae, including the genus Mastadenovirus (Human (Foot and Mouth disease (FMDV); the family Calciviridae, Subgroups A,B,C,D,E and ungrouped; simian adenoviruses including Vesicular exanthema of Swine virus, San Miguel (at least 23 Serotypes), infectious canine hepatitis, and sea lion virus, Feline picornavirus and Norwalk virus; the adenoviruses of cattle, pigs, sheep, frogs and many other family Togaviridae, including the genus Alphavirus (Eastern 25 species, the genus Aviadenovirus (Avian adenoviruses); and equine encephalitis virus, Semliki forest virus, Sindbis virus, non-cultivatable adenoviruses; the family Papoviridae, Chikungunya virus, O'Nyong-Nyong virus, Ross river virus, including the genus Papillomavirus (Human papilloma Venezuelan equine encephalitis virus, Western equine viruses, bovine papilloma viruses, Shope rabbit papilloma encephalitis virus), the genus Flavirius (Mosquito borne virus, and various pathogenic papilloma viruses of other yellow fever virus, Dengue virus, Japanese encephalitis 30 species), the genus Polyomavirus (polyomavirus, Simian virus, St. Louis encephalitis virus, Murray Valley encepha vacuolating agent (SV-40), Rabbit vacuolating agent (RKV), litis virus, West Nile virus, Kunjin virus, Central European K virus, BK virus, JC virus, and other primate polyoma tick borne virus, Far Eastern tick borne virus, Kyasanur viruses such as Lymphotrophic papilloma virus); the family forest virus, Louping III virus, Powassan virus, Omsk hem Parvoviridae including the genus Adeno-associated viruses, orrhagic fever virus), the genus Rubivirus (Rubella virus), 35 the genus Parvovirus (Feline panleukopenia virus, bovine the genus Pestivirus (Mucosal disease virus, Hog cholera parvovirus, canine parvovirus, Aleutian mink disease virus, virus, Border disease virus); the family Bunyaviridae, etc). Finally, DNA viruses may include viruses which do not including the genus Buny virus (Bunyamwera and related fit into the above families such as Kuru and Creutzfeldt viruses, California encephalitis group viruses), the genus Jacob disease viruses and chronic infectious neuropathic Phlebovirus (Sandfly fever Sicilian virus, Rift Valley fever 40 agents (CHINA virus). virus), the genus Nairovirus (Crimean-Congo hemorrhagic Each of the foregoing lists is illustrative, and is not fever virus, Nairobi sheep disease virus), and the genus intended to be limiting. Uukuvirus (Uukuniemi and related viruses); the family Orthomyxoviridae, including the genus Influenza virus (In In addition to the use of the immunostimulatory nucleic fluenza virus type A, many human Subtypes); Swine influ 45 acids to induce an antigen specific immune response in enza virus, and Avian and Equine Influenza viruses; influ humans, the methods of the preferred embodiments are enza type B (many human Subtypes), and influenza type C particularly well suited for treatment of birds such as hens, (possible separate genus); the family paramyxoviridae, chickens, turkeys, ducks, geese, quail, and pheasant. Birds including the genus Paramyxovirus (Parainfluenza virus are prime targets for many types of infections. type 1, Sendai virus, Hemadsorption virus, Parainfluenza 50 Hatching birds are exposed to pathogenic microorganisms viruses types 2 to 5, Newcastle Disease Virus, Mumps shortly after birth. Although these birds are initially pro virus), the genus Morbillivirus (Measles virus, subacute tected against pathogens by maternal derived antibodies, this Sclerosing panencephalitis virus, distemper virus, Rinderp protection is only temporary, and the bird's own immature est virus), the genus Pneumovirus (respiratory syncytial immune system must begin to protect the bird against the virus (RSV), Bovine respiratory syncytial virus and Pneu 55 pathogens. It is often desirable to prevent infection in young monia virus); the family Rhabdoviridae, including the genus birds when they are most susceptible. It is also desirable to Vesiculovirus (VSV), Chandipura virus, Flanders-Hart Park prevent against infection in older birds, especially when the virus), the genus Lyssavirus (Rabies virus), fish Rhabdovi birds are housed in closed quarters, leading to the rapid ruses, and two probable Rhabdoviruses (Marburg virus and spread of disease. Thus, it is desirable to administer the Ebola virus); the family Arenaviridae, including Lympho 60 Immunostimulatory nucleic acid and the non-nucleic acid cytic choriomeningitis virus (LCM), Tacaribe virus com adjuvant of the invention to birds to enhance an antigen plex, and Lassa virus; the family Coronoaviridae, including specific immune response when antigen is present. Infectious Bronchitis Virus (IBV), Hepatitis virus, Human An example of a common infection in chickens is chicken enteric corona virus, and Feline infectious peritonitis (Feline infectious anemia virus (CIAV). CIAV was first isolated in coronavirus). 65 Japan in 1979 during an investigation of a Marek’s disease Illustrative DNA viruses that are antigens in vertebrate vaccination break (Yuasa et al., 1979, Avian Dis. 23:366 animals include, but are not limited to, the family Poxyiri 385). Since that time, CIAV has been detected in commercial US 7,271,156 B2 93 94 poultry in all major poultry producing countries (van Bulow an NCP strain, the cow can give birth to a persistently et al., 1991, pp.690-699) in Diseases of Poultry, 9th edition, infected and specifically immunotolerant calf that will Iowa State University Press). spread virus during its lifetime. The persistently infected CIAV infection results in a clinical disease, characterized cattle can Succumb to mucosal disease and both biotypes can by anemia, hemorrhage and immunosuppression, in young then be isolated from the animal. Clinical manifestations can susceptible chickens. Atrophy of the thymus and of the bone include abortion, teratogenesis, and respiratory problems, marrow and consistent lesions of CIAV-infected chickens mucosal disease and mild diarrhea. In addition, severe are also characteristic of CIAV infection. Lymphocyte deple thrombocytopenia, associated with herd epidemics, that may tion in the thymus, and occasionally in the bursa of Fabri result in the death of the animal has been described and cius, results in immunosuppression and increased suscepti 10 strains associated with this disease seem more virulent than bility to secondary viral, bacterial, or fungal infections the classical BVDVs. which then complicate the course of the disease. The immu Equine herpes viruses (EHV) comprise a group of anti nosuppression may cause aggravated disease after infection genically distinct biological agents which cause a variety of with one or more of Marek’s disease virus (MDV), infec infections in horses ranging from Subclinical to fatal disease. tious bursal disease virus, reticuloendotheliosis virus, aden 15 These include Equine herpesvirus-1 (EHV-1), a ubiquitous ovirus, or reovirus. It has been reported that pathogenesis of pathogen in horses. EHV-1 is associated with epidemics of MDV is enhanced by CIAV (DeBoer et al., 1989, p. 28 In abortion, respiratory tract disease, and central nervous sys Proceedings of the 38th Western Poultry Diseases Confer tem disorders. Primary infection of upper respiratory tract of ence, Tempe, Ariz.). Further, it has been reported that CIAV young horses results in a febrile illness which lasts for 8 to aggravates the signs of infectious bursal disease (Rosen 10 days. Immunologically experienced mares may be re berger et al., 1989, Avian Dis. 33:707-713). Chickens infected via the respiratory tract without disease becoming develop an age resistance to experimentally induced disease apparent, so that abortion usually occurs without warning. due to CAA. This is essentially complete by the age of 2 The neurological syndrome is associated with respiratory weeks, but older birds are still susceptible to infection disease or abortion and can affect animals of either sex at (Yuasa, N. et al., 1979 supra; Yuasa, N. et al., Arian Diseases 25 any age, leading to lack of co-ordination, weakness and 24, 202-209, 1980). However, if chickens are dually infected posterior paralysis (Telford, E. A. R. et al., Virology 189, with CAA and an immunosuppressive agent (IBDV. MDV 304-316, 1992). Other EHV's include EHV-2, or equine etc.), age resistance against the disease is delayed (Yuasa, N. cytomegalovirus, EHV-3, equine coital exanthema virus, et al., 1979 and 1980 supra; Bulow von V. et al., J. Veterinary and EHV-4, previously classified as EHV-1 subtype 2. Medicine 33, 93-116, 1986). Characteristics of CIAV that 30 Sheep and goats can be infected by a variety of dangerous may potentiate disease transmission include high resistance microorganisms including visna-maedi. to environmental inactivation and some common disinfec Primates such as monkeys, apes and macaques can be tants. The economic impact of CIAV infection on the poultry infected by simian immunodeficiency virus. Inactivated industry is clear from the fact that 10% to 30% of infected cell-virus and cell-free whole simian immunodeficiency birds in disease outbreaks die. 35 vaccines have been reported to afford protection in Vaccination of birds, like other vertebrate animals can be macaques (Stott et al. (1990) Lancet 36:1538-1541; Desro performed at any age. Normally, vaccinations are performed siers et al. PNAS USA (1989) 86:6353-6357; Murphey-Corb at up to 12 weeks of age for a live microorganism and et al. (1989) Science 246:1293-1297; and Carlson et al. between 14-18 weeks for an inactivated microorganism or (1990) AIDS Res. Human Retroviruses 6:1239-1246). A other type of vaccine. For in ovo vaccination, vaccination 40 recombinant HIV gp120 vaccine has been reported to afford can be performed in the last quarter of embryo development. protection in chimpanzees (Berman et al. (1990) Nature The vaccine may be administered Subcutaneously, by spray, 345:622-625). orally, intraocularly, intratracheally, nasally, or by other Cats, both domestic and wild, are susceptible to infection mucosal delivery methods described herein. Thus, the with a variety of microorganisms. For instance, feline infec immunostimulatory nucleic acids of the invention can be 45 tious peritonitis is a disease which occurs in both domestic administered to birds and other non-human vertebrates using and wildcats, such as lions, leopards, cheetahs, and jaguars. routine vaccination schedules and the antigen can be admin When it is desirable to prevent infection with this and other istered after an appropriate time period as described herein. types of pathogenic organisms in cats, the methods of the Cattle and livestock are also susceptible to infection. invention can be used to vaccinate cats to protect them Diseases which affect these animals can produce severe 50 against infection. economic losses, especially amongst cattle. The methods of Domestic cats may become infected with several retrovi the invention can be used to protect against infection in ruses, including but not limited to feline leukemia virus livestock, such as cows, horses, pigs, sheep, and goats. (FeLV), feline sarcoma virus (FeSV), endogenous type Cows can be infected by bovine viruses. Bovine viral Concornavirus (RD-114), and feline syncytia-forming virus diarrhea virus (BVDV) is a small enveloped positive 55 (FeSFV). Of these, FeIV is the most significant pathogen, stranded RNA virus and is classified, along with hog cholera causing diverse symptoms, including lymphoreticular and virus (HOCV) and sheep border disease virus (BDV), in the myeloid neoplasms, anemias, immune mediated disorders, pestivirus genus. Although, Pestiviruses were previously and an immunodeficiency syndrome which is similar to classified in the Togaviridae family, some studies have human acquired immune deficiency syndrome (AIDS). suggested their reclassification within the Flaviviridae fam 60 Recently, a particular replication-defective FeIV mutant, ily along with the flavivirus and hepatitis C virus (HCV) designated FeIV-AIDS, has been more particularly associ groups (Francki, et al., 1991). ated with immunosuppressive properties. BVDV, which is an important pathogen of cattle can be The discovery of feline T-lymphotropic lentivirus (also distinguished, based on cell culture analysis, into cytopatho referred to as feline immunodeficiency) was first reported in genic (CP) and noncytopathogenic (NCP) biotypes. The 65 Pedersen et al. (1987) Science 235:790-793. Characteristics NCP biotype is more widespread although both biotypes can of FIV have been reported in Yamamoto et al. (1988) be found in cattle. If a pregnant cow becomes infected with Leukemia, December Supplement 2:204S-215S: Yamamoto US 7,271,156 B2 95 96 et al. (1988) Am. J. Vet. Res. 49:1246-1258; and Ackley et (RBC), Trypanosoma spp. (plasma). Theileria spp. (RBC); al. (1990) J. Virol. 64:5652-5655. Cloning and sequence Theileria parva (lymphocytes); Tritrichomonas foetus; and analysis of FIV have been reported in Olmsted et al. (1989) Sarcocystis spp. Proc. Natl. Acad. Sci. USA 86:2448-2452 and 86:4355 The major parasites of raptors include Trichomonas galli 4360. nae; Coccidia (Eimeria spp.); Plasmodium relictum, Leuco Feline infectious peritonitis (FIP) is a sporadic disease cytozoon danilewskyi (owls), Haemoproteus spp., Trypano occurring unpredictably in domestic and wild Felidae. While Soma spp.; Histomonas; Cryptosporidium meleagridis, FIP is primarily a disease of domestic cats, it has been Cryptosporidium baileyi, Giardia, Eimeria; Toxoplasma. diagnosed in lions, mountain lions, leopards, cheetahs, and Typical parasites infecting sheep and goats include Eime the jaguar. Smaller wild cats that have been afflicted with 10 ria spp., Cryptosporidium sp., Giardia sp., Toxoplasma gon FIP include the lynx and caracal, sand cat, and pallas cat. In dii; Babesia spp. (RBC), Trypanosoma spp. (plasma). domestic cats, the disease occurs predominantly in young Theileria spp. (RBC); and Sarcocystis spp. animals, although cats of all ages are Susceptible. A peak Typical parasitic infections in poultry include coccidiosis incidence occurs between 6 and 12 months of age. A decline caused by Eimeria acervulina, E. necatrix, E. tenella, Isos in incidence is noted from 5 to 13 years of age, followed by 15 pora spp. and Eimeria truncata; histomoniasis, caused by an increased incidence in cats 14 to 15 years old. Histomonas meleagridis and Histomonas gallinarum, tri chomoniasis caused by Trichomonas gallinae; and hexami Viral, bacterial, and parasitic diseases in fin-fish, shellfish tiasis caused by Hexamita meleagridis. Poultry can also be or other aquatic life forms pose a serious problem for the infected Emeria maxima, Emeria meleagridis, Eimeria aquaculture industry. Owing to the high density of animals adenoeides, Eimeria meleagrimitis, Cryptosporidium, Eime in the hatchery tanks or enclosed marine farming areas, ria brunetti, Emeria adenoeides, Leucocytozoon spp., Plas infectious diseases may eradicate a large proportion of the modium spp., Hemoproteus meleagridis, Toxoplasma gondii stock in, for example, a fin-fish, shellfish, or other aquatic and Sarcocystis. life forms facility. Prevention of disease is a more desired The methods of the invention can also be applied to the remedy to these threats to fish than intervention once the 25 disease is in progress. Vaccination of fish is the only treatment and/or prevention of parasitic infection in dogs, preventative method which may offer long-term protection cats, birds, fish and ferrets. Typical parasites of birds include Trichomonas gallinae; Eimeria spp., Isospora spp., Giardia; through immunity. Nucleic acid based vaccinations are Cryptosporidium; Sarcocystis spp., Toxoplasma gondii, described in U.S. Pat. No. 5,780,448 issued to Davis. HaemoproteuS/Parahaemoproteus, Plasmodium spp., Leu The fish immune system has many features similar to the 30 cocytozoon/Akiba, Atoxoplasma, Trypanosoma spp. Typical mammalian immune system, Such as the presence of B cells, parasites infecting dogs include Trichinella spiralis; Isopora T cells, lymphokines, complement, and immunoglobulins. spp., Sarcocystis spp., Cryptosporidium spp., Hammondia Fish have lymphocyte subclasses with roles that appear spp., Giardia duodenalis (canis); Balantidium coli, Entam similar in many respects to those of the B and T cells of oeba histolytica, Hepatozoon canis, Toxoplasma gondii, mammals. Vaccines can be administered by immersion or 35 Trypanosoma Cruzi Babesia canis, Leishmania amastig orally. otes, Neospora caninum. Aquaculture species include but are not limited to fin-fish, Typical parasites infecting feline species include Isospora shellfish, and other aquatic animals. Fin-fish include all spp., Toxoplasma gondii, Sarcocystis spp., Hammondia vertebrate fish, which may be bony or cartilaginous fish, hammondi, Besnoitia spp., Giardia spp.; Entamoeba his Such as, for example, salmonids, carp, catfish, yellowtail, 40 tolytica, Hepatozoon canis, CytauXZoon sp., CytauXZoon Seabream, and seabass. Salmonids are a family of fin-fish sp., CytauXZoon sp. (red cells, RE cells). which include trout (including rainbow trout), Salmon, and Typical parasites infecting fish include Hexamita spp., Arctic char. Examples of shellfish include, but are not Eimeria spp.; Cryptobia spp., Nosema spp., Myxosoma spp., limited to, clams, lobster, shrimp, crab, and oysters. Other Chilodonella spp., Trichodina spp.; Plistophora spp., Myxo cultured aquatic animals include, but are not limited to eels, 45 Soma Henneguya; Costia spp., Ichthyophithirius spp., and squid, and octopi. Oodinium spp. Polypeptides of viral aquaculture pathogens include but are not limited to glycoprotein (G) or nucleoprotein (N) of Typical parasites of wild mammals include Giardia spp. viral hemorrhagic septicemia virus (VHSV); G or N proteins (carnivores, herbivores), Isospora spp. (carnivores), Eimeria of infectious hematopoietic necrosis virus (1HNV); VP1, 50 spp. (carnivores, herbivores); Theileria spp. (herbivores), VP2, VP3 or N structural proteins of infectious pancreatic Babesia spp. (carnivores, herbivores), Trypanosoma spp. necrosis virus (IPNV); G protein of spring viremia of carp (carnivores, herbivores); Schistosoma spp. (herbivores); (SVC); and a membrane-associated protein, tegumin or Fasciola hepatica (herbivores), Fascioloides magna (herbi capsid protein or glycoprotein of channel catfish virus Vores), Fasciola gigantica (herbivores), Trichinella spiralis 55 (carnivores, herbivores). (CCV). Parasitic infections in Zoos can also pose serious prob Typical parasites infecting horses are Gasterophilus spp.; lems. Typical parasites of the bovidae family (blesbok, Eimeria leuckarti, Giardia spp.; Tritrichomonas equi; Babe antelope, banteng, eland, gaur, impala, klipspringer, kudu, sia spp. (RBCs), Theileria equi; Trypanosoma spp., Kloss iella equi; Sarcocystis spp. gazelle) include Eimeria spp. Typical parasites in the pin 60 nipedae family (seal, sea lion) include Eimeria phocae. Typical parasites infecting Swine include Eimeria Typical parasites in the camelidae family (camels, llamas) bebliecki, Eimeria scabra, Isospora suis, Giardia spp., Bal include Eimeria spp. Typical parasites of the giraffidae antidium coli, Entamoeba histolytica, Toxoplasma gondii family (giraffes) include Eimeria spp. Typical parasites in and Sarcocystis spp., and Trichinella spiralis. the elephantidae family (African and Asian) include Fasciola The major parasites of dairy and beef cattle include 65 spp. Typical parasites of lower primates (chimpanzees, oran Eimeria spp., Cryptosporidium sp., Giardia spp., Toxo gutans, apes, baboons, macaques, monkeys) include Giardia plasma gondii, Babesia bovis (RBC), Babesia bigemina sp., Balantidium coli, Entamoeba histolytica, Sarcocystis US 7,271,156 B2 97 98 spp., Toxoplasma gondii; Plasmodim spp. (RBC), Babesia directed mutagenesis, or may be spontaneous. All of the spp. (RBC), Trypanosoma spp. (plasma), Leishmania spp. polypeptides produced by these modifications are included (macrophages). herein as long as antigenicity still exists. The polypeptide Polypeptides of bacterial pathogens include but are not may be, for example, a viral polypeptide. limited to an iron-regulated outer membrane protein, The term substantially purified as used herein refers to a (IROMP), an outer membrane protein (OMP), and an A-pro polypeptide which is substantially free of other proteins, tein of Aeromonis Salmonicida which causes furunculosis, p57 protein of Renibacterium salmoninarum which causes lipids, carbohydrates or other materials with which it is bacterial kidney disease (BKD), major surface associated naturally associated. One skilled in the art can purify viral or antigen (msa), a surface expressed cytotoxin (mpr), a Surface 10 bacterial polypeptides using standard techniques for protein expressed hemolysin (ish), and a flagellar antigen of Yers purification. The substantially pure polypeptide will often iniosis; an extracellular protein (ECP), an iron-regulated yield a single major band on a non-reducing polyacrylamide outer membrane protein (IROMP), and a structural protein gel. In the case of partially glycosylated polypeptides or of Pasteurellosis; an OMP and a flagellar protein of Vibrosis those that have several start codons, there may be several anguillarum and V ordalii; a flagellar protein, an OMP 15 bands on a non-reducing polyacrylamide gel, but these will protein, aroA, and purA of Edwardsiellosis ictaluri and E. form a distinctive pattern for that polypeptide. The purity of tarda; and Surface antigen of Ichthyophthirius; and a struc the viral or bacterial polypeptide can also be determined by tural and regulatory protein of Cytophaga columnari; and a amino-terminal amino acid sequence analysis. Other types structural and regulatory protein of Rickettsia. of antigens not encoded by a nucleic acid vector Such as Polypeptides of a parasitic pathogen include but are not polysaccharides, Small molecule, mimics etc are described limited to the surface antigens of Ichthyophthirius. above, and included within the invention. An allergen refers to a Substance (antigen) that can induce The invention also utilizes polynucleotides encoding the an allergic or asthmatic response in a Susceptible subject. antigenic polypeptides. It is envisioned that the antigen may The list of allergens is enormous and can include pollens, be delivered to the subject in a nucleic acid molecule which insect venoms, animal dander dust, fungal spores and drugs 25 encodes for the antigen such that the antigen must be (e.g. penicillin). Examples of natural, animal and plant expressed in vivo. Such antigens delivered to the subject in allergens include but are not limited to proteins specific to a nucleic acid vector are referred to as antigens encoded by the following genuses: Canine (Canis familiaris); Der a nucleic acid vector. The nucleic acid encoding the antigen matophagoides (e.g. Dermatophagoides farinae); Felis (Fe is operatively linked to a gene expression sequence which lis domesticus); Ambrosia (Ambrosia artemisfolia; Lolium 30 directs the expression of the antigen nucleic acid within a (e.g. Lolium perenne or Lolium multiflorum); Cryptomeria eukaryotic cell. The gene expression sequence is any regu (Cryptomeria japonica); Alternaria (Alternaria alternata): latory nucleotide sequence. Such as a promoter sequence or Alder, Alnus (Alnus guiltinoasa); Betula (Betula verrucosa); promoter-enhancer combination, which facilitates the effi Quercus (Quercus alba); Olea (Olea europa); Artemisia cient transcription and translation of the antigen nucleic acid (Artemisia vulgaris); Plantago (e.g. Plantago lanceolata); 35 to which it is operatively linked. The gene expression Parietaria (e.g. Parietaria officinalis or Parietaria judaica); sequence may, for example, be a mammalian or viral pro Blattella (e.g. Blattella germanica): Apis (e.g. Apis multi moter, such as a constitutive or inducible promoter. Consti florum); Cupressus (e.g. Cupressus sempervirens, Cupressus tutive mammalian promoters include, but are not limited to, arizonica and Cupressus macrocarpa); Juniperus (e.g. Juni the promoters for the following genes: hypoxanthine phos perus Sabinoides, Juniperus virginiana, Juniperus commu 40 phoribosyltransferase (HPTR), adenosine deaminase, pyru nis and Juniperus ashei); Thuya (e.g. Thuya Orientalis); vate kinase, b-actin promoter and other constitutive promot Chamaecyparis (e.g. Chamaecyparis obtusa); Periplaneta ers. Exemplary viral promoters which function (e.g. Periplaneta americana); Agropyron (e.g. Agropyron constitutively in eukaryotic cells include, for example, pro repens); Secale (e.g. Secale cereale); Triticum (e.g. Triticum moters from the cytomegalovirus (CMV), simian virus (e.g., aestivum); Dactylis (e.g. Dactylis glomerata); Festuca (e.g. 45 SV40), papilloma virus, adenovirus, human immunodefi Festuca elation); Poa (e.g. Poa pratensis or Poa compressa); ciency virus (HIV), Rous sarcoma virus, cytomegalovirus, Avena (e.g. Avena sativa); Holcus (e.g. Holcus lanatus); the long terminal repeats (LTR) of Moloney leukemia virus Anthoxanthum (e.g. Anthoxanthum odoratum); Arrhen and other retroviruses, and the thymidine kinase promoter of atherum (e.g. Arrhenatherum elatius); Agrostis (e.g. Agros herpes simplex virus. Other constitutive promoters are tis alba); Phleum (e.g. Phleum pratense); Phalaris (e.g. 50 known to those of ordinary skill in the art. The promoters Phalaris arundinacea); Paspalum (e.g. Paspalum notatum); useful as gene expression sequences of the invention also Sorghum (e.g. Sorghum halepensis); and Bromus (e.g. Bro include inducible promoters. Inducible promoters are mus inermis). expressed in the presence of an inducing agent. For example, The antigen may be an antigen that is encoded by a the metallothionein promoter is induced to promote tran nucleic acid vector or it may be not encoded in a nucleic acid 55 Scription and translation in the presence of certain metal vector. In the former case the nucleic acid vector is admin ions. Other inducible promoters are known to those of istered to the Subject and the antigen is expressed in vivo. In ordinary skill in the art. the latter case the antigen may be administered directly to In general, the gene expression sequence shall include, as the Subject. An antigen not encoded in a nucleic acid vector necessary, 5' non-transcribing and 5' non-translating as used herein refers to any type of antigen that is not a 60 sequences involved with the initiation of transcription and nucleic acid. For instance, in Some aspects of the invention translation, respectively, Such as a TATA box, capping the antigen not encoded in a nucleic acid vector is a sequence, CAAT sequence, and the like. Especially, such 5' polypeptide. Minor modifications of the primary amino acid non-transcribing sequences will include a promoter region sequences of polypeptide antigens may also result in a which includes a promoter sequence for transcriptional polypeptide which has substantially equivalent antigenic 65 control of the operably joined antigen nucleic acid. The gene activity as compared to the unmodified counterpart polypep expression sequences optionally include enhancer sequences tide. Such modifications may be deliberate, as by site or upstream activator sequences as desired. US 7,271,156 B2 99 100 The antigen nucleic acid is operatively linked to the gene Freeman C.O., New York (1990) and Murry, E. J. Methods expression sequence. As used herein, the antigen nucleic in Molecular Biology, vol. 7, Humana Press, Inc., Cliffton, acid sequence and the gene expression sequence are said to New Jersey (1991). be operably linked when they are covalently linked in such A preferred virus for certain applications is the adeno a way as to place the expression or transcription and/or associated virus, a double-stranded DNA virus. The adeno translation of the antigen coding sequence under the influ associated virus can be engineered to be replication-deficient ence or control of the gene expression sequence. Two DNA and is capable of infecting a wide range of cell types and sequences are said to be operably linked if induction of a species. It further has advantages such as, heat and lipid promoter in the 5' gene expression sequence results in the Solvent stability; high transduction frequencies in cells of 10 diverse lineages, including hemopoietic cells; and lack of transcription of the antigen sequence and if the nature of the superinfection inhibition thus allowing multiple series of linkage between the two DNA sequences does not (1) result transductions. Reportedly, the adeno-associated virus can in the introduction of a frame-shift mutation, (2) interfere integrate into human cellular DNA in a site-specific manner, with the ability of the promoter region to direct the tran thereby minimizing the possibility of insertional mutagen Scription of the antigen sequence, or (3) interfere with the 15 esis and variability of inserted gene expression characteristic ability of the corresponding RNA transcript to be translated of retroviral infection. In addition, wild-type adeno-associ into a protein. Thus, a gene expression sequence would be ated virus infections have been followed in tissue culture for operably