A Screen of Low-Copy Nuclear Genes Reveals the LFY Gene As Phylogenetically Informative in Closely Related Species of Orchids (Ophrys)

TAXON 56 (2) • May 2007: 493–504 Schlüter & al. • A screen of low-copy nuclear genes

A screen of low-copy nuclear genes reveals the LFY gene as phylogenetically informative in closely related species of orchids (Ophrys)

Philipp M. Schlüter1,2,*, Gudrun Kohl1, Tod F. Stuessy1 & Hannes F. Paulus2

1 Department of Systematic and Evolutionary Botany, University of Vienna, Rennweg 14, 1030 Vienna, Austria. [email protected] (author for correspondence) 2 Department of Evolutionary Biology, University of Vienna, Althanstraße 14, 1090 Vienna, Austria * Current address: Ecological Plant Genetics, Swiss Federal Institute of Technology Zürich (ETH), CHN G29, Universitätsstrasse 16, 8092 Zürich, Switzerland

This paper presents PCR primers and PCR conditions for low-copy nuclear genes in Ophrys and related orchid genera identified via screening of both published and newly designed primers. For Ophrys, the most useful markers identified in this screen are the LFY/FLO gene which contains an intron of 2 kb size and the MADS-box PI/GLO gene whose 2 first introns contain single nucleotide polymorphisms with variation at the populational level. In the taxa tested, our PCR primers amplified single-copy regions. Phylogenetic analysis of closely related taxa of Ophrys section Pseudophrys, based on LFY, revealed the following groups that are delimited by morphology: O. lutea s.l.; O. omegaifera s.l. with O. iricolor nested in this group; the two O. fusca s.l. taxa, O. leucadica and O. bilunulata; and the O. fusca s.l. taxon O. cinereophila together with a group of endemics from Crete.

KEYWORDS: LEAFY/FLORICAULA (LFY/FLO), low-copy nuclear sequence markers, Ophrys fusca s.l., Ophrys section Pseudophrys, PISTILLATA/GLOBOSA (PI/GLO), sexually deceptive orchids

data not permitting additional insights apart from the INTRODUCTION identification of tetraploid taxa in the east Mediterranean The European orchid genus Ophrys is remarkable (Greilhuber & Ehrendorfer, 1975; Bernardos & al., 2003; for its pollination by sexual deception which makes it an D’Emerico & al., 2005). interesting system for evolutionary studies (Kullenberg, The present study therefore seeks to evaluate nuclear 1961; Paulus & Gack, 1990). However, the reconstruction low-copy genes, to identify sequence markers that are of relationships within Ophrys, especially among very phylogenetically informative and can be used to infer closely related species, has been hindered by the lack of relationships within Ophrys at a fine level, using sect. resolution obtained with standard chloroplast or nuclear Pseudophrys as a model system. The usefulness of low- ribosomal internal transcribed spacer (ITS) sequence copy nuclear sequence markers is becoming increasingly markers (Pridgeon & al., 1997; Aceto & al., 1999; Soliva & recognised since they frequently outperform ITS and al., 2001; Bateman & al., 2003). The availability of highly plastid markers (e.g., Bailey & Doyle, 1999; Emshwil- variable sequence markers is therefore highly desirable ler & Doyle, 1999; Lewis & Doyle, 2002; Sang, 2002; to address the question of species relationships within Oh & Potter, 2003; Howarth & Baum, 2005). We have Ophrys. screened a large number of available PCR primers for Ophrys section Pseudophrys represents a monophy- nuclear genes to identify gene regions that may be useful letic group within which standard sequence markers do not within Ophrys and related orchids and in addition, have provide any resolution (Soliva & al., 2001; Bateman & al., designed novel primers from sequences in the sequence 2003; Bernardos & al., 2005). This section is characterised databases. by attachment of pollinia to a pollinator’s abdomen rather than its head. Section Pseudophrys contains the morpho- logically readily distinguishable O. lutea s.l., O. fusca s.l. and O. omegaifera s.l. complexes, and the O. iricolor/O. MATERIALS AND METHODS mesaritica species group which has often been considered Plant material and DNA extraction. — Ophrys to be a sub-group of the O. fusca s.l. complex (Paulus plant material (Table 1) was collected in the field and & al., 1990; Paulus, 1998). The relationships among and leaves preserved in silica gel. Non-Ophrys material within these complexes have so far been amenable only was from Orchis italica, Serapias cf. bergonii, Himan- to speculation based upon morphology, chromosomal toglossum hircinum and Himantoglossum (syn. Barlia)

493 Schlüter & al. • A screen of low-copy nuclear genes TAXON 56 (2) • May 2007: 493–504

Table 1. Taxa used and EMBL sequence database accession numbers for LFY. Species Acces- Taxon groupa Country, Island, Locality Dateb sion EMBL Sequence No. O. atlantica Munby O Spain, Alhaurin de la Torre 08.04.2004 196A AM489434 O. basilissa Alibertis & Reinhard O Greece, Samos, Klima 21.02.2004 174A AM489432 O. basilissa Alibertis & Reinhard O Greece, Kos, Asklepion 27.02.2002 66A AM489423 O. bilunulata Risso F Spain, Coin Las Delicias 09.04.2004 198A AM489435 O. cinereophila Paulus & Gack F Greece, Crete, Akoumia 02.04.2003 114A AM489427, AM489428 O. creticola Paulus F Greece, Crete, Jouchtas 30.03.2003 104A AM489426 O. iricolor Desfontaines F Greece, Crete, Kato Horio 29.03.2003 100C AM489425 O. iricolor Desfontaines F Greece, Crete, Ag. Paraskies 30.03.2003 106A AM489419 O. iricolor Desfontaines F Greece, Athens 26.03.2004 208A AM489436 O. “kedra” Paulus (nom. prov.) F Greece, Crete, Spili/Gerakari 07.05.2003 150A AM489431 O. leucadica Renz F Greece, Kos, Kephalos 01.03.2002 67A AM489424 O. omegaifera Fleischmann O Greece, Crete, Thripti 25.03.2002 37A AM489420 O. “pallidula” Paulus (nom. prov.) F Greece, Crete, Thripti 04.05.2003 145C AM489430 O. phryganae Devillers-Terschuren & Devillers L Greece, Rhodes, Kattavia 21.04.2003 120A AM489429 O. sicula Tineo L Greece, Samos, Klima 22.02.2004 177A AM489433 O. sitiaca Paulus, Alibertis & Alibertis O or F Greece, Crete, Jouchtas 14.02.2001 61A AM489422 O. tenthredinifera Willdenow E Greece, Crete, Gourtinia ??.02.2001 56A AM489421 Note: All plants collected by HFP with vouchers in WU, except accessions 120A and 208A, collected by PMS and M. Fiedler, respectively. aPutative membership of the listed taxa in morphological species groups within Ophrys sect. Pseudophrys are indicated, where F, Ophrys fusca s.l.; L, O. lutea s.l.; O, O. omegaifera s.l.; while E is Ophrys sect. Ophrys (syn. Euophrys). bDates are given in DD.MM.YYYY format. robertianum. Additional plant material (Dendrobium, and 3) were screened with standard PCR protocols on a Vanilla, Asparagus) was obtained from plants grown at gradient PCR machine (Thermo Hybaid PX2 or Corbett the Botanical Garden of the University of Vienna. DNA Research Palm-Cycler) using annealing temperatures was extracted using DNeasy Plant Mini Kit (Qiagen) between 40°C and 65°C degrees. Initial reactions were and the manufacturer’s protocol, eluting DNA in 200 performed in a volume of 25 µL containing 12.5 µL RED- µL Tris-EDTA, pH 8.0. In addition, genomic DNA from Taq ReadyMix PCR Reaction Mix (Sigma-Aldrich), 1 Arabidopsis thaliana (Invitrogen, included in the AFLP µL of each, 5 µM forward and reverse primers, and c. Core Reagent Kit) was used. 25 ng genomic DNA. Thermal cycling conditions were

