USOO949.3845B2

(12) United States Patent (10) Patent No.: US 9,493,845 B2 Cao et al. (45) Date of Patent: Nov. 15, 2016

(54) METHODS FOR IDENTIFYING 5,849,520 A 12/1998 Leonard et al. COMPOUNDS THAT MODULATE 5,859,227 A 1/1999 Giordano et al. 5,908,779 A 6/1999 Carmichael et al. UNTRANSLATED REGION-DEPENDENT 5,928,888 A 7/1999 Whitney GENE EXPRESSION AND METHODS OF 5.990,298. A 1 1/1999 Carmichael et al. USING SAME 6,004,749 A 12/1999 Giordano et al. 6,010,856 A 1, 2000 Ulevitech et al. (71) Applicant: PTC Therapeutics, Inc., South 6,057.437 A 5/2000 Kamiya et al. Plainfield NJ (US) 6,107,029 A 8, 2000 Giordano s 6,117.848 A * 9/2000 Monia et al...... 514,44 A 6,159,709 A 12, 2000 K. luk et al. (72) Inventors: Liangxian Cao, Parlin, NJ (US); 6,171,821 B1 1, 2001 ENE al. Panayiota Trifillis, Piscataway, NJ 6,203,976 B1* 3/2001 Foulkes et al...... 435/6.12 (US) 6,203,982 B1 3/2001 Nunokawa et al. 6,214,563 B1 4/2001 Negulescu et al. (73) Assignee: PTC THERAPEUTICS, INC., South 22. R 1399; R Plainfield, NJ (US) 6,232,0704- 4 J. B1 5/2001 Shumanapp et al. 6,265,167 B1 T/2001 C ichael et al. (*) Notice: Subject to any disclaimer, the term of this 6,265,546 B1 T/2001 Elese al patent is extended or adjusted under 35 6,284,882 B1 9/2001 Wu-Wong et al. U.S.C. 154(b) by 0 days. 6,303.295 B1 10/2001 Taylor et al. 6,331, 170 B1 12/2001 Ordway (21) Appl. No.: 13/873.543 6,331,396 B1 12/2001 Silverman et al. 6,399,373 B1 6/2002 Bougueleret (22) Filed: Apr. 30, 2013 6,448,007 B1 9, 2002 Giordano et al. 6,455.280 B1 9, 2002 Edwards et al. O O 6,465,176 B1 10/2002 Giordano et al. (65) Prior Publication Data 6,476,208 B1 1 1/2002 Cohen et al. US 2013/034.7133 A1 Dec. 26, 2013 6,528,060 B1 3/2003 Nicolette 6,617,493 B1 9, 2003 Fader 6,627,797 B1 9, 2003 Duvick et al. Related U.S. Application Data 6,630,589 B1 10/2003 Giordano et al. (63) Continuation of application No. 10/543,033, filed as (Continued) application No. PCT/US2004/001643 on Jan. 21, 2004, now Pat. No. 8,460.864. FOREIGN PATENT DOCUMENTS (60) Provisional application No. 60/441,637, filed on Jan. EP 1 176 196 1, 2002 21, 2003. EP 1 604 O11 12/2005 (51) Int. C. (Continued) CI2O I/68 (2006.01) C07K I4/52 (2006.01) OTHER PUBLICATIONS GOIN 33/50 (2006.01) (52) U.S. Cl Bakheet et al. (Nucleic Acids Research, 2001, vol. 29, No. 1, p. CPC ...... CI2O 1/6897 (2013.01); Co7K 14/52 '')." (2013.01); C12O 1/6886 (2013.01); G0IN (Continued) 33/5011 (2013.01); G0IN 33/5023 (2013.01); C12O 2600/136 (2013.01); C12O 2600/158 (2013.01); G0IN 2333/515 (2013.01); G0IN Primary Examiner — Stephanie K Mummert 2500/00 (2013.01) (74) Attorney, Agent, or Firm — Jones Day (58) Field of Classification Search None See application file for complete search history. (57) ABSTRACT (56) References Cited The present invention relates to methods for identifying U.S. PATENT DOCUMENTS compounds that modulate untranslated region-dependent M expression of a target gene. The invention particularly 3,346.381 A 10/1967 Grieg relates to using untranslated regions of a target gene or 5.439,797 A 8, 1995 Tsien et al. fragments thereof linked to a reporter gene to identify 3. A 3. RCG." al compounds that modulate untranslated region-dependent 5,587.300 A 12/1996 Malter expression of a target gene. The methods of the present 5,691,145 A 11/1997 Pitner et al. invention provide a simple, sensitive assay for high-through 5,698,427 A 12/1997 Keene et al. put Screening of libraries of compounds to identify pharma 5,700,660 A 12/1997 Leonard et al. ceutical leads 5,731,343 A 3/1998 Feng et al. 5,734,039 A * 3/1998 Calabretta et al...... 536,245 5,776,738 A 7/1998 Dell’Orco, Sr. et al. 5,843,770 A 12, 1998 I11 et al. 20 Claims, 11 Drawing Sheets US 9,493,845 B2 Page 2

(56) References Cited Amara et al., 1999, “TGF-beta(1), regulation of alzheimer amyloid precursor protein mRNA expression in a normal human astrocyte U.S. PATENT DOCUMENTS cell line: mRNA stabilization.” Brain Res. Mol. Brain Res. 71(1):42-49. 6,635,671 B1 10/2003 Kastelic et al. Banholzer et al., 1997, “Rapamycin destabilizes interleukin-3 6,638,522 B1 10/2003 Mulye mRNA in autocrine tumor cells by a mechanism requiring an intact 6,645,747 B1 1 1/2003 Hallahan et al. 3' untranslated region.” Molecular and Cellular Biology 17: 3254 6,653,132 B1 1 1/2003 Keshet et al. 6,667,152 B2 12/2003 Miles et al. 326O. 6,872,850 B2 3/2005 Giordano et al. Bardoni & Mandel, 2002, "Advances in understanding of fragile X 7,078,171 B2 7/2006 Giordano et al. pathogenesis and FMRP function, and in identification of X linked 7,371,726 B2 5, 2008 Junker et al. mental retardation genes.” Curr. Opin. Genet. Dev. 12(3):284-293. 7,598,079 B2 10/2009 Kastelic et al. Barkoff et al., 2000, "Translational control of cyclin B1 mRNA 7,598.361 B2 10/2009 Cheikh et al. during meiotic maturation: coordinated repression and cytoplasmic 7,601,840 B2 10/2009 Moon et al. polyadenylation” Dev Biol. 2.20(1):97-109. 7,767,689 B2 8, 2010 Moon et al. Bashaw & Baker, 1995, “The msl-2 dosage compensation gene of 8,076,352 B2 12/2011 Cao et al. Drosophila encodes a putative DNA-binding protein whose expres 8,076,353 B2 12/2011 Cao et al. sion is sex specifically regulated by Sex-lethal.” Develop. 8,283,115 B1 10/2012 Friesen et al. 8,283,116 B1 10/2012 Friesen et al. 121(10):3245-3258. 8.426,194 B2 4/2013 Cao et al. Beelman & Parker, 1994, "Differential effects of translational 8.460,864 B2 6, 2013 Cao et al. inhibition in cis and in trans on the decay of the unstable yeast 2002fOOO6661 A1 1/2002 Green et al. MFA2 mRNA. J. Biol. Chem, 269:9687-9692. 2002/0132257 A1 9, 2002 Giordano et al. Bergsten & Gavis, 1999, “Role for mRNA localization in transla 2003/O135870 A1 7/2003 Cheikh et al. tional activation but not spatial restriction of nanos RNA.” Develop. 2003. O1994.53 A1 10/2003 Giordano et al. 126(4):659-669. 2004, OO63120 A1 4/2004 Beer et al. Bocket al., 1992, "Selection of single-stranded DNA molecules that 2004/009 1866 A1 5/2004 Giordano et al. bind and inhibit human thrombin.” Nature 355:564-566. 2004/O138282 A1 7/2004 Greig et al. Brennab & Seitz, 2001, “HuR and mRNA stability.” Cell. Mol. Life. 2004/O1521.17 A1 8/2004 Giordano et al. Sci. 58:266. 2004/023.1007 A1 1 1/2004 Kastelic et al. Cao, “Develop New cancer drugs that control VEGF expression: 2005/0048549 A1 3/2005 Cao et al. VEGF is an endothelial cell specific mitogen.” Grant application (no 2007/0072186 A1 3/2007 Mehta et al. date provided). 2009 OO68654 A1 3/2009 Kastelic et al. Cao, “Targeting VEGF 5'-and 3'-UTRs for tumor therapy: genera tion of stable cell lines for High Throughput screening.” (no date FOREIGN PATENT DOCUMENTS provided). Carballo et al., 1998, "Feedback inhibition of macrophage tumor EP 1761 638 3, 2007 necrosis factor-alpha production by tristetraprolin.” Science GB 98.28707.1 12/1998 281:1001. GB 98.287O9.7 12/1998 Castagnetti et al., 2000, "Control of oskar mRNA translation by JP 2001, 46086 A 2, 2001 JP 2008,507 271 3, 2008 Bruno in a novel cell-free system from Drosophila ovaries.” WO WO95/28485 10, 1995 Develop. 127(5):1063-1068. WO WO95/33831 12/1995 Charlesworth et al., 2000, "The temporal control of Weel mRNA WO WO 97.25860 7/1997 translation during Xenopus oocyte maturation is regulated by cyto WO WO 97.25860 A 7/1997 plasmic polyadenylation elements within the 3'-untranslated WO WO 98/39484 9, 1998 region.” Dev. Biol. 227(2): 706-719. WO WO 93/20212 10, 1999 Chen et al., 1994, "Interplay of two functionally and structurally WO WOOO/04051 1, 2000 distinct domains of the c-fos AU-rich element specifies its mRNA WO WOOO/O5356 2, 2000 destabilizing function.” Mol. Cell. Biol. 14:416-426. WO WOOO,393.14 T 2000 Chen et al., 1995, “AU-rich elements: characterization and impor WO WOOOf 46247 8, 2000 tance in mRNA degradation' Trends Biochem. Sci 20:465-470. WO WO O1/84155 8, 2001 WO WO O2/48150 6, 2002 Chen et al., 1995, “mRNA decay mediated by two distinct AU-rich WO WO O2/O77609 10, 2002 elements from c-fos and granulocyte-macrophage colony-stimulat WO WO O2/O83953 10, 2002 ing factor transcripts: different deadenylation kinetics and uncou WO WO O3,O87815 10, 2003 pling from translation.” Mol. Cell. Biol. 15:5777. WO WO 2004/065561 8, 2004 Chen et al., 2001, “AU Binding Proteins Recruit the Exosome to WO WO 2005/0498.68 6, 2005 Degrade ARE-Containing mRNAs' Cell 107:451. WO WO 2005/0956.15 10/2005 Claffey et al., 1998, “Identification of a human VPF/VEGF 3' WO WO 2005/118857 12/2005 untranslated region mediating hypoxia-induced mRNA stability.” WO WO 2006/022712 3, 2006 Mol. Biol. of Cell. 9:469-481. Clarket al., 2000, "Synthesis of the posterior determinant Nanos is OTHER PUBLICATIONS spatially restricted by a novel cotranslational regulatory mecha nism.” Curr. Biol. 10(20): 1311-1314. Clark et al., 2002, "A common translational control mechanism Lowe et al. (Nucleic Acids Research, 1990, 18(7): 1757-1761).* functions in axial patterning and neuroendocrine signaling in U.S. Appl. No. 12/143,697, filed Jun. 20, 2008, Friesen et al. Drosophila.” Develop. 129(14): 3325-3334. Adams et al., 1991, “Fluorescence ratio imaging of cyclic AMP in Cohen et al., 1996, “CN1-1493 inhibits monocyte/macrophaae single cells.” Nature 349:694-697. tumor necrosis factor by Suppression of translation efficiency.” Proc. Afounda et al., 1999, "Localized XId3 mRNA activation in Natl. Acad. Sci., USA 93:3967-3971. Xenopus embryos by cytoplasmic polyadenylation.” Mech Dev Crosio et al., 2000, "La protein has a positive effect on the 88(1): 15-31. translation of TOP mRNAs in vivo.” Nucl. Acids. Res. 28(15):2927 Aharon & Schneider, 1993, “Selective destabilization of short-lived 34. mRNAs with the granulocyte-macrophage colony-stimulating fac Crucs et al. 2000, "Overlapping but distinct RNA elements control tor AU-rich 3' noncoding region is mediated by a cotranslational repression and activation of nanos translation.” Mol. Cell. 5(3):457 mechanism Mol. Cell. Biol. 13: 1971. 467. US 9,493,845 B2 Page 3

(56) References Cited Genbank Accession No. NM 0026 ev 32, 2006. Genbank Accession No. NM 0029 63, 2006. OTHER PUBLICATIONS Genbank Accession No. NM 002986, 2006. Genbank Accession No. NM 0029 ev 64, 2006. Curatola et al., 1995, “Rapid degradation of AU-rich element (ARE) Genbank Accession No. NM 0032 55, 2006. mRNAs is activated by ribosome transit and blocked by secondary Genbank Accession No. M 0032 56, 2006. structure at any position 5' to the ARE.” Mol. Cell. Biol. 15:6331. Genbank Accession No. M 003355, 2006. Dahanukar & Wharton, 1996. “The Nanos gradient in Drosophila Genbank Accession No. M 0036 42, 2006. embryos is generated by translational regulation,” Genes Dev Genbank Accession No. M 0038 ev. 83, 2006. 20:2610-262O. Genbank Accession No. M 004364, 2006. Dias et al., 1994, "Chemical Probe for Glycosidic Conformation in Genbank Accession No. Telomeric DNAS J. Am. Chem. Soc. 116:4479-4480. M 004395, 2006. Diener & Moore, 1998, “Solution Structure of a Substrate for the Genbank Accession No. M 004795, 2006. Archael Pre-tRNA Splicing Endonucleases: The Bulge-Helix-Bulge Genbank Accession No. M 004797, 2006. Motif. Mol. Cell. 1:883-894. Genbank Accession No. M 00:52 52, 2006. Dominski & Marzluff, 1999, "Formation of the 3' end of histone Genbank Accession No. M 0054 ev 17, 2006. mRNA.” Gene 239(1):1-14. Genbank Accession No. M 00:59 31, 2006. Fruscoloni et al., 2001, “Cleavage of non-tRNA substrates by Genbank Accession No. M 007310, 2006. eukaryal tRNA splicing endonucleases.” EMBO Rep. 2(3):217-221. Genbank Accession No. M 000794, 2006. Gan et al., 1998, "Functional characterization of the internal ribo Genbank Accession No. M 000134, 2006. some entry site of eIF4G mRNA” J. Biol. Chem. 273:5006-5012. Genbank Accession No. M 0187 ev 27, 2006. Gavis et al., 1996, “A conserved 90 nucleotide element mediates Genbank Accession No. M 0204 15, 2006. translational repression of nanos RNA. Development. Sep. 1996; Genbank Accession No. M 0326 11, 2006. 122(9):2791-800.” Develop. 122(9): 2791-2800. Genbank Accession No. M 053056, 2006. Gebauer et al., 1998, “The Drosophila splicing regulator sex-lethal Genbank Accession No. M 0784 67, 2006. directly inhibits translation of malespecific-lethal 2 mRNA' RNA Genbank Accession No. M 080704, 2006. 4(2): 142-150. Genbank Accession No. M 0807 05, 2006. Genbank Accession . NM 0017 ev. 25, 2006. Genbank Accession No. M 080881, 2006. Genbank Accession . NM 0029 ev 25, 2006. Genbank Accession No. M 138712, 2006. Genbank Accession . NM 006536, 2006. Genbank Accession No. NM 389 92, 2006. Genbank Accession AF022375, 2006. Genbank Accession No. NM 1393 ev 17, 2006. Genbank Accession AJ131730, 2006. Genbank Accession No. S48568. Genbank Accession M11567, 2006. Genbank Accession No. U22431. Genbank Accession . M14745, 2006. Genbank Accession No. U25676. Genbank Accession . M14758, 2006. Genbank Accession No. X16302. Genbank Accession M33680, 2006. Genbank Accession No. XM 589987. Genbank Accession M54968, 2006. Genbank Accession No. XM 001831. Genbank Accession . M90 100, 2006. Genbank Accession No. XM 003061. Genbank Accession M 0002 30, 2006. Genbank Accession No. XM 003751. Genbank Accession M 0017 28, 2006. Genbank Accession No. XM O15547. Genbank Accession M 002774, 2006. Genbank Accession No. XO1394. Genbank Accession M 00:5251, 2006. Genbank Accession No. X00588.1. Genbank Accession M 080706, 2006. Goodwin et al., 1993. “Translational regulation of tra-2 by its 3' Genbank Accession M 0001 62, 2006. untranslated region controls sexual identity in C. elegans. Cell Genbank Accession M 0002 08, 2006. T5:329-339. Genbank Accession M 000247, 2006. Goodwin et al., 1997, “A genetic pathway for regulation of tra-2 Genbank Accession M 0003 21, 2006. translation” Develop. 124:749-758. Genbank Accession M 0004 18, 2006. Green et al., 2002, “Crystallization and characterization of Smaug: Genbank Accession M 0005 27, 2006. a novel RNA-binding motif.” Biochem. Biophys. Res. Commun. Genbank Accession M 000572, 2006. 297(5):1085-1088. Genbank Accession M 0005 89, 2006. Guhaniyogi & Brewer, 2001, “Regulation of mRNA stability in Genbank Accession M 0006 65, 2006. mammalian cells.” Gene 265(1-2): 11-23. Genbank Accession M 000600, 2006. Haag & Kimble. 2000, “Regulatory elements required for develop Genbank Accession M 000758, 2006. ment of caenorhabditis elegans hermaphrodites are conserved in the Genbank Accession M 0007 84, 2006. tra-2 homologue of C. remanei, a male/female sister species' Genbank Accession M 000791, 2006. Genetics 155(1):105-116. Genbank Accession M 000799, 2006. Hubert et al., 1996, “RNAs mediating cotranslational insertion of Genbank Accession M 000899, 2006 selenocysteine in eukaryotic selenoproteins' Biochimi 78(7):590 Genbank Accession M 0008 ev 75, 2006. 596. Genbank Accession M 0009 48, 2006. Ikeniura, 1985, "Codon Usage and tRNA Content in Unicellular and Genbank Accession M 0011 45, 2006. Multicellular Organisms.” Mol. Biol. Evol. 2(1): 13-34. Genbank Accession M 001168, 2006. Ikemura and Okeki. 1983, "Codon usage and transfer RNA con Genbank Accession M 0012 40, 2006. tents: organism-specific codon-choice patterns in reference to the Genbank Accession M 001565, 2006. isoacceptor contents.” Cold Spring Harbor Symp. Quant. Biol. Genbank Accession M 001567, 2006. 47:1087-1097. Genbank Accession M 001917, 2006. Jan et al., 1997, “Conservation of the Celegans tra-2 3'UTR Genbank Accession M 002006, 2006. translational control.” EMBO J 16(20):6301-6313. Genbank Accession M 002006, 2006. Jan et al., 1999, “The Star protein, GLD-1, is a translational Genbank Accession M 002087, 2006. regulator of sexual identity in Caenorhabditis elegans.” EMBO J. Genbank Accession M 0021 11, 2006. 18:258-269. Genbank Accession M 002151, 2006. Kakegawa et al., 2002, "Rapamycin induces binding activity to the Genbank Accession M 002231, 2006. terminal oligopyrimidine tract of ribosomal protein mRNA in rats.” Genbank Accession M 002392, 2006. Arch Biochem Biophys 402(1): 77-83. US 9,493,845 B2 Page 4

(56) References Cited Reyes & Abelson 1988, "Substrate Recognition and Splice Site Determination in Yeast tRNA Splicing.” Cell, 55:719-730. OTHER PUBLICATIONS Rogers et al., 2002, "An iron-responsive element type II in the 5'-untranslated region of the Alzheimer's amyloid precursor protein Kastelic et al., 1996, “Induction of rapid IL-1 beta mRNA degra transcript.” J. Biol. Chem. 277(47):455I8-45528. dation in THP-1 cells mediated through the AU-rich region in the Sarkar & Hopper, 1998, “tlNANuclear Export in Saccharomyces 3'UTR by a radicicol analogue.” Cytokine 8: 751-761. cerevisiae: In Situ Hybridization Analysis.” Mol. Biol. of the Cell Keene & Tenenbaum, 2002, “Eukaryotic mRNPs may represent 9:3041-3055. posttranscriptional operons' Mol. Cell. 9:1161. Savant-Bhonsale et al., 1992, “Evidence for instability of mRNAs Kelly et al., 1996, “Reconciliation of the X-ray and NMR structures containing AUUUA motifs mediated through translation-dependent of the thrombin-binding aptamer d(GGTTGGTGTGGTTGG).” J. assembly of a > 20S degradation complex' Genes Dev. 6: 1927. Mo1. Biol. 256:417-422. Saxena et al., 1992, "Angiogenin is a Cytotoxic, tRNA-specific Kim et al., 2002, "The human elongation factor 1 alpha (EF-1 alpha) Ribonuclease in the RNase A Superfamily.” J. Biol. Chem. first intron highly enhances expression of foreign genes from the 267(30):21982-21986. murine cytomegalovirus promoter.” J. Biotechnol. 93(2): 183-187. Schlatter & Fussenegger, 2003, “Novel CNBP- and La-based trans Kimble, 1988, "fog-2, a germ-line-specific sex determination gene lation control systems for mammalian cells.” Biotechnol Bioeng. required for hermaphrodite spermatogenesis in Caenorhabditis 81(1):1-12. elegans.” Genetics, 119:43-61. Schultze et al., 1994, "Three-dimensional solution structure of the Kleman-Leyer et al., 1997, “Properties of H. volcanii tRNA Intron thrombin-binding DNA aptamer d(GGTTGGTGTGGTIGG).” J. Endonuclease Reveal a Relationship between the Archaeal and Mo1. Biol. 235:1532-1547. Eucaryal tRNA Intron Processing Systems.” Cell. 89:839-847. Stebbins-Boaz et al., 1996, “CPEB controls the cytoplasmic Koeller et al., 1991, “Translation and the stability of mRNAs polyadenylation of cyclin, Cdk2 and c-moS mRNAS and is neces encoding the transferrin receptor and c-fos.” Proc. Natl. Acad. Sci. sary for oocyte maturation in Xenopus.” EMBO J. 15(10):2582 88: 7778. 2592. Le & Maizel, 1989, “A method for assessing the statistical signifi Stein et al., 1998, “Translation of vascular endothelial growth factor cance of RNA folding” J. Theor Biol. 138:495-510. mRNA by internal ribosome entry: implications for translation Li & Abelson, 2000, "Crystal Structure of a Dimeric Archaeal under hypoxia” Mol. Cell. Biol. 18:31 12-3119. Splicing Endonuclease.” J. Mol. Biol. 302:639-648. Stoneley, 1998. "C-Myc 5' untranslated region contains an internal Li et al., 1998, "Crystal structure and evolution of a transfer RNA ribosome entry segment” Oncogene 16:423-428. splicing enzyme” Science 280(5361):279-284. Tay et al., 2000, ... “The control of cyclin B1 mRNA translation Lykke-Andersen, J. & Garrett, R.A., 1997, “RNA-protein interac during mouse oocyte maturation.” Dev. Biol. 221(1): 1-9. tions of an archaeal homotetrameric splicing endoribonuclease with Thiele et al., 1999, “Expression of leukocyte-type 12-lipoxygenase an exceptional evolutionary history.” EMBO J 16(20):6290-6300. and reticulocyte-type 15-lipoxygenase in rabbits' Adv Exp Med Macaya et al., 1993. “Thrombin-binding DNA aptamer forms a Biol. 447:45-61. unimolecular quadruplex structure in Solution.” Proc. Natl. Acad. Tholanikunnel & Malborn, 1997, “A 20-nucleotide (A + U)-rich Sci. 90:3745-3749. element of beta2-adrenergic receptor (beta2AR) mRNA mediates Muhlrad et al., 1995. “Turnover mechanisms of the stable yeast binding to beta2AR-binding protein and is obligate for agonist PGK1 mRN.” Mol. Cell. Biol. 15(4):2145-2156. induced destabilization of receptor mRNA.” J. Biol. Chem. Mukherjee et al., 2002, "The mammalian exosome mediates the 272:11471. efficient degradation of mRNAs that contain AU-rich elements.” Thompson et al., 2000, “Rapid deadenylation and Poly(A)-depen EMBO J. 21:165. dent translational repression mediated by the Caenorhabditis Nanbru et al., 1995, “Alternative translation of the proto-oncogene elegans tra-2 3' untranslated region in Xenopus embryos.' Mol. c-myc by an internal ribosome entry site.” J. Biol. Chem. Cell. Biol. 2006):2129-2137. 272:32061-32066. Trifillis et al., 1999. “Finding the right RNA: identification of Oh et al.. 1992, “Homeotic gene Antennapedia mRNA contains cellular mRNA substrates for RNA-binding proteins.” RNA 5:1071 5'-noncoding sequences that confer translational initiation by inter 1082. nal ribosome binding.” Genes Dev 6:1643-1653. Trotta et al., 1997. “The yeast tRNA splicing endonuclease: a Ostareck-Lederer et al., 2002, “c-Src-mediated phosphorylation of tetrameric enzyme with two active site subunits homologous to the hnRNP K drives translational activation of specifically silenced archaeal tRNA endonucleases. Cell 89:849-858. mRNAs” Mol. Cell. Biol. 22(13):4535-4543. Trotta, “Gene Expression' Revised Background Draft. Paynton & Bachvarova, 1994, "Polyadenylation and deadenylation Trotta., 1999, “The Composition, Function and Evolution of he of maternal mRNAS during oocyte growth and maturation in the tRNA Splicing Endonuclease.” Thesis, California Institute of Tech mouse” Mol. Reprod. Dev 37(2): 172-180. nology, pp. 1-147. Peterlin et al., 1993, "Tat Trans-Activator.” In Human Retroviruses; Vagner et al., 1995, “Alternative translation of human fibroblast Cullen Ed., Oxford University Press: New York, pp. 75-100. growth factor 2 mRNA occurs by internal entry of ribosomes.” Mol. Pettetier & Soneberg, 1988, “Internal initiation of translation of Cell. Biol. 15:35-44. eukaryotic mRNA directed by a sequence derived from poliovirus Vagner et al., 2001, "Irresistible IRES. Attracting the translation RNA' Nature 334:320-325. machinery to internal ribosome entry sites.” EMBO Reports 2:893. Piecyk et al., 2000, “TIA-1 is a translational silencer that selectively Volarevic et al., 2000, "Proliferation, But not Growth Blocked by regulates the expression of TNF-alpha” EMBO J. 19:4154. Conditional Deletion of 40S Ribosomal Protein S6. Science Qin & Pyle, 1999. “Site-specific labeling of RNA with fluorophores 288:2045-2047. and other structural probes.” Methods 18 (1):60-70. Wang et al., 1993, "A DNA aptamer which binds to and inhibits Rajagopalan & Malter, 2000, "Growth factor-mediated stabilization thrombin exhibits a new structural motif for DNA.’ Biochem. of amyloid precursor protein mRNA is mediated by a conserved 32(8): 1899-1904. 29-nucleotide sequence in the 3'-untranslated region.” J. Wells et al., 1998, “Circularization of mRNA by eukaryotic ansla Neurochem. 74(1):52-59. tion initiation factors.' Mol. Cell. 2:135-140. Raught et al. 2000, "Translational Control of Gene Expression.” Westmark & Malter, 2001, “Extracellular-regulated kinase controls Sonenberg, Hershey and Mathews, eds. Cold Spring Harbor Labo beta-amyloid precursor protein mRNA decay” Brain Res Mol. ratory Press. Brain. Res 90(2):193-201. Reinmann et al., 2002, "Suppression of 15-lipoxygenase synthesis Wilkund et al., 2002, "Inhibition of translation by UAUUUAU and by hnRNP E1 is dependent on repetitive nature of LOX mRNA UAUUUUUAU motifs of the AU-rich RNA instability element in 3'-UTR control element Dice.” J. Mol. Biol 315(5):965-974. the HPV-1 late 3' untranslated region.” J. Biol. Chem. 277:40462. US 9,493,845 B2 Page 5

(56) References Cited Kobayashi et al., 1998, “Characterization of the 3' Untranslated region of mouse DNA topoisomerase IIC. mRNA.” Gene 215:329 OTHER PUBLICATIONS 337. Lagnado et al., 1994, "AUUUA is Not sufficient to promote Poly(A) Worthington et al., 2002, "RNA binding properties of the AU-rich Shortening and Degradation of mRNA: the Functional Sequence element-binding recombinant Nup475/TIS11?tristetraprolin pro within the AU-rich elements may be UUAUUUA(UIA) (UIA)” tein. J. Biol. Chem. 277: 48558-485.64. Mo1. Cell. Biol. 14: 7984-7995. Ye et al., 1997, “Ultrabithorax and Antennapedia 5' untranslated Levy et al., 1995, “Sequence and functional characterization of the regions promote developmentally regulated internal translation ini terminal exon of the human insulin receptor gene.” Biochem tiation Mol. Cell. Biol. 17:1714-1721. Biophys Acta 1263:253-257. Zaldi & Malter, 1995. "Nucleolin and heterogeneous nuclear Levy et al., 1996, “Post-transcriptional Regulation of Vascular ribonucleoprotein C proteins specifically interact kith the Endothelial Growth Factor by Hypoxia.” J. Biol. Chem. 271:2746 3'-untranslated region of amyloid protein precursor mRNA. J. Biol. 2753. Chem, 271 (29): 17292-17298. Levy et al., 1998, “Hypoxic Stabilization of Vascular Endothelial Zhang et al.. 1997, “Gene Expression Profiles in Normal and Cancer Growth Factor mRNA by the RNA-binding Protein HuR.” J Biol. Chem. 273(11):6417-6423. Cells. Science 276:1268-1272. Lewis et al., 1998, “Mapping of a Minimal AU-rich Sequence Zhu et al., 2001, “Binding of the La autoantigen to the 5' Required for Lipopolysaccharide-induce binding of a 55-kDA pro untranslated region of a chimeric human translation elongation tein on tumor necrosis Factor-O. mRNA.' J Biol. Chem. 273: 13781 factor 1A reporter mRNA inhibits translation in vitro.” Biochim. 13786. Biophys Acta 1521(1-3):19-29. Nanbu et al., 1994, "Multiple Instability-Regulating Sites in the Kemeny et al., 1998, “The tetravalent guanylhydrazone CNI-1493 3'Untranslated Region of the Urokinase-Type Plasminogen activa blocks the toxic effects of interleukin-2 without diminishing anti tor mRNA. Mol. Cell. Biol. 14:4920-4928. tumor efficacy.” Proc. Natl. Acad. Sci. USA95: 4561-4566. Sachs et al., 1993, "Messenger RNA Degradation in Eukaryotes.” Danner et al., 1998, “Agonist regulation of human beta2-adrenergic Cell 74:413-421. receptor mRNA stability occurs via a specific AU-rich element.” J. Sambrook et al., 1989, “Standard protocol for calcium phosphate Biol. Chem. 273(6):3223-9. mediated transfection of adherent cells.” Molec. cloning 16:33.16 Zubiaga et al., 1995, “The nonamer UUAUUUAUU is the key 37. AU-rich sequence motif that mediates mRNA degradation.” Mol. Shaw & Kamen, 1986, “A conserved AU sequence from the 3' Cell. Biol. 15(4):2219-30. Untranslated Region of GM-CSF mRNA mediates selective mRNA Akashi et al., 1994, "Number and Location of AUUUAMotifs: Role degradation.” Cell 46:659-667. in Regulating Transiently Expressed RNAs.” Blood 83:3182-3187 Shyu et al., 1991, “Two distinct destabilizing elements in the c-fos Am Soc. of Hemat. message trigger deadenylation as a first step in rapid mRNA decay.” Genes Dev 5:221-231. Auwerx et al., 1991, “The human leukemia cell line, THP-I : A Stoecklin et al., 1994, "Functional Hierarchy of AUUUA Motifs in multifaceted model for the study of monocyte-macrophage differ Mediating Rapid Interleukin-3 MRNA decay.” J Biol. Chem. entiation.” Experientia 47:22-31 Birkhauser Verlag Basel. 269:28591-28597. Beutler et al., 1988, “Assay of Ribonuclease that preferentially Stolle et al., 1988, "Cellular Factor affecting the stability of B-globin hydrolyses mRNAS Containing Cytokine-Derived UA-Rich Insta mRNA. Gene 62:65-74. bility Sequences.” Biochem. Biophys Res. Commun. 152:973-980. Sullivan et al., 1996, “Mutational analysis of the DST element in Brenchley, 1998, “Antagonizing the expression of VEGF in patho tobacco cells and transgenic plants: Identification of residues critical logical angiogenesis.” Exp. Opin Ther. Patents 8(12): 1695-1706. for mRNA instability.” RNA 2:308-315. Chen et al., 1994, "Selective Degradation of Early-Response-Gene Winstall et al., 1995, “Rapid mRNA Degradation Mediated by the mRNAS: Functional Analyses of Sequence Features of the AU-rich c-fos 3' AU-Rich element and that mediated by the Granulocyte elements. Mo1. Cell. Biol. 14: 8471-84.82. Macrophage Colony-Stimulating Factor 4 AU-Rich Element occur Chen et al., 1995, “AU-rich elements: characterization and impor through similar Polysome-Associated Mechanisms' Mol. Cell. tance in mRNA degradation.” TIBS 20:465-470. Biol. 15:3796-3804. Cho et al. 2002, “Emerging techniques for the discovery and Xu et al., 1997, “Modulation of the Fate of Cytoplasmic mRNA by validation of therapeutic targets for skeletal diseases” Expert Opin. AU-Rich elements key sequence Features Controlling mRNA Ther. Targets 6(6):679-689. Deadenylation and Decay.” Mol. Cell. Biol. 17:46 11-4621. Crawford et al., 1997, “The Role of 3' Poly(A) Tail Metabolism in Zhang et al., 1996. "An enhanced green fluorescent protein allows Tumor Necrosis Factor-O. Regulation.” J Biol. Chem. 272:21120 sensitive detection of gene transfer in mammalian cells.” BBRC 21127. The Am Soc of Biochem. and Molec. Biol. 227:707-11. Fan et al., 1998, "OverepXression of HuR, a nuclear-cytoplasmic Zhang et al., 1995, “Identification and Characterization of a shuttling protein, increases in vivo stability of ARE-containing Sequence motif involved in nonsense-mediated mRNA decay” Mol. mRNAS. EMBO J 17:3448-3460. Cell. Biol, 15:2231-2244. Forsysthe et al., 1996, “Activation of Vascular Endothelial Growth Written Opinion of the International Searching Authority dated Jul. factor Gene Transcription by Hypoxia-Inducible Factor 1.” Mol and 14, 2008 in the PCT Application No. PCT/U504/01643 filed Jan. 21, Cell. Biol. 16(9):4604-4613. 2004. Gil et al., 1996, “Multiple regions of the Arubidopsis Saur-AC1 International Search Report dated Jul. 14, 2008 in the PCT Appli gene control transcript abundance: the 3' untranslated region func cation No. PCT/US04/01643 filed Jan. 21, 2004. tions as an mRNA instability determinant.” EMBOJ 15:1678-1686. Benjamin et al., 1997, “Conditional Switching of vascular Heaton et al., 1998, “Cyclic Nucleotide Regulation of Type-1 endothelial growth factor (VEGF) expression in tumors: induction Plasminogen Activator-inhibitor mRNA stability in Rat Hepatoma of endothelial cell shedding and regression of hemangioblastoma Cells. J Biol. Chem. 273:14261-14268. like vessels by VEGF withdrawal.” Proc. Natl. Acad Sci 94.8761 Hyder et al., 2000, "Identification of Functional Estrogen Response 8766. Elements in the Gene Coding for the Potent Angiogenic Factor Bornes et al., 2004, “Control of the Vascular Endothelial growth Vascular Endothelial Growth Factor. Cancer Res 60:3183-3190. factor internal ribosme entry site (IRES) Activity and translation Iida et al., 2002, “Vascular endothelial growth factor gene expres initation by Altemativey Spliced Coding seqences.” J Biol. Chem. sion in a retinal pigmented cell is up-regulated by glucose depri 279(18): 18717-18726. vation through 3' UTR.” Life Sciences 71:1607-1614. Child et al., 1999, "Cell type-dependent and -independent control of Klausner et al., 1993, "Regulating the Fate of mRNA: The control HER-2/neu translation' Int Journal of Biochem & Cell Biol 31:201 of Cellular Iron Metabolism Cell 72:19-28. 213. US 9,493,845 B2 Page 6

(56) References Cited Genbank Accession No. M 003256, dated Apr. 5, 2009. Genbank Accession No. M 003355, dated Apr. 19, 2009. OTHER PUBLICATIONS Genbank Accession No. M 003.642, dated Oct. 22, 2008. Genbank Accession No. M 003883, dated Apr. 12, 2009. Database WPI Week, 2002, "Screening drug improving insulin Genbank Accession No. M 004364. dated Apr. 5, 2009. resistance without exacerbating diabetic retinopathy, by deteching Genbank Accession No. M 004395, dated Dec. 21, 2008. expression of reporter gene fused to promoter region of human Genbank Accession No. M 004795, dated Apr. 12, 2009. vascular endothelial growth factor gene in mammal cell.” JP 2001 Genbank Accession No. M 004797, dated Apr. 12, 2009. 340080 A. Genbank Accession No. M 005251, dated Apr. 5, 2009. De Jong et al., 2002, "RNA and RNA-protein complexes as targets Genbank Accession No. M 005252, dated Apr. 5, 2009. for therapeutic intervention.” Curr. Topics Medicinal Chem. 2:289 Genbank Accession No. 3O2. M 005417. dated Apr. 19, 2009. De Wet et al., 1987. “Firefly Luciferase Gene: Structure and Genbank Accession No. M 005931, dated Apr. 5, 2009. Expression in Mammalian Cells.” Mol Cell. Biol. 7(2):725-737. Genbank Accession No. M 006536, dated Sep. 17, 2006. Dreyfuss et al., 2002 "Messenger-RNA-Binding Proteins and the Genbank Accession No. M 007310, dated Apr. 12, 2009. Messages they Carry.” Nature Rev Molec Cell Biol. 3:195-205. Genbank Accession No. M 018727, dated Mar. 1, 2009. Eiblet al., 1999. “In vivo analysis of plastid psbA, rbcL and rp132 Genbank Accession No. M 020415, dated Mar. 29, 2009. UTR elements by chloroplast transformation: tobacco plastid gene Genbank Accession No. M 032611, dated Mar. 29, 2009. expression is controlled by modulation of transcript levels and Genbank Accession No. M 053056, dated Apr. 19, 2009. translation efficiency.” Plant J. 19:333-345. Genbank Accession No. M 078467, dated Apr. 19, 2009. Fortes et al., 2003, "Inhibiting expression of specific genes in Genbank Accession No. M 080704, dated Mar. 1, 2009. mammalian cells with 5' end-mutated u 1 small nuclear RNAs Genbank Accession No. M 080705, dated Mar. 1, 2009. targeted to terminal exons of pre-mRNA” Proc. Natl. Acad. Sci Genbank Accession No. M 080706, dated Mar. 1, 2009. 100(14):8264-8269. Genbank Accession No. M 080881, dated Dec. 21, 2008. Genbank Accession No. AF022375, dated Oct. 7, 1998. Genbank Accession No. M 138712, dated Apr. 12, 2009. Genbank Accession No. AJ131730, dated Oct. 7, 2008. Genbank Accession No. NM 138992, dated Apr. 5, 2009. Genbank Accession No. M11567, dated Oct. 30, 1994. Genbank Accession No. NM 139317, dated Apr. 5, 2009. Genbank Accession No. M14745, dated Apr. 27, 1993. Genbank Accession No. S48568, dated Apr. 17, 2002. Genbank Accession No. MI4758, dated Dec. 3, 1999. Genbank Accession No. U22431, dated Jun. 28, 1995. Genbank Accession No. M33680, dated Aug. 3, 1993. Genbank Accession No. U25676, dated Jul. 20, 1995. Genbank Accession No. M54968, dated Oct. 17, 2008. Genbank Accession No. X005881, dated Oct. 7, 2008. Genbank Accession No. M90 100, dated Dec. 31, 1994. Genbank Accession No. XO1394, dated Oct. 7, 2008. Genbank Accession No. NM 000230, dated Apr. 19, 2009. Genbank Accession No. X16302, dated Apr. 18, 2005. Genbank Accession No. NM 000162, dated Apr. 9, 2009. Genbank Accession No. XM 001831, dated May 8, 2002. Genbank Accession No. NM 000134, dated Apr. 12, 2009. Genbank Accession No. XM 003061, dated May 8, 2002. Genbank Accession No. NM 000208, dated Mar. 29, 2009. Genbank Accession No. XM 003751, dated Oct. 16, 2001. Genbank Accession No. NM 000247, dated Apr. 12, 2009. Genbank Accession No. XM 015547, dated Aug. 1, 2002. Genbank Accession No. NM 000321, dated Apr. 19, 2009. Genbak Accession No. XM 589987, dated Sep. 30, 2005. Genbank Accession No. NM 000418, dated Apr. 12, 2009. Huang et al., 1990, “Intervening sequences increase efficiency of Genbank Accession No. NM 000527, dated Apr. 26, 2009. RNA 3’ processing and accumulation of cytoplasmic RNA.” Nucl. Genbank Accession No. NM 000572, dated Apr. 19, 2009. Acids Res. 18(4):937-947. Genbank Accession No. NM 000589, dated Apr. 12, 2009. Huez et al., 1998. “Two Independent Internal Ribosome Entry Sites Genbank Accession No. NM 000665, dated Apr. 12, 2009. are Involved in Translation Initiation of Vascular Endothelial Genbank Accession No. NM 000600, dated Apr. 19, 2009. Growth Factor mRNA.” Mol. Cell. Biol. 18(11):6178-6190. Genbank Accession No. NM 000758, dated Apr. 19, 2009. Ismail et al. 2000. "Split-intron retroviral vectors: enhanced expres Genbank Accession No. NM 000784. dated Mar. 29, 2009. sion with improved safety.” J. Virol. 74 (5):2365-2371. Genbank Accession No. NM 000791, dated Mar. 29, 2009. Kozak et al., 1986. “Influences of mRNA secondary structure on Genbank Accession No. NM 000799, dated Apr. 5, 2009. intiation by eukaryotic ribosomes' Proc. Natl. Acad Sci 83:2850 Genbank Accession No. NM 000794, dated Apr. 10, 2009. 2854. Genbank Accession No. NM 000899, dated Mar. 29, 2009. Lai et al., 1999, “Evidence that Tristetraprolin binds to AU-Rich Genbank Accession No. NM 000875, dated Apr. 10, 2009. Elements and promotes the Deadenylation and Destabilitzation of Genbank Accession No. NM 000.948, dated Mar. 22, 2009. Tumor Necrosi Factor Alpha mRNA' Mol. Cell. Biol. 19(6):4311 Genbank Accession No. NM 001145, dated Apr. 5, 2009. 4323. Genbank Accession No. NM 001168, dated Apr. 19, 2009. Lemm et al., 2002, "Regulation of c-myc mRNA decay by trans Genbank Accession No. NM 001240, dated Feb. 24, 2009. lational pausing in a coding region instability determinant.” Mol. Genbank Accession No. NM 001565, dated Apr. 12, 2009. Cell. Biol. 22(12):3959-3969. Genbank Accession No. NM 001567, dated Mar. 22, 2009. Mehta et al., 2006, "Derepression of the Her-2 uORF is mediated by Genbank Accession No. NM 001728, dated Apr. 5, 2009. a novel post-transcriptional control mechanism in cancer cells.” Genbank Accession No. NM 001725, dated Oct. 22, 2006. Genes & Dev, 20:939-953. Genbank Accession No. NM 001917, dated Apr. 5, 2009. Nishimoriet al., 2004, “Involvement of the 3'-untranslated region of Genbank Accession No. NM 002006. dated Mar. 15, 2009. cyclooxygenase-2 gene in its post-transcriptional regulation through Genbank Accession No. NM 002087, dated Mar. 29, 2009. the glucocorticoid receptor.” Life Sciences 74:2505-2513. Genbank Accession No. NM 002111, dated Apr. 19, 2009. Sachs & Geballe, 2006, "Downstream control of upstream open Genbank Accession No. NM 002151, dated Apr. 23, 2009. reading frames.” Genes & Dev. 20:915-921. Genbank Accession No. NM 002231, dated Mar. 15, 2009. Tischer et al., 1991, “The human gene for vascular endothelial Genbank Accession No. NM 002392, dated Apr. 19, 2009. growth factor.” The J Biol Chem. 266(18): 11947-11954. Genbank Accession No. NM 002632, dated Apr. 19, 2009. Wang et al., 2003, “Human SP-A 3'-UTR variants mediate differ Genbank Accession No. NM 002774, dated Apr. 11, 2009. ential gene expression in basal levels and in response to Genbank Accession No. NM 002963, dated Apr. 19, 2009. dexamethasone.” Am J Physio, Lung Cell & Mol. Physio. Genbank Accession No. NM 002986, dated Mar. 29, 2009. 284(5):L738-L748. Genbank Accession No. NM 002925, dated Aug. 20, 2006. Office Action, mailed Oct. 4, 2007, in U.S. Appl. No. 10/895.393. Genbank Accession No. NM 002964, dated Mar. 29, 2009. Response to Notice of Non-Compliant Amendment, filed Jul. 9, Genbank Accession No. NM 003255, dated Mar. 22, 2009. 2007, in U.S. Appl. No. 10/895.393. US 9,493,845 B2 Page 7