linked to an antigen nucleic acid sequence if the greater than 100 passages in the absence of selective pres gene expression sequence were capable of effecting tran Sure, implying that the adeno-associated virus genomic Scription of that antigen nucleic acid sequence Such that the integration is a relatively stable event. The adeno-associated resulting transcript is translated into the desired protein or virus can also function in an extrachromosomal fashion. polypeptide. Other vectors include plasmid vectors. Plasmid vectors The antigen nucleic acid of the invention may be deliv have been extensively described in the art and are well ered to the immune system alone or in association with a known to those of skill in the art. See e.g., Sambrook et al., vector. In its broadest sense, a vector is any vehicle capable 25 Molecular Cloning: A Laboratory Manual, Second Edition, of facilitating the transfer of the antigen nucleic acid to the Cold Spring Harbor Laboratory Press, 1989. In the last few cells of the immune system so that the antigen can be years, plasmid vectors have been found to be particularly expressed and presented on the Surface of the immune cell. advantageous for delivering genes to cells in Vivo because of The vector generally transports the nucleic acid to the their inability to replicate within and integrate into a host immune cells with reduced degradation relative to the extent 30 genome. These plasmids, however, having a promoter com of degradation that would result in the absence of the vector. patible with the host cell, can express a peptide from a gene The vector optionally includes the above-described gene operatively encoded within the plasmid. Some commonly expression sequence to enhance expression of the antigen used plasmids include pBR322, p OC18, puC19, pRC/CMV, nucleic acid in immune cells. In general, the vectors useful SV40, and pPlueScript. Other plasmids are well-known to in the invention include, but are not limited to, plasmids, 35 those of ordinary skill in the art. Additionally, plasmids may phagemids, viruses, other vehicles derived from viral or be custom designed using restriction enzymes and ligation bacterial sources that have been manipulated by the insertion reactions to remove and add specific fragments of DNA. or incorporation of the antigen nucleic acid sequences. Viral It has recently been discovered that gene carrying plas vectors are a preferred type of vector and include, but are not mids can be delivered to the immune system using bacteria. limited to, nucleic acid sequences from the following 40 Modified forms of bacteria such as Salmonella can be viruses: retrovirus, Such as Moloney murine leukemia virus, transfected with the plasmid and used as delivery vehicles. Harvey murine sarcoma virus, murine mammary tumor The bacterial delivery vehicles can be administered to a host virus, and Rous sarcoma virus; adenovirus, adeno-associ subject orally or by other administration means. The bacteria ated virus; SV40-type viruses; polyoma viruses; Epstein deliver the plasmid to immune cells, e.g. B cells, dendritic Barr viruses; papilloma viruses; herpes virus; vaccinia virus; 45 cells, likely by passing through the gut barrier. High levels polio virus; and RNA virus such as a retrovirus. One can of immune protection have been established using this readily employ other vectors not named but known in the art. methodology. Such methods of delivery are useful for the Preferred viral vectors are based on non-cytopathic aspects of the invention utilizing systemic delivery of anti eukaryotic viruses in which non-essential genes have been gen, Immunostimulatory nucleic acid and/or other therapeu replaced with the gene of interest. Non-cytopathic viruses 50 tic agent. include retroviruses, the life cycle of which involves reverse Thus, the immunostimulatory nucleic acids are useful as transcription of genomic viral RNA into DNA with subse vaccine adjuvants. It was previously established that CpG quent proviral integration into host cellular DNA. Retrovi oligonucleotides are excellent vaccine adjuvants. It was also ruses have been approved for human gene therapy trials. demonstrated, however, that CpG ODN which are superb Most useful are those retroviruses that are replication 55 vaccine adjuvants in mice are not the preferred adjuvants in deficient (i.e., capable of directing synthesis of the desired non-rodent animals. In order to identify the best immuno proteins, but incapable of manufacturing an infectious par stimulatory nucleic acids for use as a vaccine adjuvant in ticle). Such genetically altered retroviral expression vectors humans and other non-rodent animals, in vivo Screening of have general utility for the high-efficiency transduction of different nucleic acids for this purpose was conducted. genes in vivo. Standard protocols for producing replication 60 Several in vitro assays were evaluated in mice for their deficient retroviruses (including the steps of incorporation of predictive value of adjuvant activity in vivo in mice. During exogenous genetic material into a plasmid, transfection of a the course of this study, an in vitro test that is predictive of packaging cell lined with plasmid, production of recombi in vivo efficacy was identified. It was discovered, rather nant retroviruses by the packaging cell line, collection of surprisingly, that both B cell and NK cell activation corre viral particles from tissue culture media, and infection of the 65 lated particularly well with the ability of an immunostimu target cells with viral particles) are provided in Kriegler, M., latory nucleic acid to enhance an in vivo immune response Gene Transfer and Expression, A Laboratory Manual W. H. against an antigen. US 7,271,156 B2 101 102 The good predictive value of B cell activation for in vivo mediated by another cell type within PBMC might contrib vaccine adjuvant activity is most likely linked to the central ute to CpG-induced functional activity of NK cells. role of B cells in the establishment of a specific immune The nucleic acids of the invention may be administered to response. Polyclonal proliferation of B cells (induced by a Subject with an anti-microbial agent. An anti-microbial immunostimulatory nucleic acids) increases the likelihood agent, as used herein, refers to a naturally-occurring or of an antigen specific B cell/T helper cell match. Further synthetic compound which is capable of killing or inhibiting more, enhanced expression of the co-stimulatory molecule infectious microorganisms. The type of anti-microbial agent CD86 on polyclonally expanded B cells activates antigen useful according to the invention will depend upon the type specific T helper cells. B cells also increase their CD40 of microorganism with which the subject is infected or at expression in response to immunostimulatory nucleic acids 10 risk of becoming infected. Anti-microbial agents include but improving the capability of CD40L expressing activated T are not limited to anti-bacterial agents, anti-viral agents, helper cells to stimulate B cells. Increased ICAM-1 synthe anti-fungal agents and anti-parasitic agents. Phrases such as sis on B cells facilitates the cell to cell contact. Thus, the “anti-infective agent”, “anti-bacterial agent”, “anti-viral activation status of polyclonal B cells plays a critical role agent”, “anti-fungal agent”, “anti-parasitic agent' and “para during the initiation of a specific antibody response. 15 siticide” have well-established meanings to those of ordi The contribution of NK cell activity for the establishment nary skill in the art and are defined in standard medical texts. of specific antibodies was, however, Surprising. NK cells are Briefly, anti-bacterial agents kill or inhibit bacteria, and part of the innate immune system and as such are involved include antibiotics as well as other synthetic or natural in the first line of defense against pathogens. Most likely the compounds having similar functions. Antibiotics are low cytokine pattern produced by NK cells upon activation is molecular weight molecules which are produced as second closely related to the initiation of a specific immune ary metabolites by cells. Such as microorganisms. In general, response. Thus, in one aspect the invention relates to a antibiotics interfere with one or more bacterial functions or method of identifying an adjuvant, by detecting NK cell structures which are specific for the microorganism and activation. The NK cell activation assay may be carried out which are not present in host cells. Anti-viral agents can be as described in the Examples below or using other known 25 isolated from natural sources or synthesized and are useful NK cell activity assays. It is preferred, however that a mixed for killing or inhibiting viruses. Anti-fungal agents are used cell population such as PBMC be used because of the to treat Superficial fungal infections as well as opportunistic likelihood that NK cell activation is an indirect effect. The and primary systemic fungal infections. Anti-parasite agents assay is preferably useful for identifying immunostimula kill or inhibit parasites. tory nucleic acids which are useful as adjuvants in human 30 Examples of anti-parasitic agents, also referred to as and other non-rodent animals. parasiticides useful for human administration include but are Cytokine induction was also identified as an important not limited to albendazole, amphotericin B, benznidazole, predictor of in vivo adjuvant activity. As there is a 2 log bithionol, chloroquine HCl, chloroquine phosphate, clinda higher endotoxin sensitivity of human than mouse primary mycin, dehydroemetime, diethylcarbamazine, diloxamide monocytes, some caution, however, is required to avoid 35 furoate, eflornithine, furazolidaone, glucocorticoids, halo endotoxin contamination of immunostimulatory nucleic fantrine, iodoquinol, ivermectin, mebendazole, mefloquine, acids used for testing in the human system (Hartmann G., meglumine antimoniate, melarsoprol, metrifonate, metron and Krieg A. M. 1999. Gene Therapy 6:893). Since TNF-C., idazole, niclosamide, nifurtimox, oxaminiquine, paromomy IL-6 and IL-12 are produced by human monocytes in cin, pentamidine isethionate, piperazine, praziquantel, pri response to even low amounts of endotoxin, their value for 40 maquine phosphate, proguanil, pyrantel pamoate, high throughput in vitro Screening assays is limited. On the pyrimethanmine-Sulfonamides, pyrimethanmine-Sulfadox other hand, human B cells and NK cells show only minor ine, quinacrine HCl, quinine Sulfate, quinidine gluconate, activation by endotoxin and thus are far more useful in spiramycin, Stibogluconate Sodium (sodium antimony glu testing for immunostimulatory activity. conate), Suramin, tetracycline, doxycycline, thiabendazole, Stimulation of cellular function in either NK or B cells 45 timidazole, trimethroprim-Sulfamethoxazole, and tryparsa (i.e. lytic activity, proliferation) requires a stronger immu mide some of which are used alone or in combination with nostimulatory nucleic acid than the induction of activation others. markers at their surface (CD69, CD86). For both cell types, Parasiticides used in non-human Subjects include pipera the use of cell Surface activation markers showed a higher Zine, diethylcarbamazine, thiabendazole, fenbendazole, nonspecific background attributable to the phosphorothioate 50 albendazole, oxfendazole, oxibendazole, febantel, levami backbone compared to the functional assays. This high sole, pyrantel tartrate, pyrantel pamoate, dichlorvos, iver sensitivity of Surface markers requires the use of low immu mectin, doramectic, milbemycin Oxime, iprinomectin, moX nostimulatory nucleic acid concentrations for optimal dis idectin, N-butyl chloride, toluene, hygromycin B crimination between immunostimulatory nucleic acid of thiacetarsemide Sodium, melarsomine, praziquantel, epsipr similar activity. Thus, the use of surface markers allows the 55 antel, benzimidazoles such as fenbendazole, albendazole, comparison of immunostimulatory nucleic acids with weak oxfendazole, clorSulon, albendazole, amprolium; deco activity, while functional assays are preferred for comparing quinate, lasalocid, monensin Sulfadimethoxine; Sulfamet immunostimulatory nucleic acids with high activity. It is of hazine, Sulfaquinoxaline, metronidazole. note that the optimal immunostimulatory nucleic acid con Parasiticides used in horses include mebendazole, centrations for stimulating B cells and NK cells differ. While 60 oxfendazole, febantel, pyrantel, dichlorvos, trichlorfon, iver 0.6 ug/ml ODN is already maximal to stimulate B cells, mectin, piperazine; for S. westeri: ivermectin, benzimidda optimal NK cell activation may require 6 ug/ml ODN. Both Zoles such as thiabendazole, cambendazole, Oxibendazole B cell activation and NK cell functional activity were and fenbendazole. Useful parasiticides in dogs include mil measured within freshly isolated PBMC. It was previously bemycin oxine, ivermectin, pyrantel pamoate and the com found that highly purified human primary B cells are acti 65 bination of ivermectin and pyrantel. The treatment of para vated by CpG DNA. The existence of a direct effect of CpG sites in Swine can include the use of levamisole, piperazine, DNA on NK cells is less clear, and a secondary mechanism pyrantel, thiabendazole, dichlorvos and fenbendazole. In US 7,271,156 B2 103 104 sheep and goats anthelmintic agents include levamisole or acetrile Sodium; Cephalexin; Cephalexin Hydrochloride: ivermectin. Caparsolate has shown some efficacy in the Cephaloglycin; Cephaloridine; Cephalothin Sodium; treatment of D. immitis (heartworm) in cats. Cephapirin Sodium; Cephradine; Cetocycline Hydrochlo Antibacterial agents kill or inhibit the growth or function ride; Cetophenicol; Chloramphenicol; Chloramphenicol of bacteria. A large class of antibacterial agents is antibiotics. 5 Palmitate; Chloramphenicol Pantothenate Complex: Antibiotics, which are effective for killing or inhibiting a Chloramphenicol Sodium Succinate; Chlorhexidine Phos wide range of bacteria, are referred to as broad spectrum phanilate; Chloroxylenol; Chlortetracycline Bisulfate; Chlo antibiotics. Other types of antibiotics are predominantly rtetracycline Hydrochloride; Cinoxacin: Ciprofloxacin: effective against the bacteria of the class gram-positive or Ciprofloxacin Hydrochloride: Cirolemycin; Clarithromycin; gram-negative. These types of antibiotics are referred to as 10 Clinafloxacin Hydrochloride; Clindamycin; Clindamycin narrow spectrum antibiotics. Other antibiotics which are Hydrochloride; Clindamycin Palmitate Hydrochloride: effective against a single organism or disease and not against Clindamycin Phosphate; Clofazimine; Cloxacillin Benza other types of bacteria, are referred to as limited spectrum thine; Cloxacillin Sodium; Cloxyquin; Colistimethate antibiotics. Antibacterial agents are sometimes classified Sodium; Colistin Sulfate; Coumermycin; Coumermycin based on their primary mode of action. In general, antibac 15 Sodium; Cyclacillin: Cycloserine; Dalfopristin; Dapsone; terial agents are cell wall synthesis inhibitors, cell mem Daptomycin; Demeclocycline; Demeclocycline Hydrochlo brane inhibitors, protein synthesis inhibitors, nucleic acid ride; Demecycline; Denofungin: Diaveridine; Dicloxacillin; synthesis or functional inhibitors, and competitive inhibi Dicloxacillin Sodium; Dihydrostreptomycin Sulfate; Dipy tOrS. rithione; Dirithromycin; Doxycycline; Doxycycline Cal Anti-bacterial agents useful in the invention include but cium; Doxycycline Fosfatex: Doxycycline Hyclate; Droxa are not limited to natural penicillins, semi-synthetic peni cin Sodium: Enoxacin; Epicillin: Epitetracycline cillins, clavulanic acid, cephalolsporins, bacitracin, amplicil Hydrochloride; Erythromycin; Erythromycin Acistrate; lin, carbenicillin, oxacillin, azlocillin, meZlocillin, piperacil Erythromycin Estolate; Erythromycin Ethylsuccinate: lin, methicillin, dicloxacillin, nafcillin, cephalothin, Erythromycin Gluceptate; Erythromycin Lactobionate: cephapirin, cephalexin, cefamandole, cefaclor, cefazolin, 25 Erythromycin Propionate; Erythromycin Stearate; Etham cefuroxine, cefoxitin, cefotaxime, cefsulodin, cefetamet, butol Hydrochloride; Ethionamide: Fleroxacin; Floxacillin; cefixime, ceftriaxone, cefoperaZone, ceftazidine, moxalac Fludalanine: Flumequine; Fosfomycin; Fosfomycin tam, carbapenems, imipenems, monobactems, euztreonam, Tromethamine; Fumoxicillin; Furazolium Chloride; Furazo Vancomycin, polymyxin, amphotericin B, nystatin, imida lium Tartrate; Fusidate Sodium; Fusidic Acid, Gentamicin Zoles, clotrimazole, miconazole, ketoconazole, itraconazole, 30 Sulfate: Gloximonam; Gramicidin; Haloprogin: Hetacillin; fluconazole, rifampins, ethambutol, tetracyclines, chloram Hetacillin Potassium: Hexedine: Ibafloxacin: Imipenem: phenicol, macrollides, aminoglycosides, Streptomycin, kana Isoconazole; Isepamicin; Isoniazid; Josamycin; Kanamycin mycin, tobramycin, amikacin, gentamicin, tetracycline, Sulfate; Kitasamycin; Levofuraltadone; Levopropylcillin minocycline, doxycycline, chlortetracycline, erythromycin, Potassium; Lexithromycin; Lincomycin; Lincomycin roXithromycin, clarithromycin, oleandomycin, azithromy 35 Hydrochloride; Lomefloxacin; Lomefloxacin Hydrochlo cin, chloramphenicol, quinolones, co-trimoxazole, norfloxa ride; Lomefloxacin Mesylate: Loracarbef: Mafenide; Meclo cin, ciprofloxacin, enoxacin, nalidixic acid, temafloxacin, cycline; Meclocycline Sulfosalicylate; Megalomicin Potas Sulfonamides, gantrisin, and trimethoprim; Acedapsone; sium Phosphate; Mequidox: Meropenem; Methacycline: Acetosulfone Sodium; Alamecin; Alexidine; Amdinocillin; Methacycline Hydrochloride; Methenamine; Methenamine Amdinocillin Pivoxil; Amicycline; Amifloxacin; Amifloxa 40 Hippurate; Methenamine Mandelate; Methicillin Sodium; cin Mesylate; Amikacin; Amikacin Sulfate; Aminosalicylic Metioprim; Metronidazole Hydrochloride; Metronidazole acid; Aminosalicylate Sodium; Amoxicillin; Amphomycin; Phosphate: Mezlocillin: Mezlocillin Sodium; Minocycline: Ampicillin; Ampicillin Sodium; Apalcillin Sodium; Apra Minocycline Hydrochloride; Mirincamycin Hydrochloride: mycin; Aspartocin, Astromicin Sulfate, Avilamycin; AVopar Monensin; Monensin Sodium; Nafcillin Sodium; Nalidixate cin: Azithromycin; AZlocillin: Azlocillin Sodium; Bacampi 45 Sodium; Nalidixic Acid; Natamycin; Nebramycin; Neomy cillin Hydrochloride: Bacitracin; Bacitracin Methylene cin Palmitate; Neomycin Sulfate; Neomycin Undecylenate: Disalicylate; Bacitracin Zinc: Bambermycins; Benzoylpas Netilmicin Sulfate; Neutramycin; Nifuradene; Nifurald Calcium; Berythromycin; Betamicin Sulfate; Biapenem: eZone; Nifuratel; Nifuratrone; Nifurdazil; Nifurimide: Biniramycin; Biphenamine Hydrochloride; Bispyrithione Nifurpirinol; Nifurquinazol; Nifurthiazole; Nitrocycline; Magsulfex; Butikacin; Butirosin Sulfate; Capreomycin Sul 50 Nitrofurantoin: Nitromide: Norfloxacin; Novobiocin fate; Carbadox; Carbenicillin Disodium; Carbenicillin India Sodium; Ofloxacin; Ormetoprim: Oxacillin Sodium; Oxi nyl Sodium; Carbenicillin Phenyl Sodium; Carbenicillin monam. Oximonam Sodium; Oxolinic Acid: Oxytetracy Potassium; Carumonam Sodium; Cefaclor, Cefadroxil, cline: Oxytetracycline Calcium; Oxytetracycline Hydro Cefamandole; Cefamandole Nafate; Cefamandole Sodium; chloride; Paldimycin; Parachlorophenol; Paulomycin; Cefaparole; Cefatrizine; Cefazaflur Sodium; Cefazolin; 55 Pefloxacin; Pefloxacin Mesylate; Penamecillin: Penicillin G Cefazolin Sodium; CefbuperaZone; Cefdinir: Cefepime: BenZathine; Penicillin G Potassium; Penicillin G Procaine; Cefepime Hydrochloride: Cefetecol; Cefixime; Penicillin G Sodium; Penicillin V: Penicillin V BenZathine; Cefinenoxime Hydrochloride; Cefinetazole; Cefinetazole Penicillin V Hydrabamine; Penicillin V Potassium; Pentizi Sodium; Cefonicid Monosodium; Cefonicid Sodium; done Sodium; Phenyl Aminosalicylate; Piperacillin Sodium; CefoperaZone Sodium; Ceforamide: Cefotaxime Sodium; 60 Pirbenicillin Sodium; Piridicillin Sodium; Pirlimycin Cefotetan: Cefotetan Disodium; Cefotiam Hydrochloride: Hydrochloride: Pivampicillin Hydrochloride: Pivampicillin Cefoxitin: Cefoxitin Sodium; Ce?pimizole; Ce?pimizole Pamoate: Pivampicillin Probenate; Polymyxin B Sulfate: Sodium; Ce?piramide: Ce?piramide Sodium; Ce?pirome Sul Porfiromycin; Propikacin; Pyrazinamide: Pyrithione Zinc; fate; Cefpodoxime Proxetil: Cefprozil; Cefroxadine: Cefsu Quindecamine Acetate; Quinupristin, Racephenicol; lodin Sodium; Ceftazidime; Ceftibuten; Ceftizoxime 65 Ramoplanin; Ranimycin; Relomycin; Repromicin; Rifabu Sodium; Ceftriaxone Sodium; Cefuroxime; Cefuroxime tin; Rifametane; Rifamexil; Rifamide: Rifampin; Rifapen Axetil: Cefuroxime Pivoxetil: Cefuroxime Sodium; Ceph tine; Rifaximin; Rolitetracycline: Rolitetracycline Nitrate; US 7,271,156 B2 105 106 Rosaramicin; Rosaramicin Butyrate; Rosaramicin Propi hepatitis B and C infection. At the dosages which are onate; Rosaramicin Sodium Phosphate; Rosaramicin Stear effective for anti-viral therapy, interferons have severe side ate; Rosoxacin; Roxarsone; Roxithromycin; Sancycline; effects Such as fever, malaise and weight loss. Sanfetrinem Sodium; Sarmoxicillin; Sarpicillin; Scopafun Immunoglobulin therapy is used for the prevention of gin, Sisomicin; Sisomicin Sulfate; Sparfloxacin; Spectino viral infection. Immunoglobulin therapy for viral infections mycin Hydrochloride: Spiramycin; Stallimycin Hydrochlo is different than bacterial infections, because rather than ride; Steflimycin; Streptomycin Sulfate; Streptonicozid: being antigen-specific, the immunoglobulin therapy func Sulfabenz; Sulfabenzamide; Sulfacetamide; Sulfacetamide tions by binding to extracellular virions and preventing them Sodium; Sulfacytine; Sulfadiazine; Sulfadiazine Sodium; from attaching to and entering cells which are Susceptible to Sulfadoxine; Sulfalene; Sulfamerazine; Sulfameter; Sul 10 the viral infection. The therapy is useful for the prevention famethazine; Sulfamethizole; Sulfamethoxazole; Sulfa of viral infection for the period of time that the antibodies monomethoxine; Sulfamoxole; Sulfanilate Zinc; Sulfanit are present in the host. In general there are two types of ran, Sulfasalazine; Sulfasomizole; Sulfathiazole; immunoglobulin therapies, normal immunoglobulin therapy Sulfazamet; Sulfisoxazole; Sulfisoxazole Acetyl; Sulfisox and hyper-immunoglobulin therapy. Normal immune globu azole Diolamine; Sulfomyxin; Sulopenem; Sultamicillin; 15 lin therapy utilizes a antibody product which is prepared Suncillin Sodium; Talampicillin Hydrochloride; Teicopla from the serum of normal blood donors and pooled. This nin; Temafloxacin Hydrochloride; Temocillin; Tetracycline; pooled product contains low titers of antibody to a wide Tetracycline Hydrochloride; Tetracycline Phosphate Com range of human viruses, such as hepatitis A, parvovirus, plex; Tetroxoprim; Thiamphenicol; Thiphencillin Potas enterovirus (especially in neonates). Hyper-immune globu sium; Ticarcillin Cresyl Sodium; Ticarcillin Disodium; lin therapy utilizes antibodies which are prepared from the Ticarcillin Monosodium; Ticlatone; Tiodonium Chloride; serum of individuals who have high titers of an antibody to Tobramycin; Tobramycin Sulfate; Tosufloxacin; Trimetho a particular virus. Those antibodies are then used against a prim; Trimethoprim Sulfate; Trisulfapyrimidines; Trolean specific virus. Examples of hyper-immune globulins include domycin; Trospectomycin Sulfate; Tyrothricin; Vancomy Zoster immune globulin (useful for the prevention of vari cin; Vancomycin Hydrochloride; Virginiamycin; and 25 cella in immuno-compromised children and neonates), Zorbamycin. human rabies immunoglobulin (useful in the post-exposure Antiviral agents are compounds which prevent infection prophylaxis of a Subject bitten by a rabid animal), hepatitis of cells by viruses or replication of the virus within the cell. B immune globulin (useful in the prevention of hepatitis B There are many fewer antiviral drugs than antibacterial virus, especially in a subject exposed to the virus), and RSV drugs because the process of viral replication is so closely 30 immune globulin (useful in the treatment of respiratory related to DNA replication within the host cell, that non syncitial virus infections). specific antiviral agents would often be toxic to the host. Another type of immunoglobulin therapy is active immu There are several stages within the process of viral infection nization. This involves the administration of antibodies or which can be blocked or inhibited by antiviral agents. These antibody fragments to viral Surface proteins. Two types of stages include, attachment of the virus to the host cell 35 vaccines which are available for active immunization of (immunoglobulin or binding peptides), uncoating of the hepatitis B include serum-derived hepatitis B antibodies and virus (e.g. amantadine), synthesis or translation of viral recombinant hepatitis B antibodies. Both are prepared from mRNA (e.g. interferon), replication of viral RNA or DNA HBSA.g. The antibodies are administered in three doses to (e.g. nucleoside analogues), maturation of new virus pro subjects at high risk of infection with hepatitis B virus, such teins (e.g. protease inhibitors), and budding and release of 40 as health care workers, sexual partners of chronic carriers, the virus. and infants. Nucleotide analogues are synthetic compounds which are Thus, anti-viral agents useful in the invention include but similar to nucleotides, but which have an incomplete or are not limited to immunoglobulins, amantadine, interferon, abnormal deoxyribose or ribose group. Once the nucleotide nucleoside analogues, and protease inhibitors. Specific analogues are in the cell, they are phosphorylated, producing 45 examples of anti-virals include but are not limited to Ace the triphosphate formed which competes with normal nucle mannan: Acyclovir; Acyclovir Sodium; Adefovir; Alovu otides for incorporation into the viral DNA or RNA. Once dine; Alvircept Sudotox: Amantadine Hydrochloride; Ara the triphosphate form of the nucleotide analogue is incor notin: Arildone: Atevirdine Mesylate: Avridine: Cidofovir; porated into the growing nucleic acid chain, it causes Cipamfylline; Cytarabine Hydrochloride; Delavirdine irreversible association with the viral polymerase and thus 50 Mesylate: Desciclovir; Didanosine; Disoxaril: Edoxudine: chain termination. Nucleotide analogues include, but are not Enviradene; Enviroxime; Famciclovir; Famotine Hydro limited to, acyclovir (used for the treatment of herpes chloride; Fiacitabine; Fialuridine; Fosarilate; Foscarnet simplex virus and varicella-Zoster virus), gancyclovir (use Sodium; Fosfonet Sodium; Ganciclovir; Ganciclovir ful for the treatment of cytomegalovirus), idoxuridine, rib Sodium; Idoxuridine; Kethoxal; Lamivudine; Lobucavir, avirin (useful for the treatment of respiratory syncitial virus), 55 Memotine Hydrochloride; Methisazone; Nevirapine; Penci dideoxyinosine, dideoxycytidine, and Zidovudine (azidothy clovir, Pirodavir; Ribavirin; Rimantadine Hydrochloride: midine). Saquinavir Mesylate: Somantadine Hydrochloride; Sorivu The interferons are cytokines which are secreted by dine: Statolon; Stavudine; Tilorone Hydrochloride; Trifluri virus-infected cells as well as immune cells. The interferons dine; Valacyclovir Hydrochloride: Vidarabine; Vidarabine function by binding to specific receptors on cells adjacent to 60 Phosphate: Vidarabine Sodium Phosphate; Viroxime; Zal the infected cells, causing the change in the cell which citabine; Zidovudine; and Zinviroxime. protects it from infection by the virus. C. and B-interferon Anti-fungal agents are useful for the treatment and pre also induce the expression of Class I and Class II MHC vention of infective fungi. Anti-fungal agents are sometimes molecules on the Surface of infected cells, resulting in classified by their mechanism of action. Some anti-fungal increased antigen presentation for host immune cell recog 65 agents function as cell wall inhibitors by inhibiting glucose nition. C. and B-interferons are available as recombinant synthase. These include, but are not limited to, basiungin/ forms and have been used for the treatment of chronic ECB. Other anti-fungal agents function by destabilizing US 7,271,156 B2 107 108 membrane integrity. These include, but are not limited to, and other therapeutic agent may be administered simulta immidazoles, such as clotrimazole, Sertaconzole, flucona neously or sequentially. When the other therapeutic agents Zole, itraconazole, ketoconazole, miconazole, and Voricona are administered simultaneously they can be administered in cole, as well as FK 463, amphotericin B, BAY38-9502, MK the same or separate formulations, but are administered at 991, pradimicin, UK 292, butenafine, and terbinafine. Other 5 the same time. The other therapeutic agents are administered anti-fungal agents function by breaking down chitin (e.g. sequentially with one another and with immunostimulatory chitinase) or immunosuppression (501 cream). Some nucleic acid, when the administration of the other therapeu examples of commercially-available agents are shown in tic agents and the immunostimulatory nucleic acid is tem Table B porally separated. The separation in time between the