Primer design. — For design of new primers, we 95°C 4 min.; 38× (95°C 40 sec.; TA 40 sec.; 72°C 3 min.); used sequences available in the public databases and 72°C 10 min.; 4°C hold, where in each PCR, annealing amino-acid alignments of exons between distantly related temperatures (TA ) varied over a 15°C temperature gra- taxa (where available, including orchid sequences) to iden- dient depending on the expected melting temperatures tify highly conserved regions and noted known intron of the primers used. PCR products were loaded on 1% positions. Alignments were carried out using Clustal agarose gels in TAE (tris acetate EDTA) buffer stained X (Thompson & al., 1997) and Bioedit 7 (Hall, 2001). with ethidium bromide (0.28 mg/L) and photographed Primers were then designed from nucleotide sequence under UV light using a Gel Doc 2000 system (BioRad). If alignments such that (1) their binding sites would lie in no amplification product was obtained, DNA and primer conserved exonic gene regions, (2) PCR would amplify concentrations were varied, different polymerases (e.g., enough exonic sequence to allow gene identification by Taq DNA polymerase, recombinant, from Fermentas) BLAST searches and (3) also variable intronic or exonic used, and in some cases, the thermal cycling conditions sequence would be amplified. In particular, PI and LFY altered. PCR reactions that yielded either a smear or weak primer design was aided by GenBank sequence AB094985 amplification products were subjected to a two-step PCR from Orchis italica and the orchid LFY sequences ob- optimisation testing different buffer systems and PCR en- tained by Montieri & al. (2004), respectively. Primers hancers, using PCR Optimization Kit II (Sigma-Aldrich) were checked for expected melting temperature, loops and the manufacturer’s protocol. If multiple bands were and primer-primer interactions using Oligo Analyzer 1.0.2 obtained, they were separated by excision and elution from software (Kuulasmaa, 2002). gel using QIAquick Gel Extraction Kit (Qiagen). Ampli- Marker screening via polymerase chain reaction fied fragments were then sequenced directly to check a (PCR). — Both published and new primers (Tables 2 PCR product’s identity by BLAST searches, or cloned and

494 TAXON 56 (2) • May 2007: 493–504 Schlüter & al. • A screen of low-copy nuclear genes

Table 2. PCR primers developed in this study. I. Primers for LFY Primer Primer sequence (5′→3′) Primer Binding Site Length PCR primers for amplification of LFY from genomic DNA E1Cf ATGGTGCTGGCCACATCGCAGCAACA 1 26 E2Gr GAAGAGGTAATCGAGCCCGTTCTTCTTAGCYC 2791 32 Nested PCR primers for LFY E1Jf GGAGCTAGAGGAGGTGTTCGAGG 96 23 E1Bf GGTACTCGACGATTGCTCGG 131 20 E1Af CGCTCTCGACGCACTTTCC 465 19 I1Df CCGTCAGCTTGTTTGTTCCTCAC 576 23 I1Ef CGTCTGTTCCATTGAACTTCTTGG 651 24 I1Ff ATGTATCTTCATCCGATTTGGAATG 816 25 I1Af AAGTCATTTCAGACAATCTTAAGTTTKG 1029 28 I1Ar CMAAACTTAAGATTGTCTGAAATGACTT 1029 28 I1Gf CGACCGCCAACACGCACCTAACAAAG 1241 26 I1Gr CTTTGTTAGGTGCGTGTTGGCGGTCG 1241 26 I1Cf GATACAGATATRCTGTTCAAAGAGC 1425 25 I1Cr GCTCTTTGAACAGCATATCTGTATC 1425 25 I1Kf ATTAGGATGAAAGCAGTAAGATTGC 1714 25 I1Kr GCAATCTTACTGCTTTCATCCTAAT 1714 25 I1Lf TTGAATATGGCTATTCGCAGTTCA 1837 24 I1Lr TGAACTGCGAATAGCCATATTCAA 1837 24 I1Jr AATAAAACAAATAGCAAAAGTGCCC 2064 25 I1Br TACTAAAATGTGCTGACAAATG 2275 22 E2Ar AGCTGCACTGGCTCCTCAG 2524 19 E2Lr CCTTTCCATCTCTCCTGCCTA 2578 21 E2Kr CCGTCGTCATCCTCATCATTCTC 2739 23 II. Primers for other genes Target genes/proteins Primer Primer sequence (5′→3′) Length Acyl-CoA ∆9 desaturase D9Des1f TTTCAYCAYCARTTYACIGAYWSIGA 26 D9Des1r TCRAAIGCRTGRTGRTTRTTRTGCCA 26 Acyl-CoA ∆12 desaturase D12Des2f CAYMGIMGICAYCAYWSIAAYACIGG 26 D12Des3r AAIARRTGRTGIGCIACRTGIGTRTC 26 APETALA3/DEFICIENS (AP3/DEF) Def4f ARGARCTGCGCGGTCTTGAGCAA 23 Def5r GTYTGIGTRSYGATGATSACATGATA 26 Asparagine synthetase AsnStAf TGATGATGAAGAGAATCCTTATC 23 AsnStBr GCATTCAGCATCATTCTATCAG 22 AsnStCr ACCTTTCAAAGATCATTCTGTAG 23 Ataxia telangiectasia mutated (ATM ) ATM1f GAYGAYCTNAGRCARGAYGCNGT 23 ATM2r CCYTGYTCRAANGCNACNCCNAGRTCDATRTG 32 CONSTANS-Like (COL) Col1f TGYGAYGCYGAYATYCAYTCYGCYAAYCC 29 Col2r GCRTAYCTDATNGTYTTYTCRAA 23 Cytokinin oxidase 1 (OCkx1) OCko1E2f AGCAGAGCTGATAAAGCTCAG 21 OCko1E3f ATGTTCCACATCCATGGCTC 20 OCko1E3r AGCCATGGATGTGGAACATC 20 OCko1E4r CTGGAATTGAAGTAGACATCC 21 Ockx2f GTGTTAGGAGGTTTGGGWCARTTYGG 26 Ockx3r AGAGRTTRAGCCAWGGATGWGGAAC 25 PISTILLATA (PI) M1f AGATCAAGCGSATCGAGAAC 20 K1r CTTGATCCKATCRATYTCCG 20 Sucrose synthase Susy7f GRTGTTCAAYGTYGTYATCYTVTCYCCYCAYG 32 Susy8f AYCAAGTICGYGCKITGGAGAAYGARATGC 30 Susy11r CRATYTCTTGGAAIGTRCTKGTGATGATGAARTC 34 Susy12r GASACRATRTTGAACTTIGGRTCRAAIACATC 32 Note: All primers are written as 5′→3′ sequences (where I is inosine), and the length of primers is indicated. For LFY primers, the 5′ nucleotide of the primer binding-site is indicated; the sequence used here as a reference is that of O. iricolor (accession 106A; EMBL accession AM489419), position 1 corresponding to the first nucleotide in exon 1. LFY primers are sorted in order of their occurrence in the gene (5′ to 3′; see also Fig. 1). The first two characters of LFY primer names indicate exon 1, 2 and intron 1, the third letter being a unique primer position within that gene region and f and r denoting forward and reverse primers. PI primers M1f and K1r bind in the MADS and K-domains of the gene, respectively.