(56) References Cited Non-Final Rejection, dated Jan. 5, 2010, in U.S. Appl. No. 10/579,500. OTHER PUBLICATIONS Final Rejection, dated Aug. 24, 2009, in U.S. Appl. No. 10/851,074. Response to Final Rejection and Request for Continued Examina Restriction Requirement, mailed Dec. 28, 2006, in U.S. Appl. No. tion, dated Nov. 24, 2009, in U.S. Appl. No. 10/851,074. 10/895,393. Non-Final Rejection, dated Jun. 24, 2010, in U.S. Appl. No. Amendment, filed Apr. 3, 2008, in U.S. Appl. No. 10/895.393. 10/851,074. Response to Restriction Requirement, filed Apr. 25, 2007, in U.S. Communication from the Examining Division, dated Jan. 29, 2010, Appl. No. 10/895.393. issued in EP 04704085.2 (EP 1604011). Final Office Action, mailed Dec. 16, 2008, in U.S. Appl. No. Horvath et al., “Multiple elements in the 5' untranslated region 10/895,393. down-regulate c-sis messenger RNA translation.” Cell Growth & Request for Continued Examination and Amendment, dated Jun. 16. Diff. 6: 1103-1110. 2009, in U.S. Appl. No. 10/895.393. Kowalski and Mager, 1998, “A human endogenous retrovirus Restriction/Election Requirement, dated Jan. 26, 2009, in U.S. Suppresses translation of an associated fusion transcript, PLA2L. J. Appl. No. 10/579,500. Virol. 72(7):6164-8. Response to Restriction/ElectionRequirement, dated Jun. 26, 2009, Hoover et al., 1997, “Pim-1 protein expression is regulated by its in U.S. Appl. No. 10/579,500. 5'-untranslated region and translation initiation factor elF-4E.” Cell Requirement for Restriction/Election, dated Jan. 11, 2007, in U.S. Growth Differ, 8: 1371-1380. Appl. No. 10/851,074. Pontrelli et al., 2004, “Translational control of apolipoprotein B Amendment and Response to Restriction/Election, dated May 11, mRNA: regulation via cis elements in the 5' and 3' untranslated 2007, in U.S. Appl. No. 10/851,074. regions.” Biochemistry, 43(21):6734-44. Non Final Office Action, dated Sep. 7, 2007, in U.S. Appl. No. Bhattacharyya et al., 2007, "Mining the GEMS a novel platform 10/851,074. technology targeting post-transcriptional control mechanisms.” Amendment and Response to Non-Final Rejection, dated Apr. 13, Drug Discov Today, 12(13-14):553-60. 2008, in U.S. Appl. No. 10/851,074. Final Rejection, dated Jan. 25, 2011 in U.S. Appl. No. 10/851,074. Non Final Rejection, dated Jul. 10, 2008, in U.S. Appl. No. Amendment, dated Jun. 27, 2011 in U.S. Appl. No. 10/851,074. 10/851,074. Non-Final Rejection, dated Feb. 15, 2011 in U.S. Appl. No. Non Final Rejection, dated Oct. 23, 2008, in U.S. Appl. No. 10/895,393. 10/851,074. Adams et al., 1998, "Localized infusion of IGF-I results in skeletal Amendment and Response to Non-Final Rejection, dated Apr. 22. muscle hypertrophy in rats.” J Appl Physiol. 84:1716-1722. 2009, in U.S. Appl. No. 10/851,074. Barton et al., 2002, "Muscle-specific expression of insulin-like Supplemental European Search Report, dated Nov. 19, 2008, issued growth factor 1 counters muscle decline in mdx mice.” J. Cell Biol. in EP 04809465.0 (EP1761638). 157:137-148. Supplemental Partial European Search Report, dated May 30, 2008, Barton-Davis, 1998, “Viral mediated expression of insulin-like issued in EP 04781055.1 (EP 1786933). growth factor I blocks the aging-related loss of skeletal muscle International Preliminary Report on Patentability, dated Jan. 23. function.” PNAS, 95:15603-15607. 2007, in the PCT Application No. PCT/US04/26309. Bogdanovich et al., 2004, “Therapeutics for Duchenne muscular International Search Report, dated Jul. 13, 2005, in the PCT dystrophy: current approaches and future directions.” J Mol Med., Application No. PCT/US04/26309. 82(2):102-15. Written Opinion of the International Searching Authority, dated Jul. Burkin and Kaufman, 1999. “The C7 B1 integrin in muscle devel 13, 2005, in the PCT Application No. PCT/US04/26309. opment and disease.” Cell Tissue Res., 296:183-190. International Preliminary Report on Patentability, dated Nov. 19. Chakkalakal et al., 2005. “Molecular, cellular, and pharmacological 2007, in the PCT Application No. PCT/US04/020751. therapies for Duchenne/Becker muscular dystrophies.” FASEB J. Written Opinion of the International Searching Authority, dated 19(8):880-91. Nov. 6, 2007, in the PCT Application No. PCT/US04/020751. Coleman et al., 1995, “Myogenic Vector Expression of Insulin-like International Search Report, dated Mar. 7, 2005, in the PCT Growth Factor I Stimulates Muscle Cell Differentiation and Application No. PCT/US04/038496. Myofiber Hypertrophy in Transgenic Mice.” J. Biol. Chem. International Preliminary Report on Patentability, dated Jul. 17. 270:12109-12116. 2008, in the PCT Application No. PCT/US04/038496. Davies and Nowak, 2006, "Molecula Mechanisms of Muscular Written Opinion, dated May 17, 2006, in the PCT Application No. Dystrophies: Old and New Players.” Nature, 7:762-773 (Supple PCT/USO4/O38496. mentary Information Included). Cohen et al., 1996, “Interleukin 6 induces the expression of vascular Engvall et al., 2003, “The new frontier in muscular dystrophy endothelial growth factor.” J. Biol Chem. 271 (12):736-741. research: booster genes.” FASEB J., 17: 1579-1584. Yamazaki et al., 2003, “HIF-1-dependent VEGF reporter gene assay Graniolini et al., 2001, “Distinct reaions in the 3' untranslated region by a stable transformant of CHO cells.” Biol & Pharm Bull. 26(4): are responsible fo argetina and stabilizing utrophin transcripts in 417-420. Skeletal muscle cells. J Cell Biol. 154:1173-1183. Zhang et al., 2000, "Wild-type p53 Suppresses angiogenesis in Gramolini, 2001, “Increased expression of utrophin in a slow vs. a human leiomyosarcoma and synovial sarcoma by transcriptional fast muscle involves posttranscriptional events.” Am J Physiol Cell Suppression of vascular endothelial growth factor expression.” Physiol. 281(4):C1300-9. Cancer Res 60:3655-3661. Kambadur et al., 1997, “Mutations in myostatin (GDF8) in double Supplemental Partial European Search Report, dated Nov. 5, 2009, muscled Belgian Blue and Piedmontese cattle.” Genome Res., issued in EP 04704085.2 (EP 1604011). 7(9):910-6. Restriction Requirement mailed Sep. 3, 2009 in U.S. Appl. No. Karin et al., 2006, "Role for IKK2 in muscle: waste not, want not.” 10/895,393. J. Clin Invest., 116: 2866-2868. Response to Restriction/Election Requirement, dated Dec. 2, 2009 Krag et al., 2004. "Heregulin ameliorates the dystrophic phenotype in U.S. Appl. No. 10/895.393. in mdx mice.” PNAS, 101: 13856-13860. Non-Final Rejection, dated Feb. 18, 2010 in U.S. Appl. No. Nowak and Davies, 2004, “Duchenne Muscular Dystrophy and 10/895,393. dystrophin: pathogenesis and opportunities for treatment.” EMBO Restriction/Election Requirement, dated Aug. 6, 2009, in U.S. Appl. Reports, 5:872-876. No. 10/579,500. Ohlendieck and Campbell, 1991, "Dystrophin-associated proteins Response to Restriction/Election Requirement, dated Sep. 4, 2009, are greatly reduced in skeletal muscle from mdx mice.” J Cell Biol. in U.S. Appl. No. 10/579,500. 11.5:1685-1694. US 9,493,845 B2 Page 8

(56) References Cited Yong et al., 2004, “Why do cells need an assembly machine for RNA-protein complexes?” Trends Cell Biol.; 15(5):226-32. OTHER PUBLICATIONS Akin et al., 1998, “Regulation of Vascular Endothelial Growth Factor (VEGF) Expression is Mediated by Internal Initiation of Patel et al., 2005. “Molecular mechanisms involving IGF-1 and Translation and Alternative Initiation of Transcription.” Oncogene, myostatin to induce muscle hypertrophy as a therapeutic strategy for 17:227-236. Duchenne Muscular Dystrophy.” Acta Myol. 24(3):230-41. Asano et al., 1997. “The translation initiation factor elF3-p48 Tobin et al., 2005. “Myostatin, a negative regulator of muscle mass: Subunit is encoded by int-6, a site of frequent integration by the implications for muscle degenerative diseases.” Curr Opin Phar mouse mammary tumor virus genome.” J. Biol. Chem. 272(38): rnacol., 5(3):328-32. 23477-23480. Vachon et al., 1997, “Integrins (alpha7betal) in muscle function and DeJong, Eric S., et al., 2002, "RNA and RNA-Protein Complexes as Survival. Disrupted expression in merosin-deficient congenital mus Targets for Therapeutic Intervention.” Current Topics in Medicinal cular dystrophy.” J. Clin Invest., 100(7): 1870-81. Chemistry, 2(3):289-302. Veyrune et al., 1996, “A localisation signal in the 3' untranslated Ge et al., 2002, "Regulation of Promoter Activity of the APP Gene region of c-myc mRNA targets c-myc mRNA and beta-globin by Cytokines and Growth Factors.” Ann. N.Y. Acad. Sci 973:463 reporter sequences to the perinuclear cytoplasm and cytoskeletal 467. bound polysomes.” J Cell Sci, 109:1185-1194. Grens et al., 1990, “The 5' and 3'Untranslated Regions of Ornithine Avila et al., 2007 "Trichostatin A increases SMN expression and Decarboxylase mRNA Affect the Translational Efficiency.” The Survival in a mouse model of spinal muscular atrophy.” J Clin Journal of Biological Chemistry, 265(20): 11810-11816. Invest.;117(3):659-71. Han et al. Interactive effects of the tumor necrosis factor promoter Bertini et al., 2005, “134th ENMC International Workshop: Out and 3'-untranslated regions. J Immunol. Mar. 15, 1991; 146(6):1843 come Measures and Treatment of Spinal Muscular Atrophy, Feb. 8. 11-13, 2005, Naarden, The Netherlands.” Neuromuscul Disord. Hudziak et al., 2000, "Antiproliferative effects of steric blocking 15(11):802-16. phoshorodiamiade morpholino an sense agents directed against Boda et al., 2004, “Survival motor neuron SMN1 and SMN2 gene c-myc.” Antisense Nucleic Acid Drug Dev., 10(3): 163-174. promoters: identical sequences and differential expression in neu Nyder et al., 1996, Cancer Research, 56 3954-3960. rons and non-neuronal cells.” Eur J Hum Genet.; 12(9):729-37. Ismail et al., 2000, "Split-intron retroviral vectors: enhanced expres Brahe et al., 2005, "Phenylbutyrate increases SMN gene expression sion with improved safety.” J Virol. 75(5):2365-2371. in spinal muscular atrophy patients.” Eur J. Hum Genet.: 13(2):256 Kedersha et al., 2002, "Stress Granules: Sites of mRNA Triage that 9. Regulate mRNA Stability and Translatability.” Biochemical Society Echaniz-Laguna et al., 1999, “The promoters of the survival motor Transactions, 30(6):963-969. neuron gene (SMN) and its copy (SMNc) share common regulatory Lal et al., 2004, “ConcurrentVersus Individual Binding of HuR and elements.” Am J Hum Genet: 64(5):1365-70. AUF1 to Common Labile Target mRNAs.” The EMBO Journal Germain-Desprez et al., 2001, “The SMN genes are subject to 23:3092-3102. transcriptional regulation during cellular differentiation.” Gene, Levy et al., 1996 “Hypoxia-inducible Protein Binding to Vascular 2.79:109-117. Endothelial Growth Factor mRNA and Its Modulation by the von Iannaconne et al., 2002 “Outcome Measures for Pediatric Spinal Hippel-Lindau Protein.” J. Biol. Chem., 271 (41): 25492-25497. Muscular Atrophy.” Arch Neurol. 59: 1445-1450. Liet al., 2001, “Targeting HER-2/new-overexpressing breast cancer Iannaconne et al., 2003, "Reliability of 4 Outcome Measures in cells by an antisense iron responsive element-directed gene expres Pediatric Spinal Muscular Atrophy.” Arch Neurol; 60: 1130-1136. sion.” Cancer Letters, 174(2): 151-158. Jarecki et al., 2005 “Diverse Small-molecule modulators of SMN McTiernan et al., 1999. “Characterization of proximal transcription expression found by high-throughput compound screening: early regulatory elements in the rat phospholamban promoter.” J. Molecu leads towards a therapeutic for spinal muscular atrophy.” Hum Mol lar & Cellular Cardiology, 31(12:2137-2153. Genet.; 14(14):2003-18. Millard et al., 2000, “A U-Rich Element in the 5' Untranslated Kolb et al., 2006, “A novel cell immunoassay to measure survival Region if necessary for the Translation of p27mRNA.” Molec & of motor neurons protein in blood cells.” BMC Neurology, 6:6. Cell. Biol. 20016):5947-5959. Lunn et al., 2004, “Indoprofen upregulates the survival motor Miller et al., 1998, “The Vascular Endothelial Growth Factor mRNA neuron protein through a cyclooxygenase-independent mecha Contains an Internal Ribosome Entry Site.” FEBS Letters, 434:417 nism.” Chem Biol.; 11(11): 1489-93. 420. Merlini et al., 2003, “Role of gabapentin in spinal muscular atrophy: Morris et al., 2000, "Upstream Open Reading Frames as Regulators results of a multicenter, randomized Italian study.” J Child Neurol. of mRNA translation.” Molec & Cell. Biol. 20023):8635-8642. 18(8):537-41. Nunokawa et al., Expression of human inducible nitric oxide Monani et al., 1999, Promoter analysis of the human centromeric Synthase is regulated by both promoter and 3'-regions. Biochem and telomeric survival motor neuron genes (SMNC and SMNT). Biophys Res Commun. Apr. 17, 1997:233(2):523-6. Biochim Biophys Acta; 1445(3):330-6. Rapella et al., 2002, “Flavopiridol inhibits vascular endothelial Sumner, 2006, "Therapeutics development for spinal muscular growth factor production induced by hypoxia or picolinic acid in atrophy.” NeuroRx.; 3(2):235-45. human neuroblastoma' Int. J. Cancer 99.658-664. Wan, 2005. “The survival of motor neurons protein determines the Pesole et al., 2001, “Structural and Functional Features of capacity for snRNP assembly: biochemical deficiency in spinal Eukaryotic mRNA Untranslated Regions.” Gene 276:73-81. muscular atrophy.” Molec & Cell Biol. 25(13): 5543-5551. Stoecklin et al., 2003, “A Constitutive Decay Element Promotes Wolstencroft et al., 2005. “A non-sequence-specific requirement for Tumor Necrosis Factor Alpha mRNA Degradation via AU-Rich SMN protein activity: the role of aminoglycosides in inducing Element-Independent Pathway.” Molecular and Cellular Biology, elevated SMN protein levels.” Hum Mol Genet, 14(9): 1199-1210. 23(10):3506-3515. Zhang et al., 2001, “An in vivo reporter system for measuring Trotta et al., 2003, “BCR/ABL Activates mdm2 mRNA Translation increased inclusion of exon 7 in SMN2 mRNA: potential therapy of via the La Antigen.” Cancer Cell, 3:145-160. SMA.” Gene Ther. (20): 1532-1538. Wickstrom E. Oligonucleotide treatment of ras-induced tumors in Gubitz et al., 2004 “The SMN complex.” Exp Cell Res. 296:51-6. nude mice. Mol Biotechnol. May 2001;18(1):35-55. Paushkin et al., 2002 "The SMN complex, an assemblyosome of Zwicky et al., 2003 “Exploring the Role of 5" Alternative Splicing ribonucleoproteins' Curr Opin Cell Biol., 14:305-12. and of the 3'-Untranslated region of Cathepsin B MRNA.” Biologi Sumner et al., 2006, "SMN mRNA and protein levels in peripheral cal Chemistry 384(7): 1007-1018. blood: biomarkers for SMA clinical trials.” Neurology, 66:1067 Canadian Office Action issued Aug. 30, 2010 in Application No. 1073. 2,514,184. US 9,493,845 B2 Page 9

(56) References Cited Final Rejection dated Oct. 13, 2011 in U.S. Appl. No. 10/895.393. Amendment Under 37 CFR 1.11 filed Apr. 13, 2012 in U.S. Appl. OTHER PUBLICATIONS No. 10/895,393. Non-Final Rejection dated Dec. 17, 2013 in U.S. Appl. No. Canadian Office Action issued Aug. 18, 2011 in Application No. 10/895,393. 2,514,184. International Search Report dated Nov. 6, 2011, issued in PCT/ US04/20751 (WO 2005/118857). Canadian Office Action issued Jul. 11, 2012 in Application No. Notice of Allowance Fees Due issued Dec. 27, 2012 in U.S. Appl. 2,514,184. No. 10/851,074. Canadian Office Action issued Apr. 29, 2013 in Application No. Issue Notification dated Apr. 1, 2013 in U.S. Appl. No. 10/851,074. 2,514,184. Genbank Accession No. AJ131730, dated Apr. 15, 2005, accessed Supplementary European Search Report dated Oct. 27, 2009 issued Jan. 28, 2014. in EP 04704085 (EP1604011). Genbank Accession No. M54968, dated Feb. 4, 1997, accessed Jan. Article 94(3) EPC Communication dated Jul. 14, 2011 issued in EP 28, 2014. 04704085 (EP1604011). Genbank Accession No. NM 000794, dated Sep. 17, 2006, Hong Kong Publication No. 1176383 issued Jul. 27, 2013 in accessed Jan. 28, 2014. Genbank Accession No. NM 000899, dated Nov. 27, 2005, Application No. HK13103422.7. accessed Jan. 28, 2014. Partial European Search Report dated Jul. 24, 2012 issued in EP Genbank Accession No. NM 002087, dated Oct. 18, 2005, 12152322.9 (EP250.0437). accessed Jan. 28, 2014. European Search Report dated Nov. 9, 2012 issued in EP Genbank Accession No. NM 002231, dated Nov. 27, 2005, 12152322.9 (EP250.0437). accessed Jan. 28, 2014. Article 04(3) EPC Communication dated Aug. 19, 2013 issued in EP Genbank Accession No. NM 002986, dated Nov. 6, 2005, accessed 12152322.9 (EP250.0437). Jan. 28, 2014. Written Opinion of the International Searching Authority datedMar. Genbank Accession No. NM 003.642, dated Sep. 24, 2005, accessed Jan. 28, 2014. 7, 2005 in the PCT Application No. PCT/US04/038496 filed Nov. Genbank Accession No. NM 004364, dated Jan. 29, 2006, 17, 2004 (WO 2005/049868). accessed Jan. 28, 2014. International Search Report dated Feb. 16, 2005 in the PCT Appli Genbank Accession No. NM 004395, dated Oct. 16, 2005, cation No. 1 PCT/US04/038496 (WO 2005/049868). accessed Jan. 28, 2014. Notice of Abandonment issued Aug. 31, 2010 in U.S. Appl. No. Genbank Accession No. NM 005931, dated Oct. 16, 2005, 10/579,500. accessed Jan. 28, 2014. Amendment filed Aug. 17, 2010 in U.S. Appl. No. 10/895.393. Genbank Accession No. NM 080881, dated Oct. 17, 2005, Final Rejection dated Oct. 27, 2010 in U.S. Appl. No. 10/895.393. accessed Jan. 28, 2014. Amendment filed Jan. 26, 2011 in U.S. Appl. No. 10/895.393. Genbank Accession No. XO1394, dated Mar. 21, 1995, accessed Non-Final Rejection dated Feb. 15, 2011 in U.S. Appl. No. Jan. 28, 2014. 10/895,393. Amendment filed Jul. 15, 2011 in U.S. Appl. No. 10/895.393. * cited by examiner U.S. Patent Nov. 15, 2016 Sheet 1 of 11 US 9,493,845 B2

Aas U.S. Patent Nov. 15, 2016 Sheet 2 of 11 US 9,493,845 B2

SV40 Early Enhancer/Promoter

ex -17 Promoter

S. polylinker for M insertion window

SV40 igte poly (A)

Polylinker sites p2itici St. Apoi Bg II Eco 47III Bami Src Soci GAA CAA AG CG ACG GGG GCC CC AGG AGA C AGC GC GA CCCCC GGG GA, CC AG GAA GAC Ric B S Fic FG. 2A U.S. Patent Nov. 15, 2016 Sheet 3 of 11 US 9,493,845 B2

{{ (scot-9,wogaeafoniza

U.S. Patent Nov. 15, 2016 Sheet 5 of 11 US 9,493,845 B2

awww.www.www.v.v.v.-va-vywswww.v.v.v. www.www.v.

