Modifying Akt Signaling in B-Cell Chronic Lymphocytic Leukemia Cells

Published OnlineFirst September 7, 2010; DOI: 10.1158/0008-5472.CAN-09-4411 Published OnlineFirst on September 7, 2010 as 10.1158/0008-5472.CAN-09-4411 Tumor and Stem Cell Biology Cancer Research Modifying Akt Signaling in B-Cell Chronic Lymphocytic Leukemia Cells Sebastian W. Hofbauer1, Josefina D. Piñón1, Gabriele Brachtl1, Lucia Haginger1, Wei Wang1, Karin Jöhrer2, Ingeborg Tinhofer1,3, Tanja Nicole Hartmann1, and Richard Greil1 Abstract Emerging evidence suggests that the survival of B-cell chronic lymphocytic leukemia (CLL) cells is depen- dent on microenvironmental influences such as antigenic stimulation and support by stromal cells. Akt, also known as protein kinase B, is a central component in prosurvival signaling downstream of these events. We investigated the role of Akt and its modulation by the protooncogene T-cell leukemia 1a (Tcl1a) in the survival pathways of primary CLL samples and CLL-derived prolymphocytic cell lines MEC-1 and MEC-2. Akt activation was increased by the protective presence of human bone marrow stromal cells and B-cell receptor mimicking signals but antagonized by direct Akt blockade with the novel specific inhibitor AiX, with preferential apoptosis induction in CLL cells with an unmutated immunoglobulin status, which predicts poor clinical outcome. In addition, we found a direct interaction of Akt with Tcl1a in an endogenous coimmunoprecipitation assay. Confirming the critical role of Tcl1a in modulating Akt signaling, Akt activation was enhanced by overexpressing Tcl1a in CLL. In contrast, decreasing Tcl1a levels by small interfering RNA re- duced Akt activation in the fludarabine-insensitive CLL cell line MEC-2 and sensitized the malignant cells to fludarabine treatment. In summary, our data reveal a significant role for the Akt-Tcl1a axis in CLL survival and propose a further evaluation of this interplay for targeting chemoresistance phenomena. Cancer Res; 70(18); 7336–44. ©2010 AACR. Introduction erally follow a more indolent course than those with unmutated (UMT) IgVH genes, who also tend to show evidence of B-cell chronic lymphocytic leukemia (CLL) is the most adverse cytogenetic features, clonal evolution, and resistance prevalent non–Hodgkin lymphoma in the Western world to therapy (2, 3). In addition, molecular markers that are and is characterized by the accumulation of CD5+ B lympho- associated with the signaling capacity of the BCR in CLL, cytes in the blood, lymph nodes, and bone marrow (BM). The such as CD38 and the ζ-associated protein 70 (ZAP-70), serve clinical course and outcome of CLL varies considerably. as indicators for poor clinical prognosis (reviewed in ref. 4). Some patients progress rapidly and die early despite therapy, In normal B lymphocytes, BCR stimulation triggers the whereas others exhibit an indolent disease course and a nor- recruitment and activation of Syk kinases, followed by the mal life span (1). Emerging evidence suggests that the B-cell activation of effector enzymes, including protein kinase C antigen receptor (BCR) is the major determinant of this dif- (PKC), phosphatidylinositol 3-kinase (PI3K), and phospholi- ferential outcome. In particular, patients carrying mutated pase Cγ2. These signaling complexes regulate key down- (MUT) variable heavy chain region genes encoding the stream pathways such as extracellular signal-regulated surface immunoglobulin component of the BCR (IgVH) gen- kinase, c-Jun NH2-terminal kinase, p38, and Akt, the out- comes of which determine the B-cell fate (5). The serine/ threoninekinaseAkt,alsoknownasproteinkinaseB,isa Authors' Affiliations: 1Laboratory for Immunological and Molecular Cancer Research, University Clinics of Internal Medicine III with central molecule in the transmission of antigenic BCR- Hematology, Oncology, Hemostaseology, Infectiology and derived signals. Several studies suggested that Akt activation Rheumatology, Salzburg, Austria; 2Tyrolean Cancer Research Institute, Innsbruck, Austria; and 3Translational Radiobiology and Radiooncology promotes CLL cell survival following BCR engagement (6, 7). Research Laboratory, Clinical Department for Radiotherapy (CCM/CVK), It is, however, controversially discussed whether in peri- Charité University Hospital, Berlin, Germany pheral blood CLL cells, constitutively active Akt contributes Note: Supplementary data for this article are available at Cancer Research to cell survival (6, 8–11). Online (http://cancerres.aacrjournals.org/). The protooncogene T-cell leukemia 1a (Tcl1a) is an Corresponding Author: Richard Greil, Laboratory for Immunological and important modulator of Akt activity. Tcl1a was initially char- Molecular Cancer Research, University Clinics of Internal Medicine III with