495 Schlüter & al. • A screen of low-copy nuclear genes TAXON 56 (2) • May 2007: 493–504

Table 3. Nuclear genes screened in this study. Results in Gene product (Acronym) Number of primers (Ref.)a Ophrysb Comments Actin 2 (*Arab. 368) – Acyl-CoA ∆9 desaturase 2 (this study) – – in positive control Acyl-CoA ∆12 desaturase 2 (this study) - Alcohol dehydrogenase (ADH) 2 (Strand & al., 1997), - +S in Dendrobium 2 (Small & Wendel, 2000) Apetala3/Deficiens (AP3/DEF) 2 (this study) + (multiple) Multiple bands, not further analysed Asparagine synthetase 3 (this study) - + in Asparagus Ataxia telangiectasia mutated (ATM) 2 (this study) + Calmodulin (CaM) 2 (Strand & al., 1997) - Cellulose synthase (CEL) 2 (*Rice. 313) + Cellulose synthase (CES) 2 (*Arab. 222) – Chalcone isomerase (CHI) 2 (Strand & al., 1997) – Chalcone synthase (CHS) 2 (Strand & al., 1997) – Chloroplast-expressed glutamine synthetase 2 (Emshwiller & Doyle, 1999) - Constans-like (COL) 2 (this study) + (multiple) Multiple bands, not further analysed Cytokinin oxidase 1 (OCkx1) 6 (this study) - +S in Dendrobium eIF2-γ 2 (*Arab. 156) – Glyceraldehyde 3-phosphate dehydrogrenase 2 (Strand & al., 1997) +S (G3PDH, GAPDH, GapC locus) 2 (Wall, 2002), 2 (this study) Heat shock protein 70, putative (Hsp70) 2 (*Arab. 262) - Leafy/Floricaula (LFY/FLO) 2 (+ nested primers, this study) +SV Malate synthase 2 (Lewis & Doyle, 2002) + Methionine synthase 2 (*Arab. 379) + Phosphoenolpyruvate carboxylase (PEPC) 2 (Gehring & al., 2001), + +S in Vanilla 2 (D. Fulop, pers. comm.), 2 (*Arab. 163) 6-Phosphoglucose isomerase (PGI, GPI) 2 (Strand & al., 1997) - Phytochrome C 5 (Mathews & Donoghue, 1999) - - in positive control for some combinations Phosphoribulokinase (PRK) 7 (Lewis & Doyle, 2002) + Pistillata/Globosa (PI/GLO) 2 (this study) +SV RNA polymerase II (RPB1) 2 (*Arab. 183) – Serine/Threonine protein kinase, putative 2 (*Arab. 069) + Splayed (SPD) 2 (*Arab. 076) - Sucrose synthase 4 (this study), 2 (*Arab. 185) +S Triose phosphate isomerase (TPI, TIM) 2 (Strand & al., 1997) – aAn asterisk (*) in the reference column identifies primers that were developed by use of the database approach of Xu & al. (2004) and whose sequences were kindly provided by J. Padolina. For these, the primer database code is given. bResults in the study group are, no amplification at all (–), no clear amplification product (-), good amplification product (+), good amplification with sequence matching target gene in BLAST searches (+S), and (+SV) as before but with sequence variation in Ophrys fusca s.l. taxa.

496 TAXON 56 (2) • May 2007: 493–504 Schlüter & al. • A screen of low-copy nuclear genes

sequenced, as detailed below. Initial screening was on ditions, both from genomic DNA and floral cDNA. Typical DNA material from Ophrys and positive controls, which conditions for PCR performed in 20 µL used 0.8 µL of were Arabidopsis thaliana where suitable, and otherwise each, 5 µM M1f forward and K1r reverse primer (Table 2), the organism from which the gene under consideration 10 µL REDTaq ReadyMix (Sigma-Aldrich) and 1 µL 1 : 10 was first isolated. Variability of sequences was compared dilution of genomic DNA (c. 25 ng). The following PCR between closely related Ophrys accessions (Table 1; at programme is suitable for amplification of PI from Ophrys least 5 randomly chosen DNAs). and related orchids: 95°C 4 min.; 38× (95°C 30 sec.; 50°C Sequencing. — Amplification products were se- 30 sec.; 72°C 3 min.); 72°C 10 min.; 4°C hold. quenced using BigDye 3.1 (Applied Biosystems) and Dy- Routine amplification conditions for LFY. — enamic ET dye terminators (Amersham) using the manu- The amplification of LFY from genomic DNA was only facturers’ protocols scaled to a reaction volume of 10 µL. possible under optimised PCR conditions. Antibody Sequences were loaded on ABI 377 or ABI 3130XL DNA hotstart PCR was performed with primers (Table 2 and sequencers (Applied Biosystems) after loading preparations Fig. 1) located in exons 1 and 2 of LFY. Reactions were as recommended by the sequencer manufacturer. performed in 20 µL volume using 2 µL 10× AccuTaq Cloning of PCR products. — PCR products were LA PCR buffer (Sigma-Aldrich; 500 mM Tris-HCl, pH cloned into pGEM-T vector (Promega) and inserted into E. 9.3, adjusted with NH4OH, 150 mM (NH4)2SO4, 25 mM coli JM109 cells (Promega) by chemical transformation, MgCl2, 1% Tween 20), 1 µL 10 mM each dNTP (Fermen- using the manufacturer’s protocols. Cells were plated out tas), 1.6 µL of each, 5 µM E1Cf forward and E2Gr reverse on LB medium containing 50 mg/L ampicillin, IPTG and primer, 1 µL 1 u/µL Jumpstart REDAccuTaq LA DNA X-Gal so as to identify positive clones. Inserts were ampli- polymerase (Sigma-Aldrich) and 1 µL genomic DNA fied from apparently positive clones by colony PCR using extract (c. 250 ng). The PCR programme used was 96°C M13 forward (–20) and reverse vector-located primers. At 25 sec.; 37× (94°C 10 sec.; 60°C 30 sec.; 68°C 5 min.); least 16 colonies were screened for insert size variation 68°C 15 min.; 4°C hold. Resulting PCR products were per cloning reaction and 5 clones of every size class were separated on a 1% agarose-TAE gel, excised and PCR then directly sequenced. products of ~3 kb length purified from the gel. 1 µL of Cloning of the LFY genomic PCR product. — All a 1 : 10 dilution of purified Ophrys LFY PCR fragment attempts to clone the LFY genomic PCR fragment (see be- was used as a template for each nested PCR with a dif- low) failed, using pGEM-T (Promega), StrataClone Blunt ferent combination of nested primers (Table 2 and Fig. PCR Cloning Kit (Stratagene), TOPO TA (Invitrogen) or 1). Nested PCR was performed in 20 µL reactions using TOPO Zero Blunt (Invitrogen), and the manufacturers’ 0.8 µL of each, 5 µM forward and reverse primer, 10 µL protocols for cloning and preparation of PCR fragments RedTaq ReadyMix (Sigma-Aldrich) and the following for cloning, i.e., blunting of PCR fragment ends using Pfu PCR programme: 95°C 1 min.; 38× (94°C 20 sec.; 60°C DNA polymerase, or A-tailing using Taq DNA polymerase. 30 sec.; 72°C 3 min.); 72°C 10 min; 4°C hold. All nested Since simple cloning proved impracticable, PCR products primer combinations expected to work could be ampli- were subcloned using Alu I and Rsa I-digested amplicons fied, typical combinations being E1Jf–I1Ar, I1Ef–I1Jr and in Sma I-digested pUC18 vector (enzymes, protocols and I1Cf–E2Kr. For routine sequencing of LFY, removal of vector from Fermentas). Inserts were then amplified by residual primers and nucleotides from nested PCR frag- colony PCR using M13 primers and sequenced as detailed ments was accomplished by cleaning them enzymatically above. with E. coli exonuclease I (Fermentas) and calf intestine Routine amplification conditions for PI. — PI alkaline phosphatase (Fermentas) using the method of could be amplified reliably under a wide range of PCR con- Werle & al. (1994) with slight modifications. 5–7 µL of