TABLE B

Company Brand Name Generic Name indication Mechanism of Action PHARMACIA & PNU 196443 PNU 196443 Anti Fungal nk Lilly LY 3O3366 Basiungin/ECB Fungal Infections Anti-fungal cell wall inhibitor, glucose synthase inhibitor Bayer Canesten (R) Clotrimazole Fungal Infections Membrane integrity destabilizer Fujisawa FK 463 FK 463 Fungal Infections Membrane integrity destabilizer Mylan Sertaconzaole Sertaconzole Fungal Infections Membrane integrity destabilizer Genzyme Chitinase Chitinase Fungal Infections, Systemic Chitin Breakdown Liposome Abelcet TM Amphotericin B, Liposomal Fungal Infections, Systemic Membrane integrity destabilizer Sequus Amphotec TM Amphotericin B, Liposomal Fungal Infections, Systemic Membrane integrity destabilizer Bayer BAY 38-9502 BAY 38-9502 Fungal Infections, Systemic Membrane integrity destabilizer Pfizer Diflucan (R) Fluconazole Fungal Infections, Systemic Membrane integrity destabilizer ohnson & Johnson Sporanox TM traconazole Fungal Infections, Systemic Membrane integrity destabilizer Sepracor Itraconzole (2R, 4S) Itraconzole (2R, 4S) Fungal Infections, Systemic Membrane integrity destabilizer ohnson & Johnson Nizoral TM Ketoconazole Fungal Infections, Systemic Membrane integrity destabilizer ohnson & Johnson Monistat (R) Miconazole Fungal Infections, Systemic Membrane integrity destabilizer Merck MK991 MK991 Fungal Infections, Systemic Membrane integrity destabilizer Bristol Myers Sq'b Pradimicin Pradimicin Fungal Infections, Systemic Membrane integrity destabilizer Pfizer UK-292, 663 UK-292, 663 Fungal Infections, Systemic Membrane integrity destabilizer Pfizer Voriconazole Voriconazole Fungal Infections, Systemic Membrane integrity destabilizer Mylan SO1 Cream SO1 Cream inflammatory Fungal Immunosuppression Conditions Mylan Mentax (R) Bulenafine Nail Fungus Membrane integrity destabilizer Schering Plough Anti Fungal Anti Fungal Opportunistic Infections Membrane integrity destabilizer Aiza Mycelex (R) Troche Clotrimazole Oral Thrush Membrane integrity stablizer Novartis Lamisil (R) erbinafine Systemic Fungal Infections, Membrane integrity destabilizer Onychomycosis

Thus, the anti-fungal agents useful in the invention administration of these compounds may be a matter of include but are not limited to imidazoles, FK 463, ampho minutes or it may be longer. Other therapeutic agents include tericin B, BAY 38-9502, MK 991, pradimicin, UK 292, 40 but are not limited to adjuvants, cytokines, antibodies, butenafine, chitinase, 501 cream, Acrisorcin; Ambruticin; antigens, etc. Amorolfine, Amphotericin B; AZaconazole; AZaserine; Bas The immunostimulatory nucleic acids are useful as adju ifungin: Bifonazole; Biphenamine Hydrochloride; Bispy vants for inducing a systemic immune response. Thus either rithione Magsulfex; Butoconazole Nitrate; Calcium Unde can be delivered to a subject exposed to an antigen to cylenate; Candicidin; Carbol-Fuchsin; Chlordantoin: 45 Ciclopirox: Ciclopirox Olamine: Cilofuingin: Cisconazole; produce an enhanced immune response to the antigen. Clotrimazole; Cuprimyxin; Denofungin: Dipyrithione: In addition to the immunostimulatory nucleic acids, the Doconazole; Econazole; Econazole Nitrate; Enilconazole; compositions of the invention may also be administered with Ethonam Nitrate; Fenticonazole Nitrate; Filipin; Flucona non-nucleic acid adjuvants. A non-nucleic acid adjuvant is Zole; Flucytosine; Fungimycin; Griseofulvin; Hamycin; Iso 50 any molecule or compound except for the immunostimula conazole to Itraconazole; Kalafungin; Ketoconazole; Lomo tory nucleic acids described herein which can stimulate the fungin; Lydimycin; Mepartricin Miconazole; Miconazole humoral and/or cellular immune response. Non-nucleic acid Nitrate; Monensin; Monensin Sodium; Naftifine Hydrochlo adjuvants include, for instance, adjuvants that create a depo ride; Neomycin Undecylenate; Nifuratel; Nifurmerone: effect, immune stimulating adjuvants, and adjuvants that Nitralamine Hydrochloride; Nystatin; Octanoic Acid; 55 create a depo effect and stimulate the immune system. Orconazole Nitrate; Oxiconazole Nitrate; Oxifungin Hydro An adjuvant that creates a depo effect as used herein is an chloride; Parconazole Hydrochloride; Partricin; Potassium adjuvant that causes the antigen to be slowly released in the Iodide Proclonol; Pyrithione Zinc, Pyrrolnitrin; Rutamycin; body, thus prolonging the exposure of immune cells to the Sanguinarium Chloride Saperconazole; Scopafungin: Sele antigen. This class of adjuvants includes but is not limited to nium Sulfide: Sinefungin; Sulconazole Nitrate; Terbinafine; 60 alum (e.g., aluminum hydroxide, aluminum phosphate); or Terconazole; Thiram; Ticlatone; Tioconazole; Tolciclate: emulsion-based formulations including mineral oil, non Tolindate; Tolnaftate; Triacetin; Triafungin: Undecylenic mineral oil, water-in-oil or oil-in-water-in oil emulsion, Acid; Viridofulvin; Zinc Undecylenate; and Zinoconazole oil-in-water emulsions such as Seppic ISA series of Mon Hydrochloride. tamide adjuvants (e.g., Montamide ISA 720, AirLiquide, Immunostimulatory nucleic acids can be combined with 65 Paris, France); MF-59 (a squalene-in-water emulsion stabi other therapeutic agents such as adjuvants to enhance lized with Span 85 and Tween 80; Chiron Corporation, immune responses. The immunostimulatory nucleic acid Emeryville, Calif.; and PROVAX (an oil-in-water emulsion US 7,271,156 B2 109 110 containing a stabilizing detergent and a micelle-forming stimulatory nucleic acids as a mucosal adjuvant has benefits agent; IDEC, Pharmaceuticals Corporation, San Diego, that other mucosal adjuvants cannot achieve. The immuno Calif.). stimulatory nucleic acids of the invention also are useful as An immune stimulating adjuvant is an adjuvant that mucosal adjuvants for induction of both a systemic and a causes activation of a cell of the immune system. It may, for mucosal immune response. instance, cause an immune cell to produce and secrete Mucosal adjuvants referred to as non-nucleic acid cytokines. This class of adjuvants includes but is not limited mucosal adjuvants may also be administered with the Immu to saponins purified from the bark of the O.Saponaria tree, nostimulatory nucleic acids. A non-nucleic acid mucosal such as QS21 (a glycolipid that elutes in the 21' peak with adjuvant as used herein is an adjuvant other than a immu HPLC fractionation; Aquila Biopharmaceuticals, Inc., 10 nostimulatory nucleic acid that is capable of inducing a Worcester, MA); polydi (carboxylatophenoxy)phosphazene mucosal immune response in a subject when administered to (PCPP polymer; Virus Research Institute, USA); derivatives a mucosal Surface in conjunction with an antigen. Mucosal of lipopolysaccharides such as monophosphoryl lipid A adjuvants include but are not limited to Bacterial toxins e.g., (MPL: Ribi ImmunoChem Research, Inc., Hamilton, Cholera toxin (CT), CT derivatives including but not limited Mont.), muramyl dipeptide (MDP: Ribi) and threonyl-mu 15 to CT B subunit (CTB) (Wu et al., 1998, Tochikubo et al., ramyl dipeptide (t-MDP: Ribi); OM-174 (a glucosamine 1998); CTD53 (Val to Asp) (Fontana et al., 1995); CTK97 disaccharide related to lipid A.; OM Pharma SA, Meyrin, (Val to Lys) (Fontana et al., 1995); CTK104 (Tyr to Lys) Switzerland); and Leishmania elongation factor (a purified (Fontana et al., 1995); CTD53/K63 (Val to Asp, Ser to Lys) Leishmania protein; Corixa Corporation, Seattle, Wash.). (Fontana et al., 1995); CTH54 (Arg to His) (Fontana et al., Adjuvants that create a depo effect and stimulate the 1995); CTNo. (His to Asn) (Fontana et al., 1995); CTE 114 immune system are those compounds which have both of the (Ser to Glu) (Fontana et al., 1995): CTE112K (Glu to Lys) above-identified functions. This class of adjuvants includes (Yamamoto et al., 1997a); CTS61F (Ser to Phe) (Yamamoto but is not limited to ISCOMS (Immunostimulating com et al., 1997a, 1997b); CTS106 (Pro to Lys) (Douce et al., plexes which contain mixed Saponins, lipids and form virus 1997, Fontana et al., 1995); and CTK63 (Ser to Lys) (Douce sized particles with pores that can hold antigen; CSL, 25 et al., 1997, Fontana et al., 1995), Zonula occludens toxin, Melbourne, Australia); SB-AS2 (SmithKline Beecham adju Zot, Escherichia coli heat-labile enterotoxin, Labile Toxin vant system #2 which is an oil-in-water emulsion containing (LT), LT derivatives including but not limited to LT B MPL and QS21: SmithKline Beecham Biologicals (SBB), subunit (LTB) (Verweij et al., 1998); LT7K (Arg to Lys) Rixensart, Belgium); SB-AS4 (SmithKline Beecham adju (Komase et al., 1998, Douce et al., 1995); LT61F (Ser to vant system #4 which contains alum and MPL: SBB. Bel 30 Phe) (Komase et al., 1998); LT112K (Glu to Lys) (Komase gium); non-ionic block copolymers that form micelles Such et al., 1998); LT118E (Gly to Glu) (Komase et al., 1998); as CRL 1005 (these contain a linear chain of hydrophobic LT146E (Arg to Glu) (Komase et al., 1998); LT192G (Arg polyoxpropylene flanked by chains of polyoxyethylene; to Gly) (Komase et al., 1998); LTK63 (Ser to Lys) (Mar Vaxcel, Inc., Norcross, Ga.); and Syntex Adjuvant Formu chetti et al., 1998, Douce et al., 1997, 1998, Di Tommaso et lation (SAF, an oil-in-water emulsion containing Tween 80 35 al., 1996); and LTR72 (Ala to Arg) (Giuliani et al., 1998), and a nonionic block copolymer, Syntex Chemicals, Inc., Pertussis toxin, PT. (Lycke et al., 1992, Spangler B D, 1992, Boulder, Colo.). Freytag and Clemments, 1999, Roberts et al., 1995, Wilson The immunostimulatory nucleic acids are also useful as et al., 1995) including PT-9K/129G (Roberts et al., 1995, mucosal adjuvants. It has previously been discovered that Cropley et al., 1995); Toxin derivatives (see below) both systemic and mucosal immunity are induced by 40 (Holmgren et al., 1993, Verweijet al., 1998, Rappuoli et al., mucosal delivery of CpG nucleic acids. The systemic immu 1995, Freytag and Clements, 1999); Lipid A derivatives nity induced in response to CpG nucleic acids included both (e.g., monophosphoryl lipid A, MPL) (Sasaki et al., 1998, humoral and cell-mediated responses to specific antigens Vancott et al., 1998; Muramyl Dipeptide (MDP) derivatives that were not capable of inducing systemic immunity when (Fukushima et al., 1996, Ogawa et al., 1989, Michalek et al., administered alone to the mucosa. Furthermore, both CpG 45 1983, Morisaki et al., 1983); Bacterial outer membrane nucleic acids and cholera toxin (CT, a mucosal adjuvant that proteins (e.g., outer Surface protein A (OspA) lipoprotein of induces a Th2-like response) induced CTL. This was sur Borrelia burgdorferi, outer membrane protine of Neisseria prising since with systemic immunization, the presence of meningitidis) (Marinaro et al., 1999, Van de Verg et al., Th2-like antibodies is normally associated with a lack of 1996); Oil-in-water emulsions (e.g., MF59) (Barchfield et CTL (Schirmbeck et al., 1995). Based on the results pre 50 al., 1999, Verschoor et al., 1999, O'Hagan, 1998); Alumi sented herein it is expected that the immunostimulatory num salts (Isaka et al., 1998, 1999); and Saponins (e.g., nucleic acids will function in a similar manner. QS21) Aquila Biopharmaceuticals, Inc., Worster, Mass.) Additionally, the immunostimulatory nucleic acids induce (Sasaki et al., 1998, MacNeal et al., 1998), ISCOMS, MF-59 a mucosal response at both local (e.g., lung) and remote (a squalene-in-water emulsion stabilized with Span 85 and (e.g., lower digestive tract) mucosal sites. Significant levels 55 Tween 80; Chiron Corporation, Emeryville, Calif.); the of IgA antibodies are induced at distant mucosal sites by the Seppic ISA series of Montamide adjuvants (e.g., Montamide immunostimulatory nucleic acids. CT is generally consid ISA 720; AirLiquide, Paris, France); PROVAX (an oil-in ered to be a highly effective mucosal adjuvant. As has been water emulsion containing a stabilizing detergent and a previously reported (Snider 1995), CT induces predomi micelle-forming agent; IDEC Pharmaceuticals Corporation, nantly IgG1 isotype of antibodies, which are indicative of 60 San Diego, Calif.); Syntext Adjuvant Formulation (SAF: Th2-type response. In contrast, the immunostimulatory Syntex Chemicals, Inc., Boulder, Colo.); polydi (carboxy nucleic acids are more Th1 with predominantly IgG2a latophenoxy)phosphazene (PCPP polymer; Virus Research antibodies, especially after boost or when the two adjuvants Institute, USA) and Leishmania elongation factor (Corixa are combined. Th1-type antibodies in general have better Corporation, Seattle, Wash.). neutralizing capabilities, and furthermore, a Th2 response in 65 Immune responses can also be induced or augmented by the lung is highly undesirable because it is associated with the co-administration or co-linear expression of cytokines asthma (Kay, 1996, Hogg, 1997). Thus the use of immuno (Bueler & Mulligan, 1996; Chow et al., 1997: Geissler et al., US 7,271,156 B2 111 112 1997: Iwasaki et al., 1997: Kim et al., 1997) or B-7 co and differentiation of dendritic cells (MHC II expression, stimulatory molecules (Iwasaki et al., 1997: Tsuji et al., cell size, granularity). The immunostimulatory nucleic acids 1997) with the Immunostimulatory nucleic acids. The cytok also induce maturation of dendritic cells. Since dendritic ines can be administered directly with Immunostimulatory cells form the link between the innate and the acquired nucleic acids or may be administered in the form of a nucleic immune system, by presenting antigens as well as through acid vector that encodes the cytokine, Such that the cytokine their expression of pattern recognition receptors which can be expressed in vivo. In one embodiment, the cytokine detect microbial molecules like LPS in their local environ is administered in the form of a plasmid expression vector. ment, the ability to activate dendritic cells with immuno The term cytokine is used as a generic name for a diverse stimulatory nucleic acids Supports the use of these immu group of Soluble proteins and peptides which act as humoral 10 nostimulatory nucleic acid based strategies for in vivo and regulators at nano- to picomolar concentrations and which, ex-vivo immunotherapy against disorders such as cancer and either under normal or pathological conditions, modulate the allergic or infectious diseases. The immunostimulatory functional activities of individual cells and tissues. These nucleic acids are also useful for activating and inducing proteins also mediate interactions between cells directly and maturation of dendritic cells. regulate processes taking place in the extracellular environ 15 Immunostimulatory nucleic acids also increase natural ment. Examples of cytokines include, but are not limited to killer cell lytic activity and antibody dependent cellular IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15, cytotoxicity (ADCC). ADCC can be performed using a IL-18, granulocyte-macrophage colony stimulating factor immunostimulatory nucleic acid in combination with an (GM-CSF), granulocyte colony stimulating factor (G-CSF), antibody specific for a cellular target, such as a cancer cell. interferon-Y (Y-IFN), IFN-O, tumor necrosis factor (TNF). When the immunostimulatory nucleic acid is administered TGF-B, FLT-3 ligand, and CD40 ligand. to a subject in conjunction with the antibody the subjects Cytokines play a role in directing the T cell response. immune system is induced to kill the tumor cell. The Helper (CD4+) T cells orchestrate the immune response of antibodies useful in the ADCC procedure include antibodies mammals through production of soluble factors that act on which interact with a cell in the body. Many such antibodies other immune system cells, including other T cells. Most 25 specific for cellular targets have been described in the art and mature CD4+ T helper cells express one of two cytokine many are commercially available. Examples of these anti profiles: Th1 or Th2. The Th1 subset promotes delayed-type bodies are listed below among the list of cancer immuno hypersensitivity, cell-mediated immunity, and immunoglo therapies. bulin class Switching to IgG. The Th2 Subset induces The immunostimulatory nucleic acids may also be admin humoral immunity by activating B cells, promoting antibody 30 istered in conjunction with an anti-cancer therapy. Anti production, and inducing class Switching to IgG and IgE. In cancer therapies include cancer medicaments, radiation and some embodiments, it is preferred that the cytokine be a Th1 surgical procedures. As used herein, a "cancer medicament” cytokine. refers to a agent which is administered to a subject for the The nucleic acids are also useful for redirecting an purpose of treating a cancer. As used herein, “treating immune response from a Th2 immune response to a Th1 35 cancer includes preventing the development of a cancer, immune response. Redirection of an immune response from reducing the symptoms of cancer, and/or inhibiting the a Th2 to a Th1 immune response can be assessed by growth of an established cancer. In other aspects, the cancer measuring the levels of cytokines produced in response to medicament is administered to a subject at risk of develop the nucleic acid (e.g., by inducing monocytic cells and other ing a cancer for the purpose of reducing the risk of devel cells to produce Th1 cytokines, including IL-12, IFN-Y and 40 oping the cancer. Various types of medicaments for the GM-CSF). The redirection or rebalance of the immune treatment of cancer are described herein. For the purpose of response from a Th2 to a Th1 response is particularly useful this specification, cancer medicaments are classified as che for the treatment or prevention of asthma. For instance, an motherapeutic agents, immunotherapeutic agents, cancer effective amount for treating asthma can be that amount; vaccines, hormone therapy, and biological response modi useful for redirecting a Th2 type of immune response that is 45 fiers. associated with asthma to a Th1 type of response. Th2 As used herein, a "cancer medicament” refers to an agent cytokines, especially IL-4 and IL-5 are elevated in the which is administered to a subject for the purpose of treating airways of asthmatic Subjects. These cytokines promote a cancer. As used herein, “treating cancer includes prevent important aspects of the asthmatic inflammatory response, ing the development of a cancer, reducing the symptoms of including IgE isotype Switching, eosinophil chemotaxis and 50 cancer, and/or inhibiting the growth of an established cancer. activation and mast cell growth. Th1 cytokines, especially In other aspects, the cancer medicament is administered to IFN-Y and IL-12, can suppress the formation of Th2 clones a Subject at risk of developing a cancer for the purpose of and production of Th2 cytokines. The immunostimulatory reducing the risk of developing the cancer. Various types of nucleic acids of the invention cause an increase in Th1 medicaments for the treatment of cancer are described cytokines which helps to rebalance the immune system, 55 herein. For the purpose of this specification, cancer medi preventing or reducing the adverse effects associated with a caments are classified as chemotherapeutic agents, immu predominately Th2 immune response. notherapeutic agents, cancer vaccines, hormonetherapy, and The nucleic acids are also useful for improving Survival, biological response modifiers. Additionally, the methods of differentiation, activation and maturation of dendritic cells. the invention are intended to embrace the use of more than The immunostimulatory nucleic acids have the unique capa 60 one cancer medicament along with the immunostimulatory bility to promote cell survival, differentiation, activation and nucleic acids. As an example, where appropriate, the immu maturation of dendritic cells. Dendritic precursor cells iso nostimulatory nucleic acids may be administered with a both lated from blood by immunomagnetic cell sorting develop a chemotherapeutic agent and an immunotherapeutic agent. morphologic and functional characteristics of dendritic cells Alternatively, the cancer medicament may embrace an during a two day incubation with GM-CSF. Without GM 65 immunotherapeutic agent and a cancer vaccine, or a che CSF these cells undergo apoptosis. The immunostimulatory motherapeutic agent and a cancer vaccine, or a chemothera nucleic acids are superior to GM-CSF in promoting survival peutic agent, an immunotherapeutic agent and a cancer US 7,271,156 B2 113 114 vaccine all administered to one Subject for the purpose of both tumor cells and normal cells but are present in a treating a subject having a cancer or at risk of developing a different quantity or a different form in tumor cells. CaCC. Examples of Such antigens are oncofetal antigens (e.g., Cancer medicaments function in a variety of ways. Some carcinoembryonic antigen), differentiation antigens (e.g., T cancer medicaments work by targeting physiological mecha and Tn antigens), and oncogene products (e.g., HER/neu). nisms that are specific to tumor cells. Examples include the Different types of cells that can kill tumor targets in vitro targeting of specific genes and their gene products (i.e., and in vivo have been identified: natural killer cells (NK proteins primarily) which are mutated in cancers. Such cells), cytolytic T lymphocytes (CTLs), lymphokine-acti genes include but are not limited to oncogenes (e.g., Ras, vated killer cells (LAKs), and activated macrophages. NK Her2, bcl-2), tumor suppressor genes (e.g., EGF, p53, Rb), 10 cells can kill tumor cells without having been previously and cell cycle targets (e.g., CDK4, p21, telomerase). Cancer sensitized to specific antigens, and the activity does not medicaments can alternately target signal transduction path require the presence of class I antigens encoded by the major ways and molecular mechanisms which are altered in cancer histocompatibility complex (MHC) on target cells. NK cells cells. Targeting of cancer cells via the epitopes expressed on are thought to participate in the control of nascent tumors their cell Surface is accomplished through the use of mono 15 and in the control of metastatic growth. In contrast to NK clonal antibodies. This latter type of cancer medicament is cells, CTLs can kill tumor cells only after they have been generally referred to herein as immunotherapy. sensitized to tumor antigens and when the target antigen is Other cancer medicaments target cells other than cancer expressed on the tumor cells that also express MHC class I. cells. For example, some medicaments prime the immune CTLs are thought to be effector cells in the rejection of system to attack tumor cells (i.e., cancer vaccines). Still transplanted tumors and of tumors caused by DNA viruses. other medicaments, called angiogenesis inhibitors, function LAK cells are a subset of null lymphocytes distinct from the by attacking the blood supply of solid tumors. Since the NK and CTL populations. Activated macrophages can kill most malignant cancers are able to metastasize (i.e., exist the tumor cells in a manner that is not antigen dependent nor primary tumor site and seed a distal tissue, thereby forming MHC restricted once activated. Activated macrophages are a secondary tumor), medicaments that impede this metasta 25 through to decrease the growth rate of the tumors they sis are also useful in the treatment of cancer. Angiogenic infiltrate. In vitro assays have identified other immune mediators include basic FGF, VEGF, angiopoietins, mechanisms such as antibody-dependent, cell-mediated angiostatin, endostatin, TNFO, TNP-470, thrombospondin cytotoxic reactions and lysis by antibody plus complement. 1, platelet factor 4, CAI, and certain members of the integrin However, these immune effector mechanisms are thought to family of proteins. One category of this type of medicament 30 be less important in vivo than the function of NK, CTLs, is a metalloproteinase inhibitor, which inhibits the enzymes LAK, and macrophages in vivo (for review see Piessens, W. used by the cancer cells to exist the primary tumor site and F., and David, J., “Tumor Immunology’. In: Scientific extravasate into another tissue. American Medicine, Vol. 2, Scientific American Books, Some cancer cells are antigenic and thus can be targeted N.Y., pp. 1-13, 1996. by the immune system. In one aspect, the combined admin 35 The goal of immunotherapy is to augment a patients istration of immunostimulatory nucleic acids and cancer immune response to an established tumor. One method of medicaments, particularly those which are classified as immunotherapy includes the use of adjuvants. Adjuvant cancer immunotherapies, is useful for stimulating a specific Substances derived from microorganisms, such as bacillus immune response against a cancer antigen. A "cancer anti Calmette-Guerin, heighten the immune response and gen’ as used herein is a compound, Such as a peptide, 40 enhance resistance to tumors in animals. associated with a tumor or cancer cell Surface and which is Immunotherapeutic agents are medicaments which derive capable of provoking an immune response when expressed from antibodies or antibody fragments which specifically on the Surface of an antigen presenting cell in the context of bind or recognize a cancer antigen. As used herein a cancer an MHC molecule. Cancer antigens, such as those present in antigen is broadly defined as an antigen expressed by a cancer vaccines or those used to prepare cancer immuno 45 cancer cell. Preferably, the antigen is expressed at the cell therapies, can be prepared from crude cancer cell extracts, as surface of the cancer cell. Even more preferably, the antigen described in Cohen, et al., 1994, Cancer Research, 54:1055, is one which is not expressed by normal cells, or at least not or by partially purifying the antigens, using recombinant expressed to the same level as in cancer cells. Antibody technology, or de novo synthesis of known antigens. Cancer based immunotherapies may function by binding to the cell antigens can be used in the form of immunogenic portions 50 Surface of a cancer cell and thereby stimulate the endog of a particular antigen or in some instances a whole cell or enous immune system to attack the cancer cell. Another way a tumor mass can be used as the antigen. Such antigens can in which antibody-based therapy functions is as a delivery be isolated or prepared recombinantly or by any other means system for the specific targeting of toxic Substances to known in the art. cancer cells. Antibodies are usually conjugated to toxins The theory of immune surveillance is that a prime func 55 Such as ricin (e.g., from castor beans), calicheamicin and tion of the immune system is to detect and eliminate maytansinoids, to radioactive isotopes such as Iodine-131 neoplastic cells before a tumor forms. A basic principle of and Yttrium-90, to chemotherapeutic agents (as described this theory is that cancer cells are antigenically different herein), or to biological response modifiers. In this way, the from normal cells and thus elicit immune reactions that are toxic Substances can be concentrated in the region of the similar to those that cause rejection of immunologically 60 cancer and non-specific toxicity to normal cells can be incompatible allografts. Studies have confirmed that tumor minimized. In addition to the use of antibodies which are cells differ, either qualitatively or quantitatively, in their specific for cancer antigens, antibodies which bind to vas expression of antigens. For example, "tumor-specific anti culature, such as those which bind to endothelial cells, are gens' are antigens that are specifically associated with tumor also useful in the invention. This is because generally solid cells but not normal cells. Examples of tumor specific 65 tumors are dependent upon newly formed blood vessels to antigens are viral antigens in tumors induced by DNA or Survive, and thus most tumors are capable of recruiting and RNA viruses. “Tumor-associated antigens are present in stimulating the growth of new blood vessels. As a result, one US 7,271,156 B2 115 116 strategy of many cancer medicaments is to attack the blood (NK) cells and an increase in IFNC. levels. The nucleic acids vessels feeding a tumor and/or the connective tissues (or when used in combination with monoclonal antibodies serve stroma) Supporting such blood vessels. to reduce the dose of the antibody required to achieve a The use of immunostimulatory nucleic acids in conjunc biological result. tion with immunotherapeutic agents such as monoclonal antibodies is able to increase long-term Survival through a Examples of cancer immunotherapies which are currently number of mechanisms including significant enhancement being used or which are in development are listed in Table of ADCC (as discussed above), activation of natural killer C.

