CELLULAR & MOLECULAR BIOLOGY LETTERS http://www.cmbl.org.pl Received: 30 August 2009 Volume 15 (2010) pp 260-271 Final form accepted: 17 February 2010 DOI: 10.2478/s11658-010-0003-7 Published online: 19 March 2010 © 2010 by the University of Wrocław, Poland Research article GLOBAL MAPPING OF ZBTB7A TRANSCRIPTION FACTOR BINDING SITES IN HepG2 CELLS XUYU ZU1, LINGLING YU1, YIMING SUN3, JING TIAN1, FENG LIU1, QINSHENG SUN1, SHENGNAN HE1, GUANG SUN1, WEISHI LUO1 and YUYANG JIANG1,2* 1The Key Laboratory of Chemical Biology, Guangdong Province, Graduate School at Shenzhen, Tsinghua University, Shenzhen, Guangdong 518055, People’s Republic of China, 2School of Medicine, Tsinghua University, Beijing 100084, People’s Republic of China, 3Medical Systems Biology Research Center, Tsinghua University, Beijing 100084, People’s Republic of China, National Engineering Research Center for Beijing Biochip Technology (NERCBBT), 18 Life Science Parkway, Beijing 102206, People's Republic of China Abstract: ZBTB7A is a known proto-oncogene that is implicated in carcinogenesis and cell differentiation and development. Fully understanding the function of ZBTB7A in cellular processes could provide useful strategies for cancer treatment and development-associated disease therapy. Here, global mapping of ZBTB7A transcription factor binding sites was developed by utilizing microarray technology in HepG2 cells. The data obtained from the microarrays was further validated via chromatin immunoprecipitation-PCR (ChIP-PCR) and real time-PCR, and it was revealed that ZBTB7A may be one of the regulators of neural development. ZBTB7A target signal pathways were identified in signal pathway and GO (Gene Ontology) analyses. This is the first report on the global mapping of ZBTB7A downstream direct targets, and these findings will be useful in understanding the roles of ZBTB7A in cellular processes. Key words: ZBTB7A, Proto-oncogene, Transcription factor, ChIP-on-chip analysis, Signal pathway * Author for correspondence. e-mail: [email protected], tel: +86 755 26036017, fax: +86 755 26032094 Abbreviations used: ChIP – chromatin immunoprecipitation; FASN – synthase gene; GO – gene ontology; KEGG – Kyoto Encyclopedia of Genes and Genomes; PMSF – phenylmethylsulfonyl fluoride CELLULAR & MOLECULAR BIOLOGY LETTERS 261 INTRODUCTION ZBTB7A, also known as Pokemon, FBI [1] or LRF [2], is a transcriptional factor that belongs to the POK protein family. The ZBTB7A gene has been shown to play roles in adipogenesis [3], T-lymphoid lineage differentiation, terminal preadipocyte differentiation promotion [2] and carcinogenesis [4, 5]. Homozygous deletion of the ZBTB7A gene resulted in embryonic lethality in a mouse model, indicating that the ZBTB7A gene has an important physiological function. ZBTB7A can self-associate via both the POZ and zinc finger domains [6], and it can also interact with BCL-6, another member of the POK protein family [7]. Considerable effort has been made to identify ZBTB7A target genes in order to elucidate the roles of ZBTB7A in carcinogenesis and cell differentiation and development. It has been shown that FBI-1 represses the transcription of some extracellular matrix genes [8] and suppresses the activity of the ADH5/FDH promoter [9]. Laudes et al. reported that ZBTB7A represses the expression level of E2F4 in a direct mechanism via ZBTB7A regulatory elements within the E2F4 promoter, and that the cyclin A expression level is reduced by ZBTB7A expression through an indirect mechanism without ZBTB7A binding to the promoter of the cyclin A gene [10]. The downregulation of the tumor suppressor Rb gene expression induced by ZBTB7A was found to be associated with the inhibition of C2C12 myoblast cell differentiation [11]. ZBTB7A was proved to be a critical factor in carcinogenesis when it was found to specifically repress the transcription of the tumor suppressor gene ARF through direct binding with the ARF promoter [4]. ZBTB7A was also found to activate the transcription of the fatty acid synthase gene (FASN) together with SREBP-1 [12] . To date, no high-throughput expression profiling had been applied to identify the ZBTB7A target genes. Chip is a powerful tool that identifies direct target genes by isolating DNA bound by proteins. When it was coupled with the microassay detection method (ChIP-chip), direct p53 and c-Myc binding loci on the genomes could be identified [13, 14]. Here, we performed a Zbtb7 ChIP-on-chip study on HepG2 cells, a cell line with a high endogenous ZBTB7A gene expression level, with the aim to delineate the ZBTB7A regulatory network. MATERIALS AND METHODS Cell culture Cells of the human hepatocellular carcinoma cell line HepG2 were purchased from the American Type Culture Collection and were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Gibco BRL) supplemented with 10% heated fetal bovine serum (FBS, Gibco, Grand Island, NY), 2 mM glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin at 37ºC, 5% CO2. Cells at 85-90% confluence were passaged by trypsinization. 