Fig. 1. LFY primer map showing exon 1, intron 1 and exon 2 of the gene, using a sequence from O. iricolor as reference sequence (accession 106A; EMBL accession AM489419). Major insertions and deletions found in Ophrys sect. Pseudophrys relative to O. iricolor are indicated. The letter indicated for primer designations (see Table 2) is unique within each exon and intron. Bold face is used for genomic PCR primers and italics for intronic primers.

497 Schlüter & al. • A screen of low-copy nuclear genes TAXON 56 (2) • May 2007: 493–504

cleaned nested PCR fragments were used for sequencing the EMBL sequence database (for accession numbers see as detailed above. Table 1), and aligned using Clustal X (Thompson & al., PCR walking. — PCR walking was carried out 1997) and Bioedit 7 (Hall, 2001). Where clearly distin- following the protocol of Siebert & al. (1995), using 1 µg guishable allelic variants were encountered in a single of genomic DNA for generation of adapter-ligated DNA individual, two allelic sequences were compiled that were libraries after digestion with Dra I, Eco RV (Eco 32I), Ssp I, maximally different. Partial intron sequences of several Stu I (Eco147I), Pvu II, Sma I or Sca I (all enzymes from individuals of the same population were checked for ad- Fermentas) and a PCR set-up as detailed for the ampli- ditional allelic variation. A model of molecular evolution fication of LFY from genomic DNA. Differing from the was estimated using Modeltest 3.7 (Posada & Crandall, original protocol (Siebert & al., 1995), the short adapter 1998) for the entire nucleotide dataset and separately for strand used was 5′-pACCTGCC-s-ddC-3′, where s indi- exon and intron sequence using MrModelTest 2.2 (Nylan- cates a phosphothiorate linkage to prevent exonucleolytic der, 2004). The model of evolution selected for the entire cleavage (as suggested by Padegimas & Reichert, 1998), nucleotide data was HKY + Γ in a hierarchical likelihood and ddC is a terminal 2′,3′-dideoxy-C to prevent priming ratio test (hLRT) and TVM + I using the Akaike infor- from the oligonucleotide’s 3′ end during PCR. mation criterion (AIC). When exon and intron data were Reverse transcriptase (RT)-PCR for PI. — Flow- treated separately, the models F81 + I + Γ or GTR + I were ers collected in the field were dissected into lip, petals, selected for exon and HKY +Γ  or GTR + Γ for intron data, sepals and column, and frozen in liquid N2. Messenger using hLRTs or the AIC, respectively. Maximum parsi- RNA was extracted with QuickPrep Micro mRNA Puri- mony (MP) analysis with equal character weights was per- fication Kit (Amersham) and the manufacturer’s protocol. formed in PAUP* 4b10 (Swofford, 2002) using a heuristic All mRNA obtained (suspended in a volume of 10 µL) search with 10 random sequence addition replicates. Most was reverse transcribed using 100 pmol anchored oligo- parsimonious trees were summarised by consensus tree dT primer (5′-pT18VN-3′), RevertAid H Minus M-MuLV methods available in PAUP*. Maximum likelihood (ML) Reverse Transcriptase (Fermentas) and Ribonuclease In- analysis in PAUP* using a heuristic search with 10 random hibitor (Fermentas), according to the supplier’s protocol sequence addition replicates were performed with both, and PCR carried out for PI as described above, but using the model selected using hLRT and AIC. Bootstrap branch Jumpstart REDAccuTaq LA Polymerase (Sigma-Aldrich) support in ML and MP reconstructions was estimated and 68°C extension temperature. using 100 pseudo-replicates. Single-strand conformational polymorphism For Bayesian inference, information from insertion/ (SSCP) analysis of PI PCR products. — SSCP were deletion (indel) characters compiled from the sequence performed for PI to assess the allelic variation pattern. PI alignment were included, using complex indel coding was amplified by PCR both from genomic DNA of Oph- (Simmons & Ochoterena, 2000). Indel characters were rys populations (not sequenced) and clones with known largely unambiguous so that the use of step matrices sequence in a volume of 20 µL, as described above. Five was unnecessary. Bayesian phylogenetic inference was microlitres of PCR products were then digested with 1 u carried out in MrBayes 3.1.2 (Ronquist & Huelsenbeck, Rsa I (Fermentas) in a reaction volume of 10 µL for 3 hrs 2003) on the complete nucleotide sequence combined at 37°C, and then kept at 4°C. The restriction digest (10 with the indel data matrix. Separate models of evolution µL) was then combined with 10 µL of SSCP loading dye for exon and intron characters were used, as selected in (10 mM NaOH, 0.03% bromophenol blue, 0.03% xylene either hLRT or AIC, indel information being treated as cyanol, in formamide abs.), denatured for 5 min. at 95°C ‘standard’ (morphological) data. Two parallel analyses and immediately chilled on ice, for a minimum of 3 min., with three Markov-chain Monte Carlo (MCMC) chains until loading of 5 µL on a native 12 % polyacrylamide gel were run for 10 million generations. Results from the (50 : 1 acrylamide : bis-acrylamide, with 0 or 5% glycerol) first one million generations were discarded, MCMC in Tris-borate EDTA (TBE) buffer. Electrophoresis was sampling seemingly having converged by this time in carried out at 22°C and 50 V for 20 min. followed by all cases. 250 V for 3 hrs in a Hoefer SE 600 Electrophoresis system (Amersham) coupled to a MultiTemp Thermostatic Circulator (Amersham). Gels were stained with PlusOne DNA Silver Staining Kit (Amersham) and the manufac- RESULTS turer’s protocol, and included digested, but undenatured Marker screening. — The results of the PCR PI dsDNA controls as well as undenatured Generuler 100 marker screen are summarised in Table 3. Most primer bp DNA ladder (Fermentas). combinations either did not yield PCR products, yielded Phylogenetic analysis of LFY. — Sequences were PCR products that were unsuitable, or PCR products did edited using SeqMan II (DNAStar Inc.) and entered into not contain sequences that corresponded to target loci.