Table C Cancer Immunotherapies in Development or on the Market MARKETER BRAND NAME (GENERIC NAME) INDICATION IDECFGenentech, Inc. Hoffmann Rituxan TM (rituximab, Mabthera) (IDEC non-Hodgkin's lymphoma LaRoche (first monoclonal C2B8, chimeric murine/human anti-CD20 antibody licensed for the MAb) treatment of cancer in the U.S.) Genentech Hoffmann-La Roche Herceptin, anti-Her2 hMAb Breast ovarian Cytogen Corp. QuadrametTM (CYT 424) radiotherapeutic Bone metastases agent Centocort Glaxo, Ajinomoto Panorex (R) (17-IA) (murine monoclonal Adjuvant therapy for antibody) colorectal (Dukes-C) Centocori Ajinomoto Panorex (R) (17-1A) (chimeric murine Pancreatic, lung, breast, monoclonal antibody) ovary IDEC DEC-Y2B8 (murine, anti-CD2O MAb non-Hodgkin's lymhoma abeled with Yttrium-90) ImClone Systems BEC2 (anti-idiotypic MAb, mimics the GD Small cell lung epitope) (with BCG) ImClone Systems C225 (chimeric monoclonal antibody to Renal cell epidermal growth factor receptor (EGFr)) Techniclone International Alpha Oncolym TM (Lym-1 monoclonal non-Hodgkin's lymphoma Therapeutics antibody linked to 131 iodine) Protein Design Labs SMART TM M195 Ab, humanized Acute myleoid leukemia Techniclone I LYM-1 (Oncolym TM) non-Hodgkin's lymphoma Corporation Cambridge Antibody Technology Aronex Pharmaceuticals, Inc. ATRAGEN (R) Acute promyelocytic leukemia ImClone Systems C225 (chimeric anti-EGFr monoclonal Head & neck, non-Small antibody) + cisplatin or radiation cell lung cancer Altarex, Canada Ovarex (B43.13, anti-idiotypic CA 125, Ovarian mouse MAb) Coulter Pharma (Clinical results Bexxar (anti-CD20 Mab labeled with '' ) non-Hodgkin's lymphoma have been positive, but the drug has been associated with significant bone marrow toxicity) Aronex Pharmaceuticals, Inc. ATRAGEN (R) Kaposi's sarcoma IDEC Pharmaceuticals Rituxan (R) (MAb against CD20) pan-B Ab in B cell lymphoma Corp. Genentech combo. with chemotherapy LeukoSite/Ilex Oncology LDP-03, huMAb to the leukocyte antigen Chronic lymphocytic CAMPATH eukemia (CLL) Center of Molecular Immunology ior té (anti CD6, murine MAb) CTCL Cancer Medarex Novartis DX-210 (humanized anti-HER-2 bispecific Breast, ovarian ibody) Medarex Novartis DX-210 (humanize anti-HER-2 bispecific Prostate, non-small cell ibody) ung, pancreatic, breast Medarex DX-11 (complement activating receptor Acute myelogenous AR) monoclonal antibody) eukemia (AML) Medarex Novartis DX-210 (humanized anti-HER-2 bispecific Renal and colon ibody) Medarex DX-11 (complement activating receptor Lx vivo bone marrow AR) monoclonal antibody) purging in acute myelogenous leukemia (AML) Medarex DX-22 (humanized bispecific antibody, Acute myleoid leukemia Ab-conjugates) (complement cascade activators) Cytogen OV103 (Yttrium-90 labelled antibody) Ovarian Cytogen OV103 (Yttrium-90 labelled antibody) Prostate Aronex Pharmaceuticals, Inc. ATRAGEN (R) non-Hodgkin's lymphoma GlaxoWellcome plc 3622W94MAb that binds to EGP40 (17-IA) non-Small cell lung, pancarcinoma antigen on adenocarcinomas prostate (adjuvant) Genentech Anti-VEGF, RhuMAb (inhibits angiogenesis) Lung, breast, prostate, colorectal Protein Design Labs Zenapax (SMART TM Anti-Tac (IL-2 Leukemia, lymphoma receptor) Ab, humanized) US 7,271,156 B2 117 118

Table C-continued Cancer Immunotherapies in Development or on the Market MARKETER BRAND NAME (GENERIC NAME) INDICATION Protein Design Labs SMART TM M195 Ab, humanized Acute promyelocytic leukemia ImClone Systems C225 (chimeric anti-EGFr monoclonal Breast antibody) + taxol ImClone Systems (licensed from C225 (chimeric anti-EGFr monoclonal prostate RPR) antibody ) + doxorubicin ImClone Systems C225 (chimeric anti-EGFr monoclonal prostate antibody) + adriamycin ImClone Systems BEC2 (anti-idiotypic MAb, mimics the GD3 Melanoma epitope) Medarex MDX-210 (humanized anti-HER-2 bispecific Cancer antibody) Medarex MDX-220 (bispecific for tumors that express Lung, colon, prostate, TAG-72) ovarian, endometrial, pancreatic and gastric Medarex Novartis MDX-210 (humanized anti-HER-2 bispecific Prostate antibody) Medarex/Merck KgaA MDX-447 (humanized anti-EGF receptor EGF receptor cancers bispecific antibody) (head & neck, prostate, lung, bladder, cervical, ovarian) Medarex Novartis DX-210 (humanized anti-HER-2 bispecific Comb. Therapy with G ibody) CSF for various cancers, esp. breast IDEC ELIMMUNE TM-2 (murine monoclonal Melanoma ibody therapeutic vaccine) IDEC ELIMMUNE TM-1 (murine monoclonal Melanoma ibody therapeutic vaccine) Immunomedics, Inc. CEACIDETM (I-131) Colorectal and other NeoRx PretargetTM radioactive antibodies non-Hodgkin's B cell lymphoma Novopharm Biotech, Inc. NovoMAb-G2 (pancarcinoma specific Ab) Cancer Techniclone Corporation? TNT (chimeric MAb to histone antigens) Brain Cambridge Antibody Technology Techniclone International TNT (chimeric MAb to histone antigens) Brain Cambridge Antibody Technology Novopharm Gliomab-H (Monoclonals - Humanized Abs) Brain, melanomas, neuroblastomas Genetics Institute? AHP GNI-2SO Mab Colorectal Merck KgaA EMD-72000 (chimeric-EGF antagonist) Cancer Immunomedics LymphoCide TM (humanized LL2 non-Hodgkin's B-cell antibody) lymphoma Immunex AHP CMA 676 (monoclonal antibody conjugate) Acute myelogenous leukemia Novopharm Biotech, Inc. Monopharm-C Colon, lung, pancreatic Novopharm Biotech, Inc. 4B5 anti-idiotype Ab Melanoma, Small-cell lung Center of Molecular Immunology ior egfriš (anti EGF-R humanized Ab) Radioimmunotherapy Center of Molecular Immunology ior c5 (murine MAb colorectal) for Colorectal radioimmunotherapy Creative BioMolecules BABS (biosynthetic antibody binding site) Breast cancer Chiron Proteins ImClone Systems/Chugai FLK-2 (monoclonal antibody to fetal liver Tumor-associated kinase-2 (FLK-2)) angiogenesis ImmunoGen, Inc. Humanized MAbsmall-drug conjugate Small-cell lung Medarex, Inc. MDX-260 bispecific, targets GD-2 Melanoma, glioma, neuroblastoma Procyon Biopharma, Inc. ANA Ab Cancer Protein Design Labs SMART TM 1D10 Ab B-cell lymphoma Protein Design Labs/Novartis SMART TMABL 364 Ab Breast, lung, colon Immunomedics, Inc. ImmuRAIT-CEA Colorectal

Yet other types of chemotherapeutic agents which can be captopurine, Mesna, Mitotane (op'-DDD), Mitoxantrone used according to the invention include Aminoglutethimide, HCl, Octreotide, Plicamycin, Procarbazine HCl, Streptozo Asparaginase, BuSulfan, Carboplatin, Chlorombucil, Cyt 60 cin, Tamoxifen citrate. Thioguanine. Thiotepa, Vinblastine arabine HCl, Dactinomycin, Daunorubicin HCl, Estramus sulfate, Amsacrine (m-AMSA), AZacitidine, Erthropoietin, tine phosphate sodium, Etoposide (VP16-213), Floxuridine, Hexamethylmelamine (HMM), Interleukin 2, MitoguaZone Fluorouracil (5-FU), Flutamide, Hydroxyurea (hydroxycar (methyl-GAG; methyl glyoxal bis-guanylhydraZone; bamide), Ifosfamide, Interferon Alfa-2a, Alfa-2b, Leupro 65 MGBG), Pentostatin (2'deoxycoformycin), Semustine lide acetate (LHRH-releasing factor analogue), Lomustine (methyl-CCNU), Teniposide (VM-26) and Vindesine sul (CCNU), Mechlorethamine HCl (nitrogen mustard), Mer fate. US 7,271,156 B2 119 120 Cancer vaccines are medicaments which are intended to a vaccine with a reduced antigen dose to be used to achieve stimulate an endogenous immune response against cancer the same beneficial effect. In some instances, cancer vac cells. Currently produced vaccines predominantly activate cines may be used along with adjuvants, such as those the humoral immune system (i.e., the antibody dependent described above. immune response). Other vaccines currently in development 5 As used herein, the terms "cancer antigen’ and "tumor are focused on activating the cell-mediated immune system antigen' are used interchangeably to refer to antigens which including cytotoxic T lymphocytes which are capable of are differentially expressed by cancer cells and can thereby killing tumor cells. Cancer vaccines generally enhance the be exploited in order to target cancer cells. Cancer antigens presentation of cancer antigens to both antigen presenting are antigens which can potentially stimulate apparently cells (e.g., macrophages and dendritic cells) and/or to other 10 tumor-specific immune responses. Some of these antigens immune cells such as T cells, B cells, and NK cells. are encoded, although not necessarily expressed, by normal Although cancer vaccines may take one of several forms, cells. These antigens can be characterized as those which are as discussed infra, their purpose is to deliver cancer antigens normally silent (i.e., not expressed) in normal cells, those and/or cancer associated antigens to antigen presenting cells that are expressed only at certain stages of differentiation (APC) in order to facilitate the endogenous processing of 15 and those that are temporally expressed Such as embryonic such antigens by APC and the ultimate presentation of and fetal antigens. Other cancer antigens are encoded by antigen presentation on the cell Surface in the context of mutant cellular genes, such as oncogenes (e.g., activated ras MHC class I molecules. One form of cancer vaccine is a oncogene), Suppressor genes (e.g., mutant p53), fusion pro whole cell vaccine which is a preparation of cancer cells teins resulting from internal deletions or chromosomal trans which have been removed from a subject, treated ex vivo 20 locations. Still other cancer antigens can be encoded by viral and then reintroduced as whole cells in the subject. Lysates genes such as those carried on RNA and DNA tumor viruses. of tumor cells can also be used as cancer vaccines to elicit Other vaccines take the form of dendritic cells which have an immune response. Another form cancer vaccine is a been exposed to cancer antigens in vitro, have processed the peptide vaccine which uses cancer-specific or cancer-asso antigens and are able to express the cancer antigens at their ciated Small proteins to activate T cells. Cancer-associated 25 cell surface in the context of MHC molecules for effective proteins are proteins which are not exclusively expressed by antigen presentation to other immune system cells. cancer cells (i.e., other normal cells may still express these The immunostimulatory nucleic acids are used in one antigens). However, the expression of cancer-associated aspect of the invention in conjunction with cancer vaccines antigens is generally consistently upregulated with cancers which are dendritic cell based. A dendritic cell is a profes of a particular type. Yet another form of cancer Vaccine is a 30 sional antigen presenting cell. Dendritic cells form the link dendritic cell vaccine which includes whole dendritic cells between the innate and the acquired immune system by which have been exposed to a cancer antigen or a cancer presenting antigens and through their expression of pattern associated antigen in vitro. Lysates or membrane fractions of recognition receptors which detect microbial molecules like dendritic cells may also be used as cancer vaccines. Den LPS in their local environment. Dendritic cells efficiently dritic cell vaccines are able to activate antigen-presenting 35 internalize, process, and present soluble specific antigen to cells directly. Other cancer vaccines include ganglioside which it is exposed. The process of internalizing and pre vaccines, heat-shock protein vaccines, viral and bacterial senting antigen causes rapid upregulation of the expression vaccines, and nucleic acid vaccines. of major histocompatibility complex (MHC) and costimu The use of immunostimulatory nucleic acids in conjunc latory molecules, the production of cytokines, and migration tion with cancer vaccines provides an improved antigen 40 toward lymphatic organs where they are believed to be specific humoral and cell mediated immune response, in involved in the activation of T cells. addition to activating NK cells and endogenous dendritic Table D lists a variety of cancer vaccines which are either cells, and increasing IFNC. levels. This enhancement allows currently being used or are in development.

TABLED Cancer Vaccines in Development or on the Market MARKETER BRAND NAME (GENERIC NAME) INDICATION

Center of Molecular EGF Cancer Immunology Center of Molecular Ganglioside cancer Immunology vaccine Center of Molecular Anti-idiotypic Cancer vaccine Immunology ImClone Systems/Memorial Gp75 antigen Melanoma Sloan-Kettering Cancer Center ImClone Systems/Memorial Anti-idiotypic Abs Cancer vaccines Sloan-Kettering Cancer Center Progenics Pharmaceuticals, Inc. GMK melanoma vaccine Melanoma Progenics Pharmaceuticals, Inc, MGV ganglioside conjugate vaccine Lymphoma, colorectal, lung Corixa Her2/neu. Breast, ovarian AltaRex Ovarex Ovarian AVAX Technologies Inc. M-Vax, autologous whole cell Melanoma AVAX Technologies Inc. O-Vax, autologous whole cell Ovarian AVAX Technologies Inc. L-Vax, autologous whole cell Leukemia-AML Biomira Iric. Chiron Theratope, STn-KLH Breast, Colorectal US 7,271,156 B2 121 122

TABLE D-continued Cancer Vaccines in Development or on the Market MARKETER BRAND NAME (GENERIC NAME) NDICATION Biomira Inc. BLP25, MUC-1 peptide vaccine encapsulated Lung in liposomal delivery system Biomira Inc. BLP25, MUC-1 peptide vaccine encapsulated Lung in liposomal delivery system + Liposomal IL 2 Biomira Inc. Liposomal idiotypic vaccine Lymphoma B-cell malignancies Ribi Immunochem Melacine, cell lysate Melanoma Corixa Peptide antigens, microsphere delivery sysem Breast and LeIF adjuvant Corixa Peptide antigens, microsphere delivery sysem Prostate and LeIF adjuvant Corixa Peptide antigens, microsphere delivery sysem and LeIF adjuvant Corixa Peptide antigens, microsphere delivery sysem and LeIF adjuvant Corixa Peptide antigens, microsphere delivery sysem and LeIF adjuvant Virus Research Institute Toxinfantigen recombinant delivery system All cancers Apollon Inc. Genevax-TCR T-cell lymphoma Bavarian Nordic Research MVA-based (vaccinia virus) vaccine Melanoma Institute AS BioChem PharmaBioChem PAGIS, BCG vaccine Bladder Vaccine Cantab Pharmaceuticals TA-HPV Cervical Cantab Pharmaceuticals TA-CIN Cervical Cantab Pharmaceuticals DISC-Virus, immunotherapy Cancer Pasteur Merieux Connaught ImmuCyst (R).TheraCys (R)- BCG Bladder Immunotherapeutic (Bacillus Calmette Guerin Connaught), for intravesical treatment of Superficial bladder cancer

As used herein, chemotherapeutic agents embrace all hormones or hormone analogs, and miscellaneous antine other forms of cancer medicaments which do not fall into the 35 oplastic drugs. Most if not all of these agents are directly categories of immunotherapeutic agents or cancer vaccines. toxic to cancer cells and do not require immune stimulation. Chemotherapeutic agents as used herein encompass both Combination chemotherapy and immunostimulatory nucleic chemical and biological agents. These agents function to acid administration increases the maximum tolerable dose of inhibit a cellular activity which the cancer cell is dependent chemotherapy. upon for continued survival. Categories of chemotherapeutic 40 Chemotherapeutic agents which are currently in develop agents include alkylating/alkaloid agents, antimetabolites, ment or in use in a clinical setting are shown in Table E.

TABLE E Cancer Drugs in Development or on the Market Marketer Brand Name Generic Name Indication Abbott TNP 470 AGM 1470 Fragyline Anti-Angiogenesis in Cancer Takeda TNP 470 AGM 1470 Fragyline Anti-Angiogenesis in Cancer Scotia Meglamine GLA Meglamine GLA Bladder Cancer Medeva Vaistar Valirubicin Bladder Cancer - Refractory in situ carcinoma Medeva Valstar Valirubicin Bladder Cancer - Papillary Cancer Rhone Poulenc Gliadel Wafer Carmustaine + Polifepr Osan Brain Tumor Warner Lambert Undisclosed Cancer (b) Undisclosed Cancer (b) Cancer Bristol Myers RAS Famesyl Transferase RAS FamesylTransferase Cancer Squib Inhibitor Inhibitor Novartis MMI 270 MMI 270 Cancer Bayer BAY 12-9566 BAY 12-9566 Cancer Merck Famesyl Transferase Inhibitor Famesyl Transferase Cancer (Solid tumors - Inhibitor pancrease, colon, lung, breast) Pfizer PFE MMP Cancer, angiogenesis Pfizer PFE Tyrosine Kinase Cancer, angiogenesis Lilly MTALY 231514 MTALY 231514 Cancer Solid Tumors Lilly LY 264618, Lometexol Lometexol Cancer Solid Tumors Scotia Glamolec LiGLA (lithium-gamma Cancer, pancreatic, breast, linolenate) colon US 7,271,156 B2 123 124

TABLE E-continued Cancer Drugs in Development or on the Market Marketer Brand Name Generic Name Indication Warner Lambert CI-994 CI-994 Cancer, Solid Tumors f Leukemia Schering AG Angiogenesis inhibitor Angiogenesis Inhibitor Cancer Cardio Takeda TNP-470 nk Malignant Tumor Smithkline Hycamtin Topotecan Metastatic Ovarian Cancer Beecham Novartis PKC 412 PKC 412 Multi-Drug Resistant Cancer Novartis Valspodar PSC 833 Myeloid Leukemia Ovarian Cancer Immunex Nowantrone Mitoxantrone Pain related to hormone refractory prostate cancer. Warner Lambert Metaret Suramin Prostate Genentech Anti-VEGF Anti-VEGF Prostate Breast Colorectal NSCL Cancer British Biotech Baltimastat Batimastat (BB94) Pterygium Eisai E 7070 E 7070 Solid Tumors Biochem BCH-4556 BCH-4SS6 Solid Tumors Pharma Sankyo CS-682 CS-682 Solid Tumors Agouron Solid Tumors IDEC Pharma 9-AC 9-AC Solid Tumors Agouron VEGFb-FGF Inhibitors VEGFb-FGF Inhibitors Solid Tumors Agouron AG3340 AG3340 Solid Tumors Macular Degen Vertex Incel VX-710 Solid Tumors - IV Vertex VX-853 VX-853 Solid Tumors - Oral Zeneca ZD 01.01 (in) ZD 01.01 Solid Tumors Novartis ISI 641 ISI 641 Solid Tumors Novartis ODN 698 ODN 698 Solid Tumors Tanube Seiyaku TA2516 Marimistat Solid Tumors British Biotech Marimastat Marimastat (BB 2516) Solid Tumors Celltech CDP 845 Aggrecanase Inhibitor Solid Tumors Breast Cancer Chiroscience D2163 D2163 Solid Tumors Metastases Warner Lambert PD 1838OS PD 183805 Daiichi DX8951f DX8951f Anti-Cancer Daiichi Lemonal DP 2202 Lemonal DP 2202 Anti-Cancer Fujisawa FK317 FK317 Anticancer Antibiotic Chugai Piclbanil OK-432 Antimalignant Tumor Nycorned AD 32, walrubicin Valirubicin Bladder Cancer-Refractory Amersham nsitu Carcinoma Nycomed Metastron Strontium Derivative Bone Cancer (adjunt therapy, Amersham Pain) Schering Plough Temodal Temozolomide Brain Tumours Schering Plough Temodal Temozolonide Brain Tumours Liposome Evacet Doxorubicin, Liposomal Breast Cancer Yewtaxan Paclitaxel Breast Cancer Advanced, Ovarian Cancer Advanced Bristol Myers Taxol Paclitaxel Breast Cancer Advanced, Squib Ovarian Cancer Advanced, NSCLC Roche Xeloda Capecitabine Breast Cancer, Colorectal Cancer Roche Furtulon Doxifluridine Breast Cancer, Colorectal Cancer, Gastric Cancer Pharmacia & Adriamycin Doxorubicin Breast Cancer, Leukemia Upjohn W8X Cyclopax Paclitaxel, Oral Breast Ovarian Cancer Rhone Poulenc Oral Taxoid Oral Taxoid Broad Cancer AHP Nowantrone Mitoxantrone Cancer Sequus SPI-077 Cisplatin, Stealth Cancer Hoechst HMR 1275 Flavopiridol Cancer Pfizer CP-358, 774 EGFR Cancer Pfizer CP-609, 754 RAS Oncogene Inhibitor Cancer Bristol Myers BMS-182751 Oral Platinum Cancer (Lung, Ovarian) Squib Bristol Myers UFT (Tegafuri Uracil) UFT (Tegafuri Uracil) Cancer Oral Squib Ergamisol Levamisole Cancer Therapy Enliluracil 776C85 5FU Enhancer Cancer, Refractory Solid & Colorectal Cancer Ergamisol Levamisole Colon Cancer US 7,271,156 B2 125 126

TABLE E-continued Cancer Drugs in Development or on the Market Marketer Brand Name Generic Name Indication Rhone Poulene Campto rinotecan Colorectal Cancer, Cervical Cancer Pharmacia & Camptosar rinotecan Colorectal Cancer, Cervical Upjohn Cancer Zeneca Tomudex Ralitrexed Colorectal Cancer, Lung Cancer, Breast Cancer ohnson & Leustain Cladribine Hairy Cell Leukaemia ohnson W8X Paxene Paclitaxel Kaposi Sarcoma Sequus Doxi Doxorubicin, Liposomal KS/Cancer Sequus Caelyx Doxorubicin, Liposomal KS/Cancer Schering AG Fludara Fludarabine Leukaemia Pharmacia & Pharmorubicin Epirubicin Lung Breast Cancer Upjohn Chiron DepoCyt DepoCyt Neoplastic Meningitis Zeneca ZD1839 ZD 1839 Non Small Cell Lung Cancer, Pancreatic Cancer BASF LU 79553 Bis-Naphtalimide Oncology BASF LU 103793 Dolastain Oncology Shering Plough Caetyx Doxorubicin-Liposorne Ovarian Breast Cancer Lilly Gemzar Gemcitabine Pancreatic Cancer, Non Small Cell Lung Cancer, Breast, Bladder and Ovarian Zeneca ZD 0473. Anormed ZD O473. Anormed Platinum based NSCL, ovarian etc. Yamanouchi YM 116 YM 116 Prostate Cancer Nycomed Seeds/I-125 Rapid St Lodine Seeds Prostate Cancer Amersham Agouron Cokai colk2 inhibitors colkAfcdk2 inhibitors Solid Tumors Agouron PARP inhibitors PARP Inhibitors Solid Tumors Chiroscience D4809 Dexifosamide Solid Tumors Bristol Myers UFT (Tegafur/Uracil) UFT (Tegafur/Uracil) Solid Tumors Squib Sankyo Krestin Krestin Solid Tumors Asta Medica Ifex Mesnex Ifosamide Solid Tumors Bristol Meyers Ifex Mesnex Ifosamide Solid Tumors Squib Bristol Myers Vulmon Teniposide Solid Tumors Squib Bristol Myers Paraplatin Carboplatin Solid Tumors Squib Bristol Myers Plantinol Cisplatin, Stealth Solid Tumors Squib Bristol Myers Plantinol Cisplatin Solid Tumors Squib Bristol Myers Vepeside Etoposide Solid Tumors Melanoma Squib Zeneca ZD 9331 ZD 9331 Solid Tumors, Advanced Colorectal Chugai Taxotere Docetaxel Solid Tumors, Breast Cancer Rhone Poulenc Taxotere Docetaxel Solid Tumors, Breast Cancer GlaxoWelicome Prodrug of guanine Prodrug of arabinside T Cell Leukemia Lymphoma arabinside & B Cell Neoplasm Bristol Myers Taxane Analog Taxane Analog Taxol follow up Squib