***--~~~~~~~~

~~~~~~~~).{}{}{}{}{}!-----~--~~~~~~~~~~~~--~~~~~~~~~~~~~~~~~*****************^^^^^^^^~~~~~~~~ 333333333448$$

83 83 & & SES s & Sy RSX w YS $$$3883 &R 8:33s 88's U.S. Patent Nov. 15, 2016 Sheet 6 of 11 US 9,493,845 B2

·~~~~~~~~~~*~{}{}{}{}{}Ž% & 88 & 83 & 3 R's U.S. Patent Nov. 15, 2016 Sheet 7 of 11 US 9,493,845 B2

jouluopp?tuseid

$$ 3 &S is $ss & 8 & R st U.S. Patent Nov. 15, 2016 Sheet 8 of 11 US 9,493,845 B2

88:38 is

U.S. Patent Nov. 15, 2016 Sheet 9 of 11 US 9,493,845 B2

V8***

?aeg,adxºwºwpº?º ~~~~). ****…….. U.S. Patent US 9,493,845 B2

U.S. Patent Nov. 15, 2016 Sheet 11 of 11 US 9,493,845 B2

Episoma Mammatian Expression Vector

pUC ori N“Ampiciliin FG. 8C US 9,493,845 B2 1. 2 METHODS FOR DENTIFYING mechanisms in the normal/healthy/wild-type cell/body and COMPOUNDS THAT MODULATE during pathology will permit rational therapeutic interven UNTRANSLATED REGION-DEPENDENT tion. GENE EXPRESSION AND METHODS OF Regulation of gene expression both at the mRNA stability USING SAME and translation levels is important in cellular responses to development or environmental stimuli such as nutrient lev This application is a continuation of U.S. application Ser. els, cytokines, hormones, and temperature shifts, as well as No. 10/543,033, filed Jul. 21, 2005, incorporated herein by environmental stresses like hypoxia, hypocalcemia, Viral reference in its entirety, which is a national stage application infection, and tissue injury (reviewed in Guhaniyogi & 10 Brewer, 2001, Gene 265(1-2):11-23). Furthermore, altera of International Application No. PCT/US04/01643, filed tions in mRNA stability have been causally connected to Jan. 21, 2004, which claims the benefit of U.S. provisional specific disorders, such as neoplasia, thalassemia, and application No. 60/441,637, filed Jan. 21, 2003, which is Alzheimer's disease, (reviewed in Guhaniyogi & Brewer, incorporated herein by reference in its entirety. 2001, Gene 265(1-2):11-23 and Translational Control of 15 Gene Expression, Sonenberg, Hershey, and Mathews, eds., 1. INTRODUCTION 2000, CSHL Press). In contrast, regulation of gene expres sion at the mRNA localization level is primarily used by the The present invention relates to a method for Screening cell to create and maintain polarity (internal gradients of and identifying compounds that modulate untranslated protein concentration) (reviewed in Translational Control of region-dependent expression of any gene. In particular, the Gene Expression, Sonenberg, Hershey, and Mathews, eds., invention provides reporter gene-based assays for the iden 2000, CSHL Press). tification of compounds that modulate untranslated region 2.3. mRNA Untranslated Regions in Gene Expression dependent expression of a gene. The methods of the present Regulation invention provide a simple, sensitive assay for high-through A typical mRNA contains a 5' cap, a 5' untranslated region put Screening of libraries of compounds to identify pharma 25 (“5' UTR) upstream of a start codon, an open reading ceutical leads. frame, also referred to as coding sequence, that encodes a stable RNA or a functional protein, a 3' untranslated region 2. BACKGROUND OF THE INVENTION (“3' UTR) downstream of the termination codon, and a poly(A)tail. Most studied cis-dependent RNA-based gene 2.1. Gene Expression 30 expression regulation elements map to the 5' or 3' UTRs. Every living organism is a product of expression of its Examples of 5' UTR regulatory elements include the iron genes in response to a developmental program (encoded in response element (“IRE”), internal ribosome entry site the genome itself) and environmental factors. Gene expres (“IRES), upstream open reading frame (“uORF'), male sion can be defined as the conversion of the nucleotide specific lethal element (“MSL-2), G-quartet element, and sequence of a gene into the amino acid sequence of a protein 35 5'-terminal oligopyrimidine tract (“TOP) (reviewed in or into the nucleotide sequence of a stable RNA. Keene & Tenenbaum, 2002, Mol Cell 9:1161 and Transla In eukaryotes, gene expression begins in the nucleus with tional Control of Gene Expression, Sonenberg, Hershey, and Mathews, eds., 2000, CSHL Press). the transcription of a gene into a premessenger-RNA, also Examples of 3' UTR regulatory elements include AU-rich referred to as a primary transcript. While still in the nucleus, 40 elements (“AREs). Selenocysteine insertion sequence the pre-mRNA is extensively modified. Each primary tran (“SECIS), histone stem loop, cytoplasmic polyadenylation script is capped at the 5' end, associates with hnRNP proteins elements (“CPEs), nanos translational control element, to form messenger RNA-protein particles (“mRNPs), amyloid precursor protein element (APP), translational acquires a polyadenylic acid tail at the 3' end, and undergoes regulation element (“TGE)/direct repeat element (“DRE), splicing to remove introns. In addition, the nucleotide 45 bruno element (“BRE), 15-lipoxygenase differentiation sequence of certain pre-mRNAS can be altered post-tran control element (15-LOX-DICE), and G-quartet element Scriptionally in a process known as RNA editing. Thus (reviewed in Keene & Tenenbaum, 2002, Mol Cell 9:1161). processed, the mature mRNA is exported to the cytoplasm. The internal ribosome entry site (“IRES) is one of the 5' Upon export, mRNA dissociates from hnRNP proteins and UTR-based cis-acting elements of post-transcriptional gene binds a set of cytosol-specific mRNA-binding proteins. 50 expression control. IRESes facilitate cap-independent trans Once in the cytoplasm, the mRNA either immediately asso lation initiation by recruiting ribosomes directly to the ciates with ribosomes and templates for protein synthesis or mRNA start codon. IRESes are commonly located in the 3' is localized to discrete cellular foci to direct compartment region of a 5' UTR and are, as recent work has established, specific protein synthesis. Degradation of mRNA and pro frequently composed of several discrete sequences. IRESes tein, which occurs both in the nucleus and the cytoplasm, 55 do not share significant primary structure homology, but do concludes the list of processes that comprise gene expres form distinct RNA secondary and tertiary structures. Some Sion. IRESes contain sequences complementary to 18S RNA and 2.2. Post-Transcriptional Gene Expression Regulation therefore may form stable complexes with the 40S ribo Gene expression is very tightly regulated. To produce the Somal Subunit and initiate assembly of translationally com desired phenotype, each gene must be expressed at a defined 60 petent complexes. A classic example of an “RNA-only time and at a defined rate and amount. Extensive experi IRES is the internal ribosome entry site from Hepatitis C mental evidence indicates that post-transcriptional processes virus. However, most known IRESes require protein co such as mRNA decay, translation, and mRNA localization factors for activity. More than 10 IRES trans-acting factors constitute major control points in gene expression. (“ITAFs) have been identified so far. In addition, all canoni An aberration in the expression of one or more genes can 65 cal translation initiation factors, with the sole exception of 5' be the cause or a downstream effect of a disease or other end cap-binding eIF4E, have been shown to participate in abnormality. Understanding gene expression regulation IRES-mediated translation initiation (reviewed in Vagner et US 9,493,845 B2 3 4 al., 2001, EMBO reports 2:893 and Translational Control of Natl. Acad. Sci. 88.7778; Savant-Bhonsale et al., 1992, Gene Expression, Sonenberg, Hershey, and Mathews, eds., Genes Dev. 6:1927; and Aharon & Schneider, 1993, Mol. 2000, CSHL Press). Cell. Biol. 13:1971). AU-rich elements (“AREs) are 3' UTR-based regulatory The mechanism of ARE-dependent translation regulation signals. AREs are the primary determinant of mRNA sta is understood even less well than that of ARE-mediated bility and one of the key determinants of mRNA translation mRNA decay. It is not clear how a 3' UTR-localized element initiation efficiency. A typical ARE is 50 to 150 nucleotides can affect translation initiation, a process that takes place in long and contains 3 to 6 copies of AUA pentamers the 5' UTR. One plausible explanation comes from recent embebbed in a generally A/U-enriched RNA region. The work showing that most or all cytoplasmic mRNPs are AUA pentamers can be scattered within the region or can 10 circularized via eIF4F poly(A)-binding protein (“PABP) stagger or even overlap (see, e.g., Chen et al., 1995, Trends interaction. This interaction can bring AREs in the 3' UTR into close proximity to the translation initiation site (see, Biol Sci 20:465). One or several AUA pentamers can be e.g., Wells et al., 1998, Mol. Cell. 2:135). replaced by expanded versions such as AUA or AUSA Citation or identification of any reference in Section 2 of heptamers (see, e.g., Wilkund et al., 2002, J Biol Chem 15 this application is not an admission that Such reference is 277:40462 and Tholanikunnel and Malborn, 1997, J Biol available as prior art to the present invention. Chem 272:11471). Single copies of the AUA (where n=3, 4, or 5) elements placed in a random sequence context are 3. SUMMARY OF THE INVENTION inactive. The minimal active ARE has the sequence UAU,A(U/A)(U/A) (where n=3, 4, or 5) (see, e.g. Wor The present invention provides methods for identifying a thington et al., 2002, J Biol Chem, 277:48558-64). The compound that modulates untranslated region-dependent activity of certain AU-rich elements in promoting mRNA expression of a target gene. In particular, the invention degradation is enhanced in the presence of distal uridine-rich provides methods for identifying compounds that down sequences. These U-rich elements do not affect mRNA regulate the translation or the stability of an mRNA of a stability when present alone and thus that have been termed 25 target gene that is associated with or has been linked to the “ARE enhancers' (see, e.g., Chen et al., 1994, Mol. Cell. onset, development, progression or severity of a particular Biol. 14:416). disease or disorder, said compounds functioning, at least in Most AREs function in mRNA decay regulation and part, by targeting one or more aspects of untranslated translation initiation regulation by interacting with specific region-dependent expression of the target gene. The inven ARE-binding proteins (“AUBPs'). There are at least 14 30 tion also provides methods for identifying compounds that known cellular proteins that bind to AU-rich elements. upregulate the translation or the stability of an mRNA of a AUBP functional properties determine ARE involvement in target gene whose expression is beneficial to a subject with one or both pathways. For example, ELAV/HuR binding to a particular disease or disorder, said compounds functioning, c-fox ARE inhibits c-fos mRNA decay (see, e.g., Brennan & at least, in part, by targeting one or more aspects of untrans Steitz, 2001, Cell Mol Life Sci. 58:266), association of 35 lated region-dependent expression of the target gene. The tristetraprolin with TNFC. ARE dramatically enhances invention encompasses the use of the compounds identified TNFC. mRNA hydrolysis (see, e.g., Carballo et al., 1998, utilizing the methods of the invention for modulating the Science 281:1001), whereas interaction of TIA-1 with the expression of a target gene in vitro and in vivo. In particular, TNFC. ARE does not alter the TNFC. mRNA stability but the invention encompasses the use of the compounds iden inhibits TNFC. translation (see, e.g., Piecyk et al., 2000, 40 tified utilizing the methods of the invention for the preven EMBO J. 19:4154). Given its size, it is very likely that one tion, treatment or amelioration of a disease or disorder or a copy of a typical ARE is capable of interacting with several symptom thereof. AUBPs molecules. Therefore, it is contended that in the cell The invention provides reporter gene-based assays for the the competition of multiple AUBPs for the limited set of identification of a compound that modulates untranslated AUBP-binding sites in an ARE and the resulting “ARE 45 region-dependent expression of a target gene. The reporter proteome' determines the ARE regulatory output. gene-based assays may be conducted by contacting a com The mechanism of ARE-mediated mRNA decay is poorly pound with a cell genetically engineered to express a nucleic understood. It has been established that mammalian mRNA acid comprising a reporter gene operably linked to one or degradation proceeds in 3' to 5' direction and that the first more untranslated regions of a target gene, and measuring step is deadenylation by poly(A)-specific ribonuclease 50 the expression of said reporter gene. Alternatively, the (“PARN). Recent work indicates that following dead reporter gene-based assays may be conducted by contacting enylation a stable multi-ribonuclease complex, termed exo a compound with a cell-free translation mixture and a Some, degrades the body of the message. Exosome alone is nucleic acid comprising a reporter gene operably linked to capable of initiating and accomplishing mRNA decay. How one or more untranslated regions of a target gene, and ever, the presence of certain ARES upregulates degradation 55 measuring the expression of said reporter gene. The altera efficiency. Available evidence suggests that AREs alone or tion in reporter gene expression relative to a previously bound by AUBPs help recruit exosome to the RNA (see, e.g., determined reference range or a control in Such reporter Chen et al., 2001, Cell 107:451 and Mukherjee et al., 2002, gene based assays indicates that a particular compound EMBO J. 21:165). modulates untranslated region-dependent expression of a It has been reported that degradation of some mRNAs 60 target gene. In a specific embodiment, a compound identi depends on ongoing translation. Thus, the translation fied utilizing a reporter gene-based assay described herein machinery can also serve as a ribonulease-recruiting or alters the expression of the reporter gene by at least 25%, at stabilizing AUBPs-removing entity. Supporting evidence least 30%, at least 35%, at least 40%, at least 45%, at least indicates that this mechanism may operate only on a Subset 50%, at least 55%, at least 60%, at least 65%, at least 70%, of mRNAS under special cell growth conditions (see, e.g., 65 at least 75%, at least 80%, at least 85%, at least 90%, at least Curatola et al., 1995, Mol. Cell. Biol. 15:6331; Chen et al., 95%, or at least 99%, or at least 1.5 fold, at least 2 fold, at 1995, Mol. Cell. Biol. 15:5777; Koeller et al., 1991, Proc. least 2.5 fold, at least 5 fold, at least 7.5 fold or at least 10 US 9,493,845 B2 5 6 fold relative to a control (e.g., PBS), the absence of a control acid comprising a reporter gene operably linked to one, two, or a previously determined reference range in an assay three or more untranslated regions of said target gene; and described herein or well-known in the art. In order to (b) detecting the expression of said reporter gene, wherein a exclude the possibility that a particular compound is func compound that modulates untranslated region-dependent tioning Solely by modulating the expression of a target gene expression is identified if the expression of said reporter in an untranslated region-independent manner, one or more gene in the presence of a compound is altered as compared mutations (i.e., deletions, insertions, or nucleotide Substitu to the expression of said reporter gene in the absence of said tions) may be introduced into the untranslated regions compound or the presence of a control (e.g., PBS). In an operably linked to a reporter gene and the effect on the alternative embodiment, the invention provides a method for expression of the reporter gene in a reporter gene-based 10 identifying a compound that modulates untranslated region assay described herein can be determined. dependent expression of a target gene, said method com In one embodiment, the invention provides a method for prising: (a) contacting a member of a library of compounds identifying a compound that modulates untranslated region with a cell-free translation mixture and a nucleic acid dependent expression of a target gene, said method com comprising a reporter gene operably linked to one, two, prising: (a) expressing a nucleic acid comprising a reporter 15 three or more untranslated regions of said target gene; and gene operably linked to two, three or more untranslated (b) detecting the expression of said reporter gene, wherein a regions of said target gene in a cell; (b) contacting said cell compound that modulates untranslated region-dependent with a member of a library of compounds; and (c) detecting expression of a target gene is identified if the expression of the expression of said reporter gene, wherein a compound said reporter gene in the presence of a compound is altered that modulates untranslated region-dependent regulation of relative to a previously determined reference range. expression is identified if the expression of said reporter In another embodiment, the invention provides a method gene in the presence of a compound is altered as compared for identifying a compound that modulates untranslated to the expression of said reporter gene in the absence of said region-dependent expression of a target gene, said method compound or the presence of a control (e.g., phosphate comprising: (a) contacting a member of a library of com buffered saline (“PBS)). In an alternative embodiment, the 25 pounds with a cell containing a nucleic acid comprising a invention provides a method for identifying a compound that reporter gene operably linked to one, two, three or more modulates untranslated region-dependent expression of a untranslated regions of said target gene; and (b) detecting a target gene, said method comprising: (a) expressing a reporter protein translated from said reporter gene, wherein nucleic acid comprising a reporter gene operably linked two, a compound that modulates untranslated region-dependent three or more untranslated regions of said target gene in a 30 expression is identified if the expression of said reporter cell; (b) contacting said cell with a member of a library of gene in the presence of a compound is altered as compared compounds; and (c) detecting the expression of said reporter to the expression of said reporter gene in the absence of said gene, wherein a compound that modulates untranslated compound or the presence of a control (e.g., PBS). In an region-dependent expression is identified if the expression alternative embodiment, the invention provides a method for of said reporter gene is altered in the presence of the 35 identifying a compound that modulates untranslated region compound relative to a previously determined reference dependent expression of a target gene, said method com range. prising: (a) contacting a member of a library of compounds In another embodiment, the invention provides a method with a cell containing a nucleic acid comprising a reporter for identifying a compound that modulates untranslated gene operably linked to one, two, three or more untranslated region-dependent expression of a target gene, said method 40 regions of said target gene; and (b) detecting expression of comprising: (a) expressing a nucleic acid consisting of a said reporter gene, wherein a compound that modulates reporter gene operably linked to one, two, three or more untranslated region-dependent expression is identified if the untranslated regions of the target gene in a cell; (b) contact expression of said reporter gene in the presence of a com ing said cell with a member of a library of compounds; and pound is altered relative to a previously determined refer (c) detecting the expression of said reporter gene, wherein a 45 ence range. compound that modulates untranslated region-dependent The invention also provides methods of identifying com regulation of expression is identified if the expression of said pounds that upregulate untranslated region-dependent reporter gene in the presence of a compound is altered as expression of a target gene utilizing the reporter gene-based compared to the expression of said reporter gene in the assays described herein. In a specific embodiment, the absence of said compound or the presence of a control (e.g., 50 invention provides a method of upregulating untranslated PBS). In an alternative embodiment, the invention provides region-dependent expression of a target gene, said method a method for identifying a compound that modulates comprising (a) contacting a compound with a cell containing untranslated region-dependent expression of a target gene, a nucleic acid comprising a reporter gene operably linked to said method comprising: (a) expressing a nucleic acid con one, two, three or more untranslated regions of said target sisting of a reporter gene operably linked to one, two, three 55 gene; and (b) detecting a reporter gene protein translated or more untranslated regions of the target gene in a cell; (b) from said reporter gene, wherein a compound that upregu contacting said cell with a member of a library of com lates untranslated region dependent expression is identified pounds; and (c) detecting the expression of said reporter if the expression of said reporter gene in the presence of a gene, wherein a compound that modulates untranslated compound is increased relative to the absence of the com region-dependent expression is identified if the expression 60 pound or a previously determined reference range. In of said reporter gene in the presence of the compound is another embodiment, the invention provides a method of altered relative to a previously determined reference range. upregulating untranslated region-dependent expression of a In another embodiment, the invention provides a method target gene, said method comprising (a) contacting a com for identifying a compound that modulates untranslated pound with a cell-free translation mixture and a nucleic acid region-dependent expression of a target gene, said method 65 comprising a reporter gene operably linked to one, two, comprising: (a) contacting a member of a library of com three or more untranslated regions of said target gene; and pounds with a cell-free translation mixture and a nucleic (b) detecting a reporter gene protein translated from said US 9,493,845 B2 7 8 reporter gene, wherein a compound that upregulates untrans assays described herein comprises a 5' UTR of a target gene lated region dependent expression is identified if the expres with a stable hairpin secondary structure operably linked to sion of said reporter gene in the presence of a compound is a reporter gene. In a preferred embodiment, a reporter gene increased relative to the absence of the compound or a construct utilized in the reporter gene-based assays previously determined reference range. described herein comprises a 5' UTR and a 3' UTR of a The invention also provides methods of identifying com target gene. The untranslated regions of a target gene utilized pounds that down-regulate untranslated region-dependent to construct a reporter gene construct may comprise one or expression of a target gene utilitizing the reporter gene-based more of the following elements: an iron response element assays described herein. In a specific embodiment, the (“IRE'), Internal ribosome entry site (“IRES), upstream invention provides a method of down-regulating untrans 10 lated region-dependent expression of a target gene, said open reading frame (“uORF), male specific lethal element method comprising (a) contacting a compound with a cell (“MSL-2), G quartet element, 5'-terminal oligopyrimidine containing a nucleic acid comprising a reporter gene oper tract (“TOP”), AU-rich element (“ARE), selenocysteine ably linked to one, two, three or more untranslated regions insertion sequence (“SECIS), histone stem loop, cytoplas of said target gene; and (b) detecting a reporter gene protein 15 mic polyadenylation element (“CPE), nanos translational translated from said reporter gene, wherein a compound that control element, amyloid precursor protein element down-regulates untranslated region dependent expression is (“APP”), translational regulation element (“TGE)/direct identified if the expression of said reporter gene in the repeat element (“DRE), Bruno element (“BRE), and a presence of a compound is decreased relative to the absence 15-lipoxygenase differentiation control element (“15-LOX of the compound or a previously determined reference DICE). range. In another embodiment, the invention provides a In addition to untranslated regions, the reporter gene method of down-regulating untranslated region-dependent constructs utilized in the reporter gene-based assays expression of a target gene, said method comprising (a) described herein may comprise one, two, three or more contacting a compound with a cell-free translation mixture introns within the open reading frame (“ORF) of the and a nucleic acid comprising a reporter gene operably 25 reporter gene. Further, the 3' end of a reporter gene may be linked to one, two, three or more untranslated regions of said polyadenylated and/or the 5' end may be capped. In a target gene; and (b) detecting a reporter gene protein trans specific embodiment, the 5' end of the reporter gene is not lated from said reporter gene, wherein a compound that capped. down-regulates untranslated region dependent expression is The reporter gene constructs utilized in the reporter identified if the expression of said reporter gene in the 30 gene-based assays described herein may comprise an presence of a compound is decreased relative to the absence untranslated region of a gene whose expression is associated of the compound or a previously determined reference with or has been linked to the onset, development, progres range. sion or severity of a particular disease or disorder. Alterna In accordance with the invention, the step of contacting a tively, the reporter gene constructs utilized in the reporter compound with a cell, or cell-free translation mixture and a 35 gene-based assays described herein may comprise an nucleic acid in the reporter gene-based assays described untranslated region of a gene whose expression is beneficial herein is preferably conducted in an aqueous Solution com to a Subject with a particular disease or disorder. Examples prising a buffer and a combination of salts. In a specific of genes from which the untranslated regions may be embodiment, the aqueous solution approximates or mimics obtained include, but are not limited, the gene encoding physiologic conditions. In another specific embodiment, the 40 tumor necrosis factor alpha (“TNF-C.”), the gene encoding aqueous solution further comprises a detergent or a surfac granulocyte-macrophage colony Stimulating factor (“GM tant. CSF), the gene encoding granulocyte colony stimulating The present invention provides methods of identifying factor (“G-CSF), the gene encoding interleukin 2 (“IL-2), environmental stimuli (e.g., exposure to different concen the gene encoding interleukin 6 (“IL-6”), the gene encoding trations of CO and/or O, stress, temperature shifts, and 45 vascular endothelial growth factor (“VEGF), the genome different pHs) that modulate untranslated region-dependent encoding hepatitis C virus (“HCV), the gene encoding expression of a target gene utilizing the reporter gene-based Survivin, or the gene encoding Her-2. In a specific embodi assays described herein. In particular, the invention provides ment, an untranslated region is obtained or derived from a method of identifying an environmental stimulus, said Her-2 and/or VEGF. In another embodiment, an untranslated method comprising (a) contacting a cell containing a nucleic 50 region is not obtained or derived from the gene encoding acid comprising a reporter gene operably linked to one, two, Her-2. In another embodiment, an untranslated region is not three or more untranslated regions of said target gene with obtained or derived from the gene encoding VEGF. In an environmental stimulus; and (b) detecting a reporter gene another embodiment, an untranslated region is not obtained protein translated from said reporter gene, wherein a com or derived from the genes encoding VEGF and Her-2. pound that modulates untranslated region dependent expres 55 Any reporter gene well-known to one of skill in the art sion is identified if the expression of said reporter gene in the may be utilized in the reporter gene constructs described presence of an environmental stimuli is altered relative to herein. Examples of reporter genes include, but are not the absence of the compound or a previously determined limited to, the gene encoding firefly luciferase, the gene reference range. In a specific embodiment, the environmen coding renilla luciferase, the genes encoding click beetle tal stimuli is not hypoxia. In another embodiment, the 60 luciferase, the gene encoding green fluorescent protein, the environmental stimuli does not include a compound. gene encoding yellow fluorescent protein, the gene encoding The reporter gene constructs utilized in the reporter red fluorescent protein, the gene encoding cyan fluorescent gene-based assays described herein may comprise a 5' protein, the gene encoding blue fluorescent protein, the gene untranslated region (“UTR) of a target gene, a 3' UTR of a encoding beta-galactosidase, the gene encoding beta-glu target gene, or a 5' UTR and a 3' UTR of a target gene 65 coronidase, the gene encoding beta-lactamase, the gene operably linked to a reporter gene. In a specific embodiment, encoding chloramphenicol acetyltransferase, and the gene a reporter gene construct utilized in the reporter gene-based encoding alkaline phosphatase. US 9,493,845 B2 10 The reporter gene-based assays described herein may be A compound that modulates untranslated region-depen conducted in a cell genetically engineered to express a dent expression in a reporter gene-based assay described reporter gene or in vitro utilizing a cell-free translation herein may be Subsequently tested in in vitro assays (e.g., mixture. Any cell or cell line of any species well-known to cell-free assays) or in vivo assays (e.g., cell-based assays) one of skill in the art may be utilized in accordance with the well-known to one of skill in the art or described herein for methods of the invention. Further, a cell-free translation the effect of said compound on the expression of the target mixture may be derived from any cell or cell line of any gene from which the untranslated regions of the reporter species well-known to one of skill in the art. Examples of gene construct were derived. Further, to assess the specific cells and cell types include, but are not limited to, human ity of a particular compound's effect on untranslated region cells (e.g., HeLa cells and 293 cells), yeast, mouse cells 10 dependent expression of a target gene, the effect of said (e.g., cultured mouse cells), rat cells (e.g., cultured rat cells), compound on the expression of one or more genes (prefer Chinese hamster ovary (“CHO) cells, Xenopus oocytes, ably, a plurality of genes) can be determined utilizing assays cancer cells (e.g., undifferentiated cancer cells), primary well-known to one of skill in the art or described herein. In cells, reticulocytes, wheat germ, rye embryo, or bacterial a preferred embodiment, a compound identified utilizing the cells. 15 reporter gene-based assays described herein has a specific The compounds utilized in the reporter gene-based assays effect on the expression of only one gene or a group of genes described herein may be members of a library of com within the same signaling pathway. pounds. In specific embodiment, the compound is selected In a specific embodiment, the specificity of a particular from a combinatorial library of compounds comprising compound for an untranslated region of a target gene is peptoids; random biooligomers; diverSomers such as hydan determined by (a) contacting the compound of interest with toins, benzodiazepines and dipeptides; vinylogous polypep a cell containing a nucleic acid comprising a reporter gene tides; nonpeptidal peptidomimetics; oligocarbamates; pep operably linked to an UTR of a different gene; and (b) tidyl phosphonates; peptide nucleic acid libraries; antibody detecting a reporter gene protein translated from the reporter libraries; carbohydrate libraries; and Small organic molecule gene, wherein the compound is specific for the untranslated libraries. In a preferred embodiment, the Small organic 25 region of the target gene if the expression of said reporter molecule libraries are libraries of benzodiazepines, iso gene in the presence of the compound is not altered or is not prenoids, thiazolidinones, metathiazanones, pyrrolidines, substantially altered relative to a previously determined morpholino compounds, or diazepindiones. reference range, or the expression in the absence of the Once a compound that modulates untranslated region compound or the presence of a control (e.g., PBS). In dependent expression of a target gene is identified, the 30 another embodiment, the specificity of a particular com structure of the compound may be determined utilizing pound for an untranslated region of a target gene is deter well-known techniques or by referring to a predetermined mined by (a) contacting the compound of interest with a code. For example, the structure of the compound may be panel of cells, each cell in a different well of a container determined by mass spectroscopy, NMR, vibrational spec (e.g., a 48 or 96 well microtiter plate) and each cell con troscopy, or X-ray crystallography. 35 taining a nucleic acid comprising a reporter gene operably A compound identified in accordance with the methods of linked to an UTR of a different gene; and (b) detecting a the invention may directly bind to an RNA transcribed from reporter gene protein translated from the reporter gene, a target gene. Alternatively, a compound identified in accor wherein the compound is specific for the untranslated region dance with the methods of invention may bind to one or of the target gene if the expression of said reporter gene in more trans-acting factors (such as, but not limited to, pro 40 the presence of the compound is not altered or is not teins) that modulate untranslated region-dependent expres substantially altered relative to a previously determined sion of a target gene. Further, a compound identified in reference range, or the expression in the absence of the accordance with the methods of invention may disrupt an compound or the presence of a control (e.g., PBS). In interaction between the 5' UTR and the 3' UTR. accordance with this embodiment, the panel may comprise In a specific embodiment, a compound identified in accor 45 5, 7, 10, 15, 20, 25, 50, 75, 100 or more cells. In another dance with the methods of the invention reduces the trans embodiment, the specificity of a particular compound for an lation efficiency and/or stability of an mRNA transcribed untranslated region of a target gene is determined by (a) from a target gene by at least 25%, at least 30%, at least contacting the compound of interest with a cell-free trans 35%, at least 40%, at least 45%, at least 50%, at least 55%, lation mixture and a nucleic acid comprising a reporter gene at least 60%, at least 65%, at least 70%, at least 75%, at least 50 operably linked to an UTR of a different gene; and (b) 80%, at least 85%, at least 90%, at least 95%, or at least detecting a reporter gene protein translated from the reporter 99%, or at least 1.5 fold, at least 2 fold, at least 2.5 fold, at gene, wherein the compound is specific for the untranslated least 5 fold, at least 7.5 fold or at least 10 fold relative to a region of the target gene if the expression of said reporter control (e.g., PBS), the absence of a control or a previously gene in the presence of the compound is not altered or is not determined reference range in an assay described herein or 55 substantially altered relative to a previously determined well-known in the art. In another embodiment, a compound reference range, or the expression in the absence of the identified in accordance with the methods of the invention compound or the presence of a control (e.g., PBS). As used reduces the translation efficiency and/or stability of an herein, the term “not substantially altered” means that the mRNA transcribed from a target gene by at least 25%, at compound alters the expression of the reporter gene or target least 30%, at least 35%, at least 40%, at least 45%, at least 60 gene by less than 20%, less than 15%, less than 10%, less 50%, at least 55%, at least 60%, at least 65%, at least 70%, than 5%, or less than 2% relative to a negative control such at least 75%, at least 80%, at least 85%, at least 90%, at least as PBS. 95%, or at least 99%, or at least 1.5 fold, at least 2 fold, at The invention provides for methods for treating, prevent least 2.5 fold, at least 5 fold, at least 7.5 fold or at least 10 ing or ameliorating one or more symptoms of a disease or fold relative to a control (e.g., PBS), the absence of a control 65 disorder associated with the aberrant expression of a target or a previously determined reference range in an assay gene, said method comprising administering to a Subject in described herein or well-known in the art. need thereof a therapeutically or prophylactically effective US 9,493,845 B2 11 12 amount of a compound, or a pharmaceutically acceptable identified in accordance with the methods of the invention salt thereof, identified according to the methods described inhibits or reduces angiogenesis by at least 25%, at least herein. In one embodiment, the target gene is aberrantly 30%, at least 35%, at least 40%, at least 45%, at least 50%, overexpressed. In another embodiment, the target gene is at least 55%, at least 60%, at least 65%, at least 70%, at least expressed at an aberrantly low level. In particular, the 75%, at least 80%, at least 85%, at least 90%, at least 95% invention provides for a method of treating or preventing a or at least 99%, or at least 1.5 fold, at least 2 fold, at least disease or disorder or ameliorating a symptom thereof, said 2.5 fold, at least 5 fold, at least 7.5 fold, or at least 10 fold method comprising administering to a Subject in need relative to a control (e.g., PBS) in an assay described herein thereof an effective amount of a compound, or a pharma or well-known in the art. ceutically acceptable salt thereof, identified according to the 10 The invention provides for a method for identifying a methods described herein, wherein said effective amount therapeutic agent for the treatment or prevention of cancer, increases the expression of a target gene beneficial in the or amelioration of a symptom thereof, said method com treatment or prevention of said disease or disorder. The prising: (a) contacting a member of a library of compounds invention also provides for a method of treating or prevent with a cell containing a nucleic acid comprising a reporter ing a disease or disorder or ameliorating a symptom thereof, 15 gene operably linked to one, two, three or more untranslated said method comprising administering to a Subject in need regions of a target gene; and (b) detecting the expression of thereof an effective amount of a compound, or a pharma said reporter gene, wherein if a compound that reduces the ceutically acceptable salt thereof, identified according to the expression of said reporter gene relative to a previously methods described herein, wherein said effective amount determined reference range, or the expression of said decreases the expression of a target gene whose expression reporter gene in the absence of said compound or the is associated with or has been linked to the onset, develop presence of a control (e.g., PBS) is detected in (b), then (c) ment, progression or severity of said disease or disorder. In contacting the compound with a cancer cell and detecting a specific embodiment, the disease or disorder is a prolif the proliferation of said cancer cell, so that if the compound erative disorder, an inflammatory disorder, an infectious reduces or inhibits the proliferation of the cancer cell, the disease, a genetic disorder, an autoimmune disorder, a 25 compound is identified as a therapeutic agent for the treat cardiovascular disease, or a central nervous system disorder. ment or prevention of cancer, or amelioration of a symptom In an embodiment wherein the disease or disorder is an thereof. The invention also provides for a method for infectious disease, the infectious disease can be caused by a identifying a therapeutic agent for the treatment or preven fungal infection, a bacterial infection, a viral infection, or an tion of cancer, or amelioration of a symptom thereof, said infection caused by another type of pathogen. 30 method comprising: (a) contacting a cell-free translation The invention provides a method for identifying a com mixture with a member of a library of compounds and a pound that inhibits or reduces angiogenesis, said method nucleic acid comprising a reporter gene operably linked to comprising: (a) contacting a member of a library of com one, two, three or more untranslated regions of a target gene; pounds with a cell containing a nucleic acid comprising a and (b) detecting the expression of said reporter gene, reporter gene operably linked to one, two, three or more 35 wherein if a compound that reduces the expression of said untranslated regions of a target gene; and (b) detecting the reporter gene relative to a previously determined reference expression of said reporter gene, wherein if a compound that range, or the expression of said reporter gene in the absence reduces the expression of said reporter gene relative to a of said compound or the presence of a control (e.g., PBS) is previously determined reference range, or to the expression detected in (b), then (c) contacting the compound with a of said reporter gene in the absence of said compound or in 40 cancer cell and detecting the proliferation of said cancer cell, the presence of a control (e.g., PBS) is detected in (b), then so that if the compound reduces or inhibits the proliferation (c) contacting the compound with a tumor cell and detecting of the cancer cell, the compound is identified as a therapeutic the proliferation of said tumor cell, so that if the compound agent for the treatment or prevention of cancer, or amelio reduces or inhibits the proliferation of the tumor cell, the ration of a symptom thereof. In a specific embodiment, the compound is identified as a compound that inhibits or 45 compound is further tested in an animal model for cancer by, reduces angiogenesis. The invention provides a method for e.g., administering said compound to said animal model and identifying a compound that inhibits or reduces angiogen verifying that the compound is effective in reducing the esis, said method comprising: (a) contacting a cell-free proliferation or spread of cancer cells in said animal model. translation mixture with a member of a library of com In a preferred embodiment, the target gene is Survivin. pounds and a nucleic acid comprising a reporter gene 50 In a specific embodiment, the invention provides for a operably linked to one, two, three or more untranslated method of identifying a therapeutic agent for the treatment regions of a target gene; and (b) detecting the expression of or prevention of breast cancer, or amelioration of a symptom said reporter gene, wherein if a compound that reduces the thereof, said method comprising: (a) contacting a member of expression of said reporter gene relative to a previously a library of compounds with a cell containing a nucleic acid determined reference range, or to the expression of said 55 comprising a reporter gene operably linked to one, two, reporter gene in the absence of said compound or in the three or more untranslated regions of a target gene; and (b) presence of a control (e.g., PBS) is detected in (b), then (c) detecting the expression of said reporter gene, wherein if a contacting the compound with a tumor cell and detecting the compound that reduces the expression of said reporter gene proliferation of said tumor cell, so that if the compound relative a previously determined reference range, or the reduces or inhibits the proliferation of the tumor cell, the 60 expression of said reporter gene in the absence of said compound is identified as a compound that inhibits or compound or the presence of a control is detected in (b), then reduces angiogenesis. In a specific embodiment, the com (c) contacting the compound with a breast cancer cell and pound is further tested in an animal model for angiogenesis detecting the proliferation of said breast cancer cell, so that by, e.g., administering said compound to said animal model if the compound reduces or inhibits the proliferation of the and verifying that angiogenesis is inhibited by said com 65 breast cancer cell, the compound is identified as a therapeu pound in said animal model. In a preferred embodiment, the tic agent for the treatment or prevention of breast cancer, or target gene is VEGF. In another embodiment, the compound amelioration of a symptom thereof. In another embodiment, US 9,493,845 B2 13 14 the invention provides for a method of identifying a thera modulates untranslated region-dependent expression is veri peutic agent for the treatment or prevention of breast cancer, fied if the expression of said reporter gene in the presence of or amelioration of a symptom thereof, said method com a compound is altered as compared to a previously deter prising: (a) contacting a cell-free translation mixture with a mined reference range or the expression of said reporter member of a library of compounds and a nucleic acid gene in the absence of said compound or the presence of a comprising a reporter gene operably linked to one, two, control. three or more untranslated regions of a target gene; and (b) In a third embodiment, the invention provides a method detecting the expression of said reporter gene, wherein if a for verifying the ability of a compound to modulate untrans compound that reduces the expression of said reporter gene lated region-dependent expression of a target gene, said relative to a previously determined reference range, or the 10 method comprising: (a) contacting a compound with a cell expression of said reporter gene in the absence of said containing a nucleic acid comprising a reporter gene oper compound or the presence of a control is detected in (b), then ably linked to one, two, three or more untranslated regions (c) contacting the compound with a breast cancer cell and of said target gene; and (b) detecting the expression of said detecting the proliferation of said breast cancer cell, so that reporter gene, wherein a compound that modulates untrans if the compound reduces or inhibits the proliferation of the 15 lated region-dependent expression is verified if the expres breast cancer cell, the compound is identified as a therapeu sion of said reporter gene in the presence of a compound is tic agent for the treatment or prevention of breast cancer, or altered as compared to a previously determined reference amelioration of a symptom thereof. In accordance with these range or the expression of said reporter gene in the absence embodiments, the compound may be further tested in an of said compound or the presence of a control. animal model for breast cancer by, e.g., administering said compound to said animal model and Verifying that the 3.1. Terminology compound is effective in reducing the proliferation or spread of breast cancer cells in said animal model. In a preferred As used herein, the term “5' cap' refers to a methylated embodiment, the target gene is Her-2. guanine cap, e.g., a 7 methylguanosine (5'-5') RNA triphos The invention also provides methods for upregulating or 25 phate, that is added to the 5' end of a pre-mRNA. downregulating the expression of a target gene utilizing a As used herein, the term 'ARE refers to an adenylate compound identified in accordance with the methods uridylate rich element in the 3' UTR of a mRNA. described herein. The upregulation or downregulation of a As used herein, the term "compound” refers to any agent target gene is particularly useful in vitro when attempting to or complex that is being tested for its ability to modulate produce a protein encoded by said target gene for use as a 30 untranslated region-dependent expression of a target gene, therapeutic or prophylactic agent, or in experiments con or any agent or complex identified by the methods described ducted to, e.g., identify the function or efficacy of said herein. Examples of compounds include, but are not limited protein. In particular, the invention provides a method of to, proteins, polypeptides, peptides, peptide analogs (includ modulating the expression of a target gene, said method ing peptides comprising non-naturally occurring amino comprising contacting a cell with an effective amount of a 35 acids, e.g., D-amino acids, phosphorous analogs of amino compound or pharmaceutically acceptable derivative acids, such as a-amino phosphoric acids and a-amino phos thereof, identified according to the methods described phoric acids, or amino acids having non-peptide linkages), herein. In one embodiment, the cell is a eucaryotic cell. In nucleic acids, nucleic acid analogs such as phosphorothio another embodiment, the cell is a procaryotic cell. ates and PNAS, hormones, antigens, antibodies, lipids, fatty The invention further provides methods for verifying or 40 acids, synthetic or naturally occurring drugs, opiates, dop confirming the ability of a compound to modulate untrans amine, serotonin, catecholamines, thrombin, acetylcholine, lated region-dependent expression of a target gene. The prostaglandins, organic molecules, pheromones, adenosine, ability of a compound to modulate untranslated region Sucrose, glucose, lactose and galactose. dependent expression of a target gene can be verified or As used herein, the term “CUG repeat” refers to a repeat confirmed utilizing any of the assays described herein to 45 of a cytosine-uracil-guanine triplet in the 3' UTR of a identify such a compound. In a first embodiment, the inven mRNA. tion provides a method for verifying the ability of a com As used herein, the term “cytosine rich element” refers to pound to modulate untranslated region-dependent expres cytosine-rich stability determinant sequences in the 3' UTR sion of a target gene, said method comprising: (a) expressing of a mRNA. a nucleic acid comprising a reporter gene operably linked to 50 As used herein, the terms “disorder” and “disease' refer one, two, three or more untranslated regions of said target to a condition in a subject. gene in a cell; (b) contacting said cell with a compound; and As used herein, the term “effective amount” refers to the (c) detecting the expression of said reporter gene, wherein a amount of a compound which is Sufficient to reduce or compound that modulates untranslated region-dependent ameliorate the severity, duration and/or a disease or disorder expression is verified if the expression of said reporter gene 55 or a symptom thereof, prevent the advancement of a disease in the presence of a compound is altered as compared to a or disorder, cause regression of a disease or disorder, prevent previously determined reference range or the expression of the recurrence, development, or onset of one or more said reporter gene in the absence of said compound or the symptoms associated with a disease or disorder, or enhance presence of a control. or improve the prophylactic or therapeutic effect(s) of In a second embodiment, the invention provides a method 60 another therapy (e.g., prophylactic or therapeutic agent). for verifying the ability of a compound to modulate untrans As used herein, the term “fragment” refers to a nucleotide lated region-dependent expression of a target gene, said sequence comprising an nucleic acid sequence of at least 5 method comprising: (a) contacting a compound with a contiguous nucleic acid residues, at least 10 contiguous cell-free translation mixture and a nucleic acid comprising a nucleic acid residues, at least 15 contiguous nucleic acid reporter gene operably linked to one, two, three or more 65 residues, at least 20 contiguous nucleic acid residues, at least untranslated regions of said target gene; and (b) detecting the 25 contiguous nucleic acid residues, at least 40 contiguous expression of said reporter gene, wherein a compound that nucleic acid residues, at least 50 contiguous nucleic acid US 9,493,845 B2 15 16 residues, at least 60 contiguous nucleic acid residues, at least persistently active disease and require additional therapy to 70 contiguous nucleic acid residues, at least contiguous 80 ameliorate the symptoms associated with their disease or nucleic acid residues, at least contiguous 90 nucleic acid disorder. residues, at least contiguous 100 nucleic acid residues, at As used herein, the phrase “pharmaceutically acceptable least contiguous 125 nucleic acid residues, at least 150 salt(s), includes, but is not limited to, salts of acidic or basic contiguous nucleic acid residues, at least contiguous 175 groups that may be present in compounds identified using nucleic acid residues, at least contiguous 200 nucleic acid the methods of the present invention. Compounds that are residues, or at least contiguous 250 nucleic acid residues of basic in nature are capable of forming a wide variety of salts the nucleotide sequence of untranslated region of a target with various inorganic and organic acids. The acids that can 10 be used to prepare pharmaceutically acceptable acid addition gene. In a specific embodiment, a fragment of a untranslated salts of Such basic compounds are those that form non-toxic region of a target gene retains at least one element of the acid addition salts, i.e., salts containing pharmacologically untranslated region (e.g., an IRES). acceptable anions, including but not limited to Sulfuric, As used herein, the term “target RNA refers to an RNA citric, maleic, acetic, oxalic, hydrochloride, hydrobromide, of interest, i.e., the RNA transcribed from a target gene or a 15 hydroiodide, nitrate, Sulfate, bisulfate, phosphate, acid phos gene of interest. In a preferred embodiment, the target RNA phate, isonicotinate, acetate, lactate, Salicylate, citrate, acid contains one or more untranslated regions, and more pref citrate, tartrate, oleate, tannate, pantothenate, bitartrate, erably, contains at least one element of the untranslated ascorbate. Succinate, maleate, gentisinate, fumarate, glucon region (e.g., an IRES). ate, glucaronate, saccharate, formate, benzoate, glutamate, As used herein, the term “host cell' includes a particular methanesulfonate, ethanesulfonate, benzenesulfonate, subject cell transformed or transfected with a nucleic acid p-toluenesulfonate and pamoate (i.e., 1,1'-methylene-bis-(2- molecule and the progeny or potential progeny of Such a hydroxy-3-naphthoate)) salts. Compounds that include an cell. Progeny of such a cell may not be identical to the parent amino moiety may form pharmaceutically acceptable salts cell transfected with the nucleic acid molecule due to with various amino acids, in addition to the acids mentioned mutations or environmental influences that may occur in 25 above. Compounds that are acidic in nature are capable of Succeeding generations or integration of the nucleic acid forming base salts with various pharmacologically accept molecule into the host cell genome. able cations. Examples of Such salts include alkali metal or As used herein, the term “in combination” refers to the alkaline earth metal salts and, particularly, calcium, magne use of more than one therapies (e.g., prophylactic and/or sium, Sodium lithium, Zinc, potassium, and iron salts. therapeutic agents). The use of the term “in combination 30 As used herein, the term “poly(A)tail” refers to a poly does not restrict the order in which therapies (e.g., prophy adenylic acid tail that is added to the 3' end of a pre-mRNA. lactic and/or therapeutic agents) are administered to a sub As used herein, the terms “prophylactic agent” and "pro ject with a particular disease or disorder. A first therapy (e.g., phylactic agents’ refer to any agent(s) which can be used in a prophylactic or therapeutic agent Such as, e.g., a compound the prevention of a particular disease or disorder. In certain identified in accordance with the methods of the invention) 35 embodiments, the term “prophylactic agent” refers to a can be administered prior to (e.g., 5 minutes, 15 minutes, 30 compound identified in the screening assays described minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 herein. In certain other embodiments, the term “prophylactic hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 agent” does not refer a compound identified in the screening weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 assays described herein. weeks before), concomitantly with, or Subsequent to (e.g., 5 40 As used herein, the phrase “prophylactically effective minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 amount refers to the amount of a therapy (e.g., a prophy hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 lactic agent) which is sufficient to result in the prevention of hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 the development, recurrence or onset of a disease or disorder weeks, 6 weeks, 8 weeks, or 12 weeks after) the adminis or one or more symptoms associated thereof. tration of a second therapy (e.g., a prophylactic or thera 45 As used herein, the terms “prevent”, “preventing and peutic agent Such as, e.g., a chemotherapeutic agent, an “prevention” refer to the prevention of the development, anti-inflammatory agent or a TNF-C. antagonist) to a subject recurrence or onset of a disease or disorder or one or more with a particular disease or disorder. symptoms thereof resulting from the administration of one As used herein, the term “IRE” refers to an iron response or more compounds identified in accordance the methods of element in the 5' UTR or 3' UTR of a mRNA. 50 the invention or the administration of a combination of Such As used herein, the term “IRES” refers to an internal a compound and a known therapy for a particular disease or ribosome entry site in the 5' UTR of a mRNA. disorder. As used herein, the term “library” refers to a plurality of As used herein, the term “previously determined refer compounds. A library can be a combinatorial library, e.g., a ence range” refers to a reference range for the expression collection of compounds synthesized using combinatorial 55 and/or the activity of a reporter gene or a target gene by a chemistry techniques, or a collection of unique chemicals of particular cell or in a particular cell-free translation mixture. low molecular weight (less than 1000 daltons) that each Each laboratory will establish its own reference range for occupy a unique three-dimensional space. each particular assay, each cell type and each cell-free As used herein, the term “ORF refers to the open reading translation mixture. In a preferred embodiment, at least one frame of a mRNA, i.e., the region of the mRNA that is 60 positive control and at least one negative control are translated into protein. included in each batch of compounds analyzed. As used herein, the terms “non-responsive' and “refrac As used herein, the term “small molecules' and analogous tory” describe patients treated with a currently available terms include, but are not limited to, peptides, peptidomi therapy (e.g., a prophylactic or therapeutic agent) for a metics, amino acids, amino acid analogs, polynucleotides, disease or disorder, which is not clinically adequate to 65 polynucleotide analogs, nucleotides, nucleotide analogs, relieve one or more symptoms associated with Such disease organic or inorganic compounds (i.e., including heteroor or disorder. Typically, such patients suffer from severe, ganic and organometallic compounds) having a molecular US 9,493,845 B2 17 18 weight less than about 10,000 grams per mole, organic or As used herein, the terms “therapeutic agent” and “thera inorganic compounds having a molecular weight less than peutic agents’ refer to any agent(s) which can be used in the about 5,000 grams per mole, organic or inorganic com prevention, treatment, management or amelioration of one pounds having a molecular weight less than about 1,000 or more symptoms of a particular disease or disorder. In grams per mole, organic or inorganic compounds having a certain embodiments, the term “therapeutic agent” refers to molecular weight less than about 500 grams per mole, a compound identified in the screening assays described organic or inorganic compounds having a molecular weight herein. In other embodiments, the term “therapeutic agent” less than about 100 grams per mole, and salts, esters, and does not refer to a compound identified in the screening other pharmaceutically acceptable forms of Such com assays described herein. pounds. Salts, esters, and other pharmaceutically acceptable 10 As used herein, the term “therapeutically effective forms of Such compounds are also encompassed. amount refers to that amount of a therapy (e.g., a thera As used herein, the terms “subject' and “patient” are used peutic agent) sufficient to reduce the severity of a disease or interchangeably herein. The terms “subject' and “subjects' disorder, reduce the duration of a disease or disorder, ame refer to an animal, preferably a mammal including a non 15 liorate of one or more symptoms of a disease or disorder, primate (e.g., a cow, pig, horse, cat, dog, rat, and mouse) and prevent advancement of a disease or disorder, cause regres a primate (e.g., a monkey such as a cynomolgous monkey sion of the disease or disorder, or to enhance or improve the and a human), and more preferably a human. In one embodi therapeutic effect(s) of another therapeutic agent. In a spe ment, the Subject is refractory or non-responsive to current cific embodiment, with respect to the treatment of cancer, a therapies for a disease or disorder (e.g., viral infections, therapeutically effective amount refers to the amount of a fungal infections, bacterial infections, proliferative diseases therapy (e.g., a therapeutic agent) that inhibits or reduces the or inflammatory diseases). In another embodiment, the Sub proliferation of cancerous cells, inhibits or reduces the ject is a farm animal (e.g., a horse, a cow, a pig, etc.) or a spread of tumor cells (metastasis), inhibits or reduces the household pet (e.g., a dog or a cat). In a preferred embodi onset, development or progression of one or more symptoms ment, the Subject is a human. 25 associated with cancer, or reduces the size of a tumor. As used herein, the term “synergistic’ refers to a combi Preferably, with respect to the treatment of cancer, a thera nation of a compound identified using one of the methods peutically effective of a therapy (e.g., a therapeutic agent) described herein, and another therapy (preferably, a therapy reduces the proliferation of cancerous cells or the size of a which has been or is currently being used to prevent or treat tumor by at least 5%, preferably at least 10%, at least 15%, a particular disease or disorder) which is more effective than 30 at least 20%, at least 25%, at least 30%, at least 35%, at least the additive effects of the therapies. A synergistic effect of a 40%, at least 45%, at least 50%, at least 55%, at least 60%, combination of therapies (e.g., prophylactic or therapeutic at least 65%, at least 70%, at least 75%, at least 80%, at least agents) permits the use of lower dosages of one or more of 85%, at least 90%, at least 95%, or at least 99% relative to the therapies and/or less frequent administration of said a control (e.g., PBS) in an assay described herein or well therapies to a subject with a particular disease or disorder. 35 known in the art. The ability to utilize lower dosages of a therapy (e.g., In another embodiment, with respect to the treatment of a prophylactic or therapeutic agent) and/or to administer said viral infection, a therapeutically effective amount refers to therapy less frequently reduces the toxicity associated with the amount of a therapy (e.g., a therapeutic agent) Sufficient the administration of said therapy to a subject without to reduce or inhibit the replication of a virus, inhibit or reducing the efficacy of said therapies in the prevention or 40 reduce the spread of the virus to other tissues or subjects, or treatment of a particular disease or disorder. In addition, a ameliorate one or more symptoms associated with the viral synergistic effect can result in improved efficacy of therapies infection. Preferably, with respect to a viral infection, a in the prevention or treatment of a particular disease or therapeutically effective amount of a therapy (e.g., a thera disorder. Finally, a synergistic effect of a combination of peutic agent) reduces the replication or spread of a virus by therapies (e.g., prophylactic or therapeutic agents) may 45 at least 5%, preferably at least 10%, at least 15%, at least avoid or reduce adverse or unwanted side effects associated 20%, at least 25%, at least 30%, at least 35%, at least 40%, with the use of either therapy alone. at least 45%, at least 50%, at least 55%, at least 60%, at least As used herein, the term “target gene’ refers to a gene or 65%, at least 70%, at least 75%, at least 80%, at least 85%, nucleotide sequence encoding a protein or polypeptide of at least 90%, at least 95%, or at least 99% relative to a interest. In a preferred embodiment, the gene or nucleotide 50 control (e.g., PBS) in an assay described herein or well sequence comprises an untranslated region. known in the art. As used herein, a “target nucleic acid refers to RNA, In another embodiment, with respect to the treatment of a DNA, or a chemically modified variant thereof. In a pre fungal infection, a therapeutically effective amount refers to ferred embodiment, the target nucleic acid is RNA. In a the amount of a therapy (e.g., a therapeutic agent) Sufficient preferred embodiment, the target nucleic acid refers to the 55 to inhibit or reduce the replication of the fungus, inhibit or untranslated region of an mRNA. Such as, but not limited to, reduce the replication or spread of the fungus to other tissues a 5' UTR and a 3' UTR. In another embodiment, the target or Subjects, or ameliorate one or more symptoms associated nucleic acid refers to an open reading frame of an mRNA. with the fungal infection. Preferably, with respect to a fungal A target nucleic acid also refers to tertiary structures of the infection, a therapeutically effective amount of a therapy nucleic acids, such as, but not limited to loops, bulges, 60 (e.g., a therapeutic agent) reduces the spread of a fungus by pseudoknots, guanosine quartets and turns. A target nucleic at least 5%, preferably at least 10%, at least 15%, at least acid also refers to RNA elements such as, but not limited to, 20%, at least 25%, at least 30%, at least 35%, at least 40%, the HIV TAR element, internal ribosome entry site, insta at least 45%, at least 50%, at least 55%, at least 60%, at least bility elements, and adenylate uridylate-rich elements, 65%, at least 70%, at least 75%, at least 80%, at least 85%, which are described in Section 5.1. Non-limiting examples 65 at least 90%, at least 95%, or at least 99% relative to a of target nucleic acids are presented in Section 5.1 and control (e.g., PBS) in an assay described herein or well Section 6. known in the art. US 9,493,845 B2 19 20 In another embodiment, with respect to the treatment of a As used herein, the term “UTR refers to the untranslated bacterial infection, a therapeutically effective amount refers region of a mRNA, i.e., the region of the mRNA that is not to the amount of a therapy (e.g., a therapeutic agent) translated into protein. In a preferred embodiment, the UTR sufficient to inhibit or reduce the replication of the bacteria, is a 5' UTR, i.e., upstream of the coding region, or a 3' UTR, to inhibit or reduce the replication or spread of the bacteria i.e., downstream of the coding region. In another embodi to other tissues or Subjects, or ameliorate one or more ment, the term UTR corresponds to a reading frame of the symptoms associated with the bacterial infection. Prefer mRNA that is not translated. In another embodiment, a UTR ably, with respect to a bacterial infection, a therapeutically contains a fragment of an untranslated region of a mRNA. effective amount of a therapy (e.g., a therapeutic agent) In a preferred embodiment, a UTR contains one or more 10 regulatory elements that modulate untranslated region-de reduces the spread of a bacteria by at least 5%, preferably at pendent regulation of gene expression. least 10%, at least 15%, at least 20%, at least 25%, at least As used herein, the term “uORF refers to an upstream 30%, at least 35%, at least 40%, at least 45%, at least 50%, open reading frame that is in the 5' UTR of the main open at least 55%, at least 60%, at least 65%, at least 70%, at least reading frame, i.e., that encodes a functional protein, of a 75%, at least 80%, at least 85%, at least 90%, at least 95%, 15 mRNA. or at least 99% relative to a control (e.g., PBS) in an assay As used herein, the term “untranslated region-dependent described herein or well-known in the art. expression” or “UTR-dependent expression” refers to the In another embodiment, with respect to the treatment of regulation of gene expression through untranslated regions an inflammatory disorder, a therapeutically effective amount at the level of mRNA expression, i.e., after transcription of refers to the amount of a therapy (e.g., a therapeutic agent) the gene has begun until the protein or the RNA product(s) that reduces the inflammation of a joint, organ or tissue. encoded by the gene has degraded. In a preferred embodi Preferably, with respect to an inflammatory disorder, a ment, the term “untranslated region-dependent expression' therapeutically effective amount of a therapy (e.g., a thera or “UTR-dependent expression” refers to the regulation of peutic agent) reduces the inflammation of a joint, organ or mRNA stability or translation. In a more preferred embodi tissue by at least 5%, preferably at least 10%, at least 15%, 25 ment, the term “untranslated region-dependent expression' at least 20%, at least 25%, at least 30%, at least 35%, at least refers to the regulation of gene expression through regula 40%, at least 45%, at least 50%, at least 55%, at least 60%, tory elements present in an untranslated region(s). at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% relative to 4. DESCRIPTION OF DRAWINGS a control (e.g., PBS) in an assay described herein or well 30 known in the art. FIGS. 1A-1C: Schematic representation of the VEGF 5'- As used herein, the terms “therapies” and “therapy” can and 3'-UTRs generated by PCR. A. VEGF 5' UTR was refer to any protocol(s), method(s), and/or agent(s) that can amplified from human genomic DNA by two separate PCR be used in the prevention, treatment, management, or ame reactions. 5' UTRI, from position 337 to the 3' end plus first lioration of a disease or disorder or one or more symptoms 35 45 nucleotides of VEGF open reading frame, was generated thereof. using primers 3 and 4.5' UTR2, covered from position 1 to As used herein, the terms “treat”, “treatment” and “treat 498, was generated with primers 1 and 2. In the overlap ing refer to the reduction or amelioration of the progres region of 5' UTR1 and 5' UTR2, the unique enzyme site Sion, severity and/or duration of a disease or disorder or one BamH I was used to assemble the full length 5' UTR in the or more symptoms thereof resulting from the administration 40 subsequent cloning. B. The full length VEGF 3'UTR was of one or more compounds identified in accordance the directly amplified from genomic DNA using primers 5 and methods of the invention, or the administration of a com 6. The two enzyme sites close to 5' end and 3' end of 3'UTR bination of therapies (e.g., a compound identified in accor (BgIII and EcoRI) were used for subsequent cloning. C. dance with the methods of the invention and another thera The following four primers shown were used to amplify peutic agent). In certain embodiments, such terms refer to 45 VEGF 5' UTR: Primer 1 (SEQID NO:69); Primer 2 (SEQID the inhibition or reduction in the proliferation of cancerous NO: 70); Primer 3 (SEQ ID NO:71); and Primer 4 (SEQ ID cells, the inhibition or reduction the spread of tumor cells NO:72). The following two primers shown were used to (metastasis), the inhibition or reduction in the onset, devel amplify VEGF 3'UTR: Primer 5 (SEQ ID NO:73) and opment or progression of one or more symptoms associated Primer 6 (SEQ ID NO:74). with cancer, or the reduction in the size of a tumor. In other 50 FIGS. 2A-2C. Identification of VEGFIRES domain in the embodiments, such terms refer to the reduction or inhibition VEGF mRNA 5' UTR. A. Dual luciferase vector used for of the replication of a virus, the inhibition or reduction in the mapping IRES function (Grentzmann et al., 1998, RNA spread of a virus to other tissues or Subjects, or the amelio 4:479-486). The polylinker sites (SEQ ID NO:75) used in ration of one or more symptoms associated with a viral mapping IRES function have been identified. B. Schematic infection. In other embodiments, such terms refer to the 55 representation of the dicistronic plasmids used for transfec reduction or inhibition of the replication of a fungus, the tion experiments. P2luc/vegfSutr1 is the dicistronic plasmid reduction or inhibition in the spread of a fungus to other containing the VEGF 5'UTRI, in which nucleotides 337 to tissues or Subjects, or the amelioration of one or more 1083 of the VEGF cDNA were fused to the firefly luciferase symptoms associated with a fungal infection. In other coding sequence; P2luc/vegf5utr-fl was generated by Sub embodiments, such terms refer to the inhibition or reduction 60 cloning VEGF 5' UTR2 into the plasmid p2luc/vegföutr1 of the replication of a bacteria, the inhibition or reduction in between Sal I and BamHI; plasmid p2Iuc/vegfö'utraelta51 the spread of a bacteria to other tissues or subjects, or the 476 is derived from p2Iuc/vegfö'utr-fl by removing the Nhe amelioration of one or more symptoms associated with a I fragment (nt 51 to 746); plasmid p2luc/vegfsutr-delta476 bacterial infection. In other embodiments, such terms refer 1038 was derived from p2Iuc/vegföutr-fl by removing the to a reduction in the Swelling of one or more joints, organs 65 sequence from BamH I site to the 3'end of 5' UTR; plasmid or tissues, or a reduction in the pain associated with an p2luc/vegföutraelta1-476 was derived from p2luc/vegföutr inflammatory disorder. fl by removing the sequence from BamH I to the 5'end of US 9,493,845 B2 21 22 5' UTR. P2luc-e used as negative control in this study. C. The designed to site-specifically integrate into the genome of constructs depicted in panel A were transfected into 293T cells genetically engineered to contain the FRT site-specific cells in the triplicate format and expression was analyzed by recombination site via the Flp recombinase (see, e.g., Craig, monitoring luciferase activity. 1988, Ann. Rev. Genet. 22:77-105; and Sauer, 1994, Curr. FIGS. 3A-3B: Generation of Stable cell lines for cell Opin. Biotechnol. 5: 521-527). C. Schematic representation based high throughput screening (“HTS”). A. Schematic of pCMR2, an episomal mammalian expression vector. representation of the monocistronic plasmid used in this study for generation of stable cell lines. B. Screening of 5. DETAILED DESCRIPTION OF THE stable cell lines. The plasmid depicted in panel A was INVENTION transfected into 293T cells. 48 hours later, the transfected 10 cells were seeded in 96 well plates at 100-500 cells per well The present invention provides methods for identifying and 200 mg/ml hygromycin was added for selection. The compounds that modulate the untranslated region-dependent culture media plus hygromycin was changed every 3 to 4 expression of any target gene. In particular, the invention days. After 2 weeks of selection, cells were screened under provides simple, rapid and sensitive methods for identifying a microscope and single colony wells were expanded for 15 compounds that modulate untranslated region-dependent further luciferase assays. The chart in panel shows the expression of a target gene utilizing reporter gene-based luciferase activities for 19 stable clones. constructs comprising one or more mRNA untranslated FIG. 4: Side by side comparison of luciferase activities for regions (“UTRs) of the target gene. The reporter gene three stable clones (B9, D3 and H6). For each cell line, based assays described herein can be utilized in a high 5x10 cells per well were seeded in 24 well plate. 48 hours throughput format to screen libraries of compounds to later, cells were lysed and assayed for luciferase activities. identify those compounds that modulate untranslated The luciferase activities were normalized against protein region-dependent expression of a target gene. concentration. The reporter gene-based assays of the invention reduce FIG. 5: Sustained high expression of luciferase by B9 the bias introduced by competitive binding assays which cells. B9 cells were continuously cultured in vitro for more 25 require the identification of use of a host cell factor (pre than 3 months. At the time points indicated, luciferase sumably essential for modulating RNA function) as a bind activity was tested with Promega’s Bright Glow substrate ing partner for the target RNA. The reporter gene-based and normalized against the protein concentration. assays of the invention are designed to detect any compound FIGS. 6A-6B: Reporter gene integration in B9 cells. The that modulates untranslated region-dependent expression of integration levels of the reporter gene were determined using 30 a target gene under physiologic conditions. semi-quantitative PCR. Series diluted plasmid pluc5'+ The reporter gene-based assays may be conducted by 3'vegf-UTR were included as positive control to make sure contacting a compound with a cell genetically engineered to the reaction for sample (genomic DNA from B9 cells) was express a nucleic acid comprising a reporter gene operably in the linear range, i.e., not saturated. Panel A shows the PCR linked to one or more untranslated regions (preferably, the 5' results for sample and positive control. The PCR band 35 and/or 3' UTRs) of a target gene, and measuring the expres intensity for each reaction is at the bottom of the picture. sion of said reporter gene. Alternatively, the reporter gene Panel B shows the PCR standard curve, plotted with PCR based assays may be conducted by contacting a compound band intensity against the amount of positive control plas with a cell-free translation mixture and a nucleic acid mid loaded for PCR. comprising a reporter gene operably linked to one or more FIGS. 7A-7B: The 5' UTR of Survivin can function as an 40 untranslated regions of a target gene, and measuring the internal ribosome entry site (IRES). A. Firefly luciferase expression of said reporter gene. The alteration in reporter assays on 293T cells transiently transfected with the survivin gene expression relative to a previously determined refer expression vectors in the absence of a stem-loop secondary ence range or a control in Such reporter-gene based assays structure. “5'+3' UTR represents the survivin expression indicates that a particular compound modulates untranslated vector containing the firefly luciferase reporter gene Sur 45 region-dependent expression of a target gene. In order to rounded by both the 5' and 3' untranslated regions of exclude the possibility that a particular compound is func survivin. “5' UTR represents the survivin expression vector tioning Solely by modulating the expression of a target gene containing the firefly luciferase reporter gene preceded only in an untranslated region-independent manner, one or more by the 5' UTR of survivin. “3' UTR represents the survivin mutations (i.e., deletions, insertions, or nucleotide Substitu expression vector containing the firefly luciferase reporter 50 tions) may be introduced into the untranslated regions gene followed only by the 3' UTR of survivin. “no UTR’ operably linked to a reporter gene and the effect on the represents the Survivin expression vector containing the expression of the reporter gene in a reporter gene-based firefly luciferase reporter gene lacking any Surrounding assay described herein can be determined. untranslated regions of Survivin. The Survivin expression The compounds identified in the reporter gene-based vectors were transiently transfected into 293T cells in dupli 55 assays described herein that modulate untranslated region cate (represented by the two bars for each construct in the dependent expression may be tested in in vitro assays (e.g., graph) and firefly luciferase activity (measured in quadru cell-free assays) or in vivo assays (e.g., cell-based assays) plicate) was normalized to total protein concentration in well-known to one of skill in the art or described herein for each of the cell lysates. B. As in FIG. 7A, except that the the effect of said compounds on the expression of the target Survivin expression vectors containing the stem-loop sec 60 gene from which the untranslated regions of the reporter ondary structure to separate cap-dependent from cap-inde gene construct were derived. Further, the specificity of a pendent translation were used. particular compound's effect on untranslated region-depen FIGS. 8A-8C: Expression Vectors. A. Schematic repre dent expression of one or more other genes (preferably, a sentation of pCMR1, a high-level stable and transient mam plurality of genes) can be determined utilizing assays well malian expression vector designed to randomly integrate 65 known to one of skill in the art or described herein. In a into the genome. B. Schematic representation of pMCP1, a preferred embodiment, a compound identified utilizing the high level stable and transient mammalian expression vector reporter gene-based assays described herein has a specific US 9,493,845 B2 23 24 effect on the expression of only one gene or a group of genes Laboratory Manual. 2d Ed., Cold Spring Harbor Laboratory, within the same signaling pathway. Cold Spring Harbor, N.Y. and Ausubel et al., eds., 1998, The structure of the compounds identified in the reporter Current Protocols in Molecular Biology, John Wiley & Sons, gene-based assays described herein that modulate untrans NY, which are both incorporated by reference herein in their lated region-dependent expression can be determined utiliz entireties), to generate an untranslated region having a ing assays well-known to one of skill in the art or described different nucleotide sequence. herein. The methods used will depend, in part, on the nature In one embodiment, an untranslated gene region(s) is of the library Screened. For example, assays or microarrays obtained or derived from a gene whose expression is asso of compounds, each having an address or identifier, may be ciated with or has been linked to the onset, development, deconvoluted, e.g., by cross-referencing the positive sample 10 progression or severity of a particular disease or disorder. In to an original compound list that was applied to the indi another embodiment, an untranslated gene region(s) is vidual test assays. Alternatively, the structure of the com obtained or derived from a gene whose expression is ben pounds identified herein may be determined using mass eficial to a subject with a particular disease or disorder. spectrometry, nuclear magnetic resonance (“NMR), X ray Examples of genes from which the untranslated regions may crystallography, or vibrational spectroscopy. 15 be obtained or derived from include, but are not limited to, The invention encompasses the use of the compounds cytokines, cytokine receptors, T cell receptors, B cell recep identified in accordance with the methods described herein tors, co-stimulatory molecules, clotting cascade factors, for the modulation (i.e., upregulation or downregulation) of cyclins, cyclin inhibitors, oncogenes, growth factors, growth the expression of a target gene. The upregulation or down factor receptors, tumor Suppressors, apoptosis inhibitor pro regulation of a target gene is particularly useful in vitro teins, cell adhesion molecules, hormones, GTP-binding pro when attempting to produce a protein encoded by said target teins, glycoproteins, ion channel receptors, calcium channel gene for use as a therapeutic or prophylactic agent, or in pumps, steroid receptors, opioid receptors, Sodium channel experiments conducted to, e.g., identify the function or pumps, heat shock proteins, MHC proteins, and tumor efficacy of said protein. The invention also encompasses the associated antigens (TAAS). use of the compounds identified in accordance with the 25 Specific examples of genes from which the untranslated methods described herein for the prevention, treatment or regions may be obtained or derived from include, but are not amelioration of a disease or disorder or a symptom thereof. limited, to the gene encoding abl, the gene encoding acetyl Examples of diseases and disorders which may be pre CoA carboxylase beta (“ACC2'; see, e.g., OMIM accession vented, treated or ameliorated utilizing a compound identi number 601557, locus link accession number 32), the gene fied in accordance with the invention include, but are not 30 encoding acetylcholinesterase (“ACHE”: see, e.g., OMIM limited to, proliferative disorders, disorders associated with accession number 100740, locus link accession number 43, aberrant angiogenesis, inflammatory disorders, infectious GenBank accession number NM 0006 65), the gene encod diseases, genetic disorders, autoimmune disorders, cardio ing actin, alpha cardiac (“ACTC'; see, e.g., OMIM acces vascular diseases, and central nervous system disorders. In sion number 102540, locus link accession number 70), the an embodiment wherein the disease or disorder is an infec 35 gene encoding acyl-CoA dehydrogenase (ACADVL’; see, tious disease, the infectious disease can be caused by a e.g., OMIM accession number 201475, locus link accession fungal infection, a bacterial infection, a viral infection, or an number 37), the gene encoding adiponectin (“ACRP30”; infection caused by another type of pathogen. see, e.g., OMIM accession number 605441, locus link 5.1. Untranslated Regions accession number 9370, GenBank accession number NM Any untranslated region may be utilized in the reporter 40 0047 97), the gene encoding ADP-ribosylation factor-4 gene constructs described herein. An untranslated gene (“ARF4'; see, e.g., OMIM accession number 601 177, locus region(s) may be obtained or derived from a gene from any link accession number 378, GenBank accession number NM species, including, but not limited to, plants (e.g., soybean, 0017 eV 25), the gene encoding alpha-glucosidase, the gene canola, cotton, wheat, corn, rice, potato, and tomato plants), encoding Alzheimer's disease amyloid A4 ('APP” or “A4” viruses, bacteria, fungus and animals (including, but not 45 or “CVAP’ or “AD1'; see, e.g., OMIM accession number limited to, mammals (primates and non-primates), farm 104760, locus link accession number 351), the gene encod animals (e.g., horses, pigs, cows, donkeys, etc.), pets (e.g., ing angiogenin (“ANG” or “RNASE5”: see, e.g., OMIM guinea pigs, cats, and dogs), and humans). Untranslated accession number 105850, locus link accession number 283, regions may be obtained and the nucleotide sequence of the GenBank accession number NM 0011 45), the gene encod untranslated regions determined by any method well-known 50 ing angiopoietin1 (ANG 1'; see, e.g., OMIM accession to one of skill in the art. The nucleotide sequence of an number 601667, locus link accession number 284), the gene untranslated region for a target gene can be obtained, e.g., encoding angiopoietin2 (“ANG2'; see, e.g., OMIM acces from the literature or a database such as GenBank. Alterna sion number 601922, locus link accession number 285), the tively, the nucleotide sequence of the untranslated regions of gene encoding angiostatin, the gene encoding angiotensin a target gene may be generated from nucleic acid from a 55 1-converting enzyme (“DCP1’; see, e.g., OMIM accession Suitable source. If a clone containing a nucleic acid of an number 106180, locus link accession number 1636), the untranslated region of a target gene is not available, but the gene encoding antigen CD82 (“KAI1; see, e.g., OMIM sequence of the untranslated region is known, a nucleic acid accession number 600623, locus link accession number of the untranslated region may be chemically synthesized or 3732, GenBank accession number NM0022 31), the gene obtained from a suitable source (e.g., a cDNA library) by 60 encoding APC, the gene encoding atrial natriuretic factor, PCR amplification. Once the nucleotide sequence of an the gene encoding bactericidal/permeability-increasing pro untranslated region is determined, the nucleotide sequence tein (“BPI'; see, e.g., OMIM accession number 109.195, of the untranslated region may be manipulated using meth locus link accession number 671, GenBank accession num ods well-known in the art for the manipulation of nucleotide ber NM 0017 eV 25), the gene encoding bcl-2, the gene sequences, e.g., recombinant DNA techniques, site directed 65 encoding beta-catenin (“CTNNB1”: see, e.g., OMIM acces mutagenesis, PCR, etc. (see, for example, the techniques sion number 116806, locus link accession number 1499), the described in Sambrook et al., 1990, Molecular Cloning. A gene encoding beta-site APP-cleaving enzyme 2 (“BASE2: US 9,493,845 B2 25 26 see, e.g., OMIM accession number 605668, locus link GenBank accession number NM 000791), the gene encod accession number 25825, GenBank accession number NM ing a disintegrin and metallo proteinase domain 33 (ADAM 138992), the gene encoding bile salt export pump (“ABCB1 33”; see, e.g., OMIM accession number 607 114, locus link 1'; see, e.g., OMIM accession number 603201, locus link accession number 80332), the gene encoding DNA methyl accession number 8647), the gene encoding BMP, the gene 5 transferase (“DNMT3b'; see, e.g., OMIM accession number encoding BNDF, the gene encoding bombesin receptor, the 602900, locus link accession number 1789), the gene encod gene encoding brcal, the gene encoding brca2, the gene ing DPP-IV, the gene encoding drebrin-1 dendritic spine encoding C1q complement receptor (see, e.g., OMIM acces protein (“DBN1; see, e.g., OMIM accession number sion number 120577, locus link accession number 22918), 126660, locus link accession number 1627, GenBank acces the gene encoding c-fms, the gene encoding c-myc, the gene 10 sion number NM 004395, NM 080881), the gene encoding encoding calcitonin, the gene encoding calcium-binding E-cadherin, the gene encoding effector cell protease receptor protein in macrophages (“MRP14; see, e.g., OMIM acces (“EPR1'; see, e.g., OMIM accession number 603411, locus sion number 123886, locus link accession number 6280, link accession number 8475), the gene encoding EGF, the GenBank accession number NM 0029 ev 65), the gene gene encoding EGFR (see, e.g., OMIM accession number encoding callsenilin (“DREAM/CSEN” or “CREAM” or 15 131550, locus link accession number 1956), the gene encod “KCh IP3'; see, e.g., OMIM accession number 604662, ing an EGFR subunit, the gene encoding EIF4BP (see, e.g., locus link accession number 30818, GenBank accession OMIM accession number 602223, locus link accession number NM 0134), the gene encoding carnitine o-palmi number 1978, GenBank accession number NM004095), the toyltransferase (“CPT2'; see, e.g., OMIM accession number gene encoding EMMPRIN (see, e.g., OMIM accession 600650, locus link accession number 1376), the gene encod number 1094.80, locus link accession number 682, GenBank ing catechol-o-methyltransferase (“COMT'; see, e.g., accession number NM001728), the gene encoding emot OMIM accession number 116790, locus link accession akin ATP-binding cassette, sub-family a member 1 number 1312, GenBank accession number NM 000754, NM (“ABCA1'; see, e.g., OMIM accession number 600046, 007310), the gene encoding cathepsin K, the gene encoding locus link accession number 19), the gene encoding endosta CD40 ligand (“TNFSF5'; see, e.g., OMIM accession num 25 tin, the gene encoding eotaxin (“CCL11: see, e.g., OMIM ber 300386, locus link accession number 959), the gene accession number 601 156, locus link accession number encoding cdk4 inhibitor, the gene encoding chemokine 6356, GenBank accession number NM002986), the gene (C-C) receptor (“IL13R; see, e.g., OMIM accession num encoding erythropoietin (“EPO'; see, e.g., OMIM accession ber 601268, locus link accession number 1232), the gene number 133170, locus link accession number 2056, Gen encoding chemokine (C-X3-C) receptor 1 (“CX3CR1; see, 30 Bank accession number NM 000799), the gene encoding e.g., OMIM accession number 601470, locus link accession estrogen receptor, the gene encoding factor IX, the gene number 1524), the gene encoding CLCA homolog encoding factor VIII, the gene encoding farnesyltransferase, (“hCLCA2; see, e.g., OMIM accession number 604003, the gene encoding FGF, the gene encoding FGF1 (see, e.g., locus link accession number 9635, GenBank accession OMIM accession number 131220, locus link accession number NM 0065 36), the gene encoding complement 35 number 2246, GenBank accession number), the gene encod decay-accelerating factor (“DAF/CD55”: see, e.g., OMIM ing FGF2 (see, e.g., OMIM accession number 134920, locus accession number 125240, locus link accession number link accession number 2247. GenBank accession number 1604), the gene encoding connective tissue growth factor NM002006), the gene encoding FGFR, the gene encoding (“CTGF'; see, e.g., OMIM accession number 121009, locus fibrillin (“FBN1”: see, e.g., OMIM accession number link accession number 1490), the gene encoding corticotro 40 134797, locus link accession number 2200), the gene encod phin releasing factor, the gene encoding CTLA4, the gene ing FMS-related tyrosine kinase 1 (“FLT1: see, e.g., OMIM encoding cyclin D1, the gene encoding cyclin E, the gene accession number 165070, locus link accession number encoding cyclin T1 (see, e.g., OMIM accession number 2321, GenBank accession number NM0020 ev 19), the gene 602506, locus link accession number 904, GenBank acces encoding forkhead box C2 (“FOXC2'; see, e.g., OMIM sion number NM 0012 40), the gene encoding cyclin 45 accession number 602402, locus link accession number dependent kinase inhibitor 1A (“p21” or “WAFT' or 2303, GenBank accession number NM 0052 51), the gene “CDKN1A” or “Cip1”: see, e.g., OMIM accession number encoding fos (see, e.g., OMIM accession number 164810, 116899, locus link accession number 1026, GenBank acces locus link accession number 2353, GenBank accession sion number NM 0784 67), the gene encoding cyclin number NM0052 52), the gene encoding G-CSF, the gene dependent kinase inhibitor 2A (“CDKN2A'; see, e.g., 50 encoding G-CSF 3 (“CSF3”; see, e.g., OMIM accession OMIM accession number 600 160, locus link accession number 138970, locus link accession number 1440), the number 1029), the gene encoding cystic fibrosis transmem gene encoding a GABA receptor, the gene encoding galanin brane conductance regulator (“CFTR), the gene encoding (“GAL'; see, e.g., OMIM accession number 137035, locus cytochrome P-450, the gene encoding D-1 dopamine recep link accession number 2586), the gene encoding gastric tor (“DRD1'; see, e.g., OMIM accession number 126449, 55 inhibitory polypeptide (“GIP'; see, e.g., OMIM accession locus link accession number 1812, GenBank accession number 137240, locus link accession number 2695), the number NM 00794, X589987), the gene encoding D-amino gene encoding GDNF, the gene encoding GGF, the gene acid oxidase (“DAO”: see, e.g., OMIM accession number encoding GGRP, the gene encoding ghrelin (“GHRL: see, 124050, locus link accession number 1610, GenBank acces e.g., OMIM accession number 605353, locus link accession sion number NM 0019 17), the gene encoding damage 60 number 51738), the gene encoding gip, the gene encoding specific DNA binding protein (“DDB1”: see, e.g., OMIM glucagon, the gene encoding glucagon receptor (“GCGR': accession number 600045, locus link accession number see, e.g., OMIM accession number 138033, locus link 1642), the gene encoding DCC, the gene encoding desmog accession number 2642), the gene encoding glucagon-like lein 1 (“DSG1'; see, e.g., OMIM accession number 125670, peptide-1 (“GLP1’; see, e.g., OMIM accession number locus link accession number 1828), the gene encoding a 65 138030, locus link accession number 2641), the gene encod dihydrofolate reductase (“DHFR'; see, e.g., OMIM acces ing glucokinase (“GCK'; see, e.g., OMIM accession number sion number 126060, locus link accession number 1719, 138079, locus link accession number 2645, GenBank acces US 9,493,845 B2 27 28 sion number NM 0001 62), the gene encoding glutamic acid see, e.g., OMIM accession number 603258, locus link decarboxylase 2 (see, e.g., OMIM accession number accession number 3551), the gene encoding inositol pholy 138275), the gene encoding glutamic acid decarboxylase 3 phosphate phosphatase-like 1 (“SHIP-2'; see, e.g., OMIM (see, e.g., OMIM accession number 138276), the gene accession number 600829, locus link accession number encoding glutamic acid decarboxylase, brain, membrane 3636, GenBank accession number NM 001567), the gene form (see, e.g., OMIM accession number 138277), the gene encoding insulin, the gene encoding interferon inducible encoding glycogen synthase kinase-3A (“GSK-3A'; see, protein (“CXCL10 (IP10); see, e.g., OMIM accession e.g., OMIM accession number 606784, locus link accession number 147310, locus link accession number 3627. Gen number 2931), the gene encoding glycogen synthase kinase Bank accession number NM 001565), the gene encoding 3B (“GSK-3B'; see, e.g., OMIM accession number 605004, 10 interferon (“IFN)-C., the gene encoding interferon-C. 1/13 locus link accession number 2932), the gene encoding precursor, the gene encoding interferon-C. 5 precursor GM-CSF (see, e.g., OMIM accession number 138960, locus (“IFNA5”: see, e.g., OMIM accession number 147565, link accession number 1437), the gene encoding gonadotro locus link accession number 3442), the gene encoding pin, the gene encoding gonadotropin releasing hormone, the interferon-C.