498 TAXON 56 (2) • May 2007: 493–504 Schlüter & al. • A screen of low-copy nuclear genes

Amongst those genes that could be amplified were Adh populations or taxa. Because PI variation was unlikely and Cko1 in Dendrobium, PI/GLO, LFY/FLO, AP3/DEF, to be phylogenetically informative, putative SSCP alleles and genes for G3PDH and sucrose synthase for Ophrys. were not cloned and PI not pursued further as a phylo- However, lack of variability or poor sequence quality genetic marker within Ophrys fusca s.l. Comparison of that precluded design of more specific primers led us to PI sequences of exons 1–3 (266 bp) show 19 silent sub- discontinue laboratory efforts for most of these, leaving stitutions among Ophrys thriptiensis and Orchis italica. only PI and LFY for further characterisation. PCR of cDNA from dissected Ophrys fusca s.l. flowers The PI/GLO gene. — Based on the sequence of showed PI to be expressed in the lateral and dorsal sepal, the 441 bp PI PCR product, spanning the first two in- petals, the lip and the column. trons, and PCR walking experiments, the positions of The LFY/FLO gene. — The ~3 kb LFY genomic PCR the first three introns in Ophrys thriptiensis PI (EMBL product spans intron 1 and sequences can be obtained accessions AM489437 to AM489439), compared with reliably from nested PCR products. LFY was found to be the Orchis italica cDNA sequence, correspond to in- phylogenetically informative within Ophrys sect. Pseu- tron positions in Antirrhinum majus GLO (Tröbner & dophrys and a summary of the variability encountered in al., 1992) rather than Arabidopsis thaliana PI (Goto & LFY is presented in Table 4. Intron-exon boundaries of Meyerowitz, 1994). In Ophrys, PI introns 1, 2 and 3 are the first Ophrys LFY intron are in good agreement with 85, 90 and > 119 bp in length with exon-intron junctions eukaryotic consensus splice sites (Long & Deutsch, 1999; AC/GT..AG/GT (exon/intron/exon), AG/GT..AG/AA and Moore, 2000). We observed great length variation of the AG/GT.., respectively. Variation among PI clones was LFY genomic PCR product among Ophrys and related limited, identifying two alleles in O. thriptiensis dif- genera, suggesting considerable variation in intron length fering by two point mutations in intron 2. These, but no (inferred approximated intron lengths are Ophrys iricolor: additional alleles, were also found in O. cinereophila, 2 kb, Himantoglossum hircinum: 1.5 kb, Himantoglossum O. iricolor, O. creberrima and O. leucadica individuals. robertiamum: 1.8 kb, Serapias cf. bergonii 0.1 kb, Orchis Additional putative alleles were identified using SSCP italica: 1 kb). Even within Ophrys, LFY intron 1 contains a of Rsa I-digested PI PCR products from an Ophrys pop- number of indels of > 30 bp length, smaller indels present ulational sample of the same taxa, although occurrence even within the closely related taxa of the O. fusca s.l. of these alleles did not seem to coincide with Ophrys group.

Table 4. Comparison of nucleotide and indel characters obtained from LFY (this study), and trnL and ITS data available in the public sequence databases. Variation is shown (1) in comparison with an outgroupa taxon and (2) within the ingroupb. Ingroup + Ophrys tenthredinifera Ingroup only

Gene/region Characters Nt Nu Ni Nv %Var Nu Ni Nv %Var

LFY (nuclear) Ingroup + O.t. (Nseq=18; Ntax=14) Ingroup only (Nseq=17; Ntax=13) Total sequence 2847 98 58 156 5.5% 25 57 82 2.9% Exon sequence 760 16 3 19 2.5% 2 3 5 0.7% Intron sequence 2087 82 55 137 6.6% 23 54 77 3.7% Indel characters 37 17 20 37 – 5 19 24 –

trnL (chloroplast) Ingroup + O.t. (Nseq=3; Ntax=3) Ingroup only (Nseq=2; Ntax=2) Total sequence 804 – – 8 1.0% – – 1 0.1% Exon sequence 311 – – 4 1.3% – – 1 0.3% Intron sequence 493 – – 4 0.8% – – 1 0.2% Indel characters 2 – – 2 – – – 2 –

ITS (nuclear ribosomal DNA) Ingroup + O.t. (Nseq=12; Ntax=11) Ingroup only (Nseq=11; Ntax=10) Total sequence 629 11 0 11 1.7% 3 0 3 0.5% ITS1 spacer 237 8 0 8 3.8% 3 0 3 1.3% 5.8S rRNA gene 153 0 0 0 0.0% 0 0 0 0.0% ITS2 spacer 239 3 0 3 1.3% 0 0 0 0.0% Indel characters 0 0 0 0 – 0 0 0 –

Note: Column headings are as follows: Nseq, number of sequences; Ntax, number of taxa; Nt, total number of characters; Nu, parsimony uninformative characters; Ni, parsimony informative characters; Nv, total number of variable characters; %Var, percentage of variable nucleotide characters. aO. tenthridinifera was used as an outgroup taxon, and includes O. tenthredinifera LFY exon data from Montieri & al. (2004). ITS data from Soliva & al. (2001) and Bernardos & al. (2005 and 1 unpublished sequence); trnL data from Soliva & al. (2001). bIngroup refers to Ophrys sect. Pseudophrys.

499 Schlüter & al. • A screen of low-copy nuclear genes TAXON 56 (2) • May 2007: 493–504

Phylogenetic reconstructions. — The phylogeny acters were included or not. In all reconstructions, we (Fig. 2) of closely related taxa of Ophrys sect. Pseudo- found the O. lutea s.l. taxa, O. sicula and O. phryganae as phrys inferred from the LFY gene is well resolved. Tree one group, which is sister to the group formed by morpho- topologies and branch lengths obtained from different logically very similar O. bilunulata and O. leucadica from phylogenetic analyses and different models of molecular the west and east Mediterranean, respectively. Members evolution agreed well with each other, whether indel char- of the O. omegaifera complex including O. omegaifera,

Fig. 2. Phylogenetic reconstructions from the LFY dataset. The tree shown is a Bayesian tree with hLRT-selected models of evolution for exon and intron data, and indel data. Posterior support is shown above branches. Bootstrap support for maximum likelihood (hLRT-selected model) and maximum parsimony topologies, respectively, is indicated below branches, where support was greater than 50.