In one embodiment, the methods of the invention use can respond in an antigen independent fashion or some immunostimulatory nucleic acids as a replacement to the use combination of these cells. A broad spectrum resistance to of IFNC. therapy in the treatment of cancer. Currently, some 55 infectious challenge is induced because the immune cells are treatment protocols call for the use of IFNC. Since IFNC. is in active form and are primed to respond to any invading produced following the administration of Some immuno compound or microorganism. The cells do not have to be stimulatory nucleic acids, these nucleic acids can be used to specifically primed against a particular antigen. This is generate IFNC, endogenously. 60 particularly useful in biowarfare, and the other circum The invention also includes a method for inducing antigen stances described above such as travelers. non-specific innate immune activation and broad spectrum The stimulation index of a particular immunostimulatory resistance to infectious challenge using the immunostimu nucleic acid can be tested in various immune cell assays. latory nucleic acids. The term antigen non-specific innate Preferably, the stimulation index of the immunostimulatory immune activation as used herein refers to the activation of 65 nucleic acid with regard to B cell proliferation is at least immune cells other than B cells and for instance can include about 5, preferably at least about 10, more preferably at least the activation of NK cells, T cells or other immune cells that about 15 and most preferably at least about 20 as determined US 7,271,156 B2 127 128 by incorporation of H uridine in a murine B cell culture, 1995, O'Hagan et al., 1994, Eldridge et al., 1989): Nucleic which has been contacted with 20 uM of nucleic acid for 20 acid vaccines (Fynan et al., 1993, Kuklin et al., 1997, Sasaki hat 37° C. and has been pulsed with 1 uCi of Huridine; and et al., 1998, Okada et al., 1997, Ishii et al., 1997); Polymers harvested and counted 4h later as described in detail in PCT (e.g. carboxymethylcellulose, chitosan) (Hamajima et al., Published Patent Applications PCT/US95/01570 (WO 1998, Jabbal-Gill et al., 1998); Polymer rings (Wyatt et al., 96/02555) and PCT/US97/19791 (WO 98/18810) claiming 1998); Proteosomes (Vancott et al., 1998, Lowell et al., priority to U.S. Ser. No. 08/386,063, now U.S. Pat. No. 1988, 1996, 1997); Sodium Fluoride (Hashi et al., 1998); 6,194,388, and Ser. No. 08/960,774, now U.S. Pat. No. Transgenic plants (Tacket et al., 1998, Mason et al., 1998, 6,239,116, filed on Feb. 7, 1995 and Oct. 30, 1997 respec Haq et al., 1995); Virosomes (Gluck et al., 1992, Mengiardi tively. For use in vivo, for example, it is important that the 10 et al., 1995, Cryz et al., 1998); Virus-like particles (Jiang et immunostimulatory nucleic acids be capable of effectively al., 1999, Leibl et al., 1998). Other delivery vehicles are inducing an immune response, such as, for example, anti known in the art and some additional examples are provided body production. below in the discussion of vectors. Immunostimulatory nucleic acids are effective in non The term effective amount of a immunostimulatory rodent vertebrate. Different immunostimulatory nucleic acid 15 nucleic acid refers to the amount necessary or Sufficient to can cause optimal immune stimulation depending on the realize a desired biologic effect. For example, an effective type of Subject and the sequence of the immunostimulatory amount of a immunostimulatory nucleic acid for inducing nucleic acid. Many vertebrates have been found according to mucosal immunity is that amount necessary to cause the the invention to be responsive to the same class of immu development of IgA in response to an antigen upon exposure nostimulatory nucleic acids, sometimes referred to as human to the antigen, whereas that amount required for inducing specific immunostimulatory nucleic acids. Rodents, how systemic immunity is that amount necessary to cause the ever, respond to different nucleic acids. As shown herein an development of IgG in response to an antigen upon exposure immunostimulatory nucleic acid causing optimal stimula to the antigen. Combined with the teachings provided tion in humans may not generally cause optimal stimulation herein, by choosing among the various active compounds in a mouse and vice versa. An immunostimulatory nucleic 25 and weighing factors such as potency, relative bioavailabil acid causing optimal stimulation in humans often does, ity, patient body weight, severity of adverse side-effects and however, cause optimal stimulation in other animals such as preferred mode of administration, an effective prophylactic cow, horses, sheep, etc. One of skill in the art can identify or therapeutic treatment regimen can be planned which does the optimal nucleic acid sequences useful for a particular not cause substantial toxicity and yet is entirely effective to species of interest using routine assays described herein 30 treat the particular subject. The effective amount for any and/or known in the art, using the guidance Supplied herein. particular application can vary depending on Such factors as The immunostimulatory nucleic acids may be directly the disease or condition being treated, the particular immu administered to the subject or may be administered in nostimulatory nucleic acid being administered, the antigen, conjunction with a nucleic acid delivery complex. A nucleic the size of the subject, or the severity of the disease or acid delivery complex shall mean a nucleic acid molecule 35 condition. One of ordinary skill in the art can empirically associated with (e.g. ionically or covalently bound to; or determine the effective amount of a particular immuno encapsulated within) a targeting means (e.g. a molecule that stimulatory nucleic acid and/or antigen and/or other thera results in higher affinity binding to target cell (e.g., B cell peutic agent without necessitating undue experimentation. Surfaces and/or increased cellular uptake by target cells). Subject doses of the compounds described herein for Examples of nucleic acid delivery complexes include 40 mucosal or local delivery typically range from about 0.1 ug nucleic acids associated with a sterol (e.g. cholesterol), a to 10 mg per administration, which depending on the appli lipid (e.g. a cationic lipid, Virosome or liposome), or a target cation could be given daily, weekly, or monthly and any cell specific binding agent (e.g. a ligand recognized by target other amount of time therebetween. More typically mucosal cell specific receptor). Preferred complexes may be suffi or local doses range from about 10 ug to 5 mg per admin ciently stable in vivo to prevent significant uncoupling prior 45 istration, and most typically from about 100 ug to 1 mg, with to internalization by the target cell. However, the complex 2-4 administrations being spaced days or weeks apart. More can be cleavable under appropriate conditions within the cell typically, immune stimulant doses range from 1 g to 10 mg so that the nucleic acid is released in a functional form. per administration, and most typically 10 ug to 1 mg, with Delivery vehicles or delivery devices for delivering anti daily or weekly administrations. Subject doses of the com gen and nucleic acids to Surfaces have been described. The 50 pounds described herein for parenteral delivery for the Immunostimulatory nucleic acid and/or the antigen and/or purpose of inducing an antigen-specific immune response, other therapeutics may be administered alone (e.g., in saline wherein the compounds are delivered with an antigen but or buffer) or using any delivery vehicles known in the art. not another therapeutic agent are typically 5 to 10,000 times For instance the following delivery vehicles have been higher than the effective mucosal dose for vaccine adjuvant described: Cochleates (Gould-Fogerite et al., 1994, 1996); 55 or immune stimulant applications, and more typically 10 to Emulsomes (Vancott et al., 1998, Lowell et al., 1997); 1,000 times higher, and most typically 20 to 100 times ISCOMs (Mowat et al., 1993, Carlsson et al., 1991, Hu et., higher. Doses of the compounds described herein for 1998, Morein et al., 1999); Liposomes (Childers et al., 1999, parenteral delivery for the purpose of inducing an innate Michalek et al., 1989, 1992, de Haan 1995a, 1995b): Live immune response or for increasing ADCC or for inducing an bacterial vectors (e.g., Salmonella, Escherichia coli, Bacil 60 antigen specific immune response when the immunostimu lus calmatte-guerin, Shigella, Lactobacillus) (Hone et al., latory nucleic acids are administered in combination with 1996, Pouwels et al., 1998, Chatfield et al., 1993, Stover et other therapeutic agents or in specialized delivery vehicles al., 1991, Nugent et al., 1998); Live viral vectors (e.g., typically range from about 0.1 ug to 10 mg per administra Vaccinia, adenovirus, Herpes Simplex) (Gallichan et al., tion, which depending on the application could be given 1993, 1995, Moss et al., 1996, Nugent et al., 1998, Flexner 65 daily, weekly, or monthly and any other amount of time et al., 1988, Morrow et al., 1999); Microspheres (Gupta et therebetween. More typically parenteral doses for these al., 1998, Jones et al., 1996, Maloy et al., 1994, Moore et al., purposes range from about 10 ug to 5 mg per administration, US 7,271,156 B2 129 130 and most typically from about 100 ug to 1 mg, with 2-4 Pharmaceutical preparations which can be used orally administrations being spaced days or weeks apart. In some include push-fit capsules made of gelatin, as well as Soft, embodiments, however, parenteral doses for these purposes sealed capsules made of gelatin and a plasticizer, Such as may be used in a range of 5 to 10,000 times higher than the glycerol or Sorbitol. The push-fit capsules can contain the typical doses described above. active ingredients in admixture with filler such as lactose, For any compound described herein the therapeutically binders such as starches, and/or lubricants such as talc or effective amount can be initially determined from animal magnesium Stearate and, optionally, stabilizers. In soft cap models. A therapeutically effective dose can also be deter Sules, the active compounds may be dissolved or Suspended mined from human data for CpG oligonucleotides which in Suitable liquids, such as fatty oils, liquid paraffin, or liquid have been tested in humans (human clinical trials have been 10 polyethylene glycols. In addition, stabilizers may be added. initiated) and for compounds which are known to exhibit Microspheres formulated for oral administration may also be similar pharmacological activities, such as other mucosal used. Such microspheres have been well defined in the art. adjuvants, e.g., LT and other antigens for vaccination pur All formulations for oral administration should be in dos poses, for the mucosal or local administration. Higher doses ages Suitable for Such administration. are required for parenteral administration. The applied dose 15 For buccal administration, the compositions may take the can be adjusted based on the relative bioavailability and form of tablets or lozenges formulated in conventional potency of the administered compound. Adjusting the dose a. to achieve maximal efficacy based on the methods described For administration by inhalation, the compounds for use above and other methods as are well-known in the art is well according to the present invention may be conveniently within the capabilities of the ordinarily skilled artisan. delivered in the form of an aerosol spray presentation from The formulations of the invention are administered in pressurized packs or a nebulizer, with the use of a suitable pharmaceutically acceptable solutions, which may routinely propellant, e.g., dichlorodifluoromethane, trichlorofluo contain pharmaceutically acceptable concentrations of salt, romethane, dichlorotetrafluoroethane, carbon dioxide or buffering agents, preservatives, compatible carriers, adju other suitable gas. In the case of a pressurized aerosol the vants, and optionally other therapeutic ingredients. 25 dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g. For use in therapy, an effective amount of the immuno gelatin for use in an inhaler or insufflator may be formulated stimulatory nucleic acid can be administered to a subject by containing a powder mix of the compound and a suitable any mode that delivers the nucleic acid to the desired powder base Such as lactose or starch. Surface, e.g., mucosal, systemic. Administering the pharma 30 The compounds, when it is desirable to deliver them ceutical composition of the present invention may be accom systemically, may be formulated for parenteral administra plished by any means known to the skilled artisan. Preferred tion by injection, e.g., by bolus injection or continuous routes of administration include but are not limited to oral, infusion. Formulations for injection may be presented in unit parenteral, intramuscular, intranasal, intratracheal, inhala dosage form, e.g., in ampoules or in multi-dose containers, tion, ocular, vaginal, and rectal. 35 with an added preservative. The compositions may take Such For oral administration, the compounds (i.e., immuno forms as Suspensions, Solutions or emulsions in oily or stimulatory nucleic acids, antigens and other therapeutic aqueous vehicles, and may contain formulatory agents such agents) can be formulated readily by combining the active as Suspending, stabilizing and/or dispersing agents. compound(s) with pharmaceutically acceptable carriers well Pharmaceutical formulations for parenteral administra known in the art. Such carriers enable the compounds of the 40 tion include aqueous solutions of the active compounds in invention to be formulated as tablets, pills, dragees, cap water-soluble form. Additionally, suspensions of the active Sules, liquids, gels, syrups, slurries, Suspensions and the like, compounds may be prepared as appropriate oily injection for oral ingestion by a subject to be treated. Pharmaceutical suspensions. Suitable lipophilic solvents or vehicles include preparations for oral use can be obtained as Solid excipient, fatty oils such as sesame oil, or synthetic fatty acid esters, optionally grinding a resulting mixture, and processing the 45 Such as ethyl oleate or triglycerides, or liposomes. Aqueous mixture of granules, after adding Suitable auxiliaries, if injection Suspensions may contain Substances which desired, to obtain tablets or dragee cores. Suitable excipients increase the viscosity of the Suspension, such as sodium are, in particular, fillers such as Sugars, including lactose, carboxymethyl cellulose, sorbitol, or dextran. Optionally, Sucrose, mannitol, or Sorbitol; cellulose preparations such the Suspension may also contain Suitable stabilizers or as, for example, maize starch, wheat starch, rice starch, 50 agents which increase the Solubility of the compounds to potato starch, gelatin, gum tragacanth, methyl cellulose, allow for the preparation of highly concentrated solutions. hydroxypropylmethyl-cellulose, sodium carboxymethylcel Alternatively, the active compounds may be in powder lulose, and/or polyvinylpyrrolidone (PVP). If desired, dis form for constitution with a suitable vehicle, e.g., sterile integrating agents may be added, such as the cross-linked pyrogen-free water, before use. polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof 55 The compounds may also be formulated in rectal or Such as Sodium alginate. Optionally the oral formulations vaginal compositions such as Suppositories or retention may also be formulated in saline or buffers for neutralizing enemas, e.g., containing conventional Suppository bases internal acid conditions or may be administered without any Such as cocoa butter or other glycerides. carriers. In addition to the formulations described previously, the Dragee cores are provided with suitable coatings. For this 60 compounds may also be formulated as a depot preparation. purpose, concentrated Sugar Solutions may be used, which Such long acting formulations may be formulated with may optionally contain gum arabic, talc, polyvinyl pyrroli Suitable polymeric or hydrophobic materials (for example as done, carbopol gel, polyethylene glycol, and/or titanium an emulsion in an acceptable oil) or ion exchange resins, or dioxide, lacquer Solutions, and Suitable organic solvents or as sparingly soluble derivatives, for example, as a sparingly solvent mixtures. Dyestuffs or pigments may be added to the 65 soluble salt. tablets or dragee coatings for identification or to characterize The pharmaceutical compositions also may comprise Suit different combinations of active compound doses. able solid or gel phase carriers or excipients. Examples of US 7,271,156 B2 131 132 Such carriers or excipients include but are not limited to efficacy. The methods of this invention, generally speaking, calcium carbonate, calcium phosphate, various Sugars, may be practiced using any mode of administration that is starches, cellulose derivatives, gelatin, and polymers such as medically acceptable, meaning any mode that produces polyethylene glycols. effective levels of an immune response without causing Suitable liquid or solid pharmaceutical preparation forms clinically unacceptable adverse effects. Preferred modes of are, for example, aqueous or saline solutions for inhalation, administration are discussed above. microencapsulated, encochleated, coated onto microscopic The compositions may conveniently be presented in unit gold particles, contained in liposomes, nebulized, aerosols, dosage form and may be prepared by any of the methods pellets for implantation into the skin, or dried onto a sharp well known in the art of pharmacy. All methods include the object to be scratched into the skin. The pharmaceutical 10 step of bringing the compounds into association with a compositions also include granules, powders, tablets, coated carrier which constitutes one or more accessory ingredients. tablets, (micro)capsules, suppositories, syrups, emulsions, In general, the compositions are prepared by uniformly and Suspensions, creams, drops or preparations with protracted intimately bringing the compounds into association with a release of active compounds, in whose preparation excipi liquid carrier, a finely divided solid carrier, or both, and then, ents and additives and/or auxiliaries such as disintegrants, 15 if necessary, shaping the product. Liquid dose units are vials binders, coating agents, Swelling agents, lubricants, flavor or ampoules. Solid dose units are tablets, capsules and ings, Sweeteners or Solubilizers are customarily used as Suppositories. For treatment of a patient, depending on described above. The pharmaceutical compositions are Suit activity of the compound, manner of administration, purpose able for use in a variety of drug delivery systems. For a brief of the immunization (i.e., prophylactic or therapeutic), review of methods for drug delivery, see Langer, Science nature and severity of the disorder, age and body weight of 249:1527-1533, 1990, which is incorporated herein by ref the patient, different doses may be necessary. The adminis CCC. tration of a given dose can be carried out both by single The immunostimulatory nucleic acids and optionally administration in the form of an individual dose unit or else other therapeutics and/or antigens may be administered per several smaller dose units. Multiple administration of doses se (neat) or in the form of a pharmaceutically acceptable salt. 25 at specific intervals of weeks or months apart is usual for When used in medicine the salts should be pharmaceutically boosting the antigen-specific responses. acceptable, but non-pharmaceutically acceptable salts may Other delivery systems can include time-release, delayed conveniently be used to prepare pharmaceutically accept release or Sustained release delivery systems. Such systems able salts thereof. Such salts include, but are not limited to, can avoid repeated administrations of the compounds, those prepared from the following acids: hydrochloric, 30 increasing convenience to the Subject and the physician. hydrobromic, Sulphuric, nitric, phosphoric, maleic, acetic, Many types of release delivery systems are available and salicylic, p-toluene sulphonic, tartaric, citric, methane sul known to those of ordinary skill in the art. They include phonic, formic, malonic, Succinic, naphthalene-2-Sulphonic, polymer base systems such as poly(lactide-glycolide), and benzene Sulphonic. Also, Such salts can be prepared as copolyoxalates, polycaprolactones, polyesteramides, poly alkaline metal or alkaline earth salts, such as Sodium, 35 orthoesters, polyhydroxybutyric acid, and polyanhydrides. potassium or calcium salts of the carboxylic acid group. Microcapsules of the foregoing polymers containing drugs Suitable buffering agents include: acetic acid and a salt are described in, for example, U.S. Pat. No. 5,075,109. (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and Delivery systems also include non-polymer systems that are: a salt (0.5-2.5% w/v); and phosphoric acid and a salt lipids including sterols such as cholesterol, cholesterol esters (0.8-2% w/v). Suitable preservatives include benzalkonium 40 and fatty acids or neutral fats such as mono-di-and tri chloride (0.003-0.03% w/v); chlorobutanol (0.3-0.9% w/v); glycerides; hydrogel release systems; Sylastic systems; pep parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% tide based systems; wax coatings; compressed tablets using w/v). conventional binders and excipients; partially fused The pharmaceutical compositions of the invention contain implants; and the like. Specific examples include, but are not an effective amount of a Immunostimulatory nucleic acid 45 limited to: (a) erosional systems in which an agent of the and optionally antigens and/or other therapeutic agents invention is contained in a form within a matrix Such as optionally included in a pharmaceutically-acceptable carrier. those described in U.S. Pat. Nos. 4,452,775, 4,675,189, and The term pharmaceutically-acceptable carrier means one or 5,736,152, and (b) diffusional systems in which an active more compatible Solid or liquid filler, diluents or encapsu component permeates at a controlled rate from a polymer lating Substances which are suitable for administration to a 50 such as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and human or other vertebrate animal. The term carrier denotes 5,407,686. In addition, pump-based hardware delivery sys an organic or inorganic ingredient, natural or synthetic, with tems can be used, some of which are adapted for implanta which the active ingredient is combined to facilitate the tion. application. The components of the pharmaceutical compo The present invention is further illustrated by the follow sitions also are capable of being commingled with the 55 ing Examples, which in no way should be construed as compounds of the present invention, and with each other, in further limiting. The entire contents of all of the references a manner Such that there is no interaction which would (including literature references, issued patents, published Substantially impair the desired pharmaceutical efficiency. patent applications, and co-pending patent applications) The immunostimulatory nucleic acids useful in the inven cited throughout this application are hereby expressly incor tion may be delivered in mixtures with additional adjuvant 60 porated by reference. (s), other therapeutics, or antigen?s). A mixture may consist of several adjuvants in addition to the Immunostimulatory EXAMPLES nucleic acid or several antigens or other therapeutics. A variety of administration routes are available. The Materials and Methods: particular mode selected will depend, of course, upon the 65 Oligodeoxynucleotides: Native phosphodiester and phos particular adjuvants or antigen selected, the particular con phorothioate-modified ODN were purchased from Operon dition being treated and the dosage required for therapeutic Technologies (Alameda, Calif.) and Hybridon Specialty US 7,271,156 B2 133 134 Products (Milford, Mass.). ODN were tested for endotoxin tion whereas the same T-rich ODN with the CpG motifs using the LAL-assay (LAL-assay BioWhittaker, Walkers methylated (non-CpG), 1979 (SEQ ID NO. 222), induces ville, Md.: lower detection limit 0.1 EU/ml). For in vitro lower, but still increased over background, activity (only assays, ODN were diluted in TE-buffer (10 mM Tris, pH 7.0, 18,618 counts) at the same concentration of 0.6 ug/ml. The 1 mM EDTA), and stored at -20° C. For in vivo use, ODN reduced proliferation at higher ODN concentrations may be were diluted in phosphate buffered saline (0.1 M PBS, pH an artifact of the cells becoming exhausted under these 7.3) and stored at 4°C. All dilutions were carried out using experimental conditions or could reflect some toxicity of the pyrogen-free reagents. higher ODN concentrations. Interestingly, shorter ODN con Isolation of human PBMC and cell culture: Peripheral taining CpG motifs, such as the 13-14 mers 2015 and 2016, blood mononuclear cells (PBMC) were isolated from 10 are less stimulatory despite the fact that their molar concen peripheral blood of healthy volunteers by Ficoll-Paque den tration would actually be higher since the ODNs were added sity gradient centrifugation (Histopaque-1077, Sigma on the basis of mass rather than molarity. This demonstrates Chemical Co., St. Louis, Mo.) as described (Hartmann et al., that ODN length may also be an important determinant in 1999 Proc. Natl. Acad. Sci USA 96:9305-10). Cells were the immune effects of the ODN. A non-CpG ODN but slight suspended in RPMI 1640 culture medium supplemented 15 T-rich ODN (about 30%T), 1982 (SEQID NO. 225), caused with 10% (v/v) heat-inactivated (56°C., 1 h) FCS (HyClone, only a small amount of background cell proliferation. Logan, Utah), 1.5 mM L-glutamine, 100 U/ml penicillin and 100 ug/ml streptomycin (all from Gibco BRL Grand Island, TABLE F N.Y.) (complete medium). Cells (final concentration 1x10 cells/ml) were cultured in complete medium in a 5% CO Oligo Concentration humidified incubator at 37° C. ODN and LPS (from Salmo ODNii 0.15 g/ml 0.6 g/ml 2 Lig/ml nella typhimurium, Sigma Chemical Co., St. Louis, Mo.) or anti-IgM were used as stimuli. For measurement of human Cues only 648 837 799 1840 S744 56,603 31,787 NK lytic activity, PBMC were incubated at 5x10/well in (SEQ ID NO. 83) 24-well plates. Cultures were harvested after 24 hours, and 25 2016 768 46O7 20,497 cells were used as effectors in a standard 4 hours 'Cr (SEQ ID NO. 256) release assay against K562 target cells as previously 1979 971 18,618 29,246 (SEQ ID NO. 222) described (Ballas et al., 1996 J. Immunol. 157: 1840-1845). 1892 787 10,078 22,850 For B cell proliferation, 1 uCi of H thymidine was added 18 (SEQ ID NO. 135) hours before harvest, and the amount of H thymidine 30 2010 849 20,741 8,054 incorporation was determined by Scintillation counting at (SEQ ID NO. 250) 2012 2586 62.955 52.462 day 5. Standard deviations of the triplicate wells were <5%. (SEQ ID NO. 252) Flow cytometry on human PBMC: Surface antigens on 2013 1043 47,960 47,231 primate PBMC were stained as previously described (Hart (SEQ ID NO. 253) mann et al., 1998 J. Pharmacol. Exp. Ther. 285:920-928). 35 2014 2700 50,708 46,625 (SEQ ID NO. 254) Monoclonal antibodies to CD3 (UCHT1), CD14 (M5E2), 2015 1059 23,239 36,119 CD19 (B43), CD56 (B159), CD69 (FN50) and CD86 (2331 (SEQ ID NO. 255) FUN-1) were purchased from Pharmingen, San Diego, Calif. IgG.K. (MOPC-21) and IgG-K (Hartmann et al., 1999 Proc. Natl. Acad. Sci USA96:9305-10) were used to 40 Numbers represent cpm of H-thymidine incorporation control for non-specific staining. NK cells were identified by for cultures of human PBMCs set up as described above. CD56 expression on CD3, CD14 and CD19 negative cells, whereas B cells were identified by expression of CD19. Example 2 Flow cytometric data of 10000 cells per sample were acquired on a FACScan (Beckton Dickinson Immunocytom 45 Concentration-dependent Activation of Human NK etry Systems, San Jose, Calif.). The viability of cells within Cell Activity with Thymidine-Rich ODN the FSC/SSC gate used for analysis was examined by propidium iodide staining (2 g/ml) and found to be higher Human PBMCs were cultured for 24 hours with a panel than 98%. Data were analyzed using the computer program of different CpG or non-CpG ODN at two different concen FlowJo (version 2.5.1, Tree Star, Inc., Stanford, Calif.). 50 trations, and then tested for their ability to kill NK target Results: cells as described previously (Ballas et al., 1996 J. Immunol. 157: 1840-1845). Killing is measured as lytic units, or L.U. Example 1 The human donor used in this experiment had a background level of 3.69 L.U. which increased to 180.36 L.U. using the CpG-dependent Stimulation of Human B Cells 55 positive control, IL-2. A CpG oligo, 2006 (SEQ ID NO. Depends on Methylation and ODN Length 246), induced high levels of NK lytic function at a low concentration of 0.6, and a lower level at a concentration of Human PBMC were obtained from normal donors and 6.0. Surprisingly, a T-rich ODN in which the CpG motifs of cultured for five days at 2x10 cells/well with the indicated 2006 were methylated (ODN at 2117 (SEQ ID NO. 358)) or concentrations of the indicated ODN sequences. As shown 60 inverted to GpCs (ODN 2137 (SEQ ID NO. 886)) retained in Table F, human PBMCs proliferate above the background strong immune stimulatory function at the higher ODN when cultured with a variety of different CpG ODN, but also concentrations, as shown in Table G. These concentration show some proliferation even with ODN that do not contain dependent immune stimulatory effects are not a general any CpG motifs. The importance of unmethylated CpG property of the phosphorothioate backbone since the experi motifs in providing optimal immune stimulation with these 65 ments described below demonstrate that a poly-AODN, is ODN is demonstrated by the fact that ODN 1840 (SEQ ID nonstimulatory above background levels. Some stimulation NO. 83) induces 56,603 counts of H-thymidine incorpora is seen with a 24-base long ODN in which all of the base US 7,271,156 B2 135 136 positions are randomized so that A, C, G, and T will occur at a frequency of 25% in each of the base positions (ODN TABLE G-continued 2182 (SEQID NO.432)). However, the stimulatory effect of HUMAN PBL CULTURED OVERNIGHT WITH OLIGOS such a 24-base ODN is greatly enhanced if it is pure poly-T, + 2141 (0.6 2.63 6.34 10.21 17.73 30.93 43.57 429 in which case stimulation is also seen at the lowest concen ug/ml) + 2141 (6.0 4.98. 15.3O 25.22 37.88 58.47 69.12 14.83 tration of 0.6 ug/ml (ODN 2183 (SEQID NO. 433)). In fact, ug/ml) the stimulatory activity of ODNSEQID NO. 433 at this low + 2142 (0.6 3.18 3.66 6.99 14.62. 19.68 32.52 1.56 concentration is higher than that of any other ODN tested at ug/ml) this low concentration, aside from the optimal human + 2142 (6.0 7.08 15.8O 25.6S 41.72 68.09 73.14 17.11 10 ug/ml) immune stimulatory ODN of SEQ ID NO. 246. In fact, the + 2143 (0.6 4.12 6.90 10.77 22.96 35.78 42.94 S.19 higher concentration of ODN SEQ ID NO. 433 stimulated ug/ml) more NK activity than any other phosphorothioate ODN + 2143 (6.0 3.16 8.40 12.38 21.69 34.80 54.21 6.64 ug/ml) except for the strong CpG ODN 2142 (SEQ ID NO. 890), + 2159 (6.0 S.OS 11.76 21.67 41.12 S1.68 65.47 13.19 which was marginally higher. If the G content of ODNSEQ 15 ug/ml) + 2132 (6.0 4.23 6.06 10.50 18.74 32.68 44.06 4.61 ID NO. 246 is increased relative to the T content by addition ug/ml) of more Gs, thus resulting in a decrease in the proportion of + 2179 (6.0 6.14 949 21.06 42.48 60.12 7187 14.54 T nucleotides the immune stimulatory effect of the ODN is ug/ml) reduced (see ODN 2132 (SEQ ID NO. 373)). Thus, the T + 2180 (6.0 2.37 8.57 15:44, 29.66 44.3S 61.31 9.47 ug/ml) content of an ODN is an important determinant of its + 2133 (6.0 6.53 12.58 231O 38.03 61.16 68.36 14.62 immune stimulatory effect. Although a poly-T ODN is the ug/ml) most stimulatory of the non-CpG ODN, other bases are also + 2134 (6.0 7.51 12.14 21.14 32.46 54.47 67.12 12.98 ug/ml) important in determining the immune stimulatory effect of a + 2184 (6.0 S.22 9.19 17.54 30.76 45.3S 63.SS 10.42 non-CpG ODN. ODN 2131 (SEQ ID NO. 372), in which ug/ml) slightly more than half of the bases are T and in which there 25 + 2185 (6.0 8.11 1477 26.27 40.31 S5.61 70.6S 15.60 ug/ml) are no Gs, is immune stimulatory at a concentration of 6 + 2116 (6.0 S.S8 10.54 16.77 37.82 S9.8O 66.33 13.07 ug/ml but has less activity than other T-rich ODN. If the 6 ug/ml) As in ODN 2131 (SEQID NO. 372) are replaced by 6 Gs, + 2181 (6.0 4.43 9.85 17.SS 27.OS 53.16 69.16 1.43 the immune stimulatory effect of the ODN can be increased ug/ml) 30 + 2130 (6.0 3.81 8.07 17:11 27.17 42.04 S3.73 8.27 (see ODN 2130 (SEQ ID NO. 371)). ug/ml) + 2131 (6.0 2.29 6.73 7.30 18.02 32.73 49.06 S.08 TABLE G ug/ml) + 2156 (0.3 2.50 S.26 8.20 15.9S 26.64 33.07 2.31 HUMAN PBL CULTURED OVERNIGHT WITH OLIGOS ug/ml) 35 + 2156 (1.0 5.91 10.99 17.31, 26.97 SO.64 63.78 10.84 MR 36OS ug/ml) SR 256 + 2157 (0.3 2.36 4.OO 6.65 12.94 24.13 38.86 2.58 % SR 7.11 ug/ml) EFFECTOR O.63 1.25 2SO S.OO 10.OO 20.00 + 2157 (1.0 3.72 9.55 17.15 34.55 52.27 65.33 11.58 CONTROL RM) L.U. ug/ml) ALONE 2.65 S.45 10.15 17.6S 29.92 39.98 3.69 + 2158 (0.3 1.25 236 6.90 16.39 15.63 29.82 1.17 + IL2 (100 U/ml) 35.95 57.66 86.26 100.39 99.71 93.64 180.36 40 ug/ml) + 1585 (0.6 3.75 6.10 12.14 23.70 36.06 43.98 S.48 + 2158 (1.0 4.73 7.26 11.07 15.SS 30.80 43.71 4.16 ugml) ug/ml) + 1585 (6.0 1542 31.09 47.07 73.34 94.29 97.73 35.85 + 2118 (0.6 1.SS 3.38 6.8S 13.36 20.1S 27.71 1.13 ugml) ug/ml) + 2006 (0.6 6.71 15.99 26.92 44.75 64.12 68.83 16.96 + 2118 (6.0 26S 3.88 9.29 12.19 22.47 28.99 1.34 ugml) 45 ug/ml) + 2006 (6.0 6.19 8.18 16.13 24.3S 39.35 S6.07 8.04 ugml) + 2117 (0.6 4.54 4.73 9.56 18.04 28.57 39.85 3.49 ugml) + 2117 (6.0 7.03 10.76 16.90 30.59 S2.14 S946 10.96 Example 3 ugml) 50 + 2137 (0.6 4.61 S.3S 10.04 15.16 23.79 37.86 2.57 Induction of B Cell Proliferation by T-rich ugml) Non-CpG ODN + 2137 (6.0 7.99 10.37 16.5S 32.32 49.78 60.3O 11.01 ugml) + 2178 (0.6 2.88 452 11.47 16.OS 24.8S 34.27 2.37 To assess the ability of T-rich ODN to activate B cell ugml) 55 proliferation, human PBMCs were stained with the cyto + 2178 (6.0 4.2.1 5.03 11.16 16.39 28.22 36.45 2.94 ugml) plasmic dye CSFE, incubated with five days with the indi + 2182 (0.6 2.42 6.57 10.49 19.73 26.5S 35.30 2.89 cated ODN at either 0.15 or 0.3 ug/ml, and then analyzed by ugml) flow cytometry. B cells were identified by gating on cells + 2182 (6.0 4.11 7.98. 14.60 26.56 40.40 51.98 7.59 ugml) positive for the lineage marker CD19). CpG ODN 2006 was + 2183 (0.6 3.73 8.46 1552 24.48 37.78 S6.77 7.8O 60 a strong inducer of B cell proliferation, and this effect was ugml) reduced if the CpG motifs were methylated or inverted to + 2183 (0.6 8.86 12.89 23.08 41.49 66.26 7S,8S 16.57 GpC as shown in FIG. 1 at an ODN concentration of 0.3 ugml) ug/ml. The base composition of the ODN appears to be + 2140 (0.6 3.78 S.27 12.30 20.79 35.7S 45.62 S.40 ugml) important in determining the immune stimulatory effect. + 2140 (6.0 6.56 13.24. 21.26 37.96 60.80 73.OS 14.82 65 Reducing the T content of an ODN substantially reduces ugml) immune stimulatory effect, as exemplified by ODN 2177 (SEQID NO. 427) in which 6 of the Ts present in ODN2137 US 7,271,156 B2 137 138 (SEQ ID NO. 886) have been switched to A's, resulting in ited a stimulation of NK activity compared to ODN 2188 a greatly reduced immune stimulatory effect. The impor (SEQ ID NO. 905) or ODN 2189 (SEQ ID NO. 906). tance of Ts in the immune stimulatory effect of an ODN is also shown by comparison of ODN 2116 (SEQ ID NO. 357) Examples 6-8 and 2181 (SEQ ID NO. 431), which differ in the 3' end of 5 the ODN. ODN 2181, in which the 3' end is poly-T is more Introduction: stimulatory than ODN 2116, in which the 3' end is poly-C, Above, we demonstrated that Poly T sequences are able to despite the fact that both ODN have a TCGTCG at the 5' enhance stimulation of Band NK cells. Here and below we end. investigate the effect of a variety of non-CpGT-rich ODN as 10 well as Poly CODN for their ability to stimulate human B Example 4 cells, NK cells and monocytes. Materials and Methods: B Cell Proliferation Induced by TG Oligonucleotides: Phosphorothioate-modified ODN were Oligonucleotides purchased from ARK Scientific GmbH (Darmstadt, Ger 15 many). The sequences used were: 1982: 5'-tccaggacttctict The stimulatory effects of TG motifs are shown in FIG. 2. caggtt-3' (SEQ ID NO.: 225), 2006: ODN 2137 has the identical base composition as ODN 2006, 5'-tcgtcgttttgtcgttttgtcgtt-3' (SEQ ID NO. 246), 2041: but the CG motifs have all been inverted to GC’s resulting 5'-ctggtctttctggttttitttctgg-3' (SEQ ID NO. 282), 21 17: in a CG-free nucleic acid. ODN does however contain 6 TG 5'-tzgtzgttttgtgtzgttttgtzgtt-3' (SEQ ID NO. 358), 2137: dinucleotides. In ODN 2177, all the TG dinucleotides of 5'-tgctgcttttgtgcttttgtgctt-3' (SEQ ID NO.: 886), 2183: ODN 2137 have been changed to AG. Although ODN 2177 5'-tttittttitttittttitttitt-3' (SEQ ID NO. 433), 21.94: contains only 6 adenines, it is virtually nonstimulatory at a 5'-tttittttitttittttitttitttittttittt-3' (SEQ ID NO.: 911), 2196: concentration of 0.2 g/ml. For comparison, an ODN 24 5'-tttitttitttitttittttitt-3' (SEQ ID NO. 913), 5126: 5'-ggttcttittg bases in length in which each position is randomized to be gtccttgtct-3' (SEQ ID NO.: 1058), 5162: any of the four bases (ODN 2182) induces >12% of B cells 25 5'-tttittttitttittttitttitttittttitttttt-3' (SEQ ID NO.: 1094), 5163: to proliferate at a concentration of 0.2 ug/ml. These results 5'-aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa-3' (SEQID NO.: 1095), indicate that the stimulatory effects of ODN 2137 are not 5168: 5'-cccccccccccccccccccccccccccccc-3' (SEQID NO.: simply those of a phosphorothioate backbone, but relate to 1096) and 5169: 5'-cycgc.gc.gcgc.gc.gcgc.gc.gcgc.gc.gcgcg-3' the presence of TG dinucleotides. (SEQ ID NO.: 1097). Most ODN were tested for LPS In order to determine the effect of varying the number of 30 content using the LAL assay (BioWhittaker, Belgium) TG dinucleotide motifs, ODN 2200 and ODN 2202 were (lower detection limit 0.1 EU/ml) also described herein. For compared, as shown in FIG. 2. Both ODN contain 18 Ts and all assays ODN were diluted in TE buffer and stored at -20° 6 Gs, but in ODN 2200 all of the Gs are consecutive, so that C. All dilutions were conducted using pyrogen-free reagents. there is only one TG dinucleotide, whereas in ODN 2202, Cell preparation and cell culture: Human PBMC were the Gs are split up as GG dinucleotides throughout the ODN 35 isolated from peripheral blood of healthy volunteers, so that there are three TGs. ODN 2202 is significantly more obtained by the German Red Cross (Ratingen, Germany), as stimulatory than ODN 2200, consistent with the model that described above in Example 1, but all material were pur at least three TG motifs in an ODN are required for optimal chased from Life Technologies, Germany and were endot stimulatory activity. It is likely that even higher levels of oxin-tested. For the B cell, NK cell and monocyte activation stimulation could be achieved if the TG motifs had been 40 assays PBMC were cultured in complete medium at a optimized as taught herein. concentration of 2x10 cells/ml in 200 ul in 96 round bottom plates in a humidified incubator at 37° C. Different ODNs, Example 5 LPS (Sigma) or IL-2 (R&D Systems, USA) were used as stimuli. At the indicated time points, cells were harvested for Effects of TTG Versus TTG Motifs 45 flow cytometry. Flow cytometry: MAbs used for staining of surface anti FIG. 3 shows the results of experiments conducted to gens were: CD3, CD14, CD19, CD56, CD69, CD80 and study TG content in terms of the relative levels of Ts versus CD86 (all obtained from Pharmingen/Becton Dickinson, Gs as it relates to the stimulatory effect of an ODN. The Germany). For monocytes Fc receptors were blocked using Figure shows that an ODN in which all of the bases are 50 human IgG (Myltenyi, Germany) as previously described randomized to be either T or G (ODN 2188 (SEQ ID NO. (Bauer, M. K. Heeg, H. Wagner, and G. B. Lipford. 1999. 905)) is nonstimulatory at a concentration of 0.2 g/ml. DNA activates human immune cells through a CpG similar to an ODN in which all of the bases are randomized sequence dependent manner. Immunology 97.699). Flow to be either A or G (ODN 2189 (SEQ ID NO. 906)). cytometric data of at least 1000 cells of a specified sub However, at the higher concentration of 2 ug/ml, the ran 55 population (B cells, monocytes, NK cells, NKT cells or T domized T/G ODN 2188 is significantly more stimulatory. cells) were acquired on a FACSCalibur (Becton Dickinson). This latter level of stimulation is still lower than that which Data were analyzed using the program CellOuest (Becton occurs with a totally randomized ODN (ODN 2182 (SEQID Dickinson). NO. 432)). The highest stimulation at low concentrations is NK-mediated cytotoxicity: PBMC were cultured over seen with an ODN in which half of the bases are fixed at T 60 night with or without 6 g/ml ODN or 100U/ml IL-2 at 37° and the other half of the bases are randomized to be either C., 5% CO. The next morning, K-562 target cells were T or G (ODN 2190 (SEQ ID NO. 907)). Since every other labeled with a fluorescent dye, CFSE, as described previ base is fixed to be a T, there cannot be any TG motifs. The ously for human B cells (Hartmann, G., and A. M. Krieg. data in FIG. 3 show that increasing the TG content of an 2000. Mechanism and function of a newly identified CpG ODN improves its stimulatory activity. 65 DNA motif in human primary B cells.J. Immunol. 164:944). In yet other experiments, the results of which are not PBMC were added in different ratios (50:1, 25:1 and 12.5:1) diagrammed herein, ODN 2190 (SEQ ID NO. 907) exhib to 2x10 target cells and incubated for 4 h at 37° C. Cells US 7,271,156 B2 139 140 were harvested and incubated with the DNA-specific dye prisingly it was also discovered that Poly C sequences (SEQ 7-AAD (Pharmingen) for detection of apoptotic cells. ID NO.: 1096) can activate human B cells at least at high Results were measured by flow cytometry. concentrations (10 ug/ml) (FIG. 5). ELISA: PBMC (3x10 cells/ml) were cultured with the Two other T-rich ODNs, namely 1982 (SEQID NO. 225) specified concentrations of ODN or LPS for 24 h (IL-6, IFNY 5 and 2041 (SEQ ID NO. 282) lacking CpG motifs were and TNFC.) or 8 h (IL-1B) in 48 well plates in a humidified tested for their effect on human B cells. PBMC (n=2) were atmosphere at 37° C. Supernatants were collected and cytok incubated with the indicated concentrations of ODN 2006 ines were measured using OPTeia ELISA Kits (Pharmingen) (SEQ ID NO. 246), 1982 (SEQ ID NO.: 225) and 2041 for IL-6, IFNY and TNFC. or an Eli-pair ELISA assay (SEQ ID NO.: 282) as described above. B cell activation (Hoelzel, Germany) for IL-1B according to the manufacturer 10 (expression of the activation marker CD86) was measured protocols. by flow cytometry. FIG. 6 demonstrates that T-rich non-CpG ODN are immu Example 6 nostimulatory at concentrations higher than 1 g/ml. Incor poration of a CpG motif into 1982 enhanced the immuno B Cell Activation Induced by ODNs Lacking CpG 15 stimulatory activity. Elongation with a Poly T sequence did Motifs not enhance the immunostimulatory activity of this already T-rich ODN but rather, decreased the activation potential In the Experiments described above in Example 3, we slightly. demonstrate that T-rich ODN were capable of activating B cells. We expand those studies here using additional ODN Example 7 and different cell and reagent sources. In a first set of experiments, we compared the activation potential of dif Immunostimulation of Non-CpG ODNs is Reflected ferent non-CpG T-rich ODNs with the very potent known in the Enhancement of NK Activation, NK CpG ODN 2006 (SEQ ID NO.: 246). PBMC (2x10°cells/ Cytotoxicity and Monocyte Activation ml) of a blood donor (n=2) were incubated with the indicated 25 concentrations of ODNs 2006 (SEQ ID NO. 246), 2117 NK cells as well as monocytes were tested for their (SEQ ID NO. 358), 2137 (SEQ ID NO.: 886), 5126 (SEQ response to non-CpG ODNs. PBMC (2x10 cells/ml) were ID NO.: 1058), and 5162 (SEQ ID NO.: 1094). Cells were incubated with 6 ug/ml of the following ODNs (n=4): 2006 incubated for 48 h at 37° C. as described above and stained (SEQ ID NO. 246), 2117 (SEQ ID NO. 358), 2137 (SEQ with mAb for CD19 (B cell marker) and CD86 (B cell 30 ID NO.: 886), 2183 (SEQID NO. 433), 2194 (SEQID NO.: activation marker, B7-2). Expression was measured by flow 911) and 5126 (SEQID NO. 1058). After 24 h of cultivation cytometry. at 37° C. cells were harvested and stained with mAb for CD3 Using different concentrations of ODNs, we showed (T cell marker), CD56 (NK cell marker) and CD69 (early (FIG. 4) that T-rich ODNs without a CpG motif, can induce activation marker) as described above. Expression of CD69 stimulation of human B cells. ODN 5126 (SEQ ID NO.: 35 on CD56-positive NK cells was measured by flow cytom 1058) which contains only a single poly-T sequence but is etry. greater than 50% T. caused high levels of human B cell FIG. 7 shows that for Poly TODNs similar effects can be activation. Although there are some similarities to SEQ ID observed as described in FIG. 5. The stimulation of NK NO. 246 (e.g. more than 80% T/G content), this ODN cells, like B cells, may be influenced by the length of the clearly lacks any known immunostimulatory CpG motif. 40 ODN. ODN 2183 (SEQ ID NO. 433) (21 bases) induced Surprisingly, for all tested T-rich ODNs, the highest stimu activation of NK cells but to a lesser extent than the longer latory index was obtained at concentrations between 3 and ODN 2194 (SEQ ID NO. 911) (27 bases), as measured by 10 ug/ml. The highest stimulatory index of the tested ODNs enhanced expression of the early activation marker CD69. was achieved by CpG/T-rich ODN SEQ ID NO. 246 at 0.4 ODN 5126 (SEQ ID NO. 1058) was also demonstrated to ug/ml. Interestingly, the activity decreased at high concen 45 activate human NK cells (FIG. 7). trations. It is believed that the anti-tumor activity of CpG ODNs Poly A, Poly C and Poly T sequences were synthesized can be assessed by the ability of the ODN to enhance and tested for biological activity. PBMC (2x10 cells/ml) of NK-mediated cytotoxicity in vitro. ODNs containing at the one representative donor (n-3) were stimulated as described 5' and 3' ends stretches of Poly G were shown to result in the above by 0.4 g/ml, 1.0 g/ml or 10.0 g/ml of the following 50 highest induction of cytotoxicity (Ballas, Z. K., W. L. ODNs: 2006 (SEQ ID NO.: 246), 2196 (SEQ ID NO. 913) Rasmussen, and A. M. Krieg. 1996. Induction of natural (Poly T, 18 bases), 2194 (SEQ ID NO.: 911) (Poly T 27 killer cell activity in murine and human cells by CpG motifs bases), 5162 (SEQ ID NO. 1094) (Poly T., 30 bases), 5163 in oligodeoxynucleotides and bacterial DNA. J. Immunol. (SEQID NO.: 1095) (Poly A, 30 bases), 5168 (SEQID NO.: 157: 1840). To investigate the influence of non-CpG T-rich 1096) (Poly C, 30 bases) and 5169 (SEQ ID NO.: 1097) 55 ODN on NK cytotoxicity, we analyzed the effect of the (Poly CG, 30 bases). Expression of the activation marker ODNs 2194 (SEQ ID NO. 911) and 5126 (SEQ ID NO.: CD86 (B7-2) on CD19-positive B cells was measured by 1058) on NK-mediated lysis (FIG. 8). NK-mediated lysis of flow cytometry. K-562 target cells was measured after over night incubation FIG. 5 demonstrates that the length of the sequence, at of PBMC with 6 g/ml of the ODN 2006 (SEQ ID NO.: least for Poly T ODNs, has an important impact on its 60 246), SEQ ID NO.: 911 (SEQ ID NO. 911) (Poly T 27 activity. A Poly T sequence containing only 18 bases (SEQ bases) and 5126 (SEQ ID NO. 1058) as described above. ID NO. 913) was shown to be less stimulatory than one with SEQID NO.: 1058 demonstrated small increases in lysis by 27 bases (SEQ ID NO.: 911) or one with 30 bases (SEQ ID human NK cells as compared to no ODN. SEQID NO. 911 NO.: 1094) with a clear rank of stimulation: SEQ ID NO. and SEQID NO. 246 enhanced human NK cell cytotoxicity 1094-SEQID NO.: 911 >SEQID NO. 913. Poly A (SEQID 65 to an even higher extent. NO.: 1095) or Poly CG (SEQ ID NO. 1097) sequences, in Previous reports demonstrated that not only NK cells but contrast, do not induce activation of human B cells. Sur also NKT cells are mediators of cytotoxic responses to US 7,271,156 B2 141 142 tumor cells (14). We, therefore, looked at the potential that CpG ODNs influence the Th1/Th2 balance by prefer activation of human NKT cells by T-rich non-CpG ODN. entially inducing Th1 cytokines (Krieg, A. M. 1999. Mecha PBMC of one representative donor (n=2) were incubated nism and applications of immune stimulatory CpG oligode with 6 g/ml ODN 2006 (SEQID NO.: 246), 2117 (SEQ ID oxynucleotides. Biochemica et Biophysica Acta 93321:1). NO. 358), 2137 (SEQ ID NO.: 886), 2183 (SEQ ID NO. 5 433), 2194 (SEQ ID NO. 913) and 5126 (SEQ ID NO.: To test whether T-rich ODN caused a similar shift to Th1 1058) for 24 has described above. Activation of NKT cells cytokines, IFNY production in PBMC was measured. In a was measured by flow cytometry after staining of cells with first set of experiments, it was demonstrated that, as mAb for CD3 (T cell marker), CD56 (NK cell marker) and described for IL-6 and TNFC, ODNs SEQID NO.: 1058 and CD69 (early activation marker). Shown is the expression of 10 SEQ ID NO. 911 induced the release of comparable CD69 on CD3 and CD56 double-positive cells (NKT cells). amounts of this Th1 cytokine IFNY. In addition, it was In FIG.9, SEQID NO. 911 as well as SEQID NO.: 1058 demonstrated that another pro-inflammatory cytokine, were found to stimulate NKT cells. Similar to NK cells SEQ IL-1B, was released upon culture of PBMC with these two ID NO.: 911 (Poly T) was more active than SEQ ID NO. 15 ODNs. Although the amount of these cytokines induced by 1058. In addition, as described above for B cells and NK cells, the length of the ODN has some influence on the the T-rich ODN lacking CpG motifs was less than when CpG immunostimulatory potential, with the longer ODN having ODN SEQ ID NO. 246 was used the amounts induced by stronger effects on NKT cells. Similar results were observed T-rich ODN were significantly higher than the control. for human T cells. Another type of cell of the immune system involved in Examples 9-11 fighting infections is the monocytes. These cells release upon activation a variety of cytokines and can mature into Introduction: dendritic cells (DC), professional antigen-presenting cells An optimal CpG motif for immune system activation in (Roitt, I., J. Brostoff, and D. Male. 1998. Immunology. 25 non-rodent vertebrates is described herein. A phosphodiester Mosby, London). FIG. 10 shows activation of human mono oligonucleotide containing this motif was found to strongly cytes after culturing of PBMC with different ODNs. PBMC stimulate CD86, CD40, CD54 and MHC II expression, IL-6 (2x10 cells/ml) were incubated with 6 g/ml 2006 (SEQID synthesis and proliferation of primary human B-cells. These NO. 246), 2117 (SEQ ID NO. 358), 2137 (SEQ ID NO.: 30 effects required internalisation of the oligonucleotide and 886), 2178 (SEQ ID NO.: 1096), 2183 (SEQ ID NO. 433), endosomal maturation. This CpG motif was associated with 2194 (SEQ ID NO.: 911), 5126 (SEQ ID NO.: 1058) and the sustained induction of the NFkB p50/p65 heterodimer 5163 (SEQ ID NO. 1095) overnight at 37° C. as described and of the transcription factor complex activating protein-1 above (n=3). Cells were harvested and stained for CD14 (AP-1). Transcription factor activation by CpG DNA was (monocyte marker) and CD80 (B7-1, activation marker). 35 preceded by increased phosphorylation of the stress kinases Expression was measured by flow cytometry. c-jun NH terminal kinase (JNK) and p38, and of activating As demonstrated above for NK and B cells, T-rich transcription factor-2 (ATF-2). In contrast to CpG, signaling sequences (e.g., SEQ ID NO. 433, SEQ ID NO.: 911) of through the B-cell receptor led to activation of extracellular different length induce monocyte stimulation but have dif 40 receptor kinase (ERK) and to phosphorylation of a different ferent levels of activity e.g., SEQ ID NO. 433>SEQ ID isoform of JNK. NO.: 911. Poly A (SEQ ID NO. 1095) as well as Poly C (SEQ ID NO.: 1096 (2178) sequences, in contrast, did not Materials and Methods: lead to activation of monocytes (measured by the upregu Oligodeoxynucleotides: Unmodified (phosphodiester, lation of CD80 at a concentration of 6 g/ml ODN). 45 PE) and modified nuclease-resistant (phosphorothioate, PS) ODN were purchased from Operon Technologies (Alameda, Example 8 Calif.) and Hybridon Specialty Products (Milford, Mass.). The sequences used are provided in Table H. E. coli DNA Induction of Cytokine Release by Non-CpG ODNs and calf thymus DNA were purchased from Sigma Chemical 50 Co., St. Louis, Mo. Genomic DNA samples were purified by Next the ability of different T-rich ODNs to influence the extraction with phenol-chloroform-isoamyl alcohol (25/24/ cytokine milieu was examined. PBMC (3x10 cells/ml) 1) and ethanol precipitation. DNA was purified from endot were cultured for 24 h with or without 6 ug/ml of the oxin by repeated extraction with triton X-114 (Sigma Chemi indicated ODNs or 1 ug/ml LPS as positive control (n=2). 55 cal Co., St. Louis, Mo.) and tested for endotoxin using the After incubation supernatants were collected and TNFC. LAL-assay (LAL-assay BioWhittaker, Walkersville, Md., measured by ELISA as described above and the results are lower detection limit 0.1 EU/ml) and the high sensitivity shown in FIG. 11. PBMC were cultured with the indicated assay for endotoxin described earlier (lower detection limit ODNs (1.0 lug/ml) as described in FIG. 11 and IL-6 was 0.0014 EU/ml) (Hartmann G., and Krieg A. M. 1999. CpG measured in the supernatants by ELISA and the results are 60 DNA and LPS induce distinct patterns of activation in shown in FIG. 12. human monocytes. Gene Therapy 6:893). Endotoxin content FIGS. 11 and 12 demonstrate that T-rich non-CpG and of DNA samples was below 0.0014 U/ml. E. coli and calf T-rich/CpG ODNs can induce the secretion of the pro thymus DNA were made single stranded before use by inflammatory cytokines TNFC. and IL-6. For both cytokines, 65 boiling for 10 minutes, followed by cooling on ice for 5 ODN 5126 (SEQ ID NO. 1058) was found in most assays minutes. DNA samples were diluted in TE-buffer using to be as potent as ODN2194 (SEQID NO. 911). It is known pyrogen-free reagents. US 7,271,156 B2 143 144