-16 precursor (“IFNA16”: see, e.g., OMIM gene encoding GRO2 oncogene or macrophage inflamma 15 accession number 147580, locus link accession number tory protein-2-alpha precursor (“CXCL2; see, e.g., OMIM 3449), the gene encoding IFN-B, the gene encoding IFN-B accession number 1391 10, locus link accession number 1 (“IFNB1”: see, e.g., OMIM accession number 147640, 2920), the gene encoding growth hormone releasing factor, locus link accession number 3456), the gene encoding IFN-y the gene encoding growth hormone, the gene encoding gsp. (see, e.g., OMIM accession number 147440, locus link the gene encoding H-ras, the gene encoding heat shock accession number 3479), the gene encoding insulin receptor protein (“HSP)-70, the gene encoding heparanase (“HPA': (“INSR'; see, e.g., OMIM accession number 147670, locus see, e.g., OMIM accession number 604724, locus link link accession number 3643, GenBank accession number accession number 10855), the gene encoding hepatitis A NM 0002 08), the gene encoding interleukin-1 b (“IL1B: virus cellular receptor (“HAVCR; see, e.g., OMIM acces see, e.g., OMIM accession number 147720, locus link sion number 606518, locus link accession number 26762), 25 accession number 3553), the gene encoding interleukin-2 the gene encoding hepatitis B virus X interacting protein (“IL-2'; see, e.g., OMIM accession number 147680, locus (“HBXIP), the gene encoding hepsin (“HPN'; see, e.g., link accession number 3558), the gene encoding interleu OMIM accession number 142440, locus link accession kin-3 (“IL-3), the gene encoding interleukin-4 (“IL-4; see, number 3249, GenBank accession number NM002151), the e.g., OMIM accession number 147780, locus link accession gene encoding Her-2 (“ERBB2'; see, e.g., OMIM accession 30 number 3565, GenBank accession number NM0005 89), the number 164870, locus link accession number 2064), the gene encoding interleukin-4 receptor (“IL4R'; see, e.g., gene encoding HGF, the gene encoding histone acetyltrans OMIM accession number 147781, locus link accession ferase (“HAT1'; see, e.g., OMIM accession number 603053, number 3566, GenBank accession number NM000418), the locus link accession number 8520, GenBank accession gene encoding interleukin-5 (“IL-5'), the gene encoding number NM 0036 42), the gene encoding histone deacety 35 interleukin-6 (“IL-6”: see, e.g., OMIM accession number lase 1 (“HDAC1'; see, e.g., OMIM accession number 147620, locus link accession number 3569), the gene encod 601241, locus link accession number 3065), the gene encod ing interleukin-7 (“IL-7), the gene encoding interleukin-8 ing histone deacetylase 3 (“HDAC3; see, e.g., OMIM (“IL-8; see, e.g., OMIM accession number 146930, locus accession number 605166, locus link accession number link accession number 3576), the gene encoding interleu 8841, GenBank accession number NM0038 ev83), the gene 40 kin-9 (“IL-9'; see, e.g., OMIM accession number 146931, encoding HIV Tat Specific Factor 1 (“HTATSF1'; see, e.g., locus link accession number 3578), the gene encoding OMIM accession number 300346, locus link accession interleukin-10 (“IL-10; see, e.g., OMIM accession number number 27336), the gene encoding HMG CoA synthetase, 124092, locus link accession number 3586, GenBank acces the gene encoding HSP-90, the gene encoding huntingtin sion number NM000572), the gene encoding interleukin-12 (“HD’; see, e.g., OMIM accession number 143100, locus 45 (“IL-12), the gene encoding interleukin-12 beta chain pre link accession number 3064, GenBank accession number cursor (“IL12B: see, e.g., OMIM accession number NM002111), the gene encoding Huantigen R (“HUR'; see, 161561, locus link accession number 3593), the gene encod e.g., OMIM accession number 603466, locus link accession ing interleukin-13 (IL-13”; see, e.g., OMIM accession number 1994, GenBank accession number NM001419), the number 147683, locus link accession number 3596, Gen gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase 50 Bank accession number NM 002188), the gene encoding (“HMGCR'; see, e.g., OMIM accession number 142910, interleukin-15 (IL-15'), the gene encoding interleukin-17F locus link accession number 3156), the gene encoding (“ML1; see, e.g., OMIM accession number 606496, locus hypoxia-inducible factor 1 (HIF-1A'; see, e.g., OMIM link accession number 11274), the gene encoding interleu accession number 603348, locus link accession number kin-18 (“IL-18'; see, e.g., OMIM accession number 600953, 3091), the gene encoding hypoxia-inducible factor 1-alpha 55 locus link accession number 3606), the gene encoding inhibitor (“HIF1AN'; see, e.g., OMIM accession number INI1/hSNF5 (see, e.g., OMIM accession number 601607, 606615, locus link accession number 55662), the gene locus link accession number 6598), the gene encoding jun, encoding iduronate 2-sulfatase (“IDS”; see, e.g., OMIM the gene encoding kallikrein 6 (“KLK6'; see, e.g., OMIM accession number 309900, locus link accession number accession number 602652, locus link accession number 3423), the gene encoding IGF-1 (see, e.g., OMIM accession 60 5653, GenBank accession number NM 002774), the gene number 147440, locus link accession number 3486), the encoding KGF, the gene encoding ki-ras, the gene encoding gene encoding IGF-1R (see, e.g., OMIM accession number kit ligand, stem cell factor (“KITLG (SCF)'; see, e.g., 147370, locus link accession number 3480, GenBank acces OMIM accession number 184745, locus link accession sion number NM 0008 eV 75), the gene encoding IGF-2, the number 4254, GenBank accession number NM000899), the gene encoding IGF binding protein-2 (“IGFBP2'; see, e.g., 65 gene encoding klotho (“KL'; see, e.g., OMIM accession OMIM accession number 146731, locus link accession number 604824, locus link accession number 9365, Gen number 3485), the gene encoding IkB kinase (“IKBKB': Bank accession number NM 004795), the gene encoding US 9,493,845 B2 29 30 L-myc, the gene encoding large tumor suppressor sion number 600266, locus link accession number 6556), the (“LATS1”: see, e.g., OMIM accession number 603473, gene encoding neural cell adhesion molecule 1 (“NCAM1': locus link accession number 9113, GenBank accession num see, e.g., OMIM accession number 116930, locus link ber NM 0046 ev 90), the gene encoding LDL receptor accession number 4684), the gene encoding neuron growth (“LDLR; see, e.g., OMIM accession number 606945, locus associated protein 43 (“GAP-43; see, e.g., OMIM acces link accession number 3949, GenBank accession number sion number 162060, locus link accession number 2596), the NM 000527), the gene encoding leptin (“LEP'; see, e.g., gene encoding NF1, the gene encoding NF2, the gene OMIM accession number 1641.60, locus link accession encoding NGF, the gene encoding a NGFR subunit, the gene number 3952, GenBank accession number NM000230), the encoding nm23, the gene encoding nuclear factor of kappa gene encoding leptin receptor (“LEPR'; see, e.g., OMIM 10 light polypeptide gene enhancer in B-cells 1 (“NFKB1”: see, accession number 601 007, locus link accession number e.g., OMIM accession number 164011, locus link accession 3953), the gene encoding leucine amino peptidase-3 number 4790), the gene encoding OSM, the gene encoding (“LAP3; see, e.g., OMIM accession number 606832, locus osteopontin (“OPN'; see, e.g., OMIM accession number link accession number 51056), the gene encoding leukemia 166490, locus link accession number 6696), the gene encod inhibitory factor ("LIF; see, e.g., OMIM accession number 15 ing P-glycoprotein-1 (“PGY 1; see, e.g., OMIM accession 159540, locus link accession number 3976), the gene encod number 171050, locus link accession number 5243, Gen ing leukemia inhibitory factor receptor ("LIFR: see, e.g., Bank accession number NM 000927), the gene encoding OMIM accession number 151443, locus link accession p38 MAP kinase (“p38” or “MAPK14; see, e.g., OMIM number 3977), the gene encoding linker for activation of T accession number 600289, locus link accession number cells (“LAT’’; see, e.g., OMIM accession number 602354, 1432), the gene encoding p53, the gene encoding p300/CBP locus link accession number 27040), the gene encoding livin associated factor (“PCAF; see, e.g., OMIM accession num (see, e.g., OMIM accession number 605737, locus link ber 602303, locus link accession number 8850), the gene accession number 79444, GenBank accession number NM encoding parathyroid hormone, the gene encoding PDGF, 1393 eV 17), the gene encoding luteinizing hormone, the the gene encoding PDGF, beta chain (“PDGF2'; see, e.g., gene encoding luteinizing hormone releasing hormone, the 25 OMIM accession number 190040, locus link accession gene encoding macrophage migration inhibitory factor number 5155), the gene encoding a PDGFR subunit, the (“MIF'; see, e.g., OMIM accession number 153620, locus gene encoding peroxin-1 (“PEX1; see, e.g., OMIM acces link accession number 4282, GenBank accession number sion number 602136, locus link accession number 5189), the NM002415), the gene encoding major histocompatibility gene encoding peroxisome assembly factor-2 (“PEX6'; see, complex class I chain-related gene A ("MICA: See, e.g., 30 e.g., OMIM accession number 601498, locus link accession OMIM accession number 600 169, locus link accession number 5190), the gene encoding peroxisome proliferator number 4276, GenBank accession number NM000247), the activated receptor-gamma (“PPARg'; see, e.g., OMIM gene encoding major histocompatibility complex class I accession number 601487, locus link accession number chain-related gene B (MICB’; see, e.g., OMIM accession 5468), the gene encoding phenylalanine hydroxylase, the number 602436, locus link accession number 4277, Gen 35 gene encoding phosphodiesterase, the gene encoding human Bank accession number NM 005931), the gene encoding phosphotyrosyl-protein phosphatase (“PTP-1B: see, e.g., matrix metalloproteinase 9 (“MMP9”: see, e.g., OMIM OMIM accession number 176885, locus link accession accession number 120361, locus link accession number number 5770, GenBank accession number NM002827), the 4318), the gene encoding matrix metalloproteinase 12 gene encoding placental growth factor (“PGF; see, e.g., (“MMP12; see, e.g., OMIM accession number 601046, 40 OMIM accession number 601 121, locus link accession locus link accession number 4321), the gene encoding max number 5228, GenBank accession number NM0026 eV 32), interacting protein 1 (“MXI1; see, e.g., OMIM accession the gene encoding plasminogen activator inhibitor protein number 600020, locus link accession number 4601), the (“PAI1; see, e.g., OMIM accession number 173360, locus gene encoding MCC, the gene encoding MDM2 (see, e.g., link accession number 5054), the gene encoding pleiotro OMIM accession number 164785, locus link accession 45 phin (“PTN'; see, e.g., OMIM accession number 162095, number 4193, GenBank accession number NM002392), the locus link accession number 5764), the gene encoding gene encoding METH-1, the gene encoding METH-2, the poly(rC) binding protein 2 (“PCBP2'; see, e.g., OMIM gene encoding methyl-CpG-binding endonuclease accession number 601210, locus link accession number (“MBD4'; see, e.g., OMIM accession number 603574, locus 5094), the gene encoding progranulin (“PCDGF or “GRN': link accession number 8930, GenBank accession number 50 see, e.g., OMIM accession number 138945, locus link NM 0039 ev 25), the gene encoding monoamine oxidase-A accession number 2896), the gene encoding prolactin ("MAOA'; see, e.g., OMIM accession number 309850, (“PRL'; see, e.g., OMIM accession number 176760, locus locus link accession number 4128, GenBank accession link accession number 5617, GenBank accession number number NM 0002 ev 40), the gene encoding monoamine NM 0009 48), the gene encoding proliferating cell nuclear oxidase-B ("MAOB'; see, e.g., OMIM accession number 55 antigen (“PCNA'; see, e.g., OMIM accession number 309860, locus link accession number 4129), the gene encod 176740, locus link accession number 5111), the gene encod ing monocyte chemotactic protein 1 ("MCP1’; see, e.g., ing protein kinase B/Akt (“AKT1: see, e.g., OMIM acces OMIM accession number 158105, locus link accession sion number 164730, locus link accession number 207), the number 6347), the gene encoding mos, the gene encoding gene encoding protein kinase C, gamma (PKCg'; see, e.g., MTS1, the gene encoding myc, the gene encoding myotro 60 OMIM accession number 176980, locus link accession phin, the gene encoding N-acetyltransferase, the gene number 5582), the gene encoding protein-tyrosine phos encoding N-cadherin, the gene encoding N-methyl D-aspar phatase, 4A, 3 (“PTP4A3; see, e.g., OMIM accession tate (“NMDA) receptor, the gene encoding NAD(P)-de number 606449, locus link accession number 11156, Gen pendent steroid dehydrogenase (“NSDHL'; see, e.g., OMIM Bank accession number NM 0326 11), the gene encoding accession number 300275, locus link accession number 65 psoriasin (“PSOR1; see, e.g., OMIM accession number 50814), the gene encoding natural resistance-associated 600353, locus link accession number 6278, GenBank acces macrophage protein (“NRAM P: see, e.g., OMIM acces sion number NM002963), the gene encoding ras, the gene US 9,493,845 B2 31 32 encoding resistin (“Fizz3; see, e.g., OMIM accession num lial growth factor (“VEGF), the gene encoding virion ber 605565, locus link accession number 56729, GenBank infectivity factor (“VIF), and the gene encoding VLA-4. accession number NM 020415), the gene encoding retino In a specific embodiment, an untranslated region is blastoma (“Rb'; see, e.g., OMIM accession number 180200. obtained or derived from the gene encoding Her-2. In locus link accession number 5925, GenBank accession another embodiment, an untranslated region is not obtained number NM000321), the gene encoding retinoblastoma 1 or derived from the gene encoding Her-2. ("Rb1), the gene encoding retinoblastoma-binding protein In one embodiment, an untranslated region is obtained or 1-like 1 (“RBBP1L1; see, e.g., locus link accession number derived from the gene encoding VEGF. In another embodi 51742), the gene encoding 5-a reductase, the gene encoding ment, an untranslated region is not obtained or derived from ribonuclease/angiogenin inhibitor (“RNH’; see, e.g., OMIM 10 the gene encoding VEGF. accession number 173320, locus link accession number The untranslated regions may be obtained or derived from 6050), the gene encoding 5100 calcium-binding protein A8 the genome of any virus utilizing any method well-known to (“MRP8'; see, e.g., OMIM accession number 123885, locus one of skill in the art. The nucleotide sequence of an link accession number 6279, GenBank accession number untranslated region for a genome of a virus can be obtained, NM0029 ev 64), the gene encoding signal transducer and 15 e.g., from the literature or a database such as GenBank. activator of transcription 6 (“STAT6'; see, e.g., OMIM Examples of viruses from which the untranslated regions accession number 601512, locus link accession number may be obtained or derived from include, but are not limited 6778), the gene encoding soluble-type polypeptide FZD4S to, retrovirsues (e.g., human immunodeficiency virus (“FZD4S'; see, e.g., OMIM accession number 604579, (“HIV) and human T cell leukemia virus (“HTLV), her locus link accession number 8322), the gene encoding pesviruses (e.g., herpes simplex virus, epstein barr virus and Somatotrophin or Somatotropin, the gene encoding Src (see, Varicella Zoster virus), reoviruses (e.g., reovirus and rotavi e.g., OMIM accession number 190090, locus link accession rus), picornaviruses (e.g., poliovirus, rhinovirus and hepa number 6714, GenBank accession number NM0054 eV 17), titis. A virus), togaviruses (e.g., rubella virus), orthomyxo the gene encoding Survivin, the gene encoding T-cell lym virus (e.g., influenza virus), paramyxoviruses (e.g., measles phoma invasion and metastasis 1 (“TIAM1'; see, e.g., 25 virus, mumps virus, respiratory syncytical virus and parain OMIM accession number 600687, locus link accession fluenza virus), filoviruses (e.g., ebola virus and Marburg number 7074), the gene encoding TEK tyrosine kinase virus), rhabdoviruses (e.g., rabies virus), coronaviruses (e.g., (“TIE2; see, e.g., OMIM accession number 600221, locus coronavirus), rhinoviruses, hepatitis B virus, and hepatitis C link accession number 7010), the gene encoding telomerase, virus. the gene encoding TGF-B, the gene encoding TGF-31 (see, 30 The untranslated regions may be obtained or derived from e.g., OMIM accession number 190180, locus link accession the genome of any bacteria utilizing any method well-known number 7040), the gene encoding thrombomodulin to one of skill in the art. The nucleotide sequence of an (“THED' or “THRM'; see, e.g., OMIM accession number untranslated region for a genome of a bacteria can be 188040, locus link accession number 7056), the gene encod obtained, e.g., from the literature or a database Such as ing thrombopoietin (“THPO or “TPO'; see, e.g., OMIM 35 GenBank. Examples of bacteria from which the untranslated accession number 600044, locus link accession number regions may be obtained or derived from include, but are not 7066), the gene encoding human trisosephosphate isomerase limited to, the Aquaspirillum family, AZospirillum family, (“TPI1; see, e.g., OMIM accession number 109450, locus AZotobacteraceae family, Bacteroidaceae family, Bartonella link accession number 7167), the gene encoding thyroid species, Bdellovibrio family, Campylobacter species, Chla hormone, the gene encoding thyroid stimulating hormone, 40 mydia species (e.g., Chlamydia pneumoniae), clostridium, the gene encoding tissue factor, the gene encoding tissue Enterobacteriaceae family (e.g., Citrobacter species, inhibitor of metalloprotease 1 (“TIMP1’; see, e.g., OMIM Edwardsiella, Enterobacter aerogenes, Erwinia species, accession number 305370, locus link accession number Escherichia coli, Hafinia species, Klebsiella species, Mor 7076), the gene encoding tissue inhibitor of metalloprotease ganella species, Proteus vulgaris, Providencia, Salmonella 2 (“TIMP2'; see, e.g., OMIM accession number 188825, 45 species, Serratia marcescens, and Shigella flexneri), Gar locus link accession number 7077, GenBank accession dinella family, Haemophilus influenzae, Halobacteriaceae number NM 003255), the gene encoding tissue inhibitor of family, Helicobacter family, Legionallaceae family, Listeria metalloprotease 4 (“TIMP4'; see, e.g., OMIM accession species, Methylococcaceae family, mycobacteria (e.g., number 601915, locus link accession number 7079, Gen Mycobacterium tuberculosis), Neisseriaceae family, Bank accession number NM 0032 56), the gene encoding 50 Oceanospirillum family, Pasteurellaceae family, Pneumo TNF-C. (see, e.g., OMIM accession number 191160, locus coccus species, Pseudomonas species, Rhizobiaceae family, link accession number 7124), the gene encoding troponin T Spirillum family, Spirosomaceae family, Staphylococcus (“TnT), the gene encoding uncoupling protein 2 (“UCP2: (e.g., methicillin resistant Staphylococcus aureus and see, e.g., OMIM accession number 601693, locus link Staphylococcus pyrogenes), Streptococcus (e.g., Streptococ accession number 7351, GenBank accession number NM 55 cus enteritidis, Streptococcus fasciae, and Streptococcus 003355), the gene encoding urokinase plasminogen activa pneumoniae), VampirovibrHelicobacter family, and Vam tor (“uPA'; see, e.g., OMIM accession number 191840, pirovibrio family. locus link accession number 5328), the gene encoding The untranslated regions may be obtained or derived from utrophin (“UTRN'; see, e.g., OMIM accession number the genome of any fungus utilizing any method well-known 128240, locus link accession number 7402), the gene encod 60 to one of skill in the art. The nucleotide sequence of an ing V-myc myelocytomatosis viral oncogene homolog ("c- untranslated region for a genome of a fungus can be MYC'; see, e.g., OMIM accession number 190080, locus obtained, e.g., from the literature or a database Such as link accession number 4609), the gene encoding Vanilloid GenBank. Examples of fungus from which the untranslated receptor subunit 1 (“VR1'; see, e.g., OMIM accession regions may be obtained or derived from include, but are not number 602076, locus link accession number 7442, Gen 65 limited to, Absidia species (e.g., Absidia corymbifera and Bank accession number NM 0187 ev 27, NM 080704, NM Absidia ramosa), Aspergillus species, (e.g., Aspergillus fia 080705, NM 080706), the gene encoding vascular endothe vus, Aspergillus filmigatus, Aspergillus nidulans, Aspergillus US 9,493,845 B2 33 34 niger, and Aspergillus terreus), Basidiobolus ranarum, Blas PCR amplification. Once the nucleotide sequence of an tomyces dermatitidis, Candida species (e.g., Candida albi element is determined, the nucleotide sequence of the ele cans, Candida glabrata, Candida kern, Candida krusei, ment may be manipulated using methods well-known in the Candida parapsilosis, Candida pseudotropicalis, Candida art for the manipulation of nucleotide sequences, e.g., quillermondii, Candida rugosa, Candida Stellatoidea, and recombinant DNA techniques, site directed mutagenesis, Candida tropicalis), Coccidioides immitis, Conidiobolus PCR, etc. (see, for example, the techniques described in species, Cryptococcus neoforms, Cunninghamella species, Sambrook et al., 1990, Molecular Cloning, A Laboratory dermatophytes. Histoplasma capsulatum, Microsporum Manual. 2d Ed., Cold Spring Harbor Laboratory, Cold gypseum, Mucor pusillus, Paracoccidioides brasiliensis, Spring Harbor, N.Y. and Ausubel et al., eds., 1998, Current Pseudallescheria boydii, Rhinosporidium seeberi, Pneumo 10 Protocols in Molecular Biology, John Wiley & Sons, NY. cystis carinii, Rhizopus species (e.g., Rhizopus arrhizus, which are both incorporated by reference herein in their Rhizopus Oryzae, and Rhizopus microsporus), Saccharony entireties), to generate an element having a different nucleic ces species, Sporothrix schenckii, Zygomycetes, and classes acid sequence. Such as Zygomycetes, Ascomycetes, the Basidiomycetes, In one embodiment, an element(s) of an untranslated Deuteromycetes, and Oomycetes. 15 region comprises the full-length sequence of a UTR, e.g., the The untranslated regions may be obtained or derived from 5' UTR or the 3' UTR. In a specific embodiment, an the genome of any plant utilizing any method well-known to element(s) of an untranslated region that has been shown or one of skill in the art. The nucleotide sequence of an has been Suggested to be involved in the regulation of untranslated region for a genome of a plant can be obtained, mRNA stability and/or translation is utilized in the reporter e.g., from the literature or a database Such as GenBank, constructs described herein. Examples of elements of an EMBL, DDBJ, rice genome database, cotton. genome data untranslated region which may be utilized in the reporter base and maize genome database. Examples of plants from constructs described herein include, but are not limited to, an which the untranslated regions may be obtained or derived IRE, IRES, uORF, MSL-2. G quartet element, 5'-terminal from include, but are not limited to, soybean, canola, cotton, oligopyrimidine tract (“TOP”), ARE, SECIS, histone stem corn, wheat, rice, tomato, and potato. Specific examples of 25 loop, CPE, nanos translational control element, APP, TGE/ plant genes from which an untranslated region may be DRE, BRE, and a 15-LOX-DICE. obtained or derived from include, but are not limited to, 5.1.1.1. Iron Response Element triose phosphate, isomerase, fructose 1,6-bisphosphate ado The maintenance of cellular iron homeostasis occurs at lase, fructose 1,6-bisphosphate, fructose 6-phosphate 2-ki the level of mRNA stability and translation. Two compo nase, phosphoglucoisomerase, pyrophsophate-dependent 30 nents of this regulatory system have been defined: a cis fructose-6-phosphate phosphotransferase, vacuolar H" acting mRNA sequence/structure motif called an iron-re translocating-pyrophosphate, invertase, sucrose synthase, sponsive element (“IRE”) and a specific trans-acting hexokinase, fructokinase, NDP-kinase, glucose-6-phosphate cytoplasmic binding protein, referred to herein as IRE 1-dehydrogenase, phosphoglucomutase, UDP-glucose pyro binding protein (“IRE-BP) (reviewed in, e.g., Mikulits et phosphorylase, glutenin genes, cis-prenyltransferase, 35 al., 1999, Mutat Res. 437(3):219-30; Harrison & Arosio, lipoxygenase, and soybean vestitone reductase (see, e.g., 1996, Biochim Biophys Acta. 1275(3):161-203; Kuhn & U.S. Patent Application Publication No. 2003/0135870 A1 Hentze, 1992, J Inorg Biochem. 1992, 47(3–4): 183-95; and and U.S. Pat. No. 6,638,5252, 6,645,747, 6,627,797, and Harford & Klausner, 1990, Enzyme 44(1-4):28-41, the dis 6,617.493, which are incorporated herein by reference in its closures of which are hereby incorporated by reference in entirety). 40 their entireties). Iron scarcity induces binding of IRE-BPs to In particular, a 5' UTR of a target gene, a 3' UTR of a a single IRE in the 5' UTR of ferritin, eALAS, aconitase, target gene, or a 5' UTR and a 3' UTR of a target gene may erythroid 5-aminolevulinic acid synthase, and SDHb be utilized in a reporter construct. In a specific embodiment, mRNAS, which specifically suppresses translation initiation. a 5' UTR of a target gene with a stable hairpin secondary Simultaneous interaction of IRE-BPs with multiple IREs in structure is utilized in a reporter construct. In another 45 the 3' UTR of transferrin receptor mRNA selectively causes specific embodiment, a reporter gene in the reporter con its stabilization. The pattern is reverted under iron overload: struct contains an intron. In a preferred embodiment, a 5' IRE-BP mRNA binding affinity is reduced, which results in UTR and a 3' UTR of a target gene are utilized in a reporter efficient protein synthesis of target transcripts harboring construct. In another preferred embodiment, a 5' UTR and a IREs in the 5' UTR and rapid degradation of transferrin 3' UTR of a target gene and an intron-containing reporter 50 mRNA. Any gene containing an IRE including, but not gene are utilized in a reporter construct. limited to, the IREs described in the references cited above, 5.1.1. Elements of Untranslated Regions can be used in the present invention to identify compounds Any element of an untranslated region(s) of a target gene that modulate untranslated region-dependent gene expres may be utilized in the reporter gene constructs described S1O. herein. Elements of an untranslated region(s) may be 55 5.1.1.2. Internal Ribosome Entry Site obtained and the nucleotide sequence of the elements deter The internal ribosome entry site (“IRES) is one of the mined by any method well-known to one of skill in the art. better characterized 5' UTR-based cis-acting elements of The nucleotide sequence of an element of an untranslated post-transcriptional gene expression control. IRESes facili region for a target gene can be obtained, e.g., from the tate cap-independent translation initiation by recruiting ribo literature or a database such as GenBank. Alternatively, the 60 somes directly to the 5' UTR of the mRNA. IRESes are nucleotide sequence of an element of an untranslated region commonly located in the 3' region of 5' UTR and are, as of a target gene may be generated from nucleic acid from a recent work has established, frequently composed of several Suitable source. If a clone containing a nucleic acid of an discrete sequences. IRESes do not share significant primary element of an untranslated region of a target gene is not structure homology, but do form distinct RNA tertiary available, but the sequence of the element is known, a 65 structures. Some IRESes contain sequences complementary nucleic acid of the element may be chemically synthesized to 18S RNA and therefore may form stable complexes with or obtained from a suitable source (e.g., a cDNA library) by 40S ribosomal subunit and initiate assembly of translation US 9,493,845 B2 35 36 ally competent complex. A classic example of an “RNA of which are incorporated by reference in their entireties). A only IRES is the internal ribosome entry site from Hepatitis G-quartet element was first identified as a conserved con C virus. However, most known IRESes require protein sensus sequence GGNTGGNGGNTGG (SEQID NO: 1), co-factors for activity. More than 10 IRES trans-acting which was present in single-stranded DNA aptamers that factors (“ITAFs) have been identified so far. In addition, all bind thrombin and inhibited thrombin-catalyzed fibrin-clot canonical translation initiation factors, with the sole excep formation (see, e.g., Bock et al., 1992, Nature 355:564-566, tion of 5' end cap-binding eIF4E, have been shown to the disclosure of which is incorporated by reference in its participate in IRES-mediated translation initiation (reviewed entirety). A similar sequence in which the G-quartet struc in Vagner et al., 2001, EMBO Reports 2:893 and Transla ture is maintained when the length of the oligonucleotide tional Control of Gene Expression, Sonenberg, Hershey, and 10 between the G pairs is increased has been identified (see, Mathews, eds., 2000, CSHL Press, the disclosures of which e.g., Dias et al., 1994, J. Am. Chem. Soc. 116:4479-4480, the are incorporated by reference in their entireties). disclosure of which is incorporated by reference in its IRES were first identified in picornaviruses (see, e.g., entirety). Pettetier & Sonenberg, 1988, Nature, 334:320-325). The 5' A G-quartet element has been identified in mRNAs asso UTRS of all picornaviruses are long and mediate transla 15 ciated with fragile X mental retardation syndrome (reviewed tional initiation by directly recruiting and binding ribo in, e.g., Bardoni & Mandel, 2002, Curr Opin Genet Dev Somes, thereby circumventing the initial cap-binding step. 12(3):284-93, the disclosure of which is incorporated by Although IRES elements are frequently found in viral reference in its entirety). The fragile X mental retardation mRNAs, they are rarely found in non-viral mRNAs. The syndrome is caused by large methylated expansions of a non-viral mRNAs shown to contain functional IRES ele CGG repeat in the FMR1 gene that lead to the loss of ments in their respective 5' UTRs include those encoding expression of FMRP, an RNA-binding protein. FMRP is immunoglobulin heavy chain binding protein (“BiP) (see, proposed to act as a regulator of mRNA transport or trans e.g., Macejak et al., 1991, Nature, 35390-4); Drosophila lation that plays a role in synaptic maturation and function Antennapedia (see, e.g., Oh et al., 1992, Genes Dev 6:1643 and has been shown to interact preferentially with mRNAs 53) and Ultrabithorax (see, e.g., Ye et al., 1997, Mol. Cell 25 containing a G quartet structure. Biol. 17:1714-21); fibroblast growth factor 2 (see, e.g., G-quartet oligonucleotides can have the sequence Vagner et al., 1995, Mol. Cell Biol. 15:35-44); initiation GGN, GGN, GGNGG (SEQ ID NO. 2), wherein x, y and Z factor eIF4G (see, e.g., Gan et al., 1998, J. Biol. Chem. indicate a variable number of nucleotides (see, e.g., U.S. Pat. 273:5006-12); proto-oncogene c-myc (see, e.g., Nanbru et No. 5,691,145, the disclosure of which is incorporated by al., 1995, J. Biol. Chem. 272:32061-6 and Stoneley, 1998, 30 reference in its entirety). While x, y and Z are each typically Oncogene 16:423-8); vascular endothelial growth factor at least about 2, preferably about 2-10, these segments may (“VEGF) (see, e.g., Stein et al., 1998, Mol. Cell Biol. be longer if desired The regions of variable sequence (i.e., 18:3112-9), and X-linked inhibitor of apoptosis protein N,N',N) are not critical in the present invention and can be (“XIAP) (see, e.g., U.S. Pat. Nos. 6,159,709 and 6,171, varied in length and sequence without disrupting the char 821), the disclosures of which are incorporated by reference 35 acteristic G-quartet structure. As a general rule, the variable in their entireties. Any gene containing an IRES including, N sequences should not be self-complementary and should but not limited to, the IRESes described in the references not contain G residues which would result in alternative cited above, can be used in the present invention to identify G-quartet structures within the molecule. Representative compounds that modulate untranslated region-dependent G-quartet oligonucleotides are 15-20 nucleotides in length, gene expression. 40 but G-quartet oligonucleotides of any length which conform 5.1.1.3. Male Specific Lethal Element to the general formula GGN, GGN, GGNGG (SEQID NO: Male-specific expression of the protein male-specific 3) are also Suitable. The G-quartet oligonucleotide is typi lethal 2 (“MSL-2') controls dosage compensation in Droso cally about 14-30 nucleotides in length. Any gene containing phila. MSL-2 protein is not produced in females and a G-quartet element including, but not limited to, the sequences in both the 5' and 3' UTRs are important for this 45 G-quartet elements described in the references cited above, sex-specific regulation because msl-2 gene expression is can be used in the present invention to identify compounds inhibited in females by Sex-lethal (“SXL'), an RNA binding that modulate untranslated region-dependent gene expres protein known to regulate pre-mRNA splicing. An intron S1O. present in the 5' untranslated region of msl-2 mRNA con 5.1.1.5. 5'-Terminal Oligopyrimidine Tract tains putative SXL binding sites and is retained in female 50 Translation control can be mediated by a terminal oli flies. The msl-2 pre-mRNA is alternatively spliced in a gopyrimidine element (“TOP) present in the 5' untranslated Sex-lethal-dependent fashion (see, e.g., Gebauer et al., 1998, region of ribosomal protein-encoding mRNAs. TOP ele RNA4(2): 142-50 and Bashaw & Baker, 1995, Development ments adopt a specific secondary structure that prevents 121 (10):3245-58, the disclosures of which are hereby incor ribosome-binding and translation-initiation of ribsomal pro porated by reference in their entireties). Any gene containing 55 tein-encoding mRNAs. However, binding of cellular nucleic an MSL-2 element including, but not limited to, the MSL-2 acid binding protein (“CNBP) or La proteins to the TOP elements described in the references cited above, can be hairpin structure abolishes the TOP-mediated transcription used in the present invention to identify compounds that block and induces ribosomal protein production (see, e.g., modulate untranslated region-dependent gene expression. Schlatter & Fussenegger, 2003, Biotechnol Bioeng 81 (1):1- 5.1.1.4. G-Quartet Element 60 12: Zhu et al., 2001, Biochim Biophys Acta 1521(1-3):19 A symmetrical structure of two tetrads of guanosine base 29; and Crosio et al., 2000, Nucleic Acids Res. 28(15):2927 pairs connected by three loops is commonly referred to as a 34, the disclosures of which are incorporated by reference in “G-quartet”, “G-quadruplex” or “G-tetraplex' structure their entireties). (see, e.g., Wang et al., 1993, Biochemistry 32:1899-1904; The immunosuppressant rapamycin selectively Sup Macaya et al., 1993, Proc. Natl. Acad. Sci. 90:3745-3749; 65 presses the translation of mRNAs containing a TOP tract Schultze et al., 1994, J. Mol. Biol. 235:1532-1547; and adjacent to the cap structure. Trans-acting factors, some of Kelly et al., 1996, J. Mol. Biol. 256:417-422, the disclosures which are regulated by rapamycin-responsive signaling US 9,493,845 B2 37 38 pathways, that bind to the 5' untranslated region of TOP example. Selenocysteine is specifically encoded by the UGA mRNAs may be involved in selective translational repres codon, and inserted in peptide chains by a cotranslational sion (see, e.g., Kakegawa et al., 2002, Arch Biochem Bio mechanism that is able to override the normal function of phys 402(1):77-83, the disclosure of which is incorporated UGA as a termination codon. In eukaryotes, efficient sele by reference in its entirety). Any gene containing a TOP nocysteine incorporation at UGA codons requires a cellular element including, but not limited to, the TOP elements protein factor and a cis-acting structural signal usually described in the references cited above, can be used in the located in the mRNA 3' untranslated region, consisting of a present invention to identify compounds that modulate selenocysteine insertion sequence (“SECIS) in a character untranslated region-dependent gene expression. istic stem-loop structure (see, e.g., Peterlin et al., 1993. “Tat 5.1.1.6. Adenylate Uridylate-Rich Element 10 Trans-Activator” In Human Retroviruses: Cullen, Ed., AU-rich elements (“AREs) are the most extensively Oxford University Press: New York: pp. 75-100; Le & studied 3' UTR-based regulatory signals. AREs are the Maizel, 1989, J. Theor. Biol. 138:495-510; and reviewed in primary determinant of mRNA stability and one of the key Hubert et al., 1996, Biochimie 78(7):590-6, the disclosures determinants of mRNA translation initiation efficiency. of which are incorporated by reference in their entireties). A typical ARE is 50 to 150 nt long and contains 3 to 6 15 The required protein factor is presumed to be present in copies of AUA pentamer embedded in a generally A/U- certain cells types that express selenoproteins, such as liver enriched RNA region. The AUA pentamers can be scattered cells, lymphocytes, macrophages, thrombocytes, and other within the region or can stagger or even overlap (Chen et al., blood cells. In such cell types, the presence of a SECIS 1995, Trends Biol. Sciences 20:465, the disclosure of which element in an mRNA is necessary and sufficient for in-frame is incorporated by reference in its entirety). One or several UGA codons to be translated as selenocysteine. AUA pentamers can be replaced by expanded versions such A SECIS element is usually UAAAG, although other as an AUA hexamer or AUSA heptamer (see, e.g., Wilkund SECIS elements have been identified or variants have been et al., 2002, J. Biol. Chem. 277:40462 and Tholanikunnel & constructed (see, e.g., U.S. Pat. Nos. 6,303.295, 5,849,520, Malborn, 1997, J. Biol. Chem. 272:11471, the disclosures of and 5,700,660, the disclosures of which are incorporated by which are incorporated by reference in their entireties). 25 reference in their entireties). Any gene containing a SECIS Single copies of the AUA (where n=3, 4, or 5) elements element including, but not limited to, the SECIS elements placed in a random sequence context are inactive. The described in the references cited above, can be used in the minimal active ARE has been determined to have the present invention to identify compounds that modulate sequence UAUA(U/A)(U/A) (where n=3, 4, or 5) (see, untranslated region-dependent gene expression. e.g., Worthington et al., 2002, J Biol Chem, 277:48558-64) 30 5.1.1.8. Histone Stem Loop the disclosure of which is incorporated by reference in its Replication-dependent histone mRNAs end with a con entirety). The activity of certain AU-rich elements in pro served 26-nucleotide sequence that contains a 16-nucleotide moting mRNA degradation is enhanced in the presence of stem-loop, i.e., the histone stem loop, instead of a poly(A) distal uridine-rich sequences. These U-rich elements do not tail. Formation of the 3' end of histone mRNA occurs by affect mRNA stability when present alone and thus that have 35 endonucleolytic cleavage of pre-mRNA releasing the mature been termed "ARE enhancers' (see, e.g., Chen et al., 1994, mRNA from the chromatin template. Cleavage requires Mol. Cell. Biol. 14:416, the disclosure of which is incorpo several trans-acting factors, including a protein, the stem rated by reference in its entirety). loop binding protein, which binds the 26-nucleotide Most AREs function in mRNA decay regulation and sequence, and a small nuclear RNP. U7 snRNP (reviewed in, translation initiation regulation by interacting with specific 40 e.g., Dominski & Marzluff, 1999, Gene 239(1):1-14, the ARE-binding proteins (“AUBPs'). There are at least 14 disclosure of which is incorporated by reference in its known cellular proteins that bind to AU-rich elements. entirety). AUBP functional properties determine ARE involvement in Sequences of histone stem loops have been described in one or both pathways. For example, ELAV/HuR binding to U.S. Pat. Nos. 6,476,208; 6,455,280; 6,399,373; 6,346,381: c-fos ARE inhibits c-fos mRNA decay (see, e.g., Brennan & 45 6,335,170; 6,331396; 6,265,546; 6,265,167; 5,990,298; Steitz, 2001, Cell Mol Life Sci. 58:266), association of 5,908,779 and 5,843,770, the disclosures of which are tristetraprolin with TNFa. ARE dramatically enhances TNFa incorporated by reference in their entireties. Any gene mRNA hydrolysis (see, e.g., Carballo et al., 1998, Science containing a histone stem loop including, but not limited to, 281:1001), whereas interaction of TIA-1 with the TNFa the histone stem loops described in the references cited ARE does not alter the TNFa mRNA stability but inhibits 50 above, can be used in the present invention to identify TNFa translation (see, e.g., Piecyk et al., 2000, EMBO J. compounds that modulate untranslated region-dependent 19:4154). gene expression. Since AREs are clearly important in biological systems, 5.1.1.9. Cytoplasmic Polyadenylation Element including but not limited to a number of the early response Maturation-specific polyadenylation in Xenopus oocytes genes that regulate cell proliferation and responses to exog 55 depends on the presence of a U-rich cytoplasmic polyade enous agents, the identification of compounds that bind to nylation element (“CPE) close to the 3' end of the RNA. one or more of the ARE clusters and potentially modulate RNAs that lack CPEs appear to be deadenylated by default the stability and translation of the target RNA can potentially when meiosis resumes. This default program also applies to be of value as a therapeutic. Any gene containing an ARE maturing mouse oocytes (see, e.g., Paynton & Bachvarova, including, but not limited to, the AREs described in the 60 1994, Mol Reprod Dev 37(2): 172-80, the disclosure of references cited above, can be used in the present invention which is incorporated by reference in its entirety). CPEs to identify compounds that modulate untranslated region have been identified in Weel protein tyrosine kinase mRNA dependent gene expression. (see, e.g., Charlesworth et al., 2000, Dev Biol 227(2):706 5.1.1.7. Selenocysteine Insertion Sequence 19, the disclosure of which is incorporated by reference in Selenium is an essential micronutrient that is now known 65 its entirety), cyclin B1 mRNA (see, e.g., Tay et al., 2000, to be incorporated as selenocysteine in a number of seleno Dev Biol 221(1):1-9 and Barkoff et al., 2000, Dev Biol proteins, glutathione peroxidase being the prototypical 22001):97-109, the disclosures of which are incorporated by US 9,493,845 B2 39 40 reference in their entireties), and Xenopus Id3 mRNA (see, repressed to permit spermatogenesis in hermaphrodites. e.g., Afouda et al., 1999, Mech Dev 88(1): 15-31, the dis Translational repression of tra-2 mRNA in C. elegans is closure of which is incorporated by reference in its entirety). mediated by tandemly repeated elements in its 3' UTR; these A Xenopus oocyte CPE binding protein (“CPEB) binds elements are called TGEs (for tra-2 and GLI element) (see, the CPE and stimulates polyadenylation. CPEB is essential e.g., Thompson et al., 2000, Mol Cell Biol 20(6):2129-37; for the cytoplasmic polyadenylation of B4 RNA, G10. Haag & Kimble, 2000, Genetics 155(1):105-16; and Janet c-mos, ccdk2, cyclins A1, B1 and B2 mRNAS which suggests al., 1997, EMBOJ 16(20):6301-13, the disclosures of which that this protein is required for polyadenylation of most are incorporated by reference in their entireties). Any gene RNAS during oocyte maturation (see, e.g., Stebbins-Boaz, et containing a TGE including, but not limited to, the TGEs al., 1996, EMBOJ 15(10):2582-92, the disclosure of which 10 described in the references cited above, can be used in the is incorporated by reference in its entirety). Any gene present invention to identify compounds that modulate containing a CPE including, but not limited to, the CPEs untranslated region-dependent gene expression. described in the references cited above, can be used in the 5.1.1.13. Direct Repeat Element present invention to identify compounds that modulate The direct repeat element (“DRE) is one control element untranslated region-dependent gene expression. 15 in the 3' UTR of the tra-2 mRNA that causes repression of 5.1.1.10. Nanos Translational Control Element tra-2, i.e., inhibits translation of tra-2 mRNA, which is The nanos translational control element is a discrete responsible for the onset of hermaphrodite spermatogenesis translational control element within the nanos 3' untrans in C. elegans (see, e.g., Goodwin et al., 1993, Cell 75:329 lated region that acts independently of the localization signal 339, the disclosure of which is incorporated by reference in to mediate translational repression of unlocalized nanos its entirety). Three germline-specific regulators have been RNA (see, e.g., Clark et al., 2002, Development 129(14): identified that mediate DRE regulation by the tra-2 3' UTR. 3325-34; Clarket al., 2000, Curr Biol 10(20): 1311-4: Crucs These include DRFQ2/GLD-1, a protein that specifically et al., 2000, Mol Cell 5(3):457-67: Bergsten & Gavis, 1999, binds the DRE (see, e.g., Goodwin et al., 1993, Cell 75:329 Development 126(4):659-69; Dahanukar & Wharton, 1996, 339) and controls tra-2 translation (see, e.g., Janet al. 1999, Genes Dev (20):2610-20; and Gavis et al., 1996, Develop 25 EMBO J. 18:258-269): FOG-2, a protein that binds GLD-1 ment 122(9):2791-800, the disclosures of which are incor and is required for the onset of hermaphrodite spermatogen porated by reference in their entireties). esis (see, e.g., Schedl & Kimble, 1988, Genetics 119:43-61); During Drosophila embryogenesis, the Smaug protein and laf-1, a gene that has not yet been identified at the represses translation of the nanos protein through an inter molecular level (see, e.g., Goodwin et al., 1997, Develop action with the nanos translational control element (see, e.g., 30 ment 124:749-758), the disclosures of which are incorpo Green et al., 2002, Biochem Biophys Res Commun 297(5): rated by reference in their entireties. Any gene containing a 1085-8, the disclosure of which is incorporated by reference DRE including, but not limited to, the DREs described in the in its entirety). Any gene containing a nanos translational references cited above, can be used in the present invention control element including, but not limited to, the nanos to identify compounds that modulate untranslated region translational control elements described in the references 35 dependent gene expression. cited above, can be used in the present invention to identify 5.1.1.14. Bruno Response Element compounds that modulate untranslated region-dependent The Bruno Response Element (“BRE), is located in the gene expression. 3' untranslated region (UTR) of oskar mRNA (see, e.g., 5.1.1.11. Amyloid Precursor Protein Element Castagnetti et al., 2000, Development 127(5):1063-8, the In one embodiment, the amyloid precursor protein ele 40 disclosure of which is incorporated by reference in its ment (APP” element) refers to a novel iron-responsive entirety). The coupled regulation of oskar mRNA localiza element within the 5' untranslated region of the Alzheimer's tion and translation in time and space is critical for correct amyloid precursor protein (APP) transcript (+51 to +94 anteroposterior patterning of the Drosophila embryo. Local from the 5'-cap site) (see, e.g., Rogers et al., 2002, J Biol ization-dependent translation of oskar mRNA, a mechanism Chem 277(47):455 18-28). The APP mRNA IRE is located 45 whereby oskar RNA localized at the posterior of the oocyte immediately upstream of an interleukin-1 responsive acute is selectively translated and the unlocalized RNA remains in box domain (+101 to +146). The APP 5' UTR conferred a translationally repressed state, ensures that Oskar activity translation was selectively down-regulated in response to is present exclusively at the posterior pole. Genetic experi intracellular iron chelation. ments indicate that translational repression involves the In another embodiment, the APP element refers to a 29 50 binding of Bruno protein to multiple sites, the BREs, in the base instability element in the 3' UTR of the amyloid 3' untranslated region of oskar mRNA. Any gene containing precursor protein involved in mRNA stability (see, e.g., a BRE including, but not limited to, the BREs described in Westmark & Malter, 2001, Brain Res Mol Brain Res 90(2): the references cited above, can be used in the present 193–201; Rajagopalan & Malter, 2000, J Neurochem 74(1): invention to identify compounds that modulate untranslated 52-9; Amara et al., 1999, Brain Res Mol Brain Res 71(1): 55 region-dependent gene expression. 42-9; and Zaidi & Malter, 1995, J Biol Chem 270(29): 5.1.1.15. 15-Lipoxygenase Differentiation Control Ele 17292-8, the disclosures of which are incorporated by ment reference in their entireties). Any gene containing a APP The translation of 15-lipoxygenase (“LOX) mRNA in element including, but not limited to, the APP elements erythroid precursor cells and of the L2 mRNA of human described in the references cited above, can be used in the 60 papilloma virus type 16 (HPV-16) in squamous epithelial present invention to identify compounds that modulate cells is silenced when either of these cells is immature and untranslated region-dependent gene expression. is activated in maturing cells by unknown mechanisms. It 5.1.1.12. Translation Regulation Element has been shown that hnRNP K and the c-Src kinase specifi Negative translational control elements in 3' UTRs regu cally interact with each other, leading to c-Src activation and late pattern formation, cell fate, and sex determination in a 65 tyrosine phosphorylation of hnRNP K in vivo and in vitro. variety of organisms. tra-2 mRNA in Caenorhabditis c-Src-mediated phosphorylation reversibly inhibits the bind elegans is required for female development but must be ing of hnRNP K to the differentiation control element US 9,493,845 B2 41 42 (“DICE) of the LOX mRNA3' untranslated region in vitro a particular reporter gene is not available, but the sequence and specifically derepresses the translation of DICE-bearing of the reporter gene is known, a nucleic acid encoding the mRNAs in vivo (see, e.g., Ostareck-Lederer et al., 2002, reporter gene may be chemically synthesized or obtained Mol Cell Biol 22(13):4535-43, the disclosure of which is from a suitable source (e.g., a cDNA library, or a cDNA incorporated by reference in its entirety). library generated from, or nucleic acid, preferably poly Cytidine-rich 15-lipoxygenase differentiation control ele A+RNA, isolated from, any tissue or cells expressing the ment (“15-LOX-DICE) is a multifunctional cis-acting ele reporter gene) by PCR amplification. Once the nucleotide ment found in the 3' untranslated region of numerous sequence of a reporter gene is determined, the nucleotide eukaryotic mRNAs. It binds KH domain proteins of the type sequence of the reporter gene may be manipulated using hnRNP E and K, thus mediating mRNA stabilization and 10 methods well-known in the art for the manipulation of translational control. Translational silencing is caused by nucleotide sequences, e.g., recombinant DNA techniques, formation of a simple binary complex between DICE and site directed mutagenesis, PCR, (see, for example, the recombinant hnRNP E1. Electromobility shift assays and techniques described in Sambrook et al., 1990, Molecular Sucrose gradient centrifugation demonstrate that rabbit Cloning, A Laboratory Manual. 2d Ed., Cold Spring Harbor 15-LOX-DICE, which is composed of ten subunits of the 15 Laboratory, Cold Spring Harbor, N.Y. and Ausubel et al., sequence (CCCCPuCCCUCUUCCCCAAG, SEQ ID NO: eds., 1998, Current Protocols in Molecular Biology, John 4), is able to bind up to ten molecules of hnRNP E1 (see, Wiley & Sons, NY, which are both incorporated by reference e.g., Reimann et al., 2002, J Mol Biol 315(5):965-74 and herein in their entireties), to generate reporter genes having Thiele et al., 1999, Adv Exp Med Biol 447:45-61, the a different amino acid sequence, for example to create amino disclosures of which are incorporated by reference in their acid Substitutions, deletions, and/or insertions. entireties). Any gene containing a 15-LOX-DICE including, Examples of reporter genes include, but are not limited to, but not limited to, the 15-LOX-DICEs described in the luciferase (e.g., firefly luciferase, renilla luciferase, and click references cited above, can be used in the present invention beetle luciferase), green fluorescent protein (“GFP) (e.g., to identify compounds that modulate untranslated region green fluorescent protein, yellow fluorescent protein, red dependent gene expression. 25 fluorescent protein, cyan fluorescent protein, and blue fluo 5.2. Reporter Gene Constructs, Transfected Cells, and rescent protein), beta-galactosidase (“b-gal'), beta-glucoro Cell-Free Extracts nidase, beta-lactamase, chloramphenicol acetyltransferase The invention provides for specific vectors containing a (“CAT), and alkaline phosphatase (AP). In a preferred reporter gene flanked by one or more UTRS of a target gene embodiment, a reporter gene utilized in the reporter con and host cells transfected with the vectors. The invention 30 structs is easily assayed and has an activity which is not also provides for the in vitro translation of a reporter gene normally found in the cell or organism of interest. flanked by one or more UTRs of a target gene. Techniques 5.2.1.1. Luciferase for practicing this specific aspect of this invention will Luciferases are enzymes that emit light in the presence of employ, unless otherwise indicated, conventional techniques oxygen and a Substrate (luciferin) and which have been used of molecular biology, microbiology, and recombinant DNA 35 for real-time, low-light imaging of gene expression in cell manipulation and production, which are routinely practiced cultures, individual cells, whole organisms, and transgenic by one of skill in the art. See, e.g., Sambrook, 1989, organisms (reviewed by Greer & Szalay, 2002, Lumines Molecular Cloning, A Laboratory Manual, Second Edition; cence 17(1):43-74). DNA Cloning, Volumes I and II (Glover, Ed. 1985); Oligo As used herein, the term “luciferase' is intended to nucleotide Synthesis (Gait, Ed. 1984); Nucleic Acid Hybrid 40 embrace all luciferases, or recombinant enzymes derived ization (Hames & Higgins, Eds. 1984); Transcription and from luciferases which have luciferase activity. The Translation (Hames & Higgins, Eds. 1984); Animal Cell luciferase genes from fireflies have been well characterized, Culture (Freshney, Ed. 1986); Immobilized Cells and for example, from the Photinus and Luciola species (see, Enzymes (IRL Press, 1986); Perbal, A Practical Guide to e.g., International Patent Publication No. WO95/25798 for Molecular Cloning (1984); Gene Transfer Vectors for Mam 45 Photinus pyralis, European Patent Application No. EP 0524 malian Cells (Miller & Calos, Eds. 1987, Cold Spring 448 for Luciola Cruciata and Luciola lateralis, and Devine Harbor Laboratory); Methods in Enzymology, Volumes 154 et al., 1993, Biochim. Biophys. Acta 1173(2):121-132 for and 155 (Wu & Grossman, and Wu, Eds., respectively), Luciola mingrelica). Other eucaryotic luciferase genes (Mayer & Walker, Eds., 1987): Immunochemical Methods include, but are not limited to, the click beetle (Photinus in Cell and Molecular Biology (Academic Press, London, 50 plagiophthalamus, see, e.g., Wood et al., 1989, Science Scopes, 1987), Expression of Proteins in Mammalian Cells 244:700-702), the sea panzy (Renilla reniformis, see, e.g., Using Vaccinia Viral Vectors in Current Protocols in Lorenz et al., 1991, Proc Natl Acad Sci USA 88(10):4438 Molecular Biology, Volume 2 (Ausubel et al., Eds., 1991). 