500 TAXON 56 (2) • May 2007: 493–504 Schlüter & al. • A screen of low-copy nuclear genes

O. basilissa, O. sitiaca and O. atlantica appeared as a target a 5′ portion of PI, additional sequence variation sister group to these two groups, with O. iricolor nested would be expected in the 3′ region of the gene, covering in O. omegaifera s.l. A further group obtained contained PISTILLATA’s C domain. O. cinereophila and the endemic taxa from Crete, O. The LFY/FLO gene. — In flowering plants, LFY creticola, O. pallidula and O. kedra. (LEAFY in Arabidopsis thaliana; FLORICAULA [FLO] in Antirrhinum majus) is a floral meristem identity gene and an important flowering time pathway integrator, several genetic pathways resulting in the expression of LFY (Wei- DISCUSSION gel & al., 1992; Blázquez & Weigel, 2000; Parcy, 2005; Effectiveness of primer screening for marker Simpson & Dean, 2005; Yoon & Baum, 2005). The LFY isolation. — As can be seen from the high number of protein acts as a transcription factor and its activation in markers initially tested, screening of previously charac- turn leads to the activation of the floral meristem and terised markers did not prove to be a very effective means consequently to flowering (Blázquez & al., 1997; Wagner of identifying suitable low-copy markers for use in closely & al., 2004; William & al., 2004; Maizel & al., 2005). LFY related Ophrys taxa. A more efficient approach to marker is present as a single-copy or low-copy gene in many plant identification may have been isolation of markers from groups (Frohlich & Meyerowitz, 1997; Frohlich & Parker, cDNA (Schlüter & al., 2005; Whittall & al., 2006). How- 2000; Gocal & al., 2001; Wada & al., 2002; Bomblies & ever, since good quality mRNA only became available al., 2003). In Orchis and other investigated orchid genera when screening efforts were nearing completion, cloning including Ophrys, a single copy of LFY could be identified of mRNA was not available as an alternative option. The by Southern blotting (Montieri & al., 2004). Therefore, apparent inefficiency of identifying variable sequence at least in diploid European Orchidoideae, paralogy is markers using a primer screening approach may in part be unlikely to be an issue when using LFY for phylogeny due to (1) many screened markers having been developed reconstructions. LFY has been used for phylogenetic pur- for different plant groups (many are for dicots) and (2) poses in other plant groups (Oh & Potter, 2003, 2005; Grob many genes having housekeeping functions and a high & al., 2004; Hoot & al., 2004; Howarth & Baum, 2005), degree of sequence conservation. It is interesting to note where the second intron of LFY typically is the longer in this respect that the best marker identified in the pres- one (e.g., Bomblies & al., 2003). In Orchis, however, the ent study, LFY, is a gene involved in development rather first intron (1 kb) is larger than the second (0.1 kb) intron than metabolism. (Montieri & al., 2004), which is likely also true for Ophrys The PI/GLO gene. — The PI/GLO (PISTILLATA/ and related genera. The observed intron length variation GLOBOSA) gene of eudicots is a MIKC-type B-class among genera is also mirrored by the large number of LFY MADS-box gene involved in establishing petal and indels within Ophrys sect. Pseudophrys, as compared to stamen organ identity, its function in monocots being ITS. Clearly, the overall information content is higher for less clear (e.g., Krizek & Fletcher, 2005, and references LFY than for ITS or trnL, LFY harbouring 5.8 times more therein). PI expression in all parts of the Ophrys flower is per cent variable nucleotide characters in the ingroup than in agreement with the expression pattern reported by Tsai ITS. Moreover, since the amplified LFY gene region is & al. (2005). The limited variation encountered among longer than ITS, the absolute number of characters obtain- clones from PI genomic PCR products suggests that our able from it is greater. PCR primers pick up a single copy of the gene in Ophrys, Phylogenetic inference. — The phylogeny (Fig. despite the fact that our PCR primers target conserved 2) of closely related taxa of Ophrys taxa based on LFY is regions of PI. This may indicate that a PI homologue is well resolved and represents a major improvement over present as a single copy gene in Ophrys, as has been found previous phylogenetic reconstructions (Pridgeon & al., in the tropical orchid Phalaenopsis (Tsai & al., 2005). 1997; Aceto & al., 1999; Soliva & al., 2001; Bateman & Southern blot experiments would be necessary to test this al., 2003; Bernardos & al., 2005). It clearly shows the hypothesis. PI has previously been used for phylogenetic potential of the first intron of the single-copy gene LFY. purposes in dicots (Bailey & Doyle, 1999). Although our Unfortunately, the rather tedious laboratory work neces- PI PCR fragment is not phylogenetically informative sary to extract sequence information from this gene makes within Ophrys fusca s.l., the presence of multiple alleles in it difficult to use LFY for routine sequencing with a large this group suggest that PI may be a useful genetic marker number of samples. for the study of Ophrys populations. Also, the number Our phylogenetic reconstructions in part confirm of substitutions among Ophrys thriptiensis and Orchis relationships of taxa based on morphology and pollination italica PI coding sequences suggest that this gene is likely biology. LFY data support the distinctness of O. fusca s.l., to be phylogenetically informative at the level of species O. lutea s.l. and O. omegaifera s.l., although two sepa- groups or genera. While the here described PCR primers rate groups including O. fusca s.l. taxa were identified.