262 Vol. 15. No. 2. 2010 CELL. MOL. BIOL. LETT. Chromatin immunoprecipitation and genome-wide ChIP-chip Chromatin immunoprecipitation and genome-wide location analysis were performed as described previously [15]. Briefly, HepG2 cells cultured to a confluence of 80% were treated with formaldehyde (1%) for 30 min, and the cells were collected by centrifugation, washed with ice-cold TBS, and disrupted by vortexing in a lysis buffer. The chromatin was sonicated to yield DNA fragments with an average length of 500 bp. The DNA fragments crosslinked to the proteins were enriched via immunoprecipitation with the ZBTB7A antibody (Abcam, ab36606, Cambridge, MA) and IgG (Abcam, ab37373, Cambridge, MA). After purification, the immunoprecipitated and input DNA were respectively labeled with Cy5 and Cy3 fluorescent dyes via ligation-mediated PCR. Both pools of labeled DNA were hybridized to Affymetrix GeneChip® Tiling Arrays. Images of the Cy5 and Cy3 fluorescence intensities were scanned using a LuxScan-10KA laser confocal scanner (CapitalBio). The signal intensities for each spot were calculated by subtracting the local background using LuxScan 3.0 software (CapitalBio). For each microarray, linear normalization using a per- channel 50th percentile method was adopted to get the ratio for each spot, and any fluorescence ratio over 2-fold higher than the norm was denoted as significant. The data from three independent experiments was combined for a statistical analysis using Student’s t test. Chromatin immunoprecipitation and PCR An independent Chromatin Immunoprecipitation was performed on HepG2 cells, using the same methods as described above. The PCR primers for ZBTB7A target validation are listed in Tab. 1. Tab. 1. PCR primers for ChIP PCR and real time-PCR. Gene Sense (5’-3’) Antisense (5’-3’) Primers for ChIP-PCR CFL1 TTTGCTAGTAGAGTAGGGTG AGAGCCTCAGAAGACACC DPYSL2 TATTCGTGGGAGTTTACC AACAGGTGCTAAGATATGTG LRRC4C TACTTCAGAGAAGTGTTGTAAG GGAATTCAAACAGTCTGC RGS3 GCGAACATGAGCAAGAGG CAAATCCAGAGTCGGGAGAG SEMA4B CAAACCAACGCCACTAGCAG GAGAGCAGGAGCGACGGTGT Primers for real time-PCR CFL1 CTGCCTGAGTGAGGACAAG TTGATGGCGTCCTTGGAG DPYSL2 CCTCGTGTACATGGCTTTC TCCCAGATGACGGACATCC RGS3 CATCTCGGATGAAAGTGCTTTG TCCTTGCATGCCTGGATC SEMA4B GAGGTGAACCGTGAGACAC TGAGGCTGGTAGAGGCTGAC GAPDH AGCCTCAAGATCATCAGCAATG TGTGGTCATGAGTCCTTCCACG Transient transfection of ZBTB7A targeting SiRNA into HePG2 cells Pokemon targeting siRNA (5’-GCUGGACCUUGUAGAUCAAtt-3’, 5’-UUGAU CUACAAGGUCCAGCtt-3’) was synthesized (GeneParma Co, Shanghai, China), and a scramble RNA was used as a control. For the siRNA CELLULAR & MOLECULAR BIOLOGY LETTERS 263 delivery, HepG2 cells were mixed gently with siRNA and OligofectAMINE (Invitrogen, CA) in a volume of 0.5 ml according to the manufacturer’s instructions, and incubated at 37ºC, 5% CO2 for 4 h, followed by the addition of an equal volume of fresh medium containing 20% FBS. The cells were continuously incubated until harvest. Real time-PCR analysis Total RNA was prepared from cells using TRIzol reagent (Invitrogen, CA) according to the manufacturer’s instructions. After being isolated, the RNA was reverse transcribed to cDNA using random primers (Promega, CA). The reaction mixture containing SYBR Green PCR Master Mix (TaKaRa, Dalian, China) was run in a 7500 real-time PCR System (Applied Biosystems, CA). The PCR primers used for quantitative RT-PCR are listed in Tab. 2. The real-time PCR parameters used were as follows: 95ºC for 10 s; 95ºC for 5 s, 60ºC for 34 s for 40 cycles; 95ºC for 15 s, 60ºC for 1 min and 95ºC for 15 s. Tab. 2. Prospective genes identified to be part of the ZBTB7A target signal pathway. Avg. Pathway Gene bank Gene Gene name fold name ID symbol change Aminosugar metabolism NM_003828 myotubularin related protein 1 MTMR1 2.98 NM_000188 hexokinase 1 HK1 2.46 NM_004388 chitobiase CTBS 2.7 NM_003115 UDP-N-acteylglucosamine pyrophosphorylase 1 UAP1 2.03 Epithelial cell signaling in Helicobacter pylori infection nuclear factor of kappa light polypeptide gene enhancer NM_020529 NFKBIA 2.27 in B-cell inhibitor, alpha NM_002751 mitogen-activated protein kinase 11 MAPK11 2.17 NM_006092 caspase recruitment domain family, member 4 CARD4 2.5 protein tyrosine phosphatase, non-receptor type NM_002834 PTPN11 3.06 11 MAPK signaling pathway calcium channel, voltage-dependent, CACNA2 NM_018398 2.6 alpha 2/delta 3 subunit D3 NM_002011 fibroblast growth factor receptor 4 FGFR4 2.14 NM_001394 dual specificity phosphatase 4 DUSP4 3.03 NM_001540 heat shock 27 kDa protein