4442), and the glow worm (Lampyris noctiluca, see e.g., 5.2.1. Reporter Genes Sula-Newby et al., 1996, Biochem J. 313:761-767). The Any reporter gene well-known to one of skill in the art 55 click beetle is unusual in that different members of the may be used in reporter gene constructs to ascertain the species emit bioluminescence of different colors, which emit effect of a compound on untranslated region-dependent light at 546 nm (green), 560 nm (yellow-green), 578 mm expression of a target gene. Reporter genes refer to a (yellow) and 593 nm (orange) (see, e.g., U.S. Pat. Nos. nucleotide sequence encoding a protein that is readily 6,475,719; 6,342,379; and 6,217,847, the disclosures of detectable either by its presence or activity. Reporter genes 60 which are incorporated by reference in their entireties). may be obtained and the nucleotide sequence of the reporter Bacterial luciferin-luciferase systems include, but are not gene determined by any method well-known to one of skill limited to, the bacterial luxgenes of terrestrial Photorhabdus in the art. The nucleotide sequence of a reporter gene can be luminescens (see, e.g., Manukhov et al., 2000, Genetika obtained, e.g., from the literature or a database such as 36(3):322-30) and marine bacteria Vibrio fischeri and Vibrio GenBank. Alternatively, a polynucleotide encoding a 65 harveyi (see, e.g., Miyamoto et al., 1988, J Biol Chem. reporter gene may be generated from nucleic acid from a 263(26): 13393-9, and Cohn et al., 1983, Proc Natl Acad Sci Suitable source. If a clone containing a nucleic acid encoding USA., 80(1): 120-3, respectively). The luciferases encom US 9,493,845 B2 43 44 passed by the present invention also includes the mutant 11:739-742; and Henderson et al., 1986, Clin. Chem. luciferases described in U.S. Pat. No. 6,265,177 to Squirrell 32: 1637-1641). The b-gal gene functions well as a reporter et al., which is hereby incorporated by reference in its gene because the protein product is extremely stable, resis entirety. tant to proteolytic degradation in cellular lysates, and easily In a preferred embodiment, the luciferase is a firefly assayed. When ONPG is used as the substrate, b-gal activity luciferase, a renilla luciferase, or a click beetle luciferase, as can be quantitated with a spectrophotometer or microplate described in any one of the references listed supra, the reader. disclosures of which are incorporated by reference in their As used herein, the term “beta galactosidase' or “b-gal' entireties. is intended to embrace all b-gals, including lac7 gene 5.2.1.2. Green Fluorescent Protein 10 products, or recombinant enzymes derived from b-gals Green fluorescent protein (“GFP) is a 238 amino acid which have b-gal activity. The b-gal gene functions well as protein with amino acid residues 65 to 67 involved in the a reporter gene because the protein product is extremely formation of the chromophore which does not require addi stable, resistant to proteolytic degradation in cellular lysates, tional Substrates or cofactors to fluoresce (see, e.g., Prasher and easily assayed. In an embodiment where ONPG is the et al., 1992, Gene 111:229-233; Yang et al., 1996, Nature 15 Substrate, b-gal activity can be quantitated with a spectro Biotechnol. 14:1252-1256; and Cody et al., 1993, Biochem photometer or microplate reader to determine the amount of istry 32:1212-1218). ONPG converted at 420 nm. In an embodiment when CPRG As used herein, the term “green fluorescent protein’ or is the Substrate, b-gal activity can be quantitated with a “GFP is intended to embrace all GFPs (including the spectrophotometer or microplate reader to determine the various forms of GFPs which exhibit colors other than amount of CPRG converted at 570 to 595 nm. In yet another green), or recombinant enzymes derived from GFPs which embodiment, the b-gal activity can be visually ascertained have GFP activity. In a preferred embodiment, GFP includes by plating bacterial cells transformed with a b-gal construct green fluorescent protein, yellow fluorescent protein, red onto plates containing Xgal and IPTG. Bacterial colonies fluorescent protein, cyan fluorescent protein, and blue fluo that are dark blue indicate the presence of high b-gal activity rescent protein. The native gene for GFP was cloned from 25 and colonies that are varying shades of blue indicate varying the bioluminescent jellyfish Aequorea victoria (see, e.g., levels of b-gal activity. Morin et al., 1972, J. Cell Physiol. 77:313–318). Wild type 5.2.1.4. Beta-Glucoronidase GFP has a major excitation peak at 395 nm and a minor Beta-glucuronidase (“GUS) catalyzes the hydrolysis of a excitation peak at 470 nm. The absorption peak at 470 nm very wide variety of b-glucuronides, and, with much lower allows the monitoring of GFP levels using standard fluores 30 efficiency, hydrolyzes some b-galacturonides. GUS is very cein isothiocyanate (FITC) filter sets. Mutants of the GFP stable, will tolerate many detergents and widely varying gene have been found useful to enhance expression and to ionic conditions, has no cofactors, nor any ionic require modify excitation and fluorescence. For example, mutant ments, can be assayed at any physiological pH, with an GFPs with alanine, glycine, isoleucine, or threonine substi optimum between 5.0 and 7.8, and is reasonably resistant to tuted for serine at position 65 result in mutant GFPs with 35 thermal inactivation (see, e.g., U.S. Pat. No. 5.268,463, shifts in excitation maxima and greater fluorescence than which is incorporated by reference in its entirety). wild type protein when excited at 488 nm (see, e.g., Heim et In one embodiment, the GUS is derived from the Esheri al., 1995, Nature 373:663-664; U.S. Pat. No. 5,625,048; chia coli b-glucuronidase gene. In alternate embodiments of Delagrave et al., 1995, Biotechnology 13:151-154; Cormack the invention, the b-glucuronidase encoding nucleic acid is et al., 1996, Gene 173:33–38; and Cramer et al., 1996, 40 homologous to the E. coli b-glucuronidase gene and/or may Nature Biotechnol. 14:315-319). The ability to excite GFP at be derived from another organism or species. 488 nm permits the use of GFP with standard fluorescence GUS activity can be assayed either by fluorescence or activated cell sorting (“FACS) equipment. In another spectrometry, or any other method described in U.S. Pat. No. embodiment, GFPs are isolated from organisms other than 5,268,463, the disclosure of which is incorporated by ref the jellyfish, Such as, but not limited to, the sea pansy, 45 erence in its entirety. For a fluorescent assay, 4-trifluorom Renilla reriformis. ethylumbelliferyl b-D-glucuronide is a very sensitive sub Techniques for labeling cells with GFP in general are strate for GUS. The fluorescence maximum is close to 500 described in U.S. Pat. Nos. 5,491,084 and 5,804,387, which nm bluish green, where very few plant compounds fluo are incorporated by reference in their entireties; Chalfie et resce or absorb. 4-trifluoromethylumbelliferyl b-D-glu al., 1994, Science 263:802-805; Heim et al., 1994, Proc. 50 curonide also fluoresces much more strongly near neutral Natl. Acad. Sci. USA '91: 12501-12504; Morise et al., 1974, pH, allowing continuous assays to be performed more Biochemistry 13:2656-2662: Ward et al., 1980, Photochem. readily than with MUG. 4-trifluoromethylumbelliferyl b-D- Photobiol. 31:611-615: Rizzuto et al., 1995, Curr. Biology glucuronide can be used as a fluorescent indicator in vivo. 5:635-642; and Kaether & Gerdes, 1995, FEBS Lett 369: The spectrophotometric assay is very straightforward and 267-271. The expression of GFPs in E. coli and C. elegans 55 moderately sensitive (Jefferson et al., 1986, Proc. Natl. are described in U.S. Pat. No. 6,251,384 to Tan et al., which Acad. Sci. USA 86:8447-8451). A preferred substrate for is incorporated by reference in its entirety. The expression of spectrophotometric measurement is p-nitrophenyl b-D-glu GFP in plant cells is discussed in Hu & Cheng, 1995, FEBS curonide, which when cleaved by GUS releases the chro Lett 369:331-33, and GFP expression in Drosophila is mophore p-nitrophenol. At a pH greater than its plc (around described in Davis et al., 1995, Dev. Biology 170:726-729. 60 7.15) the ionized chromophore absorbs light at 400-420 nm, 5.2.1.3. Beta-Galactosidase giving a yellow color. Beta galactosidase (“b-gal) is an enzyme that catalyzes 5.2.1.5. Beta-Lactamase the hydrolysis of b-galactosides, including lactose, and the Beta-lactamases are nearly optimal enzymes in respect to galactoside analogs o-nitrophenyl-b-D-galactopyranoside their almost diffusion-controlled catalysis of b-lactam (“ONPG') and chlorophenol red-b-D-galactopyranoside 65 hydrolysis, making them Suited to the task of an intracellular (“CPRG) (see, e.g., Nielsen et al., 1983 Proc Natl Acad Sci reporter enzyme (see, e.g., Christensen et al., 1990, Bio USA 80(17):5198-5202; Eustice et al., 1991, Biotechniques chem. J. 266: 853-861). They cleave the b-lactam ring of US 9,493,845 B2 45 46 b-lactam antibiotics. Such as penicillins and cephalosporins, secreted out of the cell, which facilitates the automation of generating new charged moieties in the process (see, e.g., sampling and assay procedures. A cell-based assay using O’Callaghan et al., 1968, Antimicrob. Agents. Chemother. 8: SEAP for use in cell-based assessment of inhibitors of the 57-63 and Stratton, 1988, J. Antimicrob. Chemother. 22, Hepatitis C virus protease is described in U.S. Pat. No. Suppl. A: 23-35). A large number of b-lactamases have been 5 6,280.940 to Potts et al. which is hereby incorporated by isolated and characterized, all of which would be suitable for reference in its entirety. use in accordance with the present invention (see, e.g., 5.2.2. Reporter Gene Constructs Richmond & Sykes, 1978, Adv. Microb. Physiol. 9:31-88 The invention provides reporter gene constructs for use in and Ambler, 1980, Phil. Trans. R. Soc. Lond. Ser.B. 289: the reporter gene-based assays described herein for the 321-331, the disclosures of which are incorporated by ref 10 identification of compounds that modulate untranslated erence in their entireties). region-dependent expression of a target gene. The reporter The coding region of an exemplary b-lactamase employed gene constructs of the invention comprise one or more has been described in U.S. Pat. No. 6,472.205, Kadonaga et reporter genes fused to one or more untranslated regions. For al., 1984, J. Biol. Chem. 259: 2149-2154, and Sutcliffe, example, specific RNA sequences, RNA structural motifs, 1978, Proc. Natl. Acad. Sci. USA 75: 3737-3741, the dis 15 and/or RNA structural elements that are known or suspected closures of which are incorporated by reference in their to modulate untranslated region-dependent expression of a entireties. As would be readily apparent to those skilled in target gene may be fused to the reporter gene. the field, this and other comparable sequences for peptides The present invention provides for a reporter gene flanked having b-lactamase activity would be equally suitable for by one or more untranslated regions (e.g., the 5' UTR, 3 use in accordance with the present invention. The combi UTR, or both the 5' UTR and 3' UTR of the target gene). The nation of a fluorogenic substrate described in U.S. Pat. Nos. present invention also provides for a reporter gene flanked 6,472,205, 5,955,604, and 5,741,657, the disclosures of by one or more UTRS of a target gene, said UTRS containing which are incorporated by reference in their entireties, and one or more mutations (e.g., one or more Substitutions, a Suitable b-lactamase can be employed in a wide variety of deletions and/or additions). In a preferred embodiment, the different assay systems, such as are described in U.S. Pat. 25 reporter gene is flanked by both 5' and 3' UTRs so that No. 4,740.459, which is hereby incorporated by reference in compounds that interfere with an interaction between the 5' its entirety. and 3' UTRs can be identified. In another preferred embodi 5.2.1.6. Chloramphenicol Acetyltransferase ment, a stable hairpin secondary structure is inserted into the Chloramphenicol acetyl transferase (“CAT) is com UTR, preferably the 5' UTR of the target gene. For example, monly used as a reporter gene in mammalian cell systems 30 in cases where the 5' UTR possesses IRES activity, the because mammalian cells do not have detectable levels of addition of a stable hairpin secondary structure in the 5' UTR CAT activity. The assay for CAT involves incubating cellular can be used to separate cap-dependent from cap-independent extracts with radiolabeled chloramphenicol and appropriate translation (see, e.g., Muhlrad et al., 1995, Mol. Cell. Biol. co-factors, separating the starting materials from the product 15(4):2145-56, the disclosure of which is incorporated by by, for example, thin layer chromatography (“TLC), fol 35 reference in its entirety). In another embodiment, an intron lowed by scintillation counting (see, e.g., U.S. Pat. No. is inserted into a UTR (preferably, the 5' UTR) or at the 5' 5,726,041, which is hereby incorporated by reference in its end of an ORF of a target gene. For example, but not by entirety). limitation, in cases where an RNA possesses instability As used herein, the term "chloramphenicol acetyltrans elements, an intron, e.g., the human elongation factor one ferase' or "CAT is intended to embrace all CATs, or 40 alpha (EF-1 alpha) first intron, can be cloned into a UTR recombinant enzymes derived from CAT which have CAT (preferably, the 5' UTR) or a 5' end of the ORF to increase activity. While it is preferable that a reporter system which expression (see, e.g., Kim et al., 2002, J Biotechnol 93(2): does not require cell processing, radioisotopes, and chro 183-7, the disclosure of which is incorporated by reference matographic separations would be more amenable to high in its entirety). In a preferred embodiment, both a stable through-put screening, CAT as a reporter gene may be 45 hairpin secondary structure and an intron are added to the preferable in situations when stability of the reporter gene is reporter gene construct. In a more preferred embodiment, important. For example, the CAT reporter protein has an in the stable hairpin secondary structure is cloned into the 5' vivo half life of about 50 hours, which is advantageous when UTR and the intron is added at the 5' end of the ORF of the an accumulative versus a dynamic change type of result is reporter gene. desired. 50 The reporter gene can be positioned such that the trans 5.2.1.7. Secreted Alkaline Phosphatase lation of that reporter gene is dependent upon the mode of The secreted alkaline phosphatase (“SEAP) enzyme is a translation initiation, Such as, but not limited to, cap-depen truncated form of alkaline phosphatase, in which the cleav dent translation or cap-independent translation (i.e., trans age of the transmembrane domain of the protein allows it to lation via an internal ribosome entry site). Alternatively, be secreted from the cells into the Surrounding media. In a 55 where the UTR contains an upstream open reading frame, preferred embodiment, the alkaline phosphatase is isolated the reporter gene can be positioned Such that the reporter from human placenta. protein is translated only in the presence of a compound that As used herein, the term “secreted alkaline phosphatase' shifts the reading frame of the UTR so that the formerly or “SEAP is intended to embrace all SEAP or recombinant untranslated open reading frame is then translated. enzymes derived from SEAP which have alkaline phos 60 The reporter gene constructs can be monocistronic or phatase activity. SEAP activity can be detected by a variety multicistronic. A multicistronic reporter gene construct may of methods including, but not limited to, measurement of encode 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, or in the range of catalysis of a fluorescent Substrate, immunoprecipitation, 2-5, 5-10 or 10-20 reporter genes. For example, a dicistronic HPLC, and radiometric detection. The luminescent method reporter gene construct comprising in the following order a is preferred due to its increased sensitivity over calorimetric 65 promoter, a first reporter gene, a 5' UTR of a target gene, a detection methods. The advantages of using SEAP is that a second reporter gene and optionally, a 3' UTR of a target cell lysis step is not required since the SEAP protein is gene. In such a reporter construct, the transcription of both US 9,493,845 B2 47 48 reporter genes is driven by the promoter, whereas the phosphatase promoter, and the following animal transcrip translation of the mRNA from the first reporter gene is by a tional control regions, which exhibit tissue specificity and cap-dependent Scanning mechanism and the translation of have been utilized in transgenic animals: elastase I gene the mRNA from the second reporter gene is by a cap control region which is active in pancreatic acinar cells independent mechanism by an IRES. The IRES-dependent (Swift et al., 1984, Cell 38:639-646: Ornitz et al., 1986, Cold translation of the mRNA of the second reporter gene can be Spring Harbor Symp. Quant. Biol. 50:399-409; MacDonald, normalized against cap-dependent translation. 1987, Hepatology 7:425-515); insulin gene control region 5.2.3. Expression of Reporter Gene Constructs in Cells which is active in pancreatic beta cells (Hanahan, 1985, 5.2.3.1. Vectors Nature 315: 115-122), immunoglobulin gene control region The nucleotide sequence coding for a reporter gene can be 10 which is active in lymphoid cells (Grosschedl et al., 1984, inserted into an appropriate expression vector, i.e., a vector Cell 38:647-658: Adames et al., 1985, Nature 318:533-538; which contains the necessary elements for the transcription Alexander et al., 1987, Mol. Cell. Biol. 7:1436-1444), and translation of the inserted protein-coding sequence. The mouse mammary tumor virus control region which is active necessary transcriptional and translational signals can also in testicular, breast, lymphoid and mast cells (Leder et al., be supplied by the target gene or the reporter gene. A variety 15 1986, Cell 45:485-495), albumin gene control region which of host-vector systems may be utilized to express the is active in liver (Pinkert et al., 1987, Genes and Devel. reporter gene. These include, but are not limited to, mam 1:268-276), alpha-fetoprotein gene control region which is malian cell systems infected with virus (e.g., vaccinia virus, active in liver (Krumlauf et al., 1985, Mol. Cell. Biol. adenovirus, etc.); insect cell systems infected with virus 5:1639-1648; Hammer et al., 1987, Science 235:53-58: (e.g., baculovirus); microorganisms such as yeast containing alpha 1-antitrypsin gene control region which is active in the yeast vectors, or bacteria transformed with bacteriophage, liver (Kelsey et al., 1987, Genes and Devel. 1:161-171), DNA, plasmid DNA, or cosmid DNA; and stable cell lines beta-globin gene control region which is active in myeloid generated by transformation using a selectable marker. The cells (Mogram et al., 1985, Nature 315:338-340; Kollias et expression elements of vectors vary in their strengths and al., 1986, Cell 46:89-94: myelin basic protein gene control specificities. Depending on the host-vector system utilized, 25 region which is active in oligodendrocyte cells in the brain any one of a number of Suitable transcription and translation (Readhead et al., 1987, Cell 48:703-712); myosin light elements may be used. In specific embodiments, the reporter chain-2 gene control region which is active in skeletal gene is expressed, or a fusion protein comprising the muscle (Sani, 1985, Nature 314:283-286), and gonadotropic reporter gene and ORF of a fragment thereof, of the target releasing hormone gene control region which is active in the gene is expressed. 30 hypothalamus (Mason et al., 1986, Science 234:1372-1378). Any of the methods previously described for the insertion In a specific embodiment, a vector is used that comprises of DNA fragments into a vector may be used to construct a promoter operably linked to a reporter gene flanked by one expression vectors containing a chimeric nucleic acid con or more UTRS of a target gene, origins of replication from sisting of appropriate transcriptional/translational control one or more species, and, optionally, one or more selectable signals and the protein coding sequences. These methods 35 markers (e.g., an antibiotic resistance gene). In a preferred may include in vitro recombinant DNA and synthetic tech embodiment, the vectors are CMV vectors, T7 vectors, lac niques and in vivo recombinants (genetic recombination). vectors, pCEP4 vectors, or 5.0/FRT vectors. Expression of the reporter gene construct may be regulated In a specific embodiment, an expression construct is made by a second nucleic acid sequence so that the reporter gene by amplifying the 5' and/or 3' UTRs of a target gene and is expressed in a host transformed with the recombinant 40 ligating the UTRS to a reporter gene Such as luciferase, and DNA molecule. For example, expression of a reporter gene subcloning them into a pT-Adv vector (Clontech Laborato construct may be controlled by any promoter/enhancer ele ries, Palo Alto, Calif.). It is understood by one of skill in the ment known in the art, such as a constitutive promoter, a art that the construction of the reporter plasmid may require tissue-specific promoter, or an inducible promoter. Specific the construction of intermediate plasmids if several ligations examples of promoters which may be used to control gene 45 are involved. expression include, but are not limited to, the SV40 early Expression vectors containing the reporter gene construct promoter region (Bernoist & Chambon, 1981, Nature 290: of the present invention can be identified by four general 304-310), the promoter contained in the 3' long terminal approaches: (a) nucleic acid sequencing, (b) nucleic acid repeat of Rous sarcoma virus (Yamamoto et al., 1980, Cell hybridization, (c) presence or absence of “marker nucleic 22:787-797), the herpes thymidine kinase promoter (Wagner 50 acid functions, and (d) expression of inserted sequences. In et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445), the first approach, the presence of the UTRs and/or the the regulatory sequences of the metallothionein gene (Brin reporter gene inserted in an expression vector can be ster et al., 1982, Nature 296:39–42); prokaryotic expression detected by sequencing. In the second approach, the pres vectors such as the B-lactamase promoter (Villa-Kamaroffet ence of the UTRs and/or the reporter gene inserted in an al., 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731), or 55 expression vector can be detected by nucleic acid hybrid the tac promoter (DeBoer et al., 1983, Proc. Natl. Acad. Sci. ization using probes comprising sequences that are homolo U.S.A. 80:21-25); see also “Useful proteins from recombi gous to the inserted UTRs and/or reporter gene. In the third nant bacteria' in Scientific American, 1980, 242:74-94. approach, the recombinant vector/host system can be iden plant expression vectors comprising the nopaline synthetase tified and selected based upon the presence or absence of promoter region (Herrera-Estrella et al., Nature 303:209 60 certain “marker nucleic acid functions (e.g., thymidine 213) or the cauliflower mosaic virus 35S RNA promoter kinase activity, resistance to antibiotics, transformation phe (Gardner, et al., 1981, Nucl. Acids Res. 9:2871), and the notype, occlusion body formation in baculovirus, etc.) promoter of the photosynthetic enzyme ribulose biphosphate caused by the insertion of the nucleic acid of interest, i.e., the carboxylase (Herrera-Estrella et al., 1984, Nature 310:115 reporter gene construct, in the vector. For example, if the 120); promoter elements from yeast or other fungi such as 65 nucleic acid of interest is inserted within the marker nucleic the Gal 4 promoter, the ADC (alcohol dehydrogenase) acid sequence of the vector, recombinants containing the promoter, PGK (phosphoglycerol kinase) promoter, alkaline insert can be identified by the absence of the marker nucleic US 9,493,845 B2 49 50 acid function. In the fourth approach, recombinant expres integrate the plasmid into their chromosomes and grow to sion vectors can be identified by assaying the reporter gene form foci which in turn can be cloned and expanded into cell product expressed by the recombinant. Such assays can be lines. based, for example, on the physical or functional properties A number of selection systems may be used, including but of the particular reporter gene. not limited to the herpes simplex virus thymidine kinase In a preferred embodiment, the reporter gene constructs (see, e.g., Wigler et al., 1977, Cell 11:223), hypoxanthine are cloned into stable cell line expression vectors. In a guanine phosphoribosyltransferase (see, e.g., Szybalska & preferred embodiment, the stable cell line expression vector Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48:2026), and contains a site specific genomic integration site. Such as but adenine phosphoribosyltransferase (see, e.g., Lowy et al., not limited to, pCMP1 (see, e.g., FIG. 8C in Example 10). 10 In another preferred embodiment, the reporter gene con 1980, Cell 22:817) genes can be employed in tk-, hgprt- or struct is cloned into an episomal mammalian expression aprt-cells, respectively. Also, anti-metabolite resistance can vector, such as, but not limited to, pCMR2 (see, e.g., FIG. be used as the basis of selection for dhfr, which confers 8B in Example 10). resistance to methotrexate (see, e.g., Wigler et al., 1980, 5.2.3.2. Transfection 15 Natl. Acad. Sci. USA 77:3567 and O'Hare et al., 1981, Proc. Once a vector encoding the appropriate gene has been Natl. Acad. Sci. USA 78:1527); gpt, which confers resis synthesized, a host cell is transformed or transfected with the tance to mycophenolic acid (see, e.g., Mulligan & Berg, vector of interest. The use of stable transformants is pre 1981, Proc. Natl. Acad. Sci. USA 78:2072); neo, which ferred. In a preferred embodiment, the host cell is a mam confers resistance to the aminoglycoside G-418 gene (see, malian cell. In a more preferred embodiment, the host cell is e.g., Colberre-Garapin et al., 1981, J. Mol. Biol. 150: 1); and a human cell. In another embodiment, the host cells are hygro, which confers resistance to hygromycin genes (see, primary cells isolated from a tissue or other biological e.g., Santerre et al., 1984, Gene 30:147). sample of interest. Host cells that can be used in the methods 5.2.4. Cell-Free Extracts of the present invention include, but are not limited to, The invention provides for the translation of the reporter hybridomas, pre-B cells, 293 cells, 293T cells, HeLa cells, 25 gene constructs in a cell-free system. Techniques for prac HepG2 cells, K562 cells, 3T3 cells, MCF7 cells, SkBr3 ticing this specific aspect of this invention will employ, cells, or BT474 cells. In another preferred embodiment, the unless otherwise indicated, conventional techniques of host cells are derived from tissue specific to the target gene. molecular biology, microbiology, and recombinant DNA In yet another preferred embodiment, the host cells are manipulation and production, which are routinely practiced immortalized cell lines derived from a source, e.g., a tissue, 30 specific to the target gene. Other host cells that can be used by one of skill in the art. See, e.g., Sambrook, 1989, in the present invention include, but are not limited to, Molecular Cloning, A Laboratory Manual, Second Edition; bacterial cells, yeast cells, virally-infected cells, or plant DNA Cloning, Volumes I and II (Glover, Ed. 1985); and cells. Transcription and Translation (Hames & Higgins, Eds. Transformation may be by any known method for intro 35 1984). ducing polynucleotides into a host cell, for example by Any technique well-known to one of skill in the art may packaging the polynucleotide in a virus and transducing a be used to generate cell-free extracts for translation in vitro host cell with the virus, and by direct uptake of the poly (otherwise referred to herein as cell-free translation mix nucleotide. The transformation procedure used depends tures). For example, the cell-free extracts for in vitro trans upon the host to be transformed. Bacterial transformation by 40 lation reactions can be generated by centrifuging cells and direct uptake generally employs treatment with calcium or clarifying the Supernatant. The cell extracts for the present rubidium chloride (see, e.g., Cohen, 1972, Proc. Nat. Acad. invention is about a 51 (i.e., the supernatant from a 1,000xg Sci. USA 69:2110 and Maniatis et al., 1982, “Molecular spin) to about a 5500 extract (i.e., the supernatant from a Cloning: A Laboratory Manual' (Cold Spring Harbor Press, 500,000xg spin), preferably about a S10 (i.e., the superna Cold Spring Harbor, N.Y.). Yeast transformation by direct 45 tant from a 10,000xg spin) to 5250 (i.e., the supernatant uptake may be carried out using the method of Schiestl & from a 250,000xg spin) extract. In some embodiments, Gietz, 1989, Current Genetics 16:339-346 or Hinnen et al., about a S50 (i.e., the supernatant from a 50,000xg spin) to 1978, Proc. Nat. Acad. Sci. USA 75:1929. Mammalian S100 (i.e., the supernatant from a 100,000xg spin) extract is transformations (i.e., transfections) by direct uptake may be preferred. conducted using the calcium phosphate precipitation method 50 The cell-free translation extract may be isolated from cells of Graham & Vander Eb, 1978, Virol. 52:546, or the various of any species origin. For example, the cell-free translation known modifications thereof. Other methods for introducing extract may be isolated from human cells (e.g., HeLA cells), recombinant polynucleotides into cells, particularly into 293 cells, Vero cells, yeast, mouse cells (e.g., cultured mouse mammalian cells, include dextran-mediated transfection, cells), rat cells (e.g., cultured rat cells), Chinese hamster calcium phosphate mediated transfection, polybrene medi 55 ovary (CHO) cells, Xenopus oocytes, rabbit reticulocytes, ated transfection, protoplast fusion, electroporation, encap primary cells, cancer cells (e.g., undifferentiated cancer Sulation of the polynucleotide(s) in liposomes, and direct cells), cell lines, wheat germ, rye embryo, or bacterial cell microinjection of the polynucleotides into nuclei. Such extract (see, e.g., Krieg & Melton, 1984, Nature 308:203 and methods are well-known to one of skill in the art. Dignam et al., 1990 Methods Enzymol. 182:194-203). Alter In a preferred embodiment, stable cell lines containing the 60 natively, the cell-free translation extract, e.g., rabbit reticu constructs of interest are generated for high throughput locyte lysates and wheat germ extract, can be purchased screening. Such stable cells lines may be generated by from, e.g., Promega, (Madison, Wis.). It is preferred that the introducing a reporter gene construct comprising a select cells from which the cell-free extract is obtained do not able marker, allowing the cells to grow for 1-2 days in an endogenously express a target gene of interest. In a preferred enriched medium, and then growing the cells on a selective 65 embodiment, the cell-free extract is an extract isolated from medium. The selectable marker in the recombinant plasmid human cells. In a more preferred embodiment, the human confers resistance to the selection and allows cells to stably cells are HeLa cells. US 9,493,845 B2 51 52 5.3. Libraries of Compounds Combinatorial compound libraries of the present inven Libraries screened using the methods of the present tion may be synthesized using the apparatus described in invention can comprise a variety of types of compounds. U.S. Pat. No. 6,190,619 to Kilcoin et al., which is hereby Examples of libraries that can be screened in accordance incorporated by reference in its entirety. U.S. Pat. No. with the methods of the invention include, but are not 5 6,190.619 discloses a synthesis apparatus capable of holding limited to, peptoids; random biooligomers; diverSomers a plurality of reaction vessels for parallel synthesis of Such as hydantoins, benzodiazepines and dipeptides; viny multiple discrete compounds or for combinatorial libraries logous polypeptides; nonpeptidal peptidomimetics; oligo of compounds. carbamates; peptidyl phosphonates; peptide nucleic acid In one embodiment, the combinatorial compound library libraries; antibody libraries; carbohydrate libraries; and 10 Small molecule libraries (preferably small organic mol can be synthesized in solution. The method disclosed in U.S. ecules). In some embodiments, the compounds in the librar Pat. No. 6,194.612 to Boger et al., which is hereby incor ies screened are nucleic acid or peptide molecules. In a porated by reference in its entirety, features compounds non-limiting example, peptide molecules can exist in a useful as templates for Solution phase synthesis of combi phage display library. In other embodiments, the types of 15 natorial libraries. The template is designed to permit reaction compounds include, but are not limited to, peptide analogs products to be easily purified from unreacted reactants using including peptides comprising non-naturally occurring liquid/liquid or Solid/liquid extractions. The compounds amino acids, e.g., D-amino acids, phosphorous analogs of produced by combinatorial synthesis using the template will amino acids, such as a-amino phosphoric acids and a-amino preferably be Small organic molecules. Some compounds in phosphoric acids, or amino acids having non-peptide link the library may mimic the effects of non-peptides or pep ages, nucleic acid analogs such as phosphorothioates and tides. In contrast to solid phase synthesize of combinatorial PNAS, hormones, antigens, synthetic or naturally occurring compound libraries, liquid phase synthesis does not require drugs, opiates, dopamine, serotonin, catecholamines, throm the use of specialized protocols for monitoring the indi bin, acetylcholine, prostaglandins, organic molecules, vidual steps of a multistep solid phase synthesis (Egner et pheromones, adenosine. Sucrose, glucose, lactose and galac 25 al., 1995, J. Org. Chem. 60:2652: Anderson et al., 1995, J. tose. Libraries of polypeptides or proteins can also be used Org. Chem. 60:2650; Fitch et al., 1994, J. Org. Chem. in the assays of the invention. 59:7955; Look et al., 1994, J. Org. Chem. 49:7588; Metzger In a preferred embodiment, the combinatorial libraries are et al., 1993, Angew. Chem. Int. Ed. Engl. 32:894: Small organic molecule libraries including, but not limited Youngquist et al., 1994, Rapid Commun. Mass Spect. 8:77; to, benzodiazepines, isoprenoids, beta carbalines, thiazoli 30 Chu et al., 1995, J. Am. Chem. Soc. 117:5419: Brummel et dinones, metathiazanones, pyrrolidines, morpholino com al., 1994, Science 264:399; and Stevanovic et al., 1993, pounds, and benzodiazepines. In another embodiment, the Bioorg. Med. Chem. Lett. 3:431). combinatorial libraries comprise peptoids; random bio-oli Combinatorial compound libraries useful for the methods gomers; benzodiazepines; diverSomers such as hydantoins, of the present invention can be synthesized on Solid Sup benzodiazepines and dipeptides, vinylogous polypeptides; 35 ports. In one embodiment, a split synthesis method, a nonpeptidal peptidomimetics; oligocarbamates; peptidyl protocol of separating and mixing Solid Supports during the phosphonates; peptide nucleic acid libraries; antibody librar synthesis, is used to synthesize a library of compounds on ies; or carbohydrate libraries. Combinatorial libraries are solid supports (see e.g., Lam et al., 1997, Chem. Rev. themselves commercially available (see, e.g., ComGenex, 97:41-448; Ohlmeyer et al., 1993, Proc. Natl. Acad. Sci. Princeton, N.J.; Asinex, Moscow, Ru, Tripos, Inc., St. Louis, 40 USA 90:10922-10926 and references cited therein). Each Mo.; ChemStar, Ltd, Moscow, Russia; 3D Pharmaceuticals, solid support in the final library has substantially one type of Exton, Pa.; Martek Biosciences, Columbia, Md., etc.). compound attached to its Surface. Other methods for Syn In a preferred embodiment, the library is preselected so thesizing combinatorial libraries on Solid Supports, wherein that the compounds of the library are more amenable for one product is attached to each Support, will be known to cellular uptake. For example, compounds are selected based 45 those of skill in the art (see, e.g., Nefzi et al., 1997, Chem. on specific parameters such as, but not limited to, size, Rev. 97:449-472). lipophilicity, hydrophilicity, and hydrogen bonding, which As used herein, the term "solid support' is not limited to enhance the likelihood of compounds getting into the cells. a specific type of Solid Support. Rather a large number of In another embodiment, the compounds are analyzed by Supports are available and are known to one skilled in the art. three-dimensional or four-dimensional computer computa 50 Solid Supports include silica gels, resins, derivatized plastic tion programs. films, glass beads, cotton, plastic beads, polystyrene beads, The combinatorial compound library for use in accor alumina gels, and polysaccharides. A Suitable solid Support dance with the methods of the present invention may be may be selected on the basis of desired end use and synthesized. There is a great interest in synthetic methods suitability for various synthetic protocols. For example, for directed toward the creation of large collections of small 55 peptide synthesis, a solid Support can be a resin Such as organic compounds, or libraries, which could be screened p-methylbenzhydrylamine (pMBHA) resin (Peptides Inter for pharmacological, biological or other activity. The Syn national, Louisville, Ky.), polystyrenes (e.g., PAM-resin thetic methods applied to create vast combinatorial libraries obtained from Bachem Inc., Peninsula Laboratories, etc.), are performed in Solution or in the Solid phase, i.e., on a solid including chloromethylpolystyrene, hydroxymethylpolysty Support. Solid-phase synthesis makes it easier to conduct 60 rene and aminomethylpolystyrene, poly (dimethylacrylam multi-step reactions and to drive reactions to completion ide)-grafted styrene co-divinyl-benzene (e.g., POLYHIPE with high yields because excess reagents can be easily added resin, obtained from Aminotech, Canada), polyamide resin and washed away after each reaction step. Solid-phase (obtained from Peninsula Laboratories), polystyrene resin combinatorial synthesis also tends to improve isolation, grafted with polyethylene glycol (e.g., TENTAGEL or purification and screening. However, the more traditional 65 ARGOGEL, Bayer, Tubingen, Germany) polydimethylacry Solution phase chemistry Supports a wider variety of organic lamide resin (obtained from Milligen/Biosearch, California), reactions than Solid-phase chemistry. or Sepharose (Pharmacia, Sweden). US 9,493,845 B2 53 54 In some embodiments of the present invention, com hours, 1 day, 2 days, 3 days, 4 days, 5 days, or 1 week. In pounds can be attached to Solid Supports via linkers. Linkers a preferred embodiment, the contacting is about 15 hours, can be integral and part of the solid Support, or they may be i.e., overnight. The contacting can take place for about 1 nonintegral that are either synthesized on the solid Support minute to 1 week, preferably about 5 minutes to 5 days, or attached thereto after synthesis. Linkers are useful not more preferably about 10 minutes to 2 days, and even more only for providing points of compound attachment to the preferably about 1 hour to 1 day. Solid Support, but also for allowing different groups of In one embodiment, the invention provides a method for molecules to be cleaved from the solid support under identifying a compound that modulates untranslated region different conditions, depending on the nature of the linker. dependent expression of a target gene, said method com For example, linkers can be, inter alia, electrophilically 10 prising: (a) expressing a nucleic acid comprising a reporter cleaved, nucleophilically cleaved, photocleavable, enzy gene operably linked to one or more untranslated regions of matically cleaved, cleaved by metals, cleaved under reduc said target gene in a cell; (b) contacting said cell with a tive conditions or cleaved under oxidative conditions. In a member of a library of compounds; and (c) detecting the preferred embodiment, the compounds are cleaved from the expression of said reporter gene, wherein a compound that Solid Support prior to high throughput Screening of the 15 modulates untranslated region-dependent regulation of compounds. expression is identified if the expression of said reporter 5.4. Reporter Gene-Based Screening Assays gene in the presence of a compound is altered relative to a 5.4.1. Cell-Based Assays previously determined reference range or the expression of After a vector containing the reporter gene construct is said reporter gene in the absence of said compound or the transformed or transfected into a host cell and a compound presence of a control (e.g., phosphate buffered saline library is synthesized or purchased or both, the cells are used (“PBS)). In another embodiment, the invention provides a to screen the library to identify compounds that modulate method for identifying a compound that modulates untrans untranslated region-dependent expression of a target gene. lated region-dependent expression of a target gene, said In a preferred embodiment, the cells are stably transfected method comprising: (a) contacting a member of a library of with the reporter gene construct. The reporter gene-based 25 compounds with a cell containing a nucleic acid comprising assays may be conducted by contacting a compound or a a reporter gene operably linked to one or more untranslated member of a library of compounds with a cell genetically regions of said target gene; and (b) detecting a reporter engineered to express a nucleic acid comprising a reporter protein translated from said reporter gene, wherein detecting gene operably linked to one or more untranslated regions of the expression of said reporter gene, wherein a compound a target gene, and measuring the expression of said reporter 30 that modulates untranslated region-dependent expression is gene. The alteration in reporter gene expression relative to a identified if the expression of said reporter gene in the previously determined reference range, the absence of the presence of a compound is altered relative to a previously compound or a control in Such reporter-gene based assays determined reference range or the expression of said reporter indicates that a particular compound modulates untranslated gene in the absence of said compound or the presence of a region-dependent expression of a target gene. In a preferred 35 control (e.g., PBS). embodiment, a negative control (e.g., PBS or another agent The invention also provides methods of identifying com that is known to have no effect on the expression of the pounds that upregulate or down-regulate untranslated reporter gene) and a positive control (e.g., an agent that is region-dependent expression of a target gene utilitizing the known to have an effect on the expression of the reporter cell-based reporter gene assays described herein. In a spe gene, preferably an agent that effects untranslated region 40 cific embodiment, the invention provides a method of dependent expression) are included in the cell-based assays upregulating untranslated region-dependent expression of a described herein. target gene, said method comprising (a) contacting a com The step of contacting a compound or a member of a pound with a cell containing a nucleic acid comprising a library of compounds with a cell genetically engineered to reporter gene operably linked to one, two, three or more express a reporter gene operably linked to one or more 45 untranslated regions of said target gene; and (b) detecting a untranslated regions may be conducted under physiologic reporter gene protein translated from said reporter gene, conditions. In specific embodiment, a compound or a mem wherein a compound that upregulates untranslated region ber of a library of compounds is added to the cells in the dependent expression is identified if the expression of said presence of an aqueous solution. In accordance with this reporter gene in the presence of a compound is increased embodiment, the aqueous solution may comprise a buffer 50 relative a previously determined reference range, or the and a combination of salts, preferably approximating or expression in the absence of the compound or the presence mimicking physiologic conditions. Alternatively, the aque of a control (e.g., PBS). In another embodiment, the inven ous solution may comprise a buffer, a combination of salts, tion provides a method of down-regulating untranslated and a detergent or a Surfactant. Examples of salts which may region-dependent expression of a target gene, said method be used in the aqueous Solution include, but not limited to, 55 comprising (a) contacting a compound with a cell containing KCl, NaCl, and/or MgCl. The optimal concentration of a nucleic acid comprising a reporter gene operably linked to each salt used in the aqueous solution is dependent on the one, two, three or more untranslated regions of said target cells and compounds used and can be determined using gene; and (b) detecting a reporter gene protein translated routine experimentation. from said reporter gene, wherein a compound that down The invention provides for contacting a compound or a 60 regulates untranslated region dependent expression is iden member of a library of compounds with a cell genetically tified if the expression of said reporter gene in the presence engineering to express a reporter gene operably linked to of a compound is decreased relative a previously determined one or more untranslated regions for a specific period of reference range, or the expression in the absence of the time. For example, the contacting can take place for about 1 compound or the presence of a control (e.g., PBS). minute, 2 minutes, 3 minutes, 4, minutes, 5, minutes, 10 65 The present invention provides methods of identifying minutes, 15 minutes, 20 minutes, 30 minutes, 1 hour, 2 environmental stimuli (e.g., exposure to different concen hours, 3 hours, 4 hours, 5 hours, 10 hours, 15 hours, 20 trations of CO and/or O, stress and different pHs) that US 9,493,845 B2 55 56 modulate untranslated region-dependent expression of a compound or a control in Such reporter-gene based assays target gene utilizing the cell-based reporter gene assays indicates that a particular compound modulates untranslated described herein. In particular, the invention provides a region-dependent expression of a target gene. In a preferred method of identifying an environmental stimulus, said embodiment, a negative control (e.g., PBS or another agent method comprising (a) contacting a cell containing a nucleic that is known to have no effect on the expression of the acid comprising a reporter gene operably linked to one, two, reporter gene) and a positive control (e.g., an agent that is three or more untranslated regions of said target gene with known to have an effect on the expression of the reporter an environmental stimulus; and (b) detecting a reporter gene gene, preferably an agent that effects untranslated region protein translated from said reporter gene, wherein a com dependent expression) are included in the cell-free assays pound that modulates untranslated region dependent expres 10 described herein. sion is identified if the expression of said reporter gene in the The step of contacting a compound or a member of a presence of an environmental stimuli is altered relative to a library of compounds with a cell-free translation mixture previously determined reference range, or the expression in containing a nucleic acid comprising a reporter gene oper the absence of the compound or the presence of a control ably linked to one or more untranslated regions may be (e.g., PBS). In a specific embodiment, the environmental 15 conducted under conditions approximating or mimicking stimuli is not hypoxia. In another embodiment, the environ physiologic conditions. In specific embodiment, a com mental stimuli does not include a compound. pound or a member of a library of compounds is added to the The expression of a reporter gene in the cell-based cells in the presence of an aqueous solution. In accordance reporter-gene assays may be detected by any technique with this embodiment, the aqueous solution may comprise a well-known to one of skill in the art. Methods for detecting buffer and a combination of salts, preferably approximating the expression of a reporter gene will vary with the reporter or mimicking physiologic conditions. Alternatively, the gene used. Assays for the various reporter genes are well aqueous solution may comprise a buffer, a combination of known to one of skill in the art. For example, as described salts, and a detergent or a Surfactant. Examples of salts in Section 5.2.1. luciferase, beta-galactosidase (“b-gal'). which may be used in the aqueous Solution include, but not beta-glucoronidase (“GUS), beta-lactamase, chloram 25 limited to. KCl, NaCl, and/or MgCl2. The optimal concen phenicol acetyltransferase (“CAT), and alkaline phos tration of each salt used in the aqueous solution is dependent phatase (AP) are enzymes that can be analyzed in the on the cells and compounds used and can be determined presence of a Substrate and could be amenable to high using routine experimentation. throughput Screening. For example, the reaction products of The invention provides for contacting a compound or a luciferase, beta-galactosidase (“b-gal'), and alkaline phos 30 member of a library of compounds with a cell genetically phatase (AP) are assayed by changes in light imaging engineering to express a reporter gene operably linked to (e.g., luciferase), spectrophotometric absorbance (e.g., one or more untranslated regions for a specific period of b-gal), or fluorescence (e.g., AP). Assays for changes in light time. For example, the contacting can take place for about 1 output, absorbance, and/or fluorescence are easily adapted minute, 2 minutes, 3 minutes, 4, minutes, 5, minutes, 10 for high throughput Screening. For example, b-gal activity 35 minutes, 15 minutes, 20 minutes, 30 minutes, 1 hour, 2 can be measured with a microplate reader. Green fluorescent hours, 3 hours, 4 hours, 5 hours, 10 hours, 15 hours, 20 protein (“GFP) activity can be measured by changes in hours, 1 day, 2 days, 3 days, 4 days, 5 days, or 1 week. In fluorescence. For example, in the case of mutant GFPs that a preferred embodiment, the contacting is about 15 hours, fluoresce at 488 nm, standard fluorescence activated cell i.e., overnight. The contacting can take place for about 1 sorting (“FACS) equipment can be used to separate cells 40 minute to 1 week, preferably about 5 minutes to 5 days, based upon GFP activity. more preferably about 10 minutes to 2 days, and even more Alterations in the expression of a reporter gene may be preferably about 1 hour to 1 day. determined by comparing the level of expression of the In a specific embodiment, the invention provides a reporter gene to a negative control (e.g., PBS or another method for identifying a compound that modulates untrans agent that is known to have no effect on the expression of the 45 lated region-dependent expression of a target gene, said reporter gene) and optionally, a positive control (e.g., an method comprising: (a) contacting a member of a library of agent that is known to have an effect on the expression of the compounds with a cell-free translation mixture and a nucleic reporter gene, preferably an agent that effects untranslated acid comprising a reporter gene operably linked to one or region-dependent expression). Alternatively, alterations in more untranslated regions of said target gene; and (b) the expression of a reporter gene may be determined by 50 detecting the expression of said reporter gene, wherein a comparing the level of expression of the reporter gene to a compound that modulates untranslated region-dependent previously determined reference range. expression is identified if the expression of said reporter 5.4.2. Cell-Free Assays gene in the presence of a compound is altered relative to a After a vector containing the reporter gene construct is previously determined reference range or the expression of produced, a cell-free translation extract is generated or 55 said reporter gene in the absence of said compound or the purchased, and