501 Schlüter & al. • A screen of low-copy nuclear genes TAXON 56 (2) • May 2007: 493–504

This would suggest that an O. fusca-type species may plants: comparison to nrDNA ITS and trnL intron in have been at the base of Ophrys sect. Pseudophrys. The Sphaerocardamum and other Brassicaceae. Molec. Phylog. placement of O. sitiaca in the O. omegaifera complex is in Evol. 13: 20–30. agreement with AFLP data (Schlüter & al., in press). How- Bateman, R.M., Hollingsworth, P.M., Preston, J., Yi-Bo, L., Pridgeon, A.M. & Chase, M.W. 2003. Molecular phylo- ever, based on morphology, O. iricolor would have been genetics and evolution of Orchidinae and selected Haben- expected to be nested in the mainly Andrena-pollinated O. ariinae (Orchidaceae). Bot. J. Linn. Soc. 142: 1–40. fusca complex rather than in the O. omegaifera complex, Bernardos, S., Amich, F. & Gallego, F. 2003. Karyological which is pollinated by Anthophora rather than Andrena and taxonomical notes on Ophrys (Orchidoideae, Orchid- males. Taken together, our phylogenetic reconstruction aceae) from the Iberian Peninsula. Bot. J. Linn. Soc. 142: is in good agreement with the grouping of taxa based on 395–406. pollinators and on morphology, and for the first time pro- Bernardos, S., Crespí, A., del Rey, F. & Amich, F. 2005. The section Pseudophrys (Ophrys, Orchidaceae) in the Iberian vides a molecular hypothesis for the relationship among Peninsula: a morphometric and molecular analysis. Bot. J. O. fusca s.l., O. lutea s.l. and O. omegaifera s.l. groups. Linn. Soc. 148: 359–375. However, it is clear that a phylogeny based on a single Blázquez, M.A., Soowal, L.N., Lee, I. & Weigel, D. 1997. gene does not necessarily reflect organismic history (see LEAFY expression and flower initiation in Arabidopsis. e.g., Sang, 2002). Particularly, recent speciation events or Development 124: 3835–3844. hybridisation may lead to incongruence between species Blázquez, M.A. & Weigel, D. 2000. Integration of floral induc- tive signals in Arabidopsis. Nature 404: 889–892. and gene trees, where recent species divergence may mean Bomblies, K., Wang, R.-L., Ambrose, B.A., Schmidt, R.J., that coalescence of alleles can pre-date the establishment Meeley, R.B. & Doebley, J. 2003. Duplicate FLORI- of reproductive isolation among speciating populations, CAULA/LEAFY homologs zfl1 and zfl2 control inflores- especially if ancestral population size was large. Like- cence architecture and flower patterning in maize. Devel- wise, gene flow among species may lead to the presence opment 130: 2385–2395. of additional alleles in a species, which, depending on D’Emerico, S., Pignone, D., Bartolo, G., Pulvirenti, S., Ter- the amount of genetic divergence of hybridising species, rasi, C., Stuto, S. & Scrugli, A. 2005. Karyomorphology, heterochromatin patterns and evolution in the genus Oph- may or may not be readily distinguishable from ancestral rys (Orchidaceae). Bot. J. Linn. Soc. 148: 87–99. polymorphism. Clearly, inference of evolutionary history Emshwiller, E. & Doyle, J.J. 1999. Chloroplast-expressed glu- in Ophrys should ideally employ multiple nuclear genes, tamine synthetase (ncpGS): potential utility for phyloge- the highly variable single-copy gene LFY being one of the netic studies with an example from Oxalis (Oxalidaceae). tools required. We hope that the availability of low-copy Molec. Phylog. Evol. 12: 310–319. markers for the genus Ophrys will further our understand- Frohlich, M.W. & Meyerowitz, E.M. 1997. The search for ing of evolution in this difficult group. flower homeotic gene homologs in basal angiosperms and Gnetales: a potential new source of data on the evolutionary origin of flowers. Int. J. Pl. Sci. 158: S131–S142. Frohlich, M.W. & Parker, D.S. 2000. The mostly male theory of flower evolutionary origins: from genes to fossils. Syst. ACKNOWLEDGEMENTS Bot. 25: 155–170. We wish to thank Eva Hotwagner for help with lab work, Gehring, H., Heute, V. & Kluge, M. 2001. New partial sequences of phosphoenolpyruvate carboxylase as mo- Daniel Fulop and Elena Kramer for access to unpublished se- lecular phylogenetic markers. Molec. Phylog. Evol. 20: quence and primer information, David Baum for initial help 262–274. with primer design, Joanna Padolina for access to her primer Gocal, G.F.W., King, R.W., Blundell, C.A., Schwartz, O.M., database, Herta Steinkellner for helpful discussions, Matthias Andersen, C.H. & Weigel, D. 2001. Evolution of floral Fiedler for additional plant material, Eleni Maloupa for help meristem identity genes. Analysis of Lolium temulentum with collection permits, and two anonymous reviewers for genes related to APETALA1 and LEAFY in Arabidopsis. providing valuable comments. We are grateful for funding by Pl. Physiol. 125: 1788–1801. Goto, K. & Meyerowitz, E.M. 1994. Function and regulation the Austrian Science Fund (FWF) on project P16727-B03. of the Arabidopsis floral homeotic gene PISTILLATA. Genes Dev. 8: 1548–1560. Greilhuber, J. & Ehrendorfer, F. 1975. Chromosome numbers and evolution in Ophrys (Orchidaceae). Pl. Syst. Evol. 124: LITERATURE CITED 125–138. Aceto, S., Caputo, P., Cozzolino, S., Gaudio, L. & Moretti, Grob, G.B.J., Gravendeel, B. & Eurlings, M.C.M. 2004. A. 1999. Phylogeny and evolution of Orchis and allied Potential phylogenetic utility of the nuclear FLORICAULA/ genera based on ITS DNA variation: morphological LEAFY second intron: comparison with three chloroplast gaps and molecular continuity. Molec. Phylog. Evol. 13: DNA regions in Amorphophallus (Araceae). Molec. Phy- 67–76. log. Evol. 30: 13–23. Bailey, C.D. & Doyle, J.J. 1999. Potential phylogenetic utility Hall, T. 2001. BioEdit version 5.0.6. Department of Microbiol- of the low-copy nuclear gene pistillata in dicotyledonous ogy, North Carolina State University, Raleigh.