TABLE H Oligonucleotide panel used Name (SEQ ID NO) Seguence 5' to 3' Starting seguence PE 2079 (320) TCG ACG TTC CCC CCC CCC CC

Middle base PE 2100 (341) TCG GCG TTC CCC CCC CCC CC

PE 2082 (323) TCG CCG TTC CCC CCC CCC CC

Human CpG motif PE 2080 (321) TCG TCG TC CCC CCC CCC CC

5' flanking base PE 2105 (346) GCG TCG TTC CCC CCC CCC CC

PE 2107 (348) ACG TCG TC CCC CCC CCC CC

PE 2104 (345) CCG TCG TTC CCC CCC CCC CC

3' flanking base PE 2098 (339) TCG TCG CTC CCC CCC CCC CC

PE 2099 (340) TCG TCG GTC CCC CCC CCC CC

PE 2083 (324 ) TCG TCG ATC CCC CCC CCC CC First CpG deleted PE 2108 (349) CTG TCG TTC CCC CCC CCC cc Second CpG deleted PE 2106 (347) TCG TCA TTC CCC CCC CCC cc

Methylation PE 2095 (336) TZG TZG TTC CCC CCC CCC CC

PE 2094 (335) TCG TCG TTC CCC CCC ZCC CC

Non-CpG control of PE 2078 (319) TGC TGC TTC CCC CCC CCC CC 2080 PE 2101 (342) GGC CTT, TTC CCC CCC CCC CC

PS form of 2080 PS 2116 (357) TCG TCG TTC CCC CCC CCC CC Additional CpG motifs PE 2059 (300) TCG TCG TTT TGT CGT TTT GTC GTT

Best Ps PS 2006 (246) TCG TCG TTT TGT CGT TTT GTC GTT

Methylated 2006 PS 2117 (358) TZG TZG TTT TGT ZGT TTT GTZ GTT 'PE, phosphodiester; PS, phosphorothioate; bold, base exchange; bold Z methylated cytidine; underlined, CpG dinucleotides.