a compound library is synthesized or pur presence of a control (e.g., PBS). chased or both, the cell-free translation extract and nucleic The invention also provides methods of identifying com acid are used to screen the library to identify compounds that pounds that upregulate or down-regulate untranslated modulate untranslated region-dependent expression of a region-dependent expression of a target gene utilitizing the target gene. The reporter gene-based assays may be con 60 cell-free reporter gene assays described herein. In a specific ducted in a cell-free manner by contacting a compound or a embodiment, the invention provides a method of upregulat member of a library of compounds with a cell-free transla ing untranslated region-dependent expression of a target tion mixture and a nucleic acid comprising a reporter gene gene, said method comprising (a) contacting a compound operably linked to one or more untranslated regions of a with a cell-free translation mixture and a nucleic acid target gene, and measuring the expression of said reporter 65 comprising a reporter gene operably linked to one, two, gene. The alteration in reporter gene expression relative to a three or more untranslated regions of said target gene; and previously determined reference range, the absence of a (b) detecting a reporter gene protein translated from said US 9,493,845 B2 57 58 reporter gene, wherein a compound that upregulates untrans method of electrophoretic separation, including but not lated region dependent expression is identified if the expres limited to, denaturing and non-denaturing polyacrylamide sion of said reporter gene in the presence of a compound is gel electrophoresis, urea gel electrophoresis, gel filtration, increased relative a previously determined reference range, pulsed field gel electrophoresis, two dimensional gel elec or the expression in the absence of the compound or the trophoresis, continuous flow electrophoresis, Zone electro presence of a control (e.g., PBS). In another embodiment, phoresis, agarose gel electrophoresis, and capillary electro the invention provides a method of down-regulating untrans phoresis. lated region-dependent expression of a target gene, said In a preferred embodiment, an automated electrophoretic method comprising (a) contacting a compound with a cell system comprising a capillary cartridge having a plurality of free translation mixture and a nucleic acid comprising a 10 capillary tubes is used for high-throughput Screening of reporter gene operably linked to one, two, three or more compounds bound to target RNA. Such an apparatus for untranslated regions of said target gene; and (b) detecting a performing automated capillary gel electrophoresis is dis reporter gene protein translated from said reporter gene, closed in U.S. Pat. Nos. 5,885,430; 5,916,428; 6,027,627; wherein a compound that down-regulates untranslated and 6,063,251, the disclosures of which are incorporated by region dependent expression is identified if the expression of 15 reference in their entireties. said reporter gene in the presence of a compound is The device disclosed in U.S. Pat. No. 5,885,430, which is decreased relative to a previously determined reference incorporated by reference in its entirety, allows one to range, or the expression in the absence of the compound or simultaneously introduce samples into a plurality of capil the presence of a control (e.g., PBS). lary tubes directly from microtiter trays having a standard The activity of a compound in the in vitro translation size. U.S. Pat. No. 5,885,430 discloses a disposable capillary mixture can be determined by assaying the activity of a cartridge which can be cleaned between electrophoresis reporter protein encoded by a reporter gene, or alternatively, runs, the cartridge having a plurality of capillary tubes. A by quantifying the expression of the reporter gene by, for first end of each capillary tube is retained in a mounting example, labeling the in vitro translated protein (e.g., with plate, the first ends collectively forming an array in the S-labeled methionine), northern blot analysis, RT-PCR or 25 mounting plate. The spacing between the first ends corre by immunological methods, such as western blot analysis or sponds to the spacing between the centers of the wells of a immunoprecipitation. Such methods are well-known to one microtiter tray having a standard size. Thus, the first ends of of skill in the art. the capillary tubes can simultaneously be dipped into the 5.4.3. Direct Binding Assays samples present in the tray's wells. The cartridge is provided Compounds that modulate untranslated region-dependent 30 with a second mounting plate in which the second ends of expression of a target gene can be identified by direct the capillary tubes are retained. The second ends of the binding assays. In this embodiment, the target RNA com capillary tubes are arranged in an array which corresponds prises one or more untranslated regions, and preferably to the wells in the microtiter tray, which allows for each contains at least one element of an untranslated region. Such capillary tube to be isolated from its neighbors and therefore assays are described in International Patent Publication Nos. 35 free from cross-contamination, as each end is dipped into an WO 02/083837 and WO 02/083953, the disclosures of individual well. which are hereby incorporated by reference in their entire Plate holes may be provided in each mounting plate and ties. Briefly, direct binding assays may be conducted by the capillary tubes inserted through these plate holes. In such attaching a library of compounds to Solid Supports, e.g., a case, the plate holes are sealed airtight so that the side of polymer beads, with each solid Support having Substantially 40 the mounting plate having the exposed capillary ends can be one type of compound attached to its surface. The plurality pressurized. Application of a positive pressure in the vicinity of Solid Supports of the library is exposed in aqueous of the capillary openings in this mounting plate allows for solution to target RNA having a detectable label, forming a the introduction of air and fluids during electrophoretic dye-labeled target RNA:Support-attached compound com operations and also can be used to force out gel and other plex. Binding of a target RNA molecule to a particular 45 materials from the capillary tubes during reconditioning. compound labels the Solid Support, e.g., bead, comprising The capillary tubes may be protected from damage using a the compound, which can be physically separated from needle comprising a cannula and/or plastic tubes, and the other, unlabeled solid supports. Once labeled solid supports like when they are placed in these plate holes. When metallic are identified, the chemical structures of the compounds cannula or the like are used, they can serve as electrical thereon can be determined by, e.g., by reading a code on the 50 contacts for current flow during electrophoresis. In the solid support that correlates with the structure of the presence of a second mounting plate, the second mounting attached compound. plate is provided with plate holes through which the second Alternatively, direct binding assays may be conducted by ends of the capillary tubes project. In this instance, the contacting a target RNA having a detectable label with a second mounting plate serves as a pressure containment member of a library of compounds free in solution, in 55 member of a pressure cell and the second ends of the labeled tubes or microtiter wells, or a microarray. Com capillary tubes communicate with an internal cavity of the pounds in the library that bind to the labeled target RNA will pressure cell. The pressure cell is also formed with an inlet form a detectably labeled complex that can be identified and and an outlet. Gels, buffer solutions, cleaning agents, and the removed from the uncomplexed, unlabeled compounds in like may be introduced into the internal cavity through the the library, and from uncomplexed, labeled target RNA, by 60 inlet, and each of these can simultaneously enter the second a variety of methods including, but not limited to, methods ends of the capillaries. that differentiate changes in the electrophoretic, chromato In another preferred embodiment, the automated electro graphic, or thermostable properties of the complexed target phoretic system can comprise a chip system consisting of RNA. complex designs of interconnected channels that perform 5.4.3.1. Electrophoresis 65 and analyze enzyme reactions using part of a channel design Methods for separation of the complex of a target RNA as a tiny, continuously operating electrophoresis material, bound to a compound from the unbound RNA comprises any where reactions with one sample are going on in one area of US 9,493,845 B2 59 60 the chip while electrophoretic separation of the products of eridine formate, dimethyl sulfate, 2,12-dimethyl-3,7,11,17 another sample is taking place in a different part of the chip. tetraazacyclo 11.3.1 heptadeca-1 (17).2,11,13,15-pentae Such a system is disclosed in U.S. Pat. Nos. 5,699,157: nato nickel(II) (NiCR), cobalt(II)chloride, or iron(II) 5,842,787; 5,869,004; 5,876,675; 5,942,443; 5,948,227; ethylenediaminetetraacetate (Fe-EDTA) as described for 6,042,709; 6,042,710; 6,046,056; 6,048,498; 6,086,740: example in Zheng et al., 1999, Biochem. 37:2207-2214: 6,132,685; 6,150,119; 6,150, 180; 6,153,073; 6,167,910; Latham & Cech, 1989, Science 245:276-282; and Sambrook 6,171,850; and 6,186,660, the disclosures of which are et al., 2001, in Molecular Cloning: A Laboratory Manual, pp incorporated by reference in their entireties. 12.61-12.73, Cold Spring Harbor Laboratory Press, and the The system disclosed in U.S. Pat. No. 5,699,157, which is references cited therein, which are hereby incorporated by hereby incorporated by reference in its entirety, provides for 10 reference in their entireties. The specific pattern of cleavage a microfluidic system for high-speed electrophoretic analy sites is determined by the accessibility of particular bases to sis of subject materials for applications in the fields of the reagent employed to initiate cleavage and, as such, is chemistry, biochemistry, biotechnology, molecular biology therefore is determined by the three-dimensional structure of and numerous other areas. The system has a channel in a the RNA. Substrate, a light source and a photoreceptor. The channel 15 The interaction of Small molecules with a target nucleic holds subject materials in solution in an electric field so that acid can change the accessibility of bases to these cleavage the materials move through the channel and separate into reagents both by causing conformational changes in the bands according to species. The light source excites fluo target nucleic acid or by covering a base at the binding rescent light in the species bands and the photoreceptor is interface. When a compound binds to the nucleic acid and arranged to receive the fluorescent light from the bands. The changes the accessibility of bases to cleavage reagents, the system further has a means for masking the channel so that observed cleavage pattern will change. This method can be the photoreceptor can receive the fluorescent light only at used to identify and characterize the binding of small periodically spaced regions along the channel. The system molecules to RNA as described, for example, by Prudent et also has an unit connected to analyze the modulation fre al., 1995, J. Am. Chem. Soc. 117:10145-10146 and Mei et quencies of light intensity received by the photoreceptor so 25 al., 1998, Biochem. 37:14204-14212. that velocities of the bands along the channel are deter In the preferred embodiment of this technique, the detect mined, which allows the materials to be analyzed. ably labeled target nucleic acid is incubated with an indi The system disclosed in U.S. Pat. No. 5,699,157 also vidual compound and then Subjected to treatment with a provides for a method of performing high-speed electropho cleavage reagent, either enzymatic or chemical. The reaction retic analysis of subject materials, which comprises the steps 30 mixture can be preferably be examined directly, or treated of holding the Subject materials in Solution in a channel of further to isolate and concentrate the nucleic acid. The a microfluidic system; subjecting the materials to an electric fragments produced are separated by electrophoresis and the field so that the subject materials move through the channel pattern of cleavage can be compared to a cleavage reaction and separate into species bands; directing light toward the performed in the absence of compound. A change in the channel; receiving light from periodically spaced regions 35 cleavage pattern directly indicates that the compound binds along the channel simultaneously; and analyzing the fre to the target nucleic acid. Multiple compounds can be quencies of light intensity of the received light so that examined both in parallel and serially. velocities of the bands along the channel can be determined Other embodiments of electrophoretic separation include, for analysis of said materials. The determination of the but are not limited to urea gel electrophoresis, gel filtration, velocity of a species band determines the electrophoretic 40 pulsed field gel electrophoresis, two dimensional gel elec mobility of the species and its identification. trophoresis, continuous flow electrophoresis, Zone electro U.S. Pat. No. 5,842,787, which is hereby incorporated by phoresis, and agarose gel electrophoresis. reference in its entirety, is generally directed to devices and 5.4.3.2. Size Exclusion Chromatography systems employ channels having, at least in part, depths that In another embodiment of the present invention, size are varied over those which have been previously described 45 exclusion chromatography is used to purify compounds that (such as the device disclosed in U.S. Pat. No. 5,699,157), are bound to a target nucleic acid from a complex mixture wherein said channel depths provide numerous beneficial of compounds. Size-exclusion chromatography separates and unexpected results such as but not limited to, a reduction molecules based on their size and uses gel-based media in sample perturbation, reduced non-specific sample mixture comprised of beads with specific size distributions. When by diffusion, and increased resolution. 50 applied to a column, this media settles into a tightly packed In another embodiment, the electrophoretic method of matrix and forms a complex array of pores. Separation is separation comprises polyacrylamide gel electrophoresis. In accomplished by the inclusion or exclusion of molecules by a preferred embodiment, the polyacrylamide gel electropho these pores based on molecular size. Small molecules are resis is non-denaturing, so as to differentiate the mobilities included into the pores and, consequently, their migration of the target RNA bound to a compound from free target 55 through the matrix is retarded due to the added distance they RNA. If the polyacrylamide gel electrophoresis is denatur must travel before elution. Large molecules are excluded ing, then the target RNA:compound complex must be cross from the pores and migrate with the void volume when linked prior to electrophoresis to prevent the disassociation applied to the matrix. In the present invention, a target of the target RNA from the compound during electrophore nucleic acid is incubated with a mixture of compounds while sis. Such techniques are well known to one of skill in the art. 60 free in solution and allowed to reach equilibrium. When In one embodiment of the method, the binding of com applied to a size exclusion column, compounds free in pounds to target nucleic acid can be detected, preferably in Solution are retained by the column, and compounds bound an automated fashion, by gel electrophoretic analysis of to the target nucleic acid are passed through the column. In interference footprinting. RNA can be degraded at specific a preferred embodiment, spin columns commonly used for base sites by enzymatic methods such as ribonucleases A, 65 gel filtration of nucleic acids will be employed to separate U2, CL. T. Phy M, and B. cereus or chemical methods such bound from unbound compounds (e.g., Bio-Spin columns as diethylpyrocarbonate, sodium hydroxide, hydrazine, pip manufactured by BIO-RAD). In another embodiment, the US 9,493,845 B2 61 62 size exclusion matrix is packed into multiwell plates to lated regions operably linked to a reporter gene and the allow high throughput separation of mixtures (e.g., PLAS effect on the expression of the reporter gene in a reporter MID 96-well SEC plates manufactured by Millipore). gene-based assay described herein can be determined. For 5.4.3.3. Affinity Chromatography example, a reporter gene construct comprising the 5' UTR of In one embodiment of the present invention, affinity a target gene may be mutated by deleting a fragment of the capture is used to purify compounds that are bound to a 5' UTR of the target gene or substituting a fragment of the target nucleic acid labeled with an affinity tag from a 5' UTR of the target gene with a fragment of the 5' UTR of complex mixture of compounds. To accomplish this, a target another gene and measuring the expression of the reporter nucleic acid labeled with an affinity tag is incubated with a gene in the presence and absence of a compound that has mixture of compounds while free in solution and then 10 been identified in a screening assays described Supra (See captured to a solid Support once equilibrium has been Section 5.4). If the deletion of a fragment of the 5' UTR of established; alternatively, target nucleic acids labeled with the target gene or the substitution of a fragment of the 5' an affinity tag can be captured to a solid Support first and UTR of the target gene with a fragment of the 5' UTR of then allowed to reach equilibrium with a mixture of com another gene affects the ability of the compound to modulate pounds. 15 the expression of the reporter gene, then the fragment of the The Solid Support is typically comprised of, but not 5' UTR deleted or substituted plays a role in the regulation limited to, cross-linked agarose beads that are coupled with of the reporter gene expression and the regulation, at least in a ligand for the affinity tag. Alternatively, the Solid Support part, in an untranslated region-dependent manner. may be a glass, silicon, metal, or carbon, plastic (polysty The possibility that a particular compound is functioning rene, polypropylene) Surface with or without a self-as solely by modulating the expression of a target gene in an sembled monolayer (SAM) either with a covalently attached untranslated region-independent manner may be also deter ligand for the affinity tag, or with inherent affinity for the tag mined by changing the vector utilized as a reporter con on the target nucleic acid. struct. The untranslated regions flanked by a reporter gene Once the complex between the target nucleic acid and from the first reporter construct in which an effect on compound has reached equilibrium and has been captured, 25 reporter gene expression was detected following exposure to one skilled in the art will appreciate that the retention of a compound may be inserted into a new reporter construct bound compounds and removal of unbound compounds is that has, e.g., different transcriptional regulation elements facilitated by washing the Solid Support with large excesses (e.g., a different promoter) and a different selectable marker. of binding reaction buffer. Furthermore, retention of high The level of reporter gene expression in the presence of the affinity compounds and removal of low affinity compounds 30 compound can be compared to the level of reporter gene can be accomplished by a number of means that increase the expression in the absence of the compound or in the pres stringency of washing; these means include, but are not ence of a control (e.g., PBS). If there is no change in the limited to, increasing the number and duration of washes, level of expression of the reporter gene in the presence of the raising the salt concentration of the wash buffer, addition of compound relative to the absence of the compound or in the detergent or surfactant to the wash buffer, and addition of 35 presence of a control, then the compound probably is non-specific competitor to the wash buffer. functioning in an untranslated region-independent manner. In one embodiment, the compounds themselves are The specificity of a particular compounds effect on detectably labeled with fluorescent dyes, radioactive iso untranslated region-dependent expression of a target gene topes, or nanoparticles. When the compounds are applied to can also be determined. In particular, the effect of a particu the captured target nucleic acid in a spatially addressed 40 lar compound on the expression of one or more genes fashion (e.g., in separate wells of a 96-well microplate), (preferably, a plurality of genes) can be determined utilizing binding between the compounds and the target nucleic acid assays well-known to one of skill in the art or described can be determined by the presence of the detectable label on herein. In a specific embodiment, the specificity of a par the compound using fluorescence. ticular compound for an untranslated region of a target gene Following the removal of unbound compounds, bound 45 is determined by (a) contacting the compound of interest compounds with high affinity for the target nucleic acid can with a cell containing a nucleic acid comprising a reporter be eluted from the immobilized target nucleic acids and gene operably linked to an UTR of a different gene (i.e., a analyzed. The elution of compounds can be accomplished by gene different from the target gene which has a UTR any means that break the non-covalent interactions between different from the target gene); and (b) detecting a reporter the target nucleic acid and compound. Means for elution 50 gene protein translated from the reporter gene, wherein the include, but are not limited to, changing the pH, changing compound is specific for the untranslated region of the target the salt concentration, the application of organic solvents, gene if the expression of said reporter gene in the presence and the application of molecules that compete with the of the compound is not altered or is not substantially altered bound ligand. In a preferred embodiment, the means relative to a previously determined reference range, or the employed for elution will release the compound from the 55 expression in the absence of the compound or the presence target RNA, but will not effect the interaction between the of a control (e.g., PBS). In another embodiment, the speci affinity tag and the solid Support, thereby achieving selective ficity of a particular compound for an untranslated region of elution of compound. Moreover, a preferred embodiment a target gene is determined by (a) contacting the compound will employ an elution buffer that is volatile to allow for of interest with a panel of cells, each cell in a different well Subsequent concentration by lyophilization of the eluted 60 of a container (e.g., a 48 or 96 well microtiter plate) and each compound (e.g., O M to 5 Mammonium acetate). cell containing a nucleic acid comprising a reporter gene 5.5. Methods for Confirming that a Compound Modulates operably linked to an UTR of a different gene; and (b) Untranslated Region-Dependent Expression detecting a reporter gene protein translated from the reporter In order to exclude the possibility that a particular com gene, wherein the compound is specific for the untranslated pound is functioning solely by modulating the expression of 65 region of the target gene if the expression of said reporter a target gene in an untranslated region-independent manner, gene in the presence of the compound is not altered or is not one or more mutations may be introduced into the untrans substantially altered relative to a previously determined US 9,493,845 B2 63 64 reference range, or the expression in the absence of the example, site-directed mutagenesis and PCR-mediated compound or the presence of a control (e.g., PBS). In mutagenesis. In a specific embodiment, less than 75 nucleic accordance with this embodiment, the panel may comprise acid residue substitutions, less than 50 nucleic acid residue 5, 7, 10, 15, 20, 25, 50, 75, 100 or more cells. In another Substitutions, less than 45 nucleic acid residue Substitutions, embodiment, the specificity of a particular compound for an less than 40 nucleic acid residue substitutions, less than 35 untranslated region of a target gene is determined by (a) nucleic acid residue substitutions, less than 30 nucleic acid contacting the compound of interest with a cell-free trans residue substitutions, less than 25 nucleic acid residue lation mixture and a nucleic acid comprising a reporter gene Substitutions, less than 20 nucleic acid residue Substitutions, operably linked to an UTR of a different gene; and (b) less than 15 nucleic acid residue substitutions, less than 10 detecting a reporter gene protein translated from the reporter 10 nucleic acid residue substitutions, or less than 5 nucleic acid gene, wherein the compound is specific for the untranslated residue substitutions are introduced into the nucleotide region of the target gene if the expression of said reporter sequence of an untranslated region of a target gene. In gene in the presence of the compound is not altered or is not another embodiment, less than 10 elements of an untrans substantially altered relative to a previously determined lated region of a target gene, less than 9 of an untranslated reference range, or the expression in the absence of the 15 region of a target gene, less than 8 elements of an untrans compound or the presence of a control (e.g., PBS). As used lated region of a target gene, less than 7 elements of an herein, the term “not substantially altered” means that the untranslated region of a target gene, less than 6 elements of compound alters the expression of the reporter gene or target an untranslated region of a target gene, less than 5 elements gene by less than 20%, less than 15%, less than 10%, less of an untranslated region of a target gene, less than 4 than 5%, or less than 2% relative to a negative control such elements of an untranslated region of a target gene, less than as PBS. 3 elements of an untranslated region of a target gene, or less The compounds identified in the assays described Supra than 2 elements of an untranslated region of a target gene are that modulate untranslated region-dependent expression of a mutated at one time. target gene (for convenience referred to herein as a “lead 5.5.3. Expressed Protein Concentration and Activity compound) can be further tested for untranslated region 25 Assays dependent binding to the target RNA (which contains at least The compounds identified in the reporter gene-based one untranslated region, and preferably at least one element assays described herein that modulate untranslated region of an untranslated region). Furthermore, by assessing the dependent expression may be tested in in vitro assays (e.g., effect of a compound on target gene expression, cis-acting cell-free assays) or in vivo assays (e.g., cell-based assays) elements, i.e., specific nucleotide sequences, that are 30 well-known to one of skill in the art or described herein for involved in untranslated region-dependent expression may the effect of said compounds on the expression of the target be identified. gene from which the untranslated regions of the reporter 5.5.1. RNA Binding Assays gene construct were derived. The specificity of a particular The compounds that modulate untranslated region-depen compound's effect on untranslated region-dependent expres dent expression of a target gene can be tested for binding to 35 sion of one or more other genes (preferably, a plurality of the target RNA (which contains at least one untranslated genes) can also be determined utilizing assays well-known region, and preferably at least one element of an untranslated to one of skill in the art or described herein. In a preferred region) by any method known in the art. See Section 5.4.3 embodiment, a compound identified utilizing the reporter Supra. gene-based assays described herein has a specific effect on 5.5.1. Subtraction Assay 40 the expression of only one gene or a group of genes within The element(s) of an untranslated region(s) that is nec the same signaling pathway. essary for a compound identified in accordance with the The expression of a gene can be readily detected, e.g., by methods of the invention to modulate untranslated region quantifying the protein and/or RNA encoded by said gene. dependent expression of a target gene can be determined Many methods standard in the art can be thus employed, utilizing standard mutagenesis techniques well-known to 45 including, but not limited to, immunoassays to detect and/or one of skill in the art. One or more mutations (e.g., deletions, visualize gene expression (e.g., western blot, immunopre additions and/or substitutions) may be introduced into the cipitation followed by sodium dodecyl sulfate polyacrylam untranslated regions operably linked to a reporter gene and ide gel electrophoresis (SDS-PAGE), immunocytochemis the effect on the expression of the reporter gene in a reporter try, etc.) and/or hybridization assays to detect gene gene-based assay described herein can be determined. For 50 expression by detecting and/or visualizing respectively example, a reporter gene construct comprising the 5' UTR of mRNA encoding a gene (e.g., northern assays, dot blots, in a target gene may be mutated by deleting a fragment or all situ hybridization, etc.). Such assays are routine and well of the 5' UTR of the target gene or substituting a fragment known in the art (see, e.g., Ausubel et al., eds, 1994, Current of the 5' UTR of the target gene with a fragment of the 5' Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, UTR of another gene and measuring the expression of the 55 Inc., New York, which is incorporated by reference herein in reporter gene in the presence and absence of a compound its entirety). Exemplary immunoassays are described briefly that has been identified in a screening assays described Supra below (but are not intended by way of limitation). (See Section 5.4). If the deletion of a fragment of the 5' UTR Immunoprecipitation protocols generally comprise lysing of the target gene or the substitution of a fragment of the 5' a population of cells in a lysis buffer such as RIPA buffer UTR of the target gene with a fragment of the 5' UTR of 60 (1% NP-40 or Triton X-100, 1% sodium deoxycholate, 0.1% another gene affects the ability of the compound to modulate SDS, 0.15 MNaCl, 0.01 M sodium phosphate at pH 7.2, 1% the expression of the reporter gene, then the fragment of the Trasylol) supplemented with protein phosphatase and/or 5' UTR deleted or substituted plays a role in the regulation protease inhibitors (e.g., EDTA, PMSF, aprotinin, sodium of the reporter gene expression. Vanadate), adding the antibody of interest to the cell lysate, Standard techniques known to those of skill in the art can 65 incubating for a period of time (e.g., 1 to 4 hours) at 40°C., be used to introduce mutations in the nucleotide sequence of adding protein A and/or protein G Sepharose beads to the cell an untranslated region of a target gene, including, for lysate, incubating for about an hour or more at 40° C. US 9,493,845 B2 65 66 washing the beads in lysis buffer and resuspending the beads fluorescence characteristics. FACS systems are available in in SDS/sample buffer. The ability of the antibody of interest varying levels of performance and ability, including multi to immunoprecipitate a particular antigen can be assessed color analysis. The facilitating cell can be identified by a by, e.g., western blot analysis. One of skill in the art would characteristic profile of forward and side scatter which is be knowledgeable as to the parameters that can be modified influenced by size and granularity, as well as by positive to increase the binding of the antibody to an antigen and and/or negative expression of certain cell Surface markers. decrease the background (e.g., pre-clearing the cell lysate In addition to measuring the effect of a compound iden with Sepharose beads). For further discussion regarding tified in the reporter gene-based assays described herein on immunoprecipitation protocols see, e.g., Ausubel et al., eds, the expression of the target gene from which the untranslated 1994, Current Protocols in Molecular Biology, Vol. 1, John 10 regions of the reporter gene construct were derived, the Wiley & Sons, Inc., New York at 10.16.1. activity of the protein encoded by the target gene can be Western blot analysis generally comprises preparing pro assessed utilizing techniques well-known to one of skill in tein samples, electrophoresis of the protein samples in a the art. For example, the activity of a protein encoded by a polyacrylamide gel (e.g., 8%-20% SDS-PAGE depending target gene can be determined by detecting induction of a on the molecular weight of the antigen), transferring the 15 cellular second messenger (e.g., intracellular Ca", diacyl protein sample from the polyacrylamide gel to a membrane glycerol, IP, etc.), detecting the phosphorylation of a pro such as nitrocellulose, PVDF or nylon, blocking the mem tein, detecting the activation of a transcription factor, or brane in blocking solution (e.g., PBS with 3% BSA or detecting a cellular response, for example, cellular differen non-fat milk), washing the membrane in washing buffer tiation, or cell proliferation. The induction of a cellular (e.g., PBS-Tween 20), incubating the membrane with pri second messenger or phosporylation of a protein can be mary antibody (the antibody of interest) diluted in blocking determined by, e.g., immunoassays well-known to one of buffer, washing the membrane in washing buffer, incubating skill in the art and described herein. The activation of a the membrane with a secondary antibody (which recognizes transcription factor can be detected by, e.g., electromobility the primary antibody, e.g., an anti-human antibody) conju shift assays, and a cellular response Such as cellular prolif gated to an enzymatic Substrate (e.g., horseradish peroxidase 25 eration can be detected by, e.g., trypan blue cell counts, or alkaline phosphatase) or radioactive molecule (e.g., Por H-thymidine incorporation, and flow cytometry. 'I) diluted in blocking buffer, washing the membrane in 5.6. Methods for Characterizing the Compounds that wash buffer, and detecting the presence of the antigen. One Modulate Untranslated Region-Dependent Expression of a of skill in the art would be knowledgeable as to the param Target Gene eters that can be modified to increase the signal detected and 30 If the library comprises arrays or microarrays of com to reduce the background noise. For further discussion pounds, wherein each compound has an address or identifier, regarding western blot protocols see, e.g., Ausubeletal, eds. the compound can be deconvoluted, e.g., by cross-referenc 1994, Current Protocols in Molecular Biology, Vol. 1, John ing the positive sample to original compound list that was Wiley & Sons, Inc., New York at 10.8.1. applied to the individual test assays. ELISAS comprise preparing antigen, coating the well of a 35 If the library is a peptide or nucleic acid library, the 96 well microtiter plate with the antigen, adding the anti sequence of the compound can be determined by direct body of interest conjugated to a detectable compound Such sequencing of the peptide or nucleic acid. Such methods are as an enzymatic Substrate (e.g., horseradish peroxidase or well known to one of skill in the art. alkaline phosphatase) to the well and incubating for a period A number of physico-chemical techniques can be used for of time, and detecting the presence of the antigen. In ELISAS 40 the de novo characterization of compounds bound to the the antibody of interest does not have to be conjugated to a target RNA. Examples of such techniques include, but are detectable compound; instead, a second antibody (which not limited to, mass spectrometry, NMR spectroscopy, X-ray recognizes the antibody of interest) conjugated to a detect crystallography and vibrational spectroscopy. able compound may be added to the well. Further, instead of 5.6.1. Mass Spectrometry coating the well with the antigen, the antibody may be 45 Mass spectrometry (e.g., electrospray ionization (“ESI), coated to the well. In this case, a second antibody conjugated matrix-assisted laser desorption-ionization ("MALDI), and to a detectable compound may be added following the Fourier-transform ion cyclotron resonance (“FT-ICR) can addition of the antigen of interest to the coated well. One of be used for elucidating the structure of a compound. skill in the art would be knowledgeable as to the parameters MALDI uses a pulsed laser for desorption of the ions and that can be modified to increase the signal detected as well 50 a time-of-flight analyzer, and has been used for the detection as other variations of ELISAs known in the art. For further of noncovalent tRNA:amino-acyl-tRNA synthetase com discussion regarding ELISAS see, e.g., Ausubel et al., eds, plexes (Gruic-Sovuliet al., 1997, J. Biol. Chem. 272:32084 1994, Current Protocols in Molecular Biology, Vol. 1, John 32091). However, covalent cross-linking between the target Wiley & Sons, Inc., New York at 11.2.1. nucleic acid and the compound is required for detection, Another antibody based separation that can be used to 55 since a non-covalently bound complex may dissociate dur detect the protein of interest is the use of flow cytometry ing the MALDI process. such as by a florescence activated cell sorter (“FACS”). ESI mass spectrometry (ESI-MS) has been of greater Typically, separation by flow cytometry is performed as utility for studying non-covalent molecular interactions follows. The suspended mixture of cells are centrifuged and because, unlike the MALDI process, ESI-MS generates resuspended in media. Antibodies which are conjugated to 60 molecular ions with little to no fragmentation (Xavier et al., fluorochrome are added to allow the binding of the antibod 2000, Trends Biotechnol. 18(8):349-356). ESI-MS has been ies to specific proteins. In another embodiment, the second used to study the complexes formed by HIV Tat peptide and ary antibodies that are conjugated to fluorochromes can be protein with the TAR RNA (Sannes-Lowery et al., 1997, used to detect primary antibodies specific to the protein of Anal. Chem. 69:5130-5135). interest. The cell mixture is then washed by one or more 65 Fourier-transform ion cyclotron resonance (“FT-ICR) centrifugation and resuspension steps. The mixture is run mass spectrometry provides high-resolution spectra, iso through a FACS which separates the cells based on different tope-resolved precursor ion selection, and accurate mass US 9,493,845 B2 67 68 assignments (Xavier et al., 2000, Trends Biotechnol. 18(8): harvested and prepared for data collection. The crystals are 349-356). FT-ICR has been used to study the interaction of then analyzed by diffraction (such as multi-circle diffracto aminoglycoside antibiotics with cognate and non-cognate meters, high-speed CCD detectors, and detector off-set). RNAs (Hofstadler et al., 1999, Anal. Chem. 71:3436-3440: Generally, multiple crystals must be screened for structure and Griffey et al., 1999, Proc. Natl. Acad. Sci. USA determinations. 96:10129-10133). As true for all of the mass spectrometry 5.6.4. Vibrational Spectroscopy methods discussed herein, FT-ICR does not require labeling Vibrational spectroscopy (e.g. infrared (IR) spectroscopy of the target RNA or a compound. or Raman spectroscopy) can be used for elucidating the An advantage of mass spectroscopy is not only the structure of a compound. elucidation of the structure of the compound, but also the 10 determination of the structure of the compound bound to a Infrared spectroscopy measures the frequencies of infra target RNA. Such information can enable the discovery of a red light (wavelengths from 100 to 10,000 nm) absorbed by consensus structure of a compound that specifically binds to the compound as a result of excitation of vibrational modes a target RNA. according to quantum mechanical selection rules which 5.6.2. NMR Spectroscopy 15 require that absorption of light cause a change in the electric NMR spectroscopy is a valuable technique for identifying dipole moment of the molecule. The infrared spectrum of complexed target nucleic acids by qualitatively determining any molecule is a unique pattern of absorption wavelengths changes in chemical shift, specifically from distances mea of varying intensity that can be considered as a molecular sured using relaxation effects, and NMR-based approaches fingerprint to identify any compound. have been used in the identification of small molecule Infrared spectra can be measured in a scanning mode by binders of protein drug targets (Xavier et al., 2000, Trends measuring the absorption of individual frequencies of light, Biotechnol. 18(8):349-356). The determination of structure produced by a grating which separates frequencies from a activity relationships (“SAR”) by NMR is the first method mixed-frequency infrared light source, by the compound for NMR described in which small molecules that bind relative to a standard intensity (double-beam instrument) or adjacent subsites are identified by two-dimentional H-'N 25 pre-measured (blank") intensity (single-beam instrument). In spectra of the target protein (Shuker et al., 1996, Science a preferred embodiment, infrared spectra are measured in a 274: 1531-1534). The signal from the bound molecule is pulsed mode (“FT-IR”) where a mixed beam, produced by monitored by employing line broadening, transferred NOEs an interferometer, of all infrared light frequencies is passed and pulsed field gradient diffusion measurements (Moore, through or reflected off the compound. The resulting inter 1999, Curr. Opin. Biotechnol. 10:54-58). A strategy for lead 30 ferogram, which may or may not be added with the resulting generation by NMR using a library of small molecules has interferograms from Subsequent pulses to increase the signal been recently described (Fezo et al., 1999, Chem. Biol. strength while averaging random noise in the electronic 6:755-769). signal, is mathematically transformed into a spectrum using In one embodiment of the present invention, the target Fourier Transform or Fast Fourier Transform algorithms. nucleic acid complexed to a compound can be determined 35 Raman spectroscopy measures the difference in frequency by SAR by NMR. Furthermore, SAR by NMR can also be due to absorption of infrared frequencies of scattered visible used to elucidate the structure of a compound. or ultraviolet light relative to the incident beam. The incident As described above, NMR spectroscopy is a technique for monochromatic light beam, usually a single laser frequency, identifying binding sites in target nucleic acids by qualita is not truly absorbed by the compound but interacts with the tively determining changes in chemical shift, specifically 40 electric field transiently. Most of the light scattered off the from distances measured using relaxation effects. Examples sample will be unchanged (Rayleigh Scattering) but a por of NMR that can be used for the invention include, but are tion of the scatter light will have frequencies that are the sum not limited to, one-dimentional NMR, two-dimentional or difference of the incident and molecular vibrational NMR, correlation spectroscopy (“COSY), and nuclear frequencies. The selection rules for Raman (inelastic) scat Overhauser effect (“NOE) spectroscopy. Such methods of 45 tering require a change in polarizability of the molecule. structure determination of compounds are well-known to While some vibrational transitions are observable in both one of skill in the art. infrared and Raman spectrometry, must are observable only Similar to mass spectroscopy, an advantage of NMR is the with one or the other technique. The Raman spectrum of any not only the elucidation of the structure of the compound, molecule is a unique pattern of absorption wavelengths of but also the determination of the structure of the compound 50 varying intensity that can be considered as a molecular bound to the target RNA. Such information can enable the fingerprint to identify any compound. discovery of a consensus structure of a compound that Raman spectra are measured by Submitting monochro specifically binds to a target RNA. matic light to the sample, either passed through or preferably 5.6.3. X Ray Crystallography reflected off, filtering the Rayleigh scattered light, and X-ray crystallography can be used to elucidate the struc 55 detecting the frequency of the Raman scattered light. An ture of a compound. For a review of X-ray crystallography improved Raman spectrometer is described in U.S. Pat. No. see, e.g., Blundell et al., 2002, Nat Rev Drug Discov 5,786.893 to Fink et al., which is hereby incorporated by 1(1):45-54. The first step in X-ray crystallography is the reference. formation of crystals. The formation of crystals begins with Vibrational microscopy can be measured in a spatially the preparation of highly purified and soluble samples. The 60 resolved fashion to address single beads by integration of a conditions for crystallization are then determined by opti visible microscope and spectrometer. A microscopic infrared mizing several solution variables known to induce nucle spectrometer is described in U.S. Pat. No. 5,581,085 to ation, Such as pH, ionic strength, temperature, and specific Refner et al., which is hereby incorporated by reference in concentrations of organic additives, salts and detergent. its entirety. An instrument that simultaneously performs a Techniques for automating the crystallization process have 65 microscopic infrared and microscopic Raman analysis on a been developed for the production of high-quality protein sample is described in U.S. Pat. No. 5,841,139 to Sostek et crystals. Once crystals have been formed, the crystals are al., which is hereby incorporated by reference in its entirety. US 9,493,845 B2 69 70 In one embodiment of the method, compounds are syn Specific examples of cell culture models include, but are not thesized on polystyrene beads doped with chemically modi limited to, for lung cancer, primary rat lung tumor cells (see, fied styrene monomers such that each resulting bead has a e.g., Swafford et al., 1997, Mol. Cell. Biol., 17:1366-1374) characteristic pattern of absorption lines in the vibrational and large-cell undifferentiated cancer cell lines (see, e.g., (IR or Raman) spectrum, by methods including but not Mabry et al., 1991, Cancer Cells, 3:53-58); colorectal cell limited to those described by Fenniri et al., 2000, J. Am. lines for colon cancer (see, e.g., Park & Gazdar, 1996, J. Cell Chem. Soc. 123:8151-8152. Using methods of split-pool Biochem. Suppl. 24:131-141); multiple established cell lines synthesis familiar to one of skill in the art, the library of for breast cancer (see, e.g., Hambly et al., 1997, Breast compounds is prepared so that the spectroscopic pattern of Cancer Res. Treat. 43:247-258; Gierthy et al., 1997, Che the bead identifies one of the components of the compound 10 mosphere 34:1495-1505; and Prasad & Church, 1997, Bio on the bead. Beads that have been separated according to chem. Biophys. Res. Commun. 232:14-19); a number of their ability to bind target RNA can be identified by their well-characterized cell models for prostate cancer (see, e.g., vibrational spectrum. In one embodiment of the method, Webber et al., 1996, Prostate, Part 1, 29:386-394; Part 2, appropriate sorting and binning of the beads during synthe 30:58-64; and Part 3, 30:136-142 and Boulikas, 1997, Anti sis then allows identification of one or more further com 15 cancer Res. 17:1471-1505); for genitourinary cancers, con ponents of the compound on any one bead. In another tinuous human bladder cancer cell lines (see, e.g., Ribeiro et embodiment of the method, partial identification of the al., 1997, Int. J. Radiat. Biol. 72:11-20); organ cultures of compound on a bead is possible through use of the spectro transitional cell carcinomas (see, e.g., Booth et al., 1997. scopic pattern of the bead with or without the aid of further Lab Invest. 76:843-857) and rat progression models (see, sorting during synthesis, followed by partial resynthesis of e.g., Vet et al., 1997, Biochim. Biophys Acta 1360:39–44); the possible compounds aided by doped beads and appro and established cell lines for leukemias and lymphomas priate Sorting during synthesis. (see, e.g., Drexler, 1994, Leuk. Res. 18:919-927 and In another embodiment, the IR or Raman spectra of Tohyama, 1997, Int. J. Hematol. 65:309-317). compounds are examined while the compound is still on a Many assays well-known in the art can be used to assess bead, preferably, or after cleavage from bead, using methods 25 the survival and/or growth of a patient cell or cell line including but not limited to photochemical, acid, or heat following exposure to a lead compound; for example, cell treatment. The compound can be identified by comparison of proliferation can be assayed by measuring bromodeoxyuri the IR or Raman spectral pattern to spectra previously dine (BrdU) incorporation (see, e.g., Hoshino et al., 1986, acquired for each compound in the combinatorial library. Int. J. Cancer 38:369 and Campana et al., 1988, J. Immunol. 