502 TAXON 56 (2) • May 2007: 493–504 Schlüter & al. • A screen of low-copy nuclear genes

Hoot, S.B., Napier, N.S. & Taylor, W.C. 2004. Revealing Posada, D. & Crandall, K.A. 1998. MODELTEST: testing the unknown or extinct lineages within Isoëtes (Isoëtaceae) model of DNA substitution. Bioinformatics 14: 817–818. using DNA sequences from hybrids. Amer. J. Bot. 91: Pridgeon, A.M., Bateman, R.M., Cox, A.V., Hapeman, J.R. 899–904. & Chase, M.W. 1997. Phylogenetics of subtribe Orchid- Howarth, D.G. & Baum, D.A. 2005. Genealogical evidence inae (Orchidoideae, Orchidaceae) based on nuclear ITS of homoploid hybrid speciation in an adaptive radiation of sequences. 1. Intergeneric relationships and polyphyly of Scaevola (Goodeniaceae) in the Hawaiian islands. Evolu- Orchis sensu lato. Lindleyana 12: 89–109. tion 59: 948–961. Ronquist, F. & Huelsenbeck, J.P. 2003. MrBayes 3: Bayesian Krizek, B.A. & Fletcher, J.C. 2005. Molecular mechanisms of phylogenetic inference under mixed models. Bioinforma- flower development: an armchair guide. Nat. Rev. Genet. tics 19: 1572–1574. 6: 688–698. Sang, T. 2002. Utility of low-copy nuclear gene sequences in Kullenberg, B. 1961. Studies in Ophrys pollination. Zool. Bidr. plant phylogenetics. Crit. Rev. Biochem. Molec. Biol. 37: Uppsala 34: 1–340. 121–147. Kuulasmaa, T. 2002. Oligo Analyzer 1.0.2. Distributed by the Schlüter, P.M., Ruas, P.M., Kohl, G., Ruas, C.F., Stuessy, author. Kuopio. T.F. & Paulus, H.F. In press. Reproductive isolation in Lewis, C.E. & Doyle, J.J. 2002. A phylogenetic analysis of the Aegean Ophrys omegaifera complex (Orchidaceae). Pl. tribe Areceae (Arecaceae) using two low-copy nuclear Syst. Evol. genes. Pl. Syst. Evol. 236: 1–17. Schlüter, P.M., Stuessy, T.F. & Paulus, H.F. 2005. Making Long, M. & Deutsch, M. 1999. Association of intron phases the first step: Practical considerations for the isolation with conservation at splice site sequences and evolution of of low-copy nuclear sequence markers. Taxon 54: 766– spliceosomal introns. Molec. Biol. Evol. 16: 1528–1534. 770. Maizel, A., Busch, M.A., Tanahashi, T., Perkovic, J., Kato, Siebert, P.D., Chenchik, A., Kellogg, D.E., Lukyanov, K.A. M., Hasebe, M. & Weigel, D. 2005. The floral regulator & Lukyanov, S.A. 1995. An improved PCR method for LEAFY evolves by substitutions in the DNA binding do- walking in uncloned genomic DNA. Nucl. Acids Res. 23: main. Science 308: 260–263. 1087–1088. Mathews, S. & Donoghue, M.J. 1999. The root of angiosperm Simmons, M.P. & Ochoterena, H. 2000. Gaps as characters phylogeny inferred from duplicate phytochrome genes. in sequence-based phylogenetic analyses. Syst. Biol. 49: Science 286: 947–950. 369–381. Montieri, S., Gaudio, L. & Aceto, S. 2004. Isolation of the Simpson, G.G. & Dean, C. 2005. Arabidopsis, the rosetta stone LFY/FLO homologue in Orchis italica and evolutionary of flowering time. Science 296: 285–289. analysis in some European orchids. Gene 333: 101–109. Small, R.L. & Wendel, J.F. 2000. Copy number lability and Moore, M.J. 2000. Intron recognition comes of AGe. Nat. evolutionary dynamics of the Adh gene family in diploid and Struct. Biol. 7: 14–16. tetraploid cotton (Gossypium). Genetics 155: 1913–1926. Nylander, J.A.A. 2004. MrModeltest v2. Program distributed Soliva, M., Kocyan, A. & Widmer, A. 2001. Molecular phy- by the author. Evolutionary Biology Centre, Uppsala Uni- logenetics of the sexually deceptive orchid genus Ophrys versity, Uppsala. (Orchidaceae) based on nuclear and chloroplast DNA se- Oh, S.-H. & Potter, D. 2003. Phylogenetic utility of the second quences. Molec. Phylog. Evol. 20: 78–88. intron of LEAFY in Neillia and Stephanandra (Rosaceae) Strand, A.E., Leebens-Mack, J. & Milligan, B.G. 1997. Nu- and implications for the origin of Stephanandra. Molec. clear DNA-based markers for plant evolutionary biology. Phylog. Evol. 29: 203–215. Molec. Ecol. 6: 113–118. Oh, S.-H. & Potter, D. 2005. Molecular phylogenetic system- Swofford, D.L. 2002. PAUP*. Phylogenetic Analysis Using atics and biogeography of tribe Neillieae (Rosaceae) using Parsimony (*and Other Methods), version 4. Sinauer As- DNA sequences of cpDNA, rDNA and LEAFY. Amer. J. sociates, Sunderland. Bot. 92: 179–192. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, Padegimas, L.S. & Reichert, N.A. 1998. Adapter ligation- F. & Higgins, D.G. 1997. The CLUSTAL_X windows based polymerase chain reaction-mediated walking. Anal. interface: flexible strategies for multiple sequence align- Biochem. 260: 149–153. ment aided by quality analysis tools. Nucl. Acids Res. 25: Parcy, F. 2005. Flowering: a time for integration. Int. J. Dev. 4876–4882. Biol. 49: 585–593. Tröbner, W., Ramirez, L., Motte, P., Hue, I., Huijser, P., Paulus, H.F. 1998. Der Ophrys fusca s.str.-Komplex auf Kreta Lönnig, W.-E., Saedler, H., Sommer, H. & Schwarz- und anderer Ägäisinseln mit Beschreibungen von O. blith- Sommer, Z. 1992. GLOBOSA: A homeotic gene which opertha, O. creberrima, O. cinereophila, O. cressa, O. interacts with DEFICIENS in the control of Antirrhinum thriptiensis und O. creticola spp. nov. (Orchidaceae). J. floral organogenesis. EMBO J. 11: 4693–4704. Eur. Orch. 30: 157–201. Tsai, W.-C., Lee, P.-F., Chen, H.-I., Hsiao, Y.-Y., Wei, W.-J., Paulus, H.F., Alibertis, C. & Alibertis, A. 1990. Ophrys me- Pan, Z.-J., Chuang, M.-H., Kuoh, C.-S., Chen, W.-H. & saritica H. F. Paulus und C. & A. Alibertis spec. nov. aus Chen, H.-H. 2005. PeMADS6, a GLOBOSA/PISTILLATA- Kreta, eine neue Art aus dem Ophrys fusca-iricolor-Arten- like gene in Phalaenopsis equestris involved in petaloid kreis. Mitteilungsbl. Arbeitskr. Heim. Orch. Baden-Württ. formation, and correlated with flower longevity and ovary 22: 772–787. development. Pl. Cell Physiol. 46: 1125–1139. Paulus, H.F. & Gack, C. 1990. Pollinators as prepollinating Wada, M., Cao, Q.-f., Kotoda, N., Soejima, J.-i. & Masuda, T. isolation factors: evolution and speciation in Ophrys (Or- 2002. Apple has two orthologues of FLORICAULA/LEAFY chidaceae). Israel J. Bot. 39: 43–79. involved in flowering. Pl. Molec. Biol. 49: 567–577.

503 Schlüter & al. • A screen of low-copy nuclear genes TAXON 56 (2) • May 2007: 493–504

Wagner, D., Wellmer, F., Dilks, K., Dilusha, W., Smith, Whittall, J.B., Medina-Marino, A., Zimmer, E.A. & M.R., Kumar, P.P., Riechmann, J.L., Greenland, A.J. Hodges, S.A. 2006. Generating single-copy nuclear gene & Meyerowitz, E.M. 2004. Floral induction in tissue data for a recent adaptive radiation. Molec. Phylog. Evol. culture: a system for the analysis of LEAFY-dependent 39: 124–134. gene regulation. Pl. J. 39: 273–282. William, D.A., Su, Y., Smith, M.R., Lu, M., Baldwin, D.A. Wall, D.P. 2002. Use of the nuclear gene glyceraldehyde 3- & Wagner, D. 2004. Genomic identification of direct tar- phosphate dehydrogenase for phylogeny reconstruction get genes of LEAFY. Proc. Natl. Acad. Sci. U.S.A. 101: of recently diverged lineages in Mitthyridium (Musci: 1775–1780. Calymperaceae). Molec. Phylog. Evol. 25: 10–26. Xu, W., Briggs, W.J., Padolina, J., Timme, R.E., Liu, W., Weigel, D., Alvarez, J., Smyth, D.R., Yanofsky, M.F. & Linder, C.R. & Miranker, D.P. 2004. Using MoBIoS’ Meyerowitz, E.M. 1992. LEAFY controls floral meristem scalable genome join to find conserved primer pair can- identity in Arabidopsis. Cell 69: 843–859. didates between two genomes. Bioinformatics 20, Suppl. Werle, E., Schneider, C., Renner, M., Völker, M. & Fiehn, 1: i355–i362. W. 1994. Convenient single-step, one tube purification of Yoon, H.-S. & Baum, D.A. 2005. Transgenic study of paral- PCR products for direct sequencing. Nucl. Acids Res. 22: lelism in plant morphological evolution. Proc. Natl. Acad. 4354–4355. Sci. U.S.A. 101: 6524–6529

504