Hematology, Oncology, Hemostaseology, Infectiology and Rheumatolo- acterized in preleukemic T cells (12) but is also expressed in gy, Salzburg, Austria. Phone: 43-662-4482-2880; Fax: 43-662-4482- subsets of naïve lymphocytes (13). Tcl1a protein is expressed 2898; E-mail: [email protected]. in 90% of human CLL samples at variable levels correlating doi: 10.1158/0008-5472.CAN-09-4411 with ZAP-70 expression, IgVH mutational status, and cytoge- ©2010 American Association for Cancer Research. netic aberrations (14). Tcl1a can form a hetero-oligomeric 7336 Cancer Res; 70(18) September 15, 2010 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2010 American Association for Cancer Research. Published OnlineFirst September 7, 2010; DOI: 10.1158/0008-5472.CAN-09-4411 CLL Apoptosis by Akt Modulation protein complex with Akt, thereby serving as a coactivator of Analysis of cell viability, Tcl1a expression, and Akt (15, 16). The significance of the Akt-Tcl1a axis is further Akt activation underlined by the fact that TCL1A-transgenic mice expand a Cells were stained with fluorochrome-labeled anti-CD5, CD5+/IgM+ lymphocyte population, which is reminiscent of anti-CD19, Annexin V, and 7-aminoactinomycin D (7-AAD), human CLL (17) and is accompanied by increased Akt acti- and at least 10,000 CLL cells were analyzed using a FC-500 vation levels (18). Intriguingly, these mice have a high-risk flow cytometer and CXP2-2 software (Beckman-Coulter). phenotype resembling the typical molecular features of an For intracellular phospho-Akt (Ser473)andTcl1astaining, UMT BCR of human CLL cells. cells were fixed and permeabilized using the Fix and Perm Direct interference in Akt activation by specific Akt inhibi- kit (AN DER GRUBB) and stained with isotype control, tors or modulation of the coactivator Tcl1a has not been anti-Tcl1a, anti–phosphoserine Akt, or anti–pan-Akt (19). extensively investigated thus far. We analyzed these aspects in the context of BCR-related signaling and the tumor Plasmid construction and transfection microenvironment—two elements centrally involved in surviv- TCL1A wild-type cDNA was PCR amplified and subcloned al and progression of CLL. We found a significant role for the into pcDNA3.1 vectors (Clontech). For cloning, the following Akt-Tcl1a axis in CLL cell survival. Our results warrant a fur- PCR primers with EcoRI and SalI restriction sites were used: ther evaluation of this interplay as a therapeutic target in CLL. GTGGAATTCGCCATGGCCGAGTGCCCGACACTCGGG (forward) and GTGGTCGACTCAGTCATCTGGCAGCAGCTC- Materials and Methods GAGAAG (reverse). Plasmids were nucleofected into MEC-1 cells using the Human B Cell Nucleofector kit (Lonza Reagents and antibodies Cologne AG). Transfected cells were selected by geneticin. The Akt inhibitor 10-(4′-(N-diethylamino)butyl)-2-chloro- phenoxazine, HCl (AiX) was purchased from Calbiochem, Small interfering RNA transfection the PI3K inhibitors LY294002 and U0126 were from Cell Sig- MEC-2 cells were transfected with 100 pmol small interfer- naling Technology, and 2-fluoroadenine-9-β-D-arabinofura- ing RNA (siRNA) using Metafectene Pro (Biontex GmbH) noside and rottlerin were from Sigma-Aldrich. Antibodies according to the manufacturer's instructions. Assessment against Akt1, pan-Akt, phospho-Akt (Ser473), phosphoserine of transfection efficacy was monitored by transfecting an glycogen synthase kinase 3α/β (GSK3α/β), Mcl-1, Tcl1a, Alexa Fluor 647–conjugated nontargeting siRNA and flow Bid, and Bik were purchased from Cell Signaling Technology; cytometric analysis, and effective protein knockdown was antibodies against Akt2, MDM2, p53, and phospho–Bcl-2 densitometrically assessed. (Ser70) were from Santa Cruz Biotechnology; Puma and tubu- lin were from Sigma-Aldrich; antibodies against CD5-PC7, Immunoblot analysis CD19-phycoerythrin (PE), and CD19-PC7 were from Beckman- Standard lysis buffer was supplemented with phosphatase Coulter; VLA-4 (CD49d)-PE was from BD Biosciences; and (Roche) and protease inhibitors (Sigma-Aldrich). For coim- CD38-PE was from Immunotech. munoprecipitation, a buffer containing 0.3% CHAPS was used (20). The lysate protein concentration was determined Patients, cell preparation, and AiX treatment using the Bio-Rad protein assay. For coimmunoprecipitation, Following informed consent, peripheral blood samples lysates were precleared with 50 μL protein A or G dynabeads were obtained from patients fulfilling diagnostic and immu- (Invitrogen) and further incubated with the antibody over- nophenotypic criteria for CLL at the Salzburg University Hos- night. Magnetically captured complexes were washed and pital, Austria (Supplementary Table S1). Peripheral blood analyzed by immunoblotting. Signals were detected by mononuclear cells (PBMC) were isolated by density gradient chemiluminescence using the enhanced

Load more