5.7. Secondary Screens of Compounds 30 Meth. 107:79) or (H)-thymidine incorporation (see, e.g., Once a compound has been identified to modulate Chen, 1996, Oncogene 13:1395-403 and Jeoung, 1995, J. untranslated region-dependent expression of a target gene Biol. Chem. 270:18367-73), by direct cell count, by detect and preferably, the structure of the compound has been ing changes in transcription, translation or activity of known identified by the methods described in Section 5.6, the genes such as proto-oncogenes (e.g., fos, myc) or cell cycle compounds are tested for biological activity in further assays 35 markers (Rb, cdc2, cyclin A, D1, D2, D3, E, etc.). The levels and/or animal models (see, e.g., Sections 5.7.1 and 5.7.2). of such protein and mRNA and activity can be determined Further, a lead compound may be used to design congeners by any method well known in the art. For example, protein or analogs (see, e.g., Section 5.7.3). can be quantitated by known immunodiagnostic methods 5.7.1. Cell-Based Screens Such as western blotting or immunoprecipitation using com The compounds identified in the assays described Supra 40 mercially available antibodies. mRNA can be quantitated (for convenience referred to herein as a “lead compound) using methods that are well known and routine in the art, for can be tested for biological activity using host cells con example, using northern analysis, RNase protection, the taining or engineered to contain the target RNA element polymerase chain reaction in connection with reverse tran involved in untranslated region-dependent gene expression scription (“RT-PCR). Cell viability can be assessed by coupled to a functional readout System. For example, a 45 using trypan-blue staining or other cell death or viability phenotypic or physiological readout can be used to assess markers known in the art. In a specific embodiment, the level untranslated region-dependent activity of the target RNA in of cellular ATP is measured to determined cell viability. the presence and absence of the lead compound. Differentiation can be assessed, for example, visually based In one embodiment, a phenotypic or physiological read on changes in morphology. out can be used to assess untranslated region-dependent 50 The lead compound can also be assessed for its ability to activity of the target RNA in the presence and absence of the inhibit cell transformation (or progression to malignant lead compound. For example, the target RNA may be phenotype) in vitro. In this embodiment, cells with a trans overexpressed in a cell in which the target RNA is endog formed cell phenotype are contacted with a lead compound, enously expressed. Where the target RNA controls untrans and examined for change in characteristics associated with lated region-dependent expression of a gene product 55 a transformed phenotype (a set of in vitro characteristics involved in cell growth or viability, the in vivo effect of the associated with a tumorigenic ability in vivo), for example, lead compound can be assayed by measuring the cell growth but not limited to, colony formation in Soft agar, a more or viability of the target cell. Such assays can be carried out rounded cell morphology, looser Substratum attachment, with representative cells of cell types involved in a particular loss of contact inhibition, loss of anchorage dependence, disease or disorder (e.g., leukocytes such as T cells, B cells, 60 release of proteases such as plasminogen activator, increased natural killer cells, macrophages, neutrophils and eosino Sugar transport, decreased serum requirement, or expression phils). A lower level of proliferation or survival of the of fetal antigens, etc. (see, e.g., Luria et al., 1978, General contacted cells indicates that the lead compound is effective Virology, 3d Ed., John Wiley & Sons, New York, pp. to treat a condition in the patient characterized by uncon 436-446). trolled cell growth. Alternatively, instead of culturing cells 65 Loss of invasiveness or decreased adhesion can also be from a patient, a lead compound may be screened using cells assessed to demonstrate the anti-cancer effects of a lead of a tumor or malignant cell line or an endothelial cell line. compound. For example, an aspect of the formation of a US 9,493,845 B2 71 72 metastatic cancer is the ability of a precancerous or cancer by RT-PCR or northern blot analysis) in cultured cells in ous cell to detach from primary site of disease and establish vitro using methods which are well known in the art. A lead a novel colony of growth at a secondary site. The ability of compound can also be assessed for its ability to alter a cell to invade peripheral sites reflects its potential for a bacterial replication (as determined, e.g., by measuring cancerous state. Loss of invasiveness can be measured by a 5 bacterial growth rates) or the production of bacterial proteins variety of techniques known in the art including, for (as determined, e.g., by western blot analysis) or bacterial example, induction of E-cadherin-mediated cell-cell adhe RNAs (as determined, e.g., by RT-PCR or northern blot Sion. Such E-cadherin-mediated adhesion can result in phe analysis) in cultured cells in vitro using methods which are notypic reversion and loss of invasiveness (see, e.g., Hordijk well known in the art. Finally, a lead compound can be et al., 1997, Science 278:1464-66). 10 assessed for its ability to alter fungal replication (as deter Loss of invasiveness can further be examined by inhibi mined, e.g., by fungal growth rates, such as macrodilution tion of cell migration. A variety of 2-dimensional and methods and/or microdilution methods using protocols 3-dimensional cellular matrices are commercially available known to those skilled in the art (see, e.g., Clancy et al., (Calbiochem-Novabiochem Corp. San Diego, Calif.). Cell 1997, Journal of Clinical Microbiology, 35(11): 2878-82; migration across or into a matrix can be examined using 15 Ryder et al., 1998, Antimicrobial Agents and Chemotherapy, microscopy, time-lapsed photography or videography, or by 42(5): 1057-61; or U.S. Pat. No. 5,521, 153: U.S. Pat. No. any method in the art allowing measurement of cellular 5,883,120, U.S. Pat. No. 5,521,169)) or the production of migration. In a related embodiment, loss of invasiveness is fungal proteins (as determined, e.g., by western blot analy examined by response to hepatocyte growth factor (“HGF). sis) or fungal RNAs (as determined, e.g., by RT-PCR or HGF-induced cell scattering is correlated with invasiveness northern blot analysis) in cultured cells in vitro using of cells such as Madin-Darby canine kidney (“MDCK) methods which are well known in the art. cells. This assay identifies a cell population that has lost cell 5.7.2. Animal Model-Based Screens scattering activity in response to HGF (see, e.g., Hordijk et The lead compounds identified in the reporter gene-based al., 1997, Science 278:1464-66). assay described herein can be tested for biological activity Alternatively, loss of invasiveness can be measured by 25 using animal models for a disease, disorder, condition, or cell migration through a chemotaxis chamber (Neuroprobe? syndrome of interest. These include animals engineered to Precision Biochemicals Inc. Vancouver, BC). In such assay, contain a target gene coupled to a functional readout system, a chemo-attractant agent is incubated on one side of the Such as a transgenic mouse. Such animal model systems chamber (e.g., the bottom chamber) and cells are plated on include, but are not limited to, rats, mice, chicken, cows, a filter separating the opposite side (e.g., the top chamber). 30 monkeys, pigs, dogs, rabbits, etc. In a specific embodiment In order for cells to pass from the top chamber to the bottom of the invention, a compound identified in accordance with chamber, the cells must actively migrate through small pores the methods of the invention is tested in a mouse model in the filter. Checkerboard analysis of the number of cells system. Such model systems are widely used and well that have migrated can then be correlated with invasiveness known to the skilled artisan such as the SCID mouse model (see e.g., Ohnishi, 1993, Biochem. Biophys. Res. Commun. 35 or transgenic mice. 193:518-25). The anti-angiogenic activity of a compound identified in The effect of a compound of the invention on cell adhe accordance with the invention can be determined by using sion can be measured using HUVECS. HUVECs are seeded various experimental animal models of vascularized tumors. on 24 well culture plates and incubated for 2 days to allow The anti-tumor activity of a compound identified in accor formation of a confluent monolayer. Cancerous cells or a 40 dance with the invention can be determined by administer cancer cell line such as LS-180 human colon adenocarci ing the compound to an animal model and verifying that the noma cells are labeled with 5 uM Calcein-AM for 30 min. compound is effective in reducing the proliferation or spread Calcein-AM labeled LS180 cells are added into each well of of cancer cells in said animal model. An example of an the HUVEC culture; and incubated for 10 min at 37° C. animal model for human cancer in general includes, but is TNF-C. (80 ng/ml) is then added and the culture incubated 45 not limited to, spontaneously occurring tumors of compan for is an additional 110 min. Non-adherent cells are removed ion animals (see, e.g., Vail & MacEwen, 2000, Cancer Invest by washing with PBS. The fluorescence intensity of adherent 18(8):781-92). LS-180 cell in each individual well is measured by a Examples of animal models for lung cancer include, but fluorescent plate reader set at excitation 485/20 nm and are not limited to, lung cancer animal models described by emission at 530/25 nm. 50 Zhang & Roth (1994. In Vivo 8(5):755-69) and a transgenic The effect of a compound of the invention on cell migra mouse model with disrupted p53 function (see, e.g., Morris tion and invasion can also be determined using an assay et al., 1998, J La State Med Soc 150(4): 179-85). An example based on the BD BioCoast Angiogenesis System (BD Bio of an animal model for breast cancer includes, but is not sciences, Bedford, Mass.). The fluorescence blocking mem limited to, a transgenic mouse that overexpresses cyclin D1 brane of the insert is a 3 micron pore size PET filter which 55 (see, e.g., Hosokawa et al., 2001, Transgenic Res 10(5):471 has been coated either with BD Matrigel basement matrix 8). An example of an animal model for colon cancer (for invasion assay) or without Matrigel matrix (for migra includes, but is not limited to, a TCR b and p53 double tion assay). HUVECs (250 ul/well) in culture medium knockout mouse (see, e.g., Kado et al., 2001, Cancer Res without serum are added to the top chamber, a compound 61 (6):2395-8). Examples of animal models for pancreatic added to bottom wells containing medium (750 ul/well) with 60 cancer include, but are not limited to, a metastatic model of VEGF as a chemo-attractant. Cells are then incubated for 22 Panc02 murine pancreatic adenocarcinoma (see, e.g., Wang h at 37° C. After incubation, cells are stained with Calcein et al., 2001, Int J Pancreatol 29(1):37-46) and nu-nu mice AM for measurement of fluorescence. generated in Subcutaneous pancreatic tumours (see, e.g., Further, a lead compound can be assessed for its ability to Ghaneh et al., 2001, Gene Ther 8(3):199-208). Examples of alter viral replication (as determined, e.g., by plaque forma 65 animal models for non-Hodgkin’s lymphoma include, but tion) or the production of viral proteins (as determined, e.g., are not limited to, a severe combined immunodeficiency by western blot analysis) or viral RNAs (as determined, e.g., (“SCID) mouse (see, e.g., Bryant et al., 2000, Lab Invest US 9,493,845 B2 73 74 80(4):553-73) and an IgEImu-HOX11 transgenic mouse Proc. Natl. Acad. Sci. 96:8156-8160 and Yamamoto et al., (see, e.g., Hough et al., 1998, Proc Natl Acad Sci USA 1998, Endocrinology 139(3):1411–1419, both incorporated 95(23): 13853-8). An example of an animal model for herein by reference in their entireties). esophageal cancer includes, but is not limited to, a mouse Additionally, animal models for inflammatory bowel dis transgenic for the human papillomavirus type 16 E7 onco ease can also be used to assess the efficacy of a compound gene (see, e.g., Herber et al., 1996, J Virol 70(3): 1873-81). identified in accordance with the invention (see, e.g., Kim et Examples of animal models for colorectal carcinomas al., 1992, Scand. J. Gastroentrol. 27:529-537 and Strober, include, but are not limited to, Apc mouse models (see, e.g., 1985, Dig. Dis. Sci. 30(12 Suppl):3S-10S). Ulcerative choli Fodde & Smits, 2001, Trends Mol Med 7(8):369-73 and tis and Crohn's disease are human inflammatory bowel Kuraguchi et al., 2000. Oncogene 19(50):5755-63). 10 diseases that can be induced in animals. Sulfated polysac The anti-inflammatory activity of a compound identified charides including, but not limited to, amylopectin, carra in accordance with the invention can be determined by using geen, amylopectin Sulfate, and dextran Sulfate or chemical various experimental animal models of inflammatory arthri irritants including, but not limited to, trinitrobenzenesul tis known in the art and described in Crofford & Wilder, phonic acid (TNBS) and acetic acid can be administered to “Arthritis and Autoimmunity in Animals', in Arthritis and 15 animals orally to induce inflammatory bowel diseases. Allied Conditions: A Textbook of Rheumatology, McCarty Animal models for asthma can also be used to assess the et al. (eds.), Chapter 30 (Lee & Febiger, 1993). Experimental efficacy of a compound identified in accordance with the and spontaneous animal models of inflammatory arthritis invention. An example of one such model is the murine and autoimmune rheumatic diseases can also be used to adoptive transfer model in which aeroallergen provocation assess the anti-inflammatory activity of a compound iden of TH1 or TH2 recipient mice results in TH effector cell tified in accordance with the invention. The principle animal migration to the airways and is associated with an intense models for arthritis or inflammatory disease known in the art neutrophilic (TH1) and eosinophilic (TH2) lung mucosal and widely used include: adjuvant-induced arthritis rat mod inflammatory response (see, e.g., Cohn et al., 1997, J. Exp. els, collagen-induced arthritis rat and mouse models and Med. 1861737-1747). antigen-induced arthritis rat, rabbit and hamster models, all 25 Animal models for autoimmune disorders can also be described in Crofford & Wilder, "Arthritis and Autoimmu used to assess the efficacy of a compound identified in nity in Animals', in Arthritis and Allied Conditions: A accordance with the invention. Animal models for autoim Textbook of Rheumatology, McCarty et al. (eds.), Chapter mune disorders such as type 1 diabetes, thyroid autoimmu 30 (Lee & Febiger, 1993), incorporated herein by reference nity, sytemic lupus eruthematosus, and glomerulonephritis in its entirety. 30 have been developed (see, e.g., Flanders et al., 1999, Auto The anti-inflammatory activity of a compound identified immunity 29:235-246; Krogh et al., 1999, Biochimie in accordance with the invention can be assessed using a 81:511-515; and Foster, 1999, Semin. Nephrol. 19:12-24). carrageenan-induced arthritis rat model. Carrageenan-in Animal models for viral infections can also be used to duced arthritis has also been used in rabbit, dog and pig in assess the efficacy of a compound identified in accordance studies of chronic arthritis or inflammation. Quantitative 35 with the invention. Animal models for viral infections such histomorphometric assessment is used to determine thera as EBV-associated diseases, gammaherpesviruses, infec peutic efficacy. The methods for using Such a carrageenan tious mononucleosis, simian immunodeficiency virus induced arthritis model is described in Hansra et al., 2000, (“SIV), Borna disease virus infection, hepatitis, varicella Inflammation, 24(2): 141-155. Also commonly used are virus infection, viral pneumonitis, Epstein-Barr virus patho Zymosan-induced inflammation animal models as known 40 genesis, feline immunodeficiency virus (“FIV), HTLV type and described in the art. 1 infection, human rotaviruses, and genital herpes have been The anti-inflammatory activity of a compound identified developed (see, e.g., Hayashi et al., 2002. Histol Histopathol in accordance with the invention can also be assessed by 17(4): 1293-310; Arico et al., 2002, J Interferon Cytokine measuring the inhibition of carrageenan-induced paw edema Res 22(11):1081-8: Flano et al., 2002, Immunol Res 25(3): in the rat, using a modification of the method described in 45 201-17; Sauermann, 2001, Curr Mol Med 1(4):515-22: Winter et al., 1962, Proc. Soc. Exp. Biol Med. 111, 544-547. Pletnikov et al., 2002, Front Biosci 7:d593-607; Engler et This assay has been used as a primary in vivo Screen for the al., 2001, Mol Immunol 38(6):457-65; White et al., 2001, anti-inflammatory activity of most NSAIDs, and is consid Brain Pathol 11(4):475-9: Davis & Matalon, 2001, News ered predictive of human efficacy. The anti-inflammatory Physiol Sci 16:185-90; Wang, 2001, Curr Top Microbiol activity of a compound identified in accordance with the 50 Immunol. 258:201-19; Phillips et al., 2000, J Psychophar invention is expressed as the percent inhibition of the macol. 14(3):244-50; Kazanji, 2000, AIDS Res Hum Ret increase in hind paw weight of the test group relative to the roviruses. 16(16):1741-6; Saifet al., 1996, Arch Virol Suppl. vehicle dosed control group. 12:153-61; and Hsiung et al., 1984, Rev Infect Dis. 6(1): In a specific embodiment of the invention where the 33-50). experimental animal model used is adjuvant-induced arthri 55 Animal models for bacterial infections can also be used to tis rat model, body weight can be measured relative to a assess the efficacy of a compound identified in accordance control group to determine the anti-inflammatory activity of with the invention. Animal models for bacterial infections a compound identified in accordance with the invention. Such as H. pylori-infection, genital mycoplasmosis, primary Alternatively, the efficacy of a compound identified in Sclerosing cholangitis, cholera, chronic lung infection with accordance with the invention can be assessed using assays 60 Pseudomonas aeruginosa, Legionnaires disease, gas that determine bone loss. Animal models such as ovariec troduodenal ulcer disease, bacterial meningitis, gastric Heli tomy-induced bone resorption mice, rat and rabbit models cobacter infection, pneumococcal otitis media, experimental are known in the art for obtaining dynamic parameters for allergic neuritis, leprous neuropathy, mycobacterial infec bone formation. Using methods such as those described by tion, endocarditis, Aeromonas-associated enteritis, Bacte Yositake et al. or Yamamoto et al., bone volume is measured 65 roides fragilis infection, syphilis, Streptococcal endocarditis, in vivo by microcomputed tomography analysis and bone acute hematogenous osteomyelitis, human scrub typhus, histomorphometry analysis (see, e.g., Yoshitake et al., 1999, toxic shock syndrome, anaerobic infections, Escherichia US 9,493,845 B2 75 76 coli infections, and Mycoplasma pneumoniae infections (3):127-37; Salkowski & Balish, 1990, Infect Immun. have been developed (see, e.g., Sugiyama et al., 2002, J 58(10):3300-6: Ahmad et al., 1986, Am J Kidney Dis. Gastroenterol. 37 Suppl 13:6-9: Brown et al., 2001, Am J 7(2):153-6: Alture-Werber E. Edberg S C, 1985, Myco Reprod Immunol. 46(3):232-41; Vierling, 2001, Best Pract pathologia. 89(2):69-73; Kane et al., 1981, Antimicrob Res Clin Gastroenterol. 15(4):591-610; Klose, 2000, Trends Agents Chemother. 20(5):595-9: Barbee et al., 1977, Am J Microbiol. 8(4): 189-91; Stotland et al., 2000, Pediatr Pul Pathol. 86(1):281-4; and Maestrone et al., 1973, Am J Vet monol. 30(5):413-24: Brieland et al., 2000, Immunophar Res. 34(6):833-6). macology 48(3):249-52: Lee, 2000, Baillieres Best Pract The toxicity and/or efficacy of a compound identified in Res Clin Gastroenterol. 14(1): 75-96; Koedel & Pfister, accordance with the invention can be determined by stan 1999, Infect Dis Clin North Am. 13(3):54.9-77; Nedrud, 10 dard pharmaceutical procedures in cell cultures or experi 1999, FEMS Immunol Med Microbiol. 24(2):243-50; Prell mental animals, e.g., for determining the LDso (the dose ner et al., 1999, Microb Drug Resist. 5(1):73-82; Vriesend lethal to 50% of the population) and the EDs (the dose orp, 1997, J Infect Dis. 176 Suppl2:S164-8: Shetty & Antia, therapeutically effective in 50% of the population). The dose 1996, Indian J Lepr. 68(1): 95-104; Balasubramanian et al., ratio between toxic and therapeutic effects is the therapeutic 1994, Immunobiology 191 (4-5):395-401; Carbon et al., 15 index and it can be expressed as the ratio LDso/EDso. A 1994, Int J Biomed Comput. 36(1-2):59-67: Haberberger et compound identified in accordance with the invention that al., 1991, Experientia. 47(5):426–9; Onderdonket al., 1990, exhibits large therapeutic indices is preferred. While a Rev Infect Dis. 12 Suppl 2:S169-77: Wicher & Wicher, compound identified in accordance with the invention that 1989, Crit Rev. Microbiol. 16(3):181-234; Scheld, 1987, J exhibits toxic side effects may be used, care should be taken Antimicrob Chemother. 20 Suppl A:71-85; Emslie & Nade, to design a delivery system that targets such agents to the 1986, Rev Infect Dis. 8(6):841-9; Ridgway et al., 1986, Lab site of affected tissue in order to minimize potential damage Anim Sci. 36(5):481-5; Quimby & Nguyen, 1985, Crit Rev to uninfected cells and, thereby, reduce side effects. Microbiol. 12(1):1-44: Onderdonk et al., 1979, Rev Infect The data obtained from the cell culture assays and animal Dis. 1(2):291-301; Smith, 1976, Ciba Found Symp. (42): studies can be used in formulating a range of dosage of a 45-72, and Taylor-Robinson, 1976, Infection. 4 (1 Suppl):4- 25 compound identified in accordance with the invention for 8). use in humans. The dosage of Such agents lies preferably Animal models for fungal infections can also be used to within a range of circulating concentrations that include the assess the efficacy of a compound identified in accordance EDs with little or no toxicity. The dosage may vary within with the invention. Animal models for fungal infections such this range depending upon the dosage form employed and as Candida infections, Zygomycosis, Candida mastitis, pro 30 the route of administration utilized. For any agent used in the gressive disseminated trichosporonosis with latent trichos method of the invention, the therapeutically effective dose poronemia, disseminated candidiasis, pulmonary paracoc can be estimated initially from cell culture assays. A dose cidioidomycosis, pulmonary aspergillosis, Pneumocystis may be formulated in animal models to achieve a circulating carinii pneumonia, cryptococcal meningitis, coccidioidal plasma concentration range that includes the ICs (i.e., the meningoencephalitis and cerebrospinal vasculitis, Aspergil 35 concentration of the compound that achieves a half-maximal lus niger infection, Fusarium keratitis, paranasal sinus inhibition of symptoms) as determined in cell culture. Such mycoses, Aspergillus fumigatus endocarditis, tibial dys information can be used to more accurately determine useful chondroplasia, Candida glabrata vaginitis, oropharyngeal doses in humans. Levels in plasma may be measured, for candidiasis, X-linked chronic granulomatous disease, tinea example, by high performance liquid chromatography. pedis, cutaneous candidiasis, mycotic placentitis, dissemi 40 5.7.3. Design of Congeners or Analogs nated trichoSporonosis, allergic bronchopulmonary aspergil The compounds which display the desired biological losis, mycotic keratitis, Cryptococcus neoformans infection, activity can be used as lead compounds for the development fungal peritonitis, Curvularia geniculata infection, staphy or design of congeners or analogs having useful pharmaco lococcal endophthalmitis, sporotrichosis, and dermatophy logical activity. For example, once a lead compound is tosis have been developed (see, e.g., Arendrup et al., 2002, 45 identified, molecular modeling techniques can be used to Infection 30(5):286-91; Kamei, 2001, Mycopathologia 152 design variants of the compound that can be more effective. (1):5-13: Guhad et al., 2000, FEMS Microbiol Lett. 192(1): Examples of molecular modeling systems are the CHARM 27-31; Yamagata et al., 2000, JClin Microbiol. 38(9):32606: and QUANTA programs (Polygen Corporation, Waltham, Andrutis et al., 2000, J. Clin Microbiol. 38(6):2317-23; Cock Mass.). CHARM performs the energy minimization and et al., 2000, Rev Inst Med Trop Sao Paulo 42(2):59-66: 50 molecular dynamics functions. QUANTA performs the con Shibuya et al., 1999, Microb Pathog. 27(3):123-31; Beers et struction, graphic modelling and analysis of molecular struc al., 1999, J. Lab Clin Med. 133(5):423-33; Najvar et al., ture. QUANTA allows interactive construction, modifica 1999, Antimicrob Agents Chemother. 43(2):413-4; Williams tion, visualization, and analysis of the behavior of molecules et al., 1988, J Infect Dis. 178(4): 1217-21; Yoshida, 1988, with each other. Kansenshogaku Zasshi. 1998 June; 72(6):621-30; Alexan 55 A number of articles review computer modeling of drugs drakis et al., 1998, Br J Ophthalmol. 82(3):306-11; interactive with specific proteins, such as Rotivinen et al., Chakrabarti et al., 1997, J Med Vet Mycol. 35(4):295-7: 1988, Acta Pharmaceutical Fennica 97:159-166; Ripka, Martin et al., 1997, Antimicrob Agents Chemother. 41(1): 1998, New Scientist 54–57; McKinally & Rossmann, 1989, 13-6; Chu et al., 1996, Avian Dis. 40(3):715-9: Fidel et al., Annu Rev. Pharmacol. Toxiciol. 29:111-122; Perry & 1996, J Infect Dis. 173(2):425-31; Cole et al., 1995, FEMS 60 Davies, OSAR: Quantitative Structure-Activity Relation Microbiol Lett. 15: 126(2):177-80; Pollocket al., 1995, Nat ships in Drug Design pp. 189-193 (Alan R. Liss, Inc. 1989); Genet. 9(2):202-9: Uchida et al., 1994, Jpn. J Antibiot. Lewis & Dean, 1989, Proc. R. Soc. Lond. 236:125-140 and 47(10): 1407-12: Maebashi et al., 1994, J Med Vet Mycol. 141-162; Askew et al., 1989, J. Am. Chem. Soc. 111:1082 32(5):349-59; Jensen & Schonheyder, 1993, J Exp Anim 1090. Other computer programs that screen and graphically Sci. 35(4): 155-60; Gokaslan & Anaissie, 1992, Infect 65 depict chemicals are available from companies such as Immun. 60(8):3339-44: Kurup et al., 1992, J Immunol. BioDesign, Inc. (Pasadena, Calif.), Allelix, Inc. (Missis 148(12):3783-8: Singh et al., 1990, Mycopathologia. 112 sauga, Ontario, Canada), and Hypercube, Inc. (Cambridge, US 9,493,845 B2 77 78 Ontario). Although these are primarily designed for appli Intraventricular injection may be facilitated by an intraven cation to drugs specific to particular proteins, they can be tricular catheter, for example, attached to a reservoir, such as adapted to design of drugs specific to any identified region. an Ommaya reservoir. The analogs and congeners can be tested for binding to the Pulmonary administration can also be employed, e.g., by target RNA using the above-described secondary screens for 5 use of an inhaler or nebulizer, and formulation with an biologic activity. Alternatively, lead compounds with little or aerosolizing agent, or via perfusion in a fluorocarbon or no biologic activity, as ascertained in the secondary screen, synthetic pulmonary Surfactant. In certain embodiments, the can also be used to design analogs and congeners of the compound and pharmaceutically acceptable salts thereof can compound that have biologic activity. be formulated as a suppository, with traditional binders and 10 vehicles such as triglycerides. 5.8. Use of Identified Compounds that Modulate Untrans In another embodiment, the compound and pharmaceuti lated Region-Dependent Gene Expression to Treat/Prevent cally acceptable salts thereof can be delivered in a vesicle, Disease in particular a liposome (see Langer, 1990, Science 249: Biologically active compounds identified using the meth 1527-1533; Treat et al., 1989, in Liposomes in the Therapy ods of the invention or a pharmaceutically acceptable salt 15 of Infectious Disease and Cancer, Lopez-Berestein and thereof can be administered to a patient, preferably a mam Fidler (eds.), Liss, New York, pp. 353–365; and Lopez mal, more preferably a human, Suffering from a disease or Berestein, ibid., pp. 317-327; see generally ibid.). disorder whose onset, progression, development and/or In yet another embodiment, the compound and pharma severity is associated with the expression of a target gene. ceutically acceptable salts thereof can be delivered in a Alternatively, biologically active compounds identified controlled release system (see, e.g., Goodson, 1984, in using the methods of the invention or a pharmaceutically Medical Applications of Controlled Release, supra, vol. 2, acceptable salt thereofthat are beneficial for the treatment of pp. 115-138). Other controlled-release systems discussed in a disease or disorder can be administered to a patient, the review by Langer, 1990, Science 249:1527-1533 may be preferably a mammal, more preferably a human, Suffering used. In one embodiment, a pump may be used (see Langer, from Such a disease or disorder. In a specific embodiment, a 25 supra: Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; compound or a pharmaceutically acceptable salt thereof is Buchwald et al., 1980, Surgery 88:507; Saudek et al., 1989, administered to a patient, preferably a mammal, more pref N. Engl. J. Med. 321:574). In another embodiment, poly erably a human, as a preventative measure against a disease meric materials can be used (see Medical Applications of or disorder associated with an RNA:host cell factor inter Controlled Release, Langer and Wise (eds.), 1974, CRC action in vivo. 30 Pres. Boca Raton, Fla.; Controlled Drug Bioavailability, When administered to a patient, the compound or a Drug Product Design and Performance, Smolen and Ball pharmaceutically acceptable salt thereof is preferably (eds.), 1984, Wiley, New York; Ranger & Peppas, 1983, J. Macromol. Sci. Rev. Macromol. Chem. 23:61; see also Levy administered as component of a composition that optionally et al., 1985, Science 228:190; During et al., 1989, Ann. comprises a pharmaceutically acceptable vehicle. The com 35 Neurol. 25:351; Howard et al., 1989, J. Neurosurg, 71:105). position can be administered orally, or by any other conve In yet another embodiment, a controlled-release system can nient route, for example, by infusion or bolus injection, by be placed in proximity of a target RNA of the compound or absorption through epithelial or mucocutaneous linings a pharmaceutically acceptable salt thereof, thus requiring (e.g., oral mucosa, rectal, and intestinal mucosa, etc.) and only a fraction of the systemic dose. may be administered together with another biologically 40 Compositions comprising the compound or a pharmaceu active agent. Administration can be systemic or local. Vari tically acceptable salt thereof (“compound compositions') ous delivery systems are known, e.g., encapsulation in can additionally comprise a suitable amount of a pharma liposomes, microparticles, microcapsules, capsules, etc., and ceutically acceptable vehicle so as to provide the form for can be used to administer the compound and pharmaceuti proper administration to the patient. cally acceptable salts thereof 45 In a specific embodiment, the term “pharmaceutically Methods of administration include but are not limited to acceptable” means approved by a regulatory agency of the intradermal, intramuscular, intraperitoneal, intravenous, Federal or a state government or listed in the U.S. Pharma Subcutaneous, intranasal, epidural, oral, Sublingual, intrana copeia or other generally recognized pharmacopeia for use sal, intracerebral, intravaginal, transdermal, rectally, by in animals, mammals, and more particularly in humans. The inhalation, or topically, particularly to the ears, nose, eyes, 50 term “vehicle' refers to a diluent, adjuvant, excipient, or or skin. The mode of administration is left to the discretion carrier with which a compound of the invention is admin of the practitioner. In most instances, administration will istered. Such pharmaceutical vehicles can be liquids, such as result in the release of the compound or a pharmaceutically water and oils, including those of petroleum, animal, Veg acceptable salt thereof into the bloodstream. etable or synthetic origin, such as peanut oil, Soybean oil, In specific embodiments, it may be desirable to administer 55 mineral oil, sesame oil and the like. The pharmaceutical the compound or a pharmaceutically acceptable salt thereof vehicles can be saline, gum acacia, gelatin, starch paste, talc, locally. This may be achieved, for example, and not by way keratin, colloidal silica, urea, and the like. In addition, of limitation, by local infusion during Surgery, topical appli auxiliary, stabilizing, thickening, lubricating and coloring cation, e.g., in conjunction with a wound dressing after agents may be used. When administered to a patient, the Surgery, by injection, by means of a catheter, by means of a 60 pharmaceutically acceptable vehicles are preferably sterile. Suppository, or by means of an implant, said implant being Water is a preferred vehicle when the compound of the of a porous, non-porous, or gelatinous material, including invention is administered intravenously. Saline solutions and membranes, such as Sialastic membranes, or fibers. aqueous dextrose and glycerol Solutions can also be In certain embodiments, it may be desirable to introduce employed as liquid vehicles, particularly for injectable solu the compound or a pharmaceutically acceptable salt thereof 65 tions. Suitable pharmaceutical vehicles also include excipi into the central nervous system by any Suitable route, ents such as starch, glucose, lactose, Sucrose, gelatin, malt, including intraventricular, intrathecal and epidural injection. rice, flour, chalk, silica gel, Sodium Stearate, glycerol monos US 9,493,845 B2 79 80 tearate, talc, sodium chloride, dried skim milk, glycerol, The amount of a compound or a pharmaceutically accept propylene, glycol, water, ethanol and the like. Compound able salt thereof that will be effective in the treatment of a compositions, if desired, can also contain minor amounts of particular disease will depend on the nature of the disease, wetting or emulsifying agents, or pH buffering agents. and can be determined by standard clinical techniques. In Compound compositions can take the form of Solutions, addition, in vitro or in vivo assays may optionally be Suspensions, emulsion, tablets, pills, pellets, capsules, cap employed to help identify optimal dosage ranges. The pre Sules containing liquids, powders, Sustained-release formu cise dose to be employed will also depend on the route of lations, Suppositories, emulsions, aerosols, sprays, Suspen administration, and the seriousness of the disease, and sions, or any other form Suitable for use. In one embodiment, should be decided according to the judgment of the practi 10 tioner and each patient's circumstances. However, Suitable the pharmaceutically acceptable vehicle is a capsule (see dosage ranges for oral administration are generally about e.g., U.S. Pat. No. 5,698,155). Other examples of suitable 0.001 milligram to about 500 milligrams of a compound or pharmaceutical vehicles are described in Remington's Phar a pharmaceutically acceptable salt thereof per kilogram maceutical Sciences, Alfonso R. Gennaro, ed., Mack Pub body weight per day. In specific preferred embodiments of lishing Co. Easton, Pa., 19th ed., 1995, pp. 1447 to 1676, 15 the invention, the oral dose is about 0.01 milligram to about incorporated herein by reference. 500 milligrams per kilogram body weight per day, about In a preferred embodiment, the compound or a pharma 0.01 milligram to about 250 milligram per kilogram body ceutically acceptable salt thereof is formulated in accor weight per day, about 0.01 milligram to about 100 milli dance with routine procedures as a pharmaceutical compo grams per kilogram body weight per day, more preferably sition adapted for oral administration to human beings. about 0.1 milligram to about 75 milligrams per kilogram Compositions for oral delivery may be in the form of tablets, body weight per day, more preferably about 0.5 milligram to lozenges, aqueous or oily Suspensions, granules, powders, 5 milligrams per kilogram body weight per day. The dosage emulsions, capsules, syrups, or elixirs, for example. Orally amounts described herein refer to total amounts adminis administered compositions may contain one or more agents, tered; that is, if more than one compound is administered, or for example, Sweetening agents such as fructose, aspartame 25 if a compound is administered with a therapeutic agent, then or saccharin; flavoring agents such as peppermint, oil of the preferred dosages correspond to the total amount admin wintergreen, or cherry; coloring agents; and preserving istered. Oral compositions preferably contain about 10% to agents, to provide a pharmaceutically palatable preparation. about 95% active ingredient by weight. Moreover, where in tablet or pill form, the compositions can Suitable dosage ranges for intravenous (i.v.) administra be coated to delay disintegration and absorption in the 30 tion are about 0.01 milligram to about 100 milligrams per gastrointestinal tract thereby providing a Sustained action kilogram body weight per day, about 0.1 milligram to about over an extended period of time. Selectively permeable 35 milligrams per kilogram body weight per day, and about membranes Surrounding an osmotically active driving com 1 milligram to about 10 milligrams per kilogram body pound are also suitable for orally administered composi weight per day. Suitable dosage ranges for intranasal admin tions. In these later platforms, fluid from the environment 35 istration are generally about 0.01 pg/kg body weight per day Surrounding the capsule is imbibed by the driving com to about 1 mg/kg body weight per day. Suppositories gen pound, which Swells to displace the agent or agent compo erally contain about 0.01 milligram to about 50 milligrams sition through an aperture. These delivery platforms can of a compound of the invention per kilogram body weight provide an essentially Zero order delivery profile as opposed per day and comprise active ingredient in the range of about to the spiked profiles of immediate release formulations. A 40 0.5% to about 10% by weight. time delay material Such as glycerol monostearate or glyc Recommended dosages for intradermal, intramuscular, erol Stearate may also be used. Oral compositions can intraperitoneal, Subcutaneous, epidural, Sublingual, intrac include standard vehicles Such as mannitol, lactose, starch, erebral, intravaginal, transdermal administration or admin magnesium Stearate, sodium saccharine, cellulose, magne istration by inhalation are in the range of about 0.001 sium carbonate, and the like. Such vehicles are preferably of 45 milligram to about 200 milligrams per kilogram of body pharmaceutical grade. Typically, compositions for intrave weight per day. Suitable doses for topical administration are nous administration comprise sterile isotonic aqueous buffer. in the range of about 0.001 milligram to about 1 milligram, Where necessary, the compositions may also include a depending on the area of administration. Effective doses solubilizing agent. may be extrapolated from dose-response curves derived In another embodiment, the compound or a pharmaceu 50 from in vitro or animal model test systems. Such animal tically acceptable salt thereof can be formulated for intra models and systems are well known in the art. venous administration. Compositions for intravenous The compound and pharmaceutically acceptable salts administration may optionally include a local anesthetic thereof are preferably assayed in vitro and in vivo, for the Such as lignocaine to lessen pain at the site of the injection. desired therapeutic or prophylactic activity, prior to use in Generally, the ingredients are Supplied either separately or 55 humans. For example, in vitro assays can be used to deter mixed together in unit dosage form, for example, as a dry mine whether it is preferable to administer the compound, a lyophilized powder or water-free concentrate in a hermeti pharmaceutically acceptable salt thereof, and/or another cally sealed container Such as an ampoule or Sachette therapeutic agent. Animal model systems can be used to indicating the quantity of active agent. Where the compound demonstrate safety and efficacy. or a pharmaceutically acceptable salt thereof is to be admin 60 5.9. Target Diseases or Disorders istered by infusion, it can be dispensed, for example, with an The present invention provides methods for preventing, infusion bottle containing sterile pharmaceutical grade water treating or ameliorating a disease or disorder or one or more or saline. Where the compound or a pharmaceutically symptoms thereof, said methods comprising administering acceptable salt thereof is administered by injection, an to a Subject in need thereof one or more compounds iden ampoule of sterile water for injection or saline can be 65 tified in accordance with the methods of the invention. In provided so that the ingredients may be mixed prior to one embodiment, the invention provides a method of pre administration. venting, treating or ameliorating a disease or disorder or one US 9,493,845 B2 81 82 or more symptoms thereof, said method comprising admin agents which are currently being used, have been used or are istering to a subject in need thereof a dose of a prophylac known to be useful in the prevention, treatment or amelio tically or therapeutically effective amount of one or more ration of one or more symptoms associated with a disease or compounds identified in accordance with the methods of the disorder. invention. In another embodiment, the invention provides a 5.9.1. Proliferative Disorders method of preventing, treating or ameliorating a disease or A compound identified in accordance with the methods of disorder or one or more symptoms thereof, said method the invention may be administered to a subject in need comprising administering to a subject in need thereof a dose thereof to prevent, treat or ameliorate a cancer or one or of a prophylactically or therapeutically effective amount of more symptoms thereof. A compound identified in accor one or more compounds identified in the assays described 10 dance with the methods of the invention may also be herein, said compounds increasing untranslated region-de administered in combination with one or more other thera pendent expression of a target gene whose expression useful pies (e.g., prophylactic or therapeutic agents) to a subject in in the prevention or treatment of said disease or disorder. In need thereof to prevent, treat or ameliorate a cancer or one another embodiment, the invention provides a method of or more symptoms thereof. Preferably, such therapies are preventing, treating or ameliorating a disease or disorder or 15 useful for the prevention or treatment of cancer. Examples of one or more symptoms thereof, said method comprising such therapies include, but are not limited to chemothera administering to a subject in need thereof a dose of a peutic agents (e.g., acivicin, anthramycin, bleomycin Sul prophylactically or therapeutically effective amount of one fate, carbetimer, carboplatin, cisplatin, cyclophosphamide, or more compounds identified in the assays described, said daunorubicin hydrochloride, docetaxel, doxorubicin, doxo compounds decreasing untranslated region-dependent rubicin hydrochloride, epipropidine, etoposide, etoposide expression of a target gene whose expression is associated phosphate, etoprine fluorouracil, gemcitabine, gemcitabine with the onset, progression, development and/or severity of hydrochloride, hydroxyurea, idarubicin hydrochloride, ifos said disease or disorder. In a specific embodiment, a com famide, ilmofosine, methotrexate, methotrexate Sodium, pound identified in accordance with the methods of the paclitaxel, trimetrexate, trimetrexate glucuronate, vinblas invention is not administered to prevent, treat, or ameliorate 25 tine Sulfate, Vincristine Sulfate, vindesine, vindesine Sulfate, a disease or disorder or one or more symptoms thereof, if and vinepidine Sulfate) and anti-angiogenic agents (e.g., Such compound has been used previously to prevent, treat or angiostatin (plasminogen fragment), antiangiogenic anti ameliorate said disease or disorder. thrombin III, angiozyme, combretastatin A-4, endostatin The invention also provides methods of preventing, treat (collagen XVIII fragment), and fibronectin fragment). In a ing or ameliorating a disease or disorder or one or more 30 specific embodiment, the invention provides a method of symptoms thereof, said methods comprising administering preventing, treating or ameliorating cancer or one or more to a subject in need thereof one or more of the compounds symptoms thereof, said method comprising administering to identified utilizing the screening methods described herein, a Subject in need thereof a dose of a prophylactically or and one or more other therapies (e.g., prophylactic or therapeutically effective amount of a compound identified in therapeutic agents). Preferably, such therapies (e.g., prophy 35 accordance with the methods of the invention. In another lactic or therapeutic agents) are currently being used, have embodiment, the invention provides a method of preventing, been used or are known to be useful in the prevention, treating or ameliorating cancer or one or more symptoms treatment or amelioration of one or more symptoms asso thereof, said method comprising administering to a subject ciated with said disease or disorder. The therapies (e.g., in need thereof a dose of a prophylactically or therapeuti prophylactic or therapeutic agents) of the combination thera 40 cally effective amount of a compound identified in accor pies of the invention can be administered sequentially or dance with the methods of the invention and a dose of a concurrently. In a specific embodiment, the combination prophylactically or therapeutically effective amount of one therapies of the invention comprise a compound of the or more other therapies (e.g., prophylactic or therapeutic invention and at least one other therapy (e.g., prophylactic or agents). therapeutic agent) which has a different mechanism of action 45 A compound identified in accordance with the methods of than said compound. The combination therapies of the the invention may be used as a first, second, third or fourth present invention improve the prophylactic or therapeutic line of therapy for the treatment of cancer. The invention effect of a compound of the invention by functioning provides methods for treating or ameliorating cancer or a together with the compound to have an additive or syner symptom thereof in a subject refractory to conventional gistic effect. The combination therapies of the present inven 50 therapies for Such a cancer, said methods comprising admin tion reduce the side effects associated with the therapies istering to said Subject a dose of a prophylactically or (e.g., prophylactic or therapeutic agents). therapeutically effective amount of a compound identified in The prophylactic or therapeutic agents of the combination accordance with the methods of the invention. A cancer may therapies can be administered to a Subject in the same be determined to be refractory to a therapy means when at pharmaceutical composition. Alternatively, the prophylactic 55 least some significant portion of the cancer cells are not or therapeutic agents of the combination therapies can be killed or their cell division arrested in response to the administered concurrently to a subject in separate pharma therapy. Such a determination can be made either in vivo or ceutical compositions. The prophylactic or therapeutic in vitro by any method known in the art for assaying the agents may be administered to a subject by the same or effectiveness of treatment on cancer cells, using the art different routes of administration. 60 accepted meanings of “refractory in Such a context. In a In a specific embodiment, a pharmaceutical composition specific embodiment, a cancer is refractory where the num comprising one or more compounds identified in a screening ber of cancer cells has not been significantly reduced, or has assay described herein is administered to a subject, prefer increased. ably a human, to prevent, treat or ameliorate a disease or The invention provides methods for treating or amelio disorder or a symptom thereof. In accordance with the 65 rating cancer or a symptom thereof in a subject refractory to invention, pharmaceutical compositions of the invention existing single agent therapies for Such a cancer, said meth may also comprise one or more prophylactic or therapeutic ods comprising administering to said subject a dose of a US 9,493,845 B2 83 84 prophylactically or therapeutically effective amount of a 1; tissue inhibitor of metalloprotease 2: tissue inhibitor of compound identified in accordance with the methods of the metalloprotease 4; transforming growth factor, beta-1: invention and a dose of a prophylactically or therapeutically tumor necrosis factor receptor Superfamily, member 5, effective amount of one or more other therapies (e.g., TNFRSF5; urokinase plasminogen activator; and v-myc prophylactic or therapeutic agents). The invention also pro myelocytomatosis viral oncogene homolog. vides methods for treating cancer by administering a com In a specific embodiment, a compound identified in the pound identified in accordance with the methods of the assays described herein to down-regulate untranslated invention in combination with any other therapy (e.g., region-dependent VEGF expression may be used to prevent, radiation therapy, chemotherapy or Surgery) to patients who treat or ameliorate a vascularized tumor or one or more have proven refractory to other therapies but are no longer 10 symptoms thereof. In another embodiment, a compound not on these therapies. The invention also provides methods for previously known to affect VEGF expression which was the treatment of a patient having cancer and immunosup identified in the assays described herein to down-regulate pressed by reason of having previously undergone other untranslated region-dependent VEGF may be used to pre cancer therapies. The invention also provides alternative vent, treat or ameliorate a vascularized tumor or one or more methods for the treatment of cancer where chemotherapy, 15 symptoms thereof. radiation therapy, hormonal therapy, and/or biological In another embodiment, a compound identified in the therapy/immunotherapy has proven or may prove too toxic, assays described herein to down-regulate untranslated i.e., results in unacceptable or unbearable side effects, for the region-dependent Survivin expression may be used to pre subject being treated. Further, the invention provides meth vent, treat or ameliorate cancer (in particular, cancer in ods for preventing the recurrence of cancer in patients that which Survivin is highly expressed) or one or more symp have been treated and have no disease activity by adminis toms thereof. In another embodiment, a compound not tering a compound identified in accordance with the meth previously known to affect survivin expression which was ods of the invention. identified in the assays described herein to down-regulate In this embodiment, target genes encoding proteins untranslated region-dependent Survivin may be used to include, but are not limited to, angiogenin; angiopoietin1; 25 prevent, treat or ameliorate cancer or one or more symptoms angiopoietin2; antigen CD82: aryl hydrocarbon receptor thereof. nuclear translocator; B cell lymphoma 2: beta-catenin, cad In another embodiment, a compound identified in the herin-1, CLCA homolog: connective tissue growth factor, assays described herein to down-regulate untranslated cysteine-rich 61; cyclin D1; cyclin-dependent kinase inhibi region-dependent Her-2 expression in breast cancer cells tor 2A, CDKN2 CDK4 inhibitor multiple tumor suppressor 30 may be used to prevent, treat or ameliorate breast cancer (in 1, SOR 1, MTS1TP16 p16(INK4) p16(INK4A) p14(ARF): particular, Her-2 positive breast cancer) or one or more cyclin-dependent kinase inhibitor 1A (p21, Cip1); dihydro symptoms thereof. In another embodiment, a compound not folate reductase; DNA methyltransferase; effector cell pro previously known to affect Her-2 expression which was tease receptor; EMMPRIN; epithelial growth factor recep identified in the assays described herein to down-regulate tor; fibroblast growth factor 2; fibroblast growth factor 1: 35 untranslated region-dependent Her-2 expression may be FMS-related tyrosine kinase 1: heparanase; hepsin; Her-2: used to prevent, treat or ameliorate breast cancers or one or histone acetyltransferase; histone deacetylase3; histone more symptoms thereof. deacetylase 1: Hu Antigen R, a member of the Elav (embry Cancers that can be treated by the methods encompassed onic lethal abnormal vision) family of RNA-binding pro by the invention include, but are not limited to, neoplasms, teins; hypoxia-inducible factor 1-alpha inhibitor; hypoxia 40 tumors, metastases, or any disease or disorder characterized inducible factor 1; insulin like growth factor 1 receptor, by uncontrolled cell growth. The cancer may be a primary or IGF-1R; insulin-like growth factor 1; insulin-like growth metastatic cancer. Specific examples of cancers that can be factor binding protein-2; interleukin 2; interleukin