Cell preparation and cell culture: Human peripheral blood block endosomal maturation/acidification. At the indicated mononuclear cells (PBMC) were isolated from peripheral time points, cells were harvested for flow cytometry as blood of healthy volunteers by Ficoll-Paque density gradient described below. centrifugation (Histopaque-1077, Sigma Chemical Co., St. 45 For signal transduction studies, human primary B-cells Louis, Mo.) as described (Hartmann G. Krug A. Eigler A. were isolated by immunomagnetic cell sorting using the Moeller J., Murphy J., Albrecht R., and Endres S. 1996. VARIOMACS technique (Miltenyi Biotec Inc., Auburn, Specific Suppression of human tumor necrosis factor-alpha Calif.) as described by the manufacturer. In brief, PBMC synthesis by antisense oligodeoxynucleotides. Antisense obtained from buffy coats of healthy blood donors (Elmer L. 50 DeGowin Blood Center, University of Iowa) were incubated Nucleic Acid Drug Dev 6:291)). Cells were suspended in with a microbeads-conjugated antibody to CD19 and passed RPMI 1640 culture medium supplemented with 10% (v/v) over a positive selection column. Purity of B-cells was heat-inactivated (56°C., 1 h) FCS (HyClone, Logan, Utah), higher than 95%. After stimulation, whole cellular extracts 1.5 mM L-glutamine, 100 U/ml penicillin and 100 ug/ml (Western blot) and nuclear extracts (EMSA) for signal streptomycin (all from Gibco BRL, Grand Island, N.Y.) 55 transduction studies were prepared. (complete medium). All compounds were purchased endot For CpG binding protein studies, Ramos cells (human oxin-tested. Viability was determined before and after incu Burkitt lymphoma B cell line, ATCC CRL-1923 or CRL bation with ODN by trypan blue exclusion (conventional 1596: Intervirology 5: 319-334, 1975) were grown in com microscopy) or by propidium iodide exclusion (flow cyto plete medium. Untreated cells were harvested and cytosolic metric analysis). In all experiments, 96% to 99% of PBMC 60 protein extracts were prepared and analyzed for the presence were viable. Cells (final concentration 1x10° cells/ml) were of CpG oligonucleotide binding proteins by EMSA and cultured in complete medium in a 5% CO humidified UV-crosslink as described below. incubator at 37° C. Different oligonucleotides (see table I, Flow cytometry: Staining of Surface antigens was per concentration as indicated in the figure legends), LPS (from formed as previously described (Hartmann G. Krug A. salmonella typhimurium, Sigma Chemical Co., St. Louis, 65 Bidlingmaier M., Hacker U. Eigler A., Albrecht R., Stras Mo.) or anti-IgM were used as stimuli. Chloroquine (5 burger C. J., and Endres S. 1998. Spontaneous and cationic ug/ml. Sigma Chemical Co., St. Louis, Mo.) was used to lipid-mediated uptake of antisense oligonucleotides in US 7,271,156 B2 145 146 human monocytes and lymphocytes. J Pharmacol Exp Ther and stored at -80° C. Protein concentrations were measured 285:920). Monoclonal antibodies to HLA-DR were pur using a Bradford protein assay (Bio-Rad, Hercules, Calif.) chased from Immunotech, Marseille, France. All other anti according to the manufacturer. bodies were purchased from Pharmingen, San Diego, Calif.: Western blot analysis: Equal concentrations of whole cell mABs to CD19 (B43), CD40 (5C3), CD54 (HA58), CD86 protein extracts (25 ug/lane) were boiled in SDS sample (2331 (FUN-1)). IgG.K. (MOPC-21) and IgG-K were used buffer (50 mM Tris-C1, pH 6.8; 1% B-mercaptoethanol; 2% to control for specific staining. Intracellular cytokine stain SDS: 0.1% bromphenolblue; 10% glycerol) for 4 min before ing for IL-6 was performed as described (Hartmann G., and being subjected to electrophoresis on a 10% polyacrylamide Krieg A. M. 1999. CpG DNA and LPS induce distinct gel containing 0.1% SDS (SDS-PAGE). After electrophore patterns of activation in human monocytes. Gene Therapy 10 sis, proteins were transferred to Immobilion-P transfer mem 6:893). In brief, PBMC (final concentration 1x10° cells/ml) branes (Millipore Corp. Bedford, Mass.). Blots were were incubated in the presence of brefeldin A (final concen blocked with 5% nonfat dry milk. Specific antibodies tration 1 Jug/ml. Sigma Chemical Co., St. Louis, Mo.). After against the phosphorylated form of extracellular receptor incubation, cells were harvested and stained using a FITC kinase (ERK), c-jun NH2-terminal kinase (JNK), p38 and labeled mAB to CD19 (B43), a PE-labeled rat anti-human 15 activating transcription factor-2 (ATF-2) were used (New IL-6 mAb (MO2-6A3, Pharmingen) and the Fix and Perm England BioLabs, Beverly, Mass.). Blots were developed in Kit (Caltag Laboratories, Burlingame, Calif.). Flow cyto enhanced chemiluminescence reagent (ECL, Amersham metric data of 5000 cells per sample were acquired on a International, Aylesbury, U.K.) according to the manufac FACScan (Beckton Dickinson Immunocytometry Systems, turer's recommended procedure. San Jose, Calif.). Non-viable cells were excluded from Electrophoretic mobility shift assay (EMSA): To detect analysis by propidium iodide staining (2 g/ml). Data were the DNA-binding activity of the transcription factor activa analyzed using the computer program FlowJo (version 2.5.1, tor protein-1 (AP-1) and NFKB, nuclear extracts (1 lug/lane) Tree Star, Inc., Stanford, Calif.). were analyzed by EMSA using the dsODNs 5' GAT CTA Proliferation assay: CFSE (5-(and-6-) carboxyfluorescein GTG ATG AGT CAG CCG GAT C (SEQ ID NO.: 838) diacetate succinimidyl ester, Molecular Probes, USA) is a 25 containing the AP-1 binding sequence, and the NFKBURE fluorescein-derived intracellular fluorescent label which is from the c-myc promotor region 5' TGC AGG AAG TCC divided equally between daughter cells upon cell division. GGGTTTTCC CCA ACC CCC C, (SEQ ID NO.: 1142), Staining of cells with CFSE allows both quantification and as probes. ODNs were end labeled with T4-polynucleotide immunophenotyping (phycoerythrin-labeled antibodies) of kinase (New England Biolabs) and (y-P)ATP (Amersham, proliferating cells in a mixed cell suspension. Briefly, PBMC 30 Arlington Heights, Ill.). Binding reactions were performed were washed twice in PBS, resuspended in PBS containing with 1 lug nuclear protein extract in DNA-binding buffer (10 CFSE at a final concentration of 5 uM, and incubated at 37° mM Tris-HCl (pH 7.5), 40 mM MgCl, 20 mM EDTA, 1 C. for 10 minutes. Cells were washed three times with PBS mM dithiothreitol, 8% glycerol and 100-400 ng of poly and incubated for five days as indicated in the figure legends. (dI-dC) with 20,000-40,000 cpm labeled ODN in 10 ul total Proliferating CD19-positive B-cells were identified by 35 volume. Specificity of the NFKB bands was confirmed by decreased CFSE content using flow cytometry. competition studies with cold oligonucleotides from unre Preparation of whole cell, nuclear and cytosolic protein lated transcription factor binding sites (10-100 ng). For the extracts: For Western blot analysis, whole cell extracts were Supershift assay, 2 g of specific antibodies for c-Rel, p50 prepared. Primary B-cells were treated with medium, the and p65 (Santa Cruz, Biotechnology, Inc., Santa Cruz, Calif.) phosphodiester oligonucleotides 2080 (SEQID NO. 321) or 40 were added into the reaction mixture for 30 min before the 2078 (SEQ ID NO. 319) at 30 g/ml, or anti-IgM (10 radiolabeled probe was added. Following incubation for 30 ug/ml). Cells were harvested, washed twice with ice-cold minutes at room temperature loading buffer was added and PBS containing 1 mM NaVO, resuspended in lysis buffer the probes were electrophoresed on a 6% polyacrylamide gel (150 mM NaCl, 10 mM TRIS pH 7.4, 1% NP40, 1 mM in Tris-borate-EDTA running buffer (90 mM Tris, 90 mM NaVO, 50 mM NaF. 30 mg/ml leupeptin, 50 mg/ml 45 boric acid, 2 mM EDTA, pH 8.0). Gels were dried and then aprotinin, 5 mg/ml antipain, 5 mg/ml pepstatin, 50 ug/ml autoradiographed. phenylmethylsulfonylfluoride (PMSF)), incubated for 15 UV-crosslinking and denaturing protein electrophoresis: min on ice and spun at 14000 rpm for 10 min. The super Nuclear extracts were incubated with labeled phosphodi natant was frozen at -80 C. For the preparation of nuclear ester oligonucleotide as described for the EMSA. DNA extracts, primary B-cells were resuspended in hypotonic 50 protein complexes were crosslinked with UV-light in a buffer (10 mM HEPES/KOH (pH 7.9), 10 mM KC1, 0.05% Stratalinker (Stratagene) for 10 minutes. Probes were mixed NP40, 1.5 mM MgCl, 0.5 mM dithiothreitol (DTT), 0.5 with SDS-sample buffer, boiled for 10 minutes and loaded mM PMSF, 30 mg/ml leupeptin, 50 mg/ml aprotinin, 5 on a 7.5% SDS-PAGE. The gel was dried on Whatman paper mg/ml antipain, 5 mg/ml pepstatin). After 15 minutes incu and autoradiographed. Plotting the distance against the bation on ice, the Suspension was centrifuged at 1000xg for 55 molecular weight of the marker proteins yielded a standard 5 minutes. The pelleted nuclei were resuspended in extrac curve which was used to calculate the approximate molecu tion buffer (20 mM HEPES (pH 7.9), 450 mM NaCl, 50 mM lar weight of the crosslinked protein-ODN complexes. The NaF, 20% glycerol, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, molecular weight of the oligonucleotide was subtracted from 1 mM PMSF, 30 mg/ml leupeptin, 50 mg/ml aprotinin, 5 this value to give the size. mg/ml antipain, 5 mg/ml pepstatin) and incubated on ice for 60 one hour. The nuclear Suspension was centrifuged for 10 Example 9 minutes at 16,000 g at 4° C. Supernatant was collected and stored at -80° C. Cytosolic extracts for the CpG binding Identification of an Optimal CpG Motif for Use protein studies were prepared from unstimulated Ramos Alone or in Combination with a T-Rich ODN cells, which were lysed with hypotonic buffer as described 65 for the preparation of the nuclear extract. After centrifuga Phosphorothioate oligonucleotides containing the murine tion, the Supernatant was removed as cytoplasmic fraction CpG motif GACGTT (SEQ ID NO. 1143) (for example US 7,271,156 B2 147 148 1826 (SEQID NO.: 69) and used at concentrations which 3' (SEQID NO:1145) motifs, which showed that additional are active in murine B-cells (Yi A. K. Chang M. Peckham CpG motifs (2006 (SEQ ID NO. 246)) tended to increase D. W., Krieg A. M., and Ashman R. F. 1998. CpG oligode the activity of phosphorothioate oligonucleotides. oxyribonucleotides rescue mature spleen B cells from spon Purified B-cells isolated from peripheral blood by immu taneous apoptosis and promote cell cycle entry. J Immunol 5 nomagnetic cell sorting were activated by CpG DNA to the 160:5898), have showed little or no immunostimulatory activity on human immune cells. At higher concentrations same extent as unpurified B-cells within PBMC. Thus, this ODN was found to demonstrate some stimulatory effect activation of B-cells is a primary response and not a sec on human B cells. ondary effect caused by cytokines secreted by other cells. In earlier studies on B-cell activation in mice, it was found 10 In addition to the co-stimulatory molecule CD86, the that a CpG-dinucleotide flanked by two 5" purines and two functional stage of B-cells is characterized by other surface 3' pyrimidines and preferably the 6mer motif 5' GACGTT3' markers. For example, activated T helper cells stimulate (SEQ ID NO: 1143) was optimal for a phosphodiester B-cells by CD40 ligation, the intercellular adhesion mol oligonucleotide to be active (Krieg A. M., et al. 1995 Nature ecule-1 (ICAM-1, CD54) mediates binding to other immune 374:546, Yi A. K. Chang M., et al. 1998 J Immunol 15 cells, and major histocompatibility complex II (MHC II) is 160:5898). responsible for antigen presentation. We found that B cell In order to identify an optimal motif for stimulation of an expression of CD40, CD54 and MHC II was upregulated by immune response in humans and non-rodent vertebrates we the CpG oligonucleotide 2080 (SEQ ID NO.: 321). The designed a series of ODN and tested their activity. First we non-CpG control oligonucleotide 2078 (SEQ ID NO. 319) designed a 20 merphosphodiester oligonucleotide with a TC showed no activity compared to medium alone. dinucleotide at the 5' end preceding the optimal murine CpG When PBMC were incubated for 5 days in the presence of motif 5' GACGTT3' (SEQ ID NO.: 1143) and followed by 2080 (SEQ ID NO. 321) (added at 0 hours, 4 hours, 18 a poly C tail (2079: 5’ TCG ACG TTC CCCCCCCCCCC hours and every Subsequent morning), it was intriguing that 3' (SEQ ID NO. 320)). This oligonucleotide if added to a subpopulation of lymphocytes increased in cell size (FSC) human primary B-cells under the same conditions as found 25 to be optimal for E. coli DNA (repeated addition at 0 hours, and became more granular (SSC). To examine if this sub 4 hours and 18 hours; 30 lug/ml for each time point) population represented proliferating B-cells, we stained stimulated high levels of CD86 expression on human pri freshly isolated PBMC with CFSE (5-(and-6-) carboxyfluo mary B-cells after two days. To determine the structure rescein diacetate Succinimidyl ester) at day 0 and incubated function relationship of the CpG motifs, we replaced the 30 them for 5 days with 2080 (SEQ ID NO. 321) as above. bases adjacent to the CpG dinucleotides while maintaining CFSE is a fluorescent molecule that binds irreversibly to cell the two CpG dinucleotides within the sequence. Exchange proteins. Each cell division decreases CFSE stain by 50%. of the adenine located between both CpG dinucleotides by Cells staining low with CFSE (proliferating cells) were thymidine (2080 (SEQ ID NO. 321)) resulted in slightly found to be mainly CD19-positive B-cells. The oligonucle higher activity. Replacement by guanosine (2100 (SEQ ID 35 otide 2080 (SEQID NO. 321) induced 60 to 70% of CD19 NO. 341)) or cytidine (2082 (SEQ ID NO. 323)) at this positive B-cells to proliferate within 5 days. The control position showed no major changes compared to 2079 (SEQ oligonucleotide 2078 (SEQ ID NO. 319) induced less than ID NO. 320). In contrast, replacement of the thymidine 3' 5% of B-cells to proliferate. Proliferating B-cells (CFSE to the second CpG dinucleotide by the purines guanosine low) showed a larger cell size (FSC) and higher granularity. (2099 (SEQ ID NO. 340)) or adenine (2083 (SEQID NO.: 40 Proliferating B-cells expressed higher levels of CD86 324)) resulted in a major drop in activity of the oligonucle than non-proliferating cells (not shown). In agreement with otide, while the pyrimidine cytidine caused only a minor this finding, the oligonucleotide panel tested above for decrease. The thymidine immediately 5' to the first CpG induction of CD86 expression resulted in an almost identical dinucleotide was also important. Replacement of the thymi pattern of B-cell proliferation. Replacement of the 3' thy dine by any other base (2105 (SEQID NO. 346), guanosine: 45 midine reduced activity more than changing the thymidine 2107 (SEQ ID NO. 348), adenine; 2104 (SEQ ID NO.: in the middle position. 345), cytidine) led to a marked decrease in activity of the oligonucleotide. Elimination of the first (2108 (SEQID NO. Example 10 349)) or the second (2106 (SEQ ID NO. 347)) CpG dinucleotide also partially reduced the activity. 50 B-Cell Activation Requires Endosomal The addition of more 5' GTCGTT3' (SEQID NO.: 1144) Maturation/Acidification CpG motifs to the phosphodiester oligonucleotide contain ing the 8mer duplex CpG motif (5' TCGTCGTT3' (SEQ ID It has previously been shown that chloroquine, an inhibi NO: 1145), 2080 (SEQ ID NO.: 321)) did not further tor of endosomal acidification, blocks CpG-mediated stimu enhance CD86 expression on B-cells (2059 (SEQ ID NO. 55 lation of murine antigen presenting cells and B-cells, while 300)). An oligonucleotide with the same sequence as 2080 not influencing LPS-mediated effects (Hacker H., et al 1998 (SEQ ID NO. 321) but with a phosphorothioate backbone Embo J 17:6230, Yi A. K. et al 1998 J Immunol 160:4755, showed no activity above background (2116 (SEQID NO.: Macfarlane D. E., and Manzel L. 1998 J Immunol. 160: 357)). This was surprising since the phosphorothioate back 1122). We found that the addition of 5 lug/ml chloroquine bone has been reported to greatly stabilize oligonucleotides 60 completely blocked CpG DNA-mediated induction of CD86 and enhance CpG-induced stimulation (Krieg A. M., Yi A. expression on primary B-cells (MFI CD86: 2006 (SEQ ID K., Matson S. Waldschmidt T. J., Bishop G. A., Teasdale R. NO.: 246), 4.7 vs 1.4: E. coli DNA, 3.4 vs. 1.4; medium Koretzky G. A., and Klinman D. M. 1995. CpG motifs in only, 0.9; n=4). Furthermore, chloroquine completely inhib bacterial DNA trigger direct B-cell activation. Nature 374: ited the induction of B-cell proliferation by the phospho 546). We therefore performed further structure-function 65 rothioate oligonucleotide 2006 (SEQ ID NO.: 246) mea analysis of phosphorothioate oligonucleotides containing sured with the CFSE proliferation assay as well as with the the 5' GTCGTT3' (SEQ ID NO: 1144) and 5' TCGTCGTT standard. These results suggest that as with murine cells, US 7,271,156 B2 149 150 activation of human B-cells by CpG DNA requires the response to CpG DNA within 60 min. ATF-2, a substrate of uptake of DNA in endoSomes and Subsequent endosomal both p38 and JNK (Gupta S., Campbell D., Derijard B., and acidification. Davis R. J. 1995. Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science 267:389) and Example 11 a component of the AP-1 complex, showed weak phospho rylation after 30 min which increased after 60 min. CpG Analysis of Sub-Cellular Events Resulting Upon DNA failed to induce substantial phosphorylation of ERK. Human B Cell Stimulation with Optimal Human In contrast, anti-IgM, stimulating the B-cell receptor, did ODN trigger phosphorylation of ERK. Anti-IgM activated differ 10 ent isoforms of JNK than CpG DNA. Since the CpG motif requirement for maximal B-cell activation is substantially different between mouse Example 12 (GACGTT) (SEQID NO: 1143) and humans (TCGTCGTT) (SEQ ID NO:1145), we were interested if the basic intrac Assay for In Vivo Adjuvant Activity ellular signaling events are comparable. Rapid induction of 15 NFKB binding activity has been found earlier in murine An in vitro screening assay to identify ODN useful as an B-cells and macrophages (Stacey K. J., et al 1996J Immunol adjuvant in vivo in humans and other non-rodent animals 157:2116, Yi A. K. et al 1998 J Immunol. 160:4755). To was developed. Since we saw not only quantitative but also investigate the NFKB response to CpG DNA in humans, qualitative differences in activities of different CpG ODN in human primary B-cells were isolated from peripheral blood mice, we first screened a panel of CpG and non-CpG control by immunomagnetic cell sorting and incubated with the ODN on mouse cells to find in vitro assays with reliable and CpG oligonucleotide 2080 (SEQID NO. 321), the non-CpG strong correlation to in vivo adjuvant activity with hepatitis control oligonucleotide 2078 (SEQ ID NO. 319), or B surface antigen (HBSAg). We then systematically tested a medium. At the indicated time points, cells were harvested panel of more than 250 ODN in corresponding human and nuclear extracts were prepared. In the presence of CpG 25 assays to identify sequences with in vitro immunostimula oligonucleotide, NFKB binding activity was increased tory activity. We next examined if the ODN with the highest within one hour and maintained up to 18 hours (latest time activity in these human assays also activate B cell prolif point examined). The non-CpG control oligonucleotide eration in chimpanzees and monkeys, and finally, if they are 2078 (SEQ ID NO. 319) did not show enhanced NFKB active as adjuvants with HBS Ag in chimpanzees and cyno activity compared to cells incubated with medium only. The 30 molgus monkeys in vivo. These studies revealed that the NFKB band was identified by cold competition, and shown sequence, number and spacing of individual CpG motifs to consist of p50 and p65 subunits by Supershift assay. contribute to the immunostimulatory activity of a CpG The activating protein-1 (AP-1) transcription factor is phosphorothioate ODN. An ODN with a TC dinucleotide at involved in the regulation of immediate early genes and the 5' end followed by three 6mer CpG motifs (5' GTCGTT cytokine expression (Karin M. 1995. The regulation of AP-1 35 3") separated by TT dinucleotides consistently showed the activity by mitogen-activated protein kinases. J Biol Chem highest activity for human, chimpanzee, and rhesus monkey 270: 16483). In murine B-cells, AP-1 binding activity is leukocytes. Chimpanzees or monkeys Vaccinated once induced in response to CpG DNA (Yi A. K., and Krieg A. M. against hepatitis B with this CpG ODN adjuvant developed 1998. Rapid induction of mitogen-activated protein kinases 15 times higher anti-HBs antibody titers than those receiving by immune stimulatory CpG DNA. J Immunol 161:4493). 40 vaccine alone. To determine whether this transcription factor would also be Materials and Methods induced by CpG DNA in humans, we examined AP-1 DNA Oligodeoxynucleotides: Phosphorothioate-modified binding activity in human primary B-cells. Cells were incu ODN were purchased from Operon Technologies (Alameda, bated with the CpG oligonucleotide 2080 (SEQ ID NO. Calif.) and Hybridon Specialty Products (Milford, Mass.). 321) or the control oligonucleotide 2078 (SEQ ID NO. 45 ODN were tested for endotoxin using the LAL-assay (LAL 319). Nuclear extracts were prepared and the AP-1 binding assay BioWhittaker, Walkersville, Md., lower detection activity was analyzed by EMSA. AP-1 binding activity was limit 0.1 EU/ml). For in vitro assays, ODN were diluted in enhanced within one hour, and increased up to 18 hours TE-buffer (10 mM Tris, pH 7.0, 1 mM EDTA), and stored (latest time point examined), showing a Sustained response. at -20°C. For in vivo use, ODN were diluted in phosphate Since AP-1 activity is induced by many stimuli (Angel P. 50 buffered saline (0.1 M PBS, pH 7.3) and stored at 4°C. All and Karin M. 1991. The role of Jun, Fos and the AP-1 dilutions were carried out using pyrogen-free reagents. complex in cell-proliferation and transformation. Biochim Mouse spleen cell cultures: Spleens were removed from Biophys Acta 1072:129), we were interested in signal trans 6-12 week old female BALB/c (The Jackson Laboratory), duction pathways upstream of AP-1. The AP-1 transcription 2x10 splenocytes were cultured with 0.2 MODN for 4 factor complex integrates different mitogen activated protein 55 hours (TNF-C.) or 24 hours (IL-6, IFN-y, IL-12), and cytok kinase (MAPK) pathways (Karin M. 1995. The regulation of ines were detected by ELISA as previously described (Yi A. AP-1 activity by mitogen-activated protein kinases. J Biol K. Klinman D. M., Martin T. L., Matson S., and Krieg A. Chem 270: 16483). Western blots were performed using M. 1996. Rapid immune activation by CpG motifs in whole cell extracts from primary B-cells incubated with the bacterial DNA. Systemic induction of IL-6 transcription CpG oligonucleotide 2080 (SEQ ID NO. 321), the control 60 through an antioxidant-sensitive pathway. J Immunol 157: 2078 (SEQ ID NO. 319), or medium only. Specific anti 5394). To evaluate CpG-induced B cell proliferation, spleen bodies to the phosphorylated form of JNK, p38, ATF-2 and cells were depleted of T cells with anti-Thy-1.2 and comple ERK were used. Strong induction of JNK phosphorylation ment and centrifugation over lympholyte M(R) (Cedarlane was found 30 min and 60 min after exposure to CpG-DNA, Laboratories, Hornby, ON, Canada), cultured for 44 hours while the non-CpG oligonucleotide showed no activity 65 with the indicated ODN, and then pulsed for 4 hours with 1 above background. The protein kinase p38, another stress uCi of H thymidine as described previously (Krieg A. M., activated protein kinase (SAPK), was also phosphorylated in Yi A. K. Matson S. Waldschmidt T. J., Bishop G. A., US 7,271,156 B2 151 152 Teasdale R. Koretzky G. A., and Klinman D. M. 1995. CpG (B43), CD56 (B159), CD69 (FN50) and CD86 (2331 (FUN motifs in bacterial DNA trigger direct B-cell activation. 1)) were purchased from Pharmingen, San Diego, Calif. Nature 374:546). To examine NK cell lytic activity murine IgG.K. (MOPC-21) and IgG-K (Hartmann G. et al 1999 spleen cells were depleted of B cells using magnetic beads PNAS 96:9305) were used to control for non-specific stain coated with goat anti-mouse Ig as previously detailed (Bal 5 ing. NK cells were identified by CD56 expression on CD3. las Z. K., and Rasmussen W. 1993. Lymphokine-activated CD14 and CD19 negative cells, whereas B cells were killer cells. VII. IL-4 induces an NK1.1"CD8 CBTCR-CfB identified by expression of CD19. Flow cytometric data B220" lymphokine-activated killer subset. J Immunol 150: from 10000 cells per sample were acquired on a FACScan 17). Cells were cultured at 5x10/well in 24-well plates and (Beckton Dickinson Immunocytometry Systems, San Jose, harvested at 18 hours for use as effector cells in a standard 10 4 hour 'Cr-release assay against YAC-1 target cells. One Calif.). The viability of cells within the FSC/SSC gate used unit (LU) was defined as the number of cells needed to effect for analysis was examined by propidium iodide staining (2 30% specific lysis. ug/ml) and found to be higher than 98%. Data were analyzed Immunization of mice against HBS Ag and evaluation of using the computer program Flow Jo (version 2.5.1, Tree the humoral response: Groups of 6-8 week old female 15 Star, Inc., Stanford, Calif.). BALB/c mice (n=5 or 10, Charles River, Montreal, QC) Immunization of chimpanzees and cynomolgus monkeys were immunized against HBS Ag as previously described against HBS Ag and evaluation of the humoral response: (Davis H. L., et al 1998J Immunol. 160:870). In brief, each Fourteen cynomolgus monkeys (2.0-3.5 kg) were immu mouse received a single IM injection of 50 ul PBS contain nized with a pediatric dose of Engerix-B (SmithKline Bee ing 1 ug recombinant HBS Ag (Medix Biotech, Foster City, cham Biologicals, Rixensart, BE) containing 10 ug HBSAg Calif.) and 10 ug of CpG ODN or non-CpG ODN as a sole adsorbed to alum (25 mg All"/mg HBs.Ag). This was admin adjuvant or combined with alum (Alhydrogel '85'. Superfos istered alone (n=5), or combined with CpG ODN 1968 (n=5, Biosector, Vedbaek, Denmark; 25 mg All"/mg HBs.Ag). 500 ug) or CpG ODN 2006 (SEQ ID NO. 246) (n=4, 150 Control mice were immunized with HBS Ag without adju Jug). Four chimpanzees (10-20 kg) were immunized in the vant or with alum. Plasma was recovered from mice at 25 same fashion with two receiving control vaccine (Engerix-B various times after immunization and Abs specific to HBSAg only) and two receiving experimental vaccine (Engerix-B (anti-HBs) were quantified by end-point dilution ELISA assay (in triplicate) as described previously (Davis H. Letal plus 1 mg CpG ODN 2006). All vaccines were administered 1998J Immunol. 160:870). End-point titers were defined as IM in the-right anterior thigh in a total volume of 1 ml. the highest plasma dilution that resulted in an absorbance 30 Monkeys were maintained in the animal facility of the value (OD450) two times higher than that of non-immune Primate Research Center (Bogor, Indonesia) and chimpan plasma with a cut-off value of 0.05. Zees were housed at Bioqual (Rockville, Md.). Animals were Isolation of primate PBMC and cell culture: Peripheral monitored daily by animal care specialists. No symptoms of blood mononuclear cells (PBMC) were isolated from general ill health or local adverse reactions at the injection peripheral blood of healthy volunteers, chimpanzees or 35 site were noted. Plasma was recovered by IV puncture prior rhesus or cynomolgus monkeys by Ficoll-hypaque density to and at various times after immunization and was stored gradient centrifugation (Histopaque-1077, Sigma Chemical frozen (-20° C.) until assayed for antibodies. Anti-HBs Co., St. Louis, Mo.) as described (Hartmann G. et al 1996 antibodies were detected using a commercial ELISA kit Antisense Nucleic Acid Drug Dev 6:291). Cells were sus (Monolisa Anti-HBs; Sanofi-Pasteur, Montreal, QC) and pended in RPMI 1640 culture medium supplemented with 40 titers were expressed in mIU/ml based on comparison with 10% (v/v) heat-inactivated (56° C., 1 h) FCS (HyClone, WHO defined standards (Monolisa Anti-HBs Standards: Logan, Utah), 1.5 mM L-glutamine, 100 U/ml penicillin and Sanofi-Pasteur). 100 ug/ml streptomycin (all from Gibco BRL Grand Island, Results N.Y.) (complete medium). Cells (final concentration 1x10' Identification of CpG ODN with different profiles of in cells/ml) were cultured in complete medium in a 5% CO 45 vitro immune activities: Our studies showed that the precise humidified incubator at 37° C. ODN and LPS (from Salmo bases on the 5' and 3' sides of a CpG dinucleotide within a nella typhimurium, Sigma Chemical Co., St. Louis, Mo.) or CpG motif may have an impact on the level of immune anti-IgM were used as stimuli. For measurement of human activation of a synthetic ODN, but it has been unclear NK lytic activity, PBMC were incubated at 5x10/well in whether different CpG motifs might display different 24-well plates. Cultures were harvested after 24 hours, and 50 immune effects. To evaluate this possibility, we tested a cells were used as effectors in a standard 4 hours 'Cr panel of CpG ODN for their ability to induce NK lytic release assay against K562 target cells as previously activity, B cell proliferation, and to stimulate synthesis of described (Ballas Z. K. Rasmussen W. L., and Krieg A. M. TNF-C. IL-6, IFN-Y and IL-12 in murine spleen cells. 1996. Induction of NK activity in murine and human cells by Immunostimulatory activity of ODN without CpG motifs CpG motifs in oligodeoxynucleotides and bacterial DNA. J. 55 (ODN 1982 (SEQ ID NO.: 225), ODN 1983 (SEQ ID NO.: Immunol 157: 1840; Ballas Z. K., and Rasmussen W. 1993. 226)) was negative or weak compared to CpG ODN. ODN Lymphokine-activated killer cells. VII. IL-4 induces an with non optimal CpG motifs (ODN 1628 (SEQ ID NO. NK1.1"CD8 O'B TCR-O?3 B220" lymphokine-activated 767), ODN 1758 (SEQ ID NO.: 1)) were less active than killer subset. J Immunol 150:17). For B cell proliferation, 1 ODN containing CpG motifs flanked by two 5" purines and uCi of H thymidine was added 18 hours before harvest, and 60 two 3' pyrimidines (ODN 1760 (SEQID NO. 3), ODN 1826 the amount of H thymidine incorporation was determined (SEQ ID NO.: 69), ODN 1841 (SEQ ID NO.: 84)). ODN by scintillation counting at day 5. Standard deviations of the 1826 containing two optimal murine CpG motifs (5' triplicate wells were <5%. GACGTT3') (SEQID NO:1143) had the highest activity for Flow cytometry on primate PBMC. Surface antigens on 5 of 6 measured endpoints. Except for ODN 1628, all ODN primate PBMC were stained as previously described (Hart 65 showed a generally similar pattern of activity (NK cell mann Get al 1998J Pharmacol Exp. Ther 285:920). Mono mediated lysis, B cell proliferation, IL-12, IL-6, TNF a. clonal antibodies to CD3 (UCHT1), CD14 (M5E2), CD19 IFN-Y). Of note, ODN 1628, which was unique in this panel US 7,271,156 B2 153 154 for containing two G-rich regions, showed preferential 2013 (SEQ ID NO. 253)) show intermediate activity. High induction of IFN-Y synthesis but relatively low stimulation activity was found when the 5' TpC directly preceded a of the other activities. 6-mer human CpG motif (5' TCGTCGTT 3' (SEQ ID Identification of in vitro assays which correlate with in NO:1145) (in SEQID NO. 246)) and was followed by two Vivo adjuvant activity: Since adjuvant activity is an in vivo 5 6-mer motifs (ODN 2005 (SEQ ID NO. 245), ODN 2006 endpoint, we were interested in identifying in vitro assays (SEQ ID NO. 246) and ODN 2007 (SEQ ID NO.: 247)). that would predict the adjuvant activity of a CpG ODN in The best results were obtained when the 6-mer CpG motifs vivo. The same ODN used for in vitro endpoints therefore were separated from each other and from the 5' 8-mer CpG were tested for their adjuvant activity to immunize mice motif by TpT (ODN 2006 (SEQ ID NO. 246)). against HBs.Ag. This was carried out both with ODN alone 10 Expression of the activation marker CD69 is rapidly and with ODN combined with alum, since earlier studies had upregulated on the Surface of NK cells Subsequent to stimu shown strong synergy for CpG ODN and alum adjuvants lation. To confirm the results from the NK cell lysis assay, (PCT Published Patent Application WO98/401.00). PBMC were incubated for 18 hours with ODN (2 ug/ml). BALB/c mice immunized with HBS Ag without adjuvant CD69 expression was examined on CD56 positive NK cells attained only low titers of anti-HBs by 4 weeks, and this was 15 (CD3, CD14 and CD19 negative). Although induction of not affected by addition of control ODN. In contrast, addi CD69 expression was less sequence restricted than stimu tion of CpG ODN raised anti-HBs titers by 5 to 40 fold, lation of NK cell functional activity, control ODN (ODN depending on the sequence used. When alum was added, 1982, ODN 2116, ODN 2117, ODN 2010) showed only low titers of anti HBs were approximately 6 times higher than activity similar to background levels. ODN with two human with HBs.Ag alone. Specifically, control ODN had no effect CpG motifs separated by 5' TTTT 3' (ODN 1965 (SEQ ID and the various CpG ODN augmented these titers 2 to 36 NO. 208)) or four human CpG motifs without spacing fold. Results obtained with the different ODN alone corre (ODN 2013 (SEQID NO. 253)) were relatively more active lated very strongly (r=0.96) with those obtained using the at inducing CD69 expression than at stimulating NK cell same ODN plus alum. When linear regression was per lytic activity. Optimal NK cell functional activity, as well as formed, a very high degree of correlation was found between 25 CD69 expression, was obtained with ODNs containing a certain in vitro assays and in vivo augmentation of anti-HBS TpC dinucleotide preceding the human CpG motif, and titers. Of all the in vitro endpoints examined, the induction additional human motifs within the sequence (ODN 2006 of NK lytic activity showed the best correlation to in vivo (SEQ ID NO.: 246), ODN 2007 (SEQ ID NO.: 247)). adjuvant activity (without alum, r 0.98; with alum, r 0.95: Activity of phosphorothioate ODN for stimulating human p<0.0001). A good correlation regarding adjuvant activity 30 B cells: In preliminary experiments we found that the was also obtained for B-cell stimulation (r=0.84 and 0.7), as percentage of proliferating B cells (CFSE assay, see methods well as secretion of TNF-C. (r–0.9 and 0.88), IL-12 (r=0.88 section) correlated with the surface expression of the co and 0.86) and IL-6 (r–0.85 and 0.91). The one in vitro assay stimulatory CD86 on B cells, as measured by flow cytom that did not correlate well with the in vivo results was IFN-y etry. Thus we used CD86 expression on B cells to screen a secretion (r-0.57 and 0.68). These data demonstrate that in 35 panel of ODN for their immunostimulatory activity. PBMC vitro assays for NK lytic activity, B cell activation and were incubated with 0.6 ug/ml ODN. Expression of CD86 production of TNF-C., IL-6 and IL-12 provide valuable (mean fluorescence intensity, MFI) was examined on CD19 information in vitro to predict the adjuvant activity of a positive B cells. A poly CODN (ODN 2017 (SEQ ID NO.: given ODN in vivo. 257)) or ODN without CpG dinucleotides (ODN 1982 (SEQ Screening of a phosphorothioate ODN panel to activate 40 ID NO.: 225)) failed to stimulate human B cells under these human NK cells: In previous studies we found that synthesis experimental conditions. A phosphorothioate ODN (ODN of inflammatory cytokines by human PBMC is induced by 2116 (SEQ ID NO. 256)) with one optimal human CpG extremely low amounts of endotoxin (induced TNF-C. secre motif preceded by a TpC (5' TCGTCGTT 3' (SEQ ID NO: tion is detectable with just 6 pg/ml endotoxin, 2 logs more 1145) (in SEQID NO. 246)) was inactive. The presence of sensitive than murine immune cells). In contrast, activation 45 one human 6-mer CpG motif (5' GTCGTT3' (SEQ ID NO. of human B cells and induction of human NK cell lytic 1144)) had no activating effect. Two of these CpG motifs activity with endotoxin is low even at high endotoxin within the sequence showed no (ODN 1960 (SEQ ID NO. concentrations. Based on these results we selected activation 203), ODN 2016 (SEQID NO.: 256)) or intermediate (ODN of NK cells (lytic activity and CD69 expression) and B cells 1965 (SEQ ID NO. 208)) activity dependent on the (proliferation and CD86 expression) as the most highly 50 sequence context. If the ODN was composed of three or four specific and reproducible assays with low inter-subject vari copies of this motif (ODN 2012 (SEQ ID NO. 252), ODN ability and used these assays for in vitro Screening of a pool 2013 (SEQ ID NO.: 253), ODN 2014 (SEQ ID NO.: 254)), of ODN. intermediate activity on B cells could be detected. The First we studied the effect of phosphorothioate ODN combination of the human 8-mer CpG motif on the 5' end of containing various combinations and permutations of CpG 55 the ODN with two 6-mer CpG motifs (ODN 2005 (SEQ ID motifs on NK cell-mediated lysis of target cells. For clarity NO. 245), ODN 2006 (SEQID NO.:246), ODN 2007 (SEQ and ease of presentation, only data with selected represen ID NO. 247), ODN 2102 (SEQ ID NO. 343), ODN 2103 tative CpG and control ODN are shown. Human PBMC (SEQ ID NO. 344)) led to a considerable increase in the were incubated with different phosphorothioate ODN (6 ability of the ODN to stimulate B cells. The spacing between ug/ml) for 24 hours and tested for their ability to lyse 60 the single motifs was critical. The separation of CpG motifs 'Cr-labeled K562 cells. ODN with two 6-mer CpG motifs by TpT was preferable (ODN 2006 (SEQ ID NO. 246)) (either 5' GACGTT3' (SEQ ID NO. 1143) or 5 GTCGTT compared to unseparated CpG motifs (ODN 2005 (SEQ ID 3' (SEQ ID NO.: 1144)) in combination with a TpC at the NO.:); also compare ODN 1965 (SEQID NO. 208) to ODN 5'end of the ODN (ODN 1840 5' TCCATGTCGTTCCT 1960 (SEQ ID NO. 203)). The human 6-mer CpG motif (5' GTCGTT 3' (SEQ ID NO.: 83), ODN 1851 5' TCCT 65 GTCGTT 3') was better than the optimal mouse 6-mer CpG GACGTTCCTGACGTT 3' (SEQ ID NO. 94) or with at motif (5' GACGTT3' (SEQ ID NO. 246)) when combined least three 6-mer motifs without a TpC at the 5' end (ODN with the human 8-mer CpG motif on the 5' end (ODN 2006 US 7,271,156 B2 155 156 vs. ODN 2102 (SEQ ID NO. 343) and ODN 2103 (SEQ ID NO. 344)). A (TCG), ODN was inactive or only weakly TABLE J-continued active, as were ODN containing CpG dinucleotides flanked by guanines or other CpG dinucleotides (ODN 2010 (SEQ Proliferative response of PBMC to phosphorothioate ID NO. 250)). Taken together, the findings for NK cells and CpG ODN in primates B cells showed consistently that of the ODN tested, ODN Rhesus 2006 (SEQ ID NO. 246) has the highest immunostimula Humans Chimpanzee monkey tory activity on human immune cells. ODN 1968 35 -- 9 20.0 - 3.8 1.9 -- 0.7 Comparative analysis of potency of CpG phosphorothio (SEQ ID NO.: 211) 10 ODN 1982 9.7 - 1.1 2.5 - 1.1 0.7 - 0.1 ate ODNs in different primates: Different CpG motifs are (SEQ ID NO.: 225) optimal to activate murine and human immune cells. Fur ODN 2006 58 -- 8 27.4 +- 8.9 6.3 +- 3.3 thermore, the number and location of CpG motifs within an (SEQ ID NO.: 246) active phosphorothioate ODN is different in mice and ODN 2007 47 - 11 0.5 - 0.1 0.4 - 0.2 humans. We were interested to know if CpG phosphorothio (SEQ ID NO.: 247) ate ODN show a similar activity among different species of primates. We compared a panel of CpG ODN for their ability PBMC were prepared from peripheral blood and incubated to induce B cell proliferation in humans, chimpanzees and with ODN (0.6 ug/ml) as indicated for five days. Prolifera rhesus or cynomolgus monkeys. The capability of ODN to tion was measured by uptake of H/thymidine (cpm/1000) stimulate human B cell proliferation (Table J) correlated during the last 18 hours. More than 95% of proliferating well with their ability to induce CD86 expression on B cells. cells were B-cells as determined using the CFSE assay. Four ODN 2006 (SEQ ID NO. 246), which showed the highest human probands, six chimpanzees and two rhesus monkeys activity in human B cells and NK cells, was also the most were tested. active in stimulating chimpanzee and rhesus monkey B cell In vivo adjuvant activity of CpG ODN in chimpanzees proliferation (Table J). ODN 1968 (SEQ ID NO. 211) and and cynomolgus monkeys: In order to evaluate whether CpG 25 ODN with strong in vitro stimulatory effects on primate cells ODN 2006 (SEQ ID NO.: 246) gave the highest activation had detectable adjuvant activity in Vivo, Cynomolgus mon of cynomolgus monkey B-cells in vitro (SI of 25 and 29 keys and chimpanzees were immunized with Engerix B, respectively at 6 ug ODN/ml). Surprisingly, CpG ODN 2007 which comprises HBS Ag adsorbed to alum, alone or with (SEQ ID NO.: 247), which displayed similarly high activity added ODN 1968 (500 g) or ODN 2006 (SEQID NO.:246) as the optimal ODN 2006 (SEQ ID NO. 246) in human (1 mg) respectively. Compared to controls not receiving cells, did not stimulate Rhesus monkey or chimpanzee B cell 30 CpG ODN, anti-HBs titers at 4 weeks post-prime and 2 proliferation, and the ODN 1968 (SEQID NO. 211) showed weeks post-boost were 66- and 16-fold higher respectively low activity. CpG ODN originally identified with high in the monkeys, and 15- and 3-fold higher in the chimpan activity in mice (ODN 1760 (SEQ ID NO. 3), ODN 1826 Zees (Table K). Thus a clear adjuvant effect of CpG ODN (SEQ ID NO.: 69)) showed little activity in monkeys (Table was seen, and this was particularly striking after a single J). immunization.

TABLE K Anti-HBs responses in primates immunized against HBSAg with CpG ODN Anti-HBs (mCiml

Primate species l CpG ODN 4 wks post-prime 2 wks post-boost Cynomolgus monkey 5 None 15 44 4880 - 13113 5 ODN 1968 (500 g) 995 - 1309 76449 42094 (SEQ ID NO. 211) Chimpanzee 2 None 6,11 3712, 4706 2 ODN 2006 (1 mg) 125, 135 9640, 16800 (SEQ ID NO. 246) Animals were immunized by IM injection of Engerix B containing 10 ug HBSAg adsorbed to alum, alone or with added CpG ODN. Cynomolgus monkeys were boosted at 10 wks and chimpanzees were boosted at 4 wks post-prime. Anti-HBs was determinedby ELISA assay; values for monkeys are GMT + SEM (n = 5) whereas individual values for the two chimpanzees in each group are provided.

55 The foregoing written specification is considered to be TABLE J sufficient to enable one skilled in the art to practice the Proliferative response of PBMC to phosphorothioate invention. The present invention is not to be limited in scope CpG ODN in primates by examples provided, since the examples are intended as a 60 single illustration of one aspect of the invention and other Rhesus functionally equivalent embodiments are within the scope of Humans Chimpanzee monkey the invention. Various modifications of the invention in No addition 0.5 - 0.1 0.5 - 0.1 0.5 - 0.0 addition to those shown and described herein will become ODIN 1760 23 - 7 0.3 - 0.1 0.5 - 0.3 apparent to those skilled in the art from the foregoing (SEQ ID NO.:3) ODN 1826 0.8 - 0.1 0.4 - 0.1 0.6 - 0.1 65 description and fall within the Scope of the appended claims. (SEQ ID NO.: 69) The advantages and objects of the invention are not neces sarily encompassed by each embodiment of the invention. US 7,271,156 B2 157 158

SEQUENCE LISTING

<160> NUMBER OF SEQ ID NOS : 1145 <210> SEQ ID NO 1 &2 11s LENGTH 18 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 1 totcc.ca.gcg tdcgcc at 18

<210> SEQ ID NO 2 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 2 ataatc.ca.gc titgaac caag 20

<210> SEQ ID NO 3 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 3 ataatcgacg ttcaa.gcaag 20

<210> SEQ ID NO 4 &2 11s LENGTH 18 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 4 taccgc.gtgc gaccctict 18

<210 SEQ ID NO 5 &2 11s LENGTH 9 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 5 ggggagggit

<210> SEQ ID NO 6 &2 11s LENGTH 9 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 6 ggggagggg

<210 SEQ ID NO 7 &2 11s LENGTH 9 US 7,271,156 B2 160

-continued

&212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 7 ggtgaggtg

<210 SEQ ID NO 8 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <221 NAME/KEY: modified base <222> LOCATION: (8) . . . (8) &223> OTHER INFORMATION 5 c. &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 8 to catgitngt toctagatgct 20

SEQ ID NO 9 LENGTH 15 TYPE DNA ORGANISM: Artificial Sequence FEATURE: NAME/KEY: modified base LOCATION: (11) . . . (11) OTHER INFORMATION 5 c. FEATURE: OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 9 gctacct tag ngtga 15

SEQ ID NO 10 LENGTH 2.0 TYPE DNA ORGANISM: Artificial Sequence FEATURE: NAME/KEY: modified base LOCATION: (8) . . . (8) OTHER INFORMATION 5 c. FEATURE: OTHER INFORMATION: Synthetic Sequence

<400 SEQUENCE: 10 to catgangt toctatoct 20

SEQ ID NO 11 LENGTH 2.0 TYPE DNA ORGANISM: Artificial Sequence FEATURE: NAME/KEY: modified base LOCATION: (13) . . . (13) OTHER INFORMATION 5 c. FEATURE: OTHER INFORMATION: Synthetic Sequence

<400 SEQUENCE: 11 to catgacgt tontgatgct 20

SEQ ID NO 12 LENGTH 15 TYPE DNA ORGANISM: Artificial Sequence FEATURE: US 7,271,156 B2 161 162

-continued <221 NAME/KEY: modified base <222> LOCATION: (7) . . . (7) &223> OTHER INFORMATION 5 c. &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 12 gctagangtt agtgt 15

<210> SEQ ID NO 13 &2 11s LENGTH 19 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 13 agct coatgg togctoactg 19

<210> SEQ ID NO 14 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 14 ccacgtcgac cctoragg.cga 20

<210> SEQ ID NO 15 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 15 gcacatcg to cog cago.cga 20

<210> SEQ ID NO 16 &2 11s LENGTH 19 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 16 gtoacticgtg gtacct cqa 19

<210 SEQ ID NO 17 &2 11s LENGTH 25 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 17 gttggataca ggccagacitt tottg 25

<210> SEQ ID NO 18 &2 11s LENGTH 25 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 18 US 7,271,156 B2 163 164

-continued gattcaactt gcgctdatct taggc 25

SEQ ID NO 19 LENGTH 24 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sequence

<400 SEQUENCE: 19 accatggacg aactgtttcc cct c 24

SEQ ID NO 20 LENGTH 24 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sequence

<400 SEQUENCE: 20 accatggacg agctgtttcc cct c 24

SEQ ID NO 21 LENGTH 24 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 21 accatggacg acctgtttcc ccto 24

SEQ ID NO 22 LENGTH 24 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 22 accatggacg tactgtttcc ccto 24

SEQ ID NO 23 LENGTH 24 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 23 accatggacg gtctgtttcc cct c 24

SEQ ID NO 24 LENGTH 24 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 24 accatggacg ttctgtttcc ccto 24

SEQ ID NO 25 LENGTH 25 TYPE DNA US 7,271,156 B2 165 166

-continued ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sequence

<400 SEQUENCE: 25 ccactcacat citgctgctcc acaag 25

SEQ ID NO 26 LENGTH 25 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 26 acttctdata gtc.cctittgg to cag 25

SEQ ID NO 27 LENGTH 2.0 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 27 to catgagct tcctgagtct 20

SEQ ID NO 28 LENGTH 20 TYPE DNA ORGANISM: Artificial Sequence FEATURE OTHER INFORMATION: Synthetic Sequence FEATURE NAME/KEY: modified base LOCATION: (9) . . . (9) OTHER INFORMATION I FEATURE NAME/KEY: modified base LOCATION: (11) . . . (11) OTHER INFORMATION I FEATURE NAME/KEY: modified base LOCATION: (15) . . . (15) OTHER INFORMATION I

<400 SEQUENCE: 28 gaggaagging niggangacgt 20

SEQ ID NO 29 LENGTH 20 TYPE DNA ORGANISM: Artificial Sequence FEATURE OTHER INFORMATION: Synthetic Sequence FEATURE NAME/KEY: modified base LOCATION: (7) . . . (7) OTHER INFORMATION I FEATURE NAME/KEY: modified base LOCATION: (13) . . . (13) OTHER INFORMATION I FEATURE NAME/KEY: modified base LOCATION: (18) . . . (18) OTHER INFORMATION I

<400 SEQUENCE: 29 gtgaatncgt ton.cgg gnct 20 US 7,271,156 B2 167 168

-continued

<210 SEQ ID NO 30 &2 11s LENGTH 6 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 30 aaaaaa.

<210> SEQ ID NO 31 &2 11s LENGTH 6 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 31 cococc

<210> SEQ ID NO 32 &2 11s LENGTH 6 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 32 citgtca

<210 SEQ ID NO 33 &2 11s LENGTH 6 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 33 togtag

<210> SEQ ID NO 34 &2 11s LENGTH 6 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 34 togtgg

<210 SEQ ID NO 35 &2 11s LENGTH 6 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 35 cgtogt

<210 SEQ ID NO 36 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE US 7,271,156 B2 169 170

-continued OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 36 to catgtcgg to citgagtict 20

SEQ ID NO 37 LENGTH 2.0 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sequence

<400 SEQUENCE: 37 to catgcc.gg to citgagtict 20

SEQ ID NO 38 LENGTH 2.0 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sequence

<400 SEQUENCE: 38 to catgacgg to citgagtict 20

SEQ ID NO 39 LENGTH 2.0 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sequence

<400 SEQUENCE: 39 to catgacgg to citgagtict 20

SEQ ID NO 40 LENGTH 2.0 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sequence

<400 SEQUENCE: 40 to catgtcga toctoagtct 20

SEQ ID NO 41 LENGTH 2.0 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sequence

<400 SEQUENCE: 41 to catgtc.gc ticcitgagtct 20

SEQ ID NO 42 LENGTH 2.0 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sequence <400 SEQUENCE: 42 to catgtc.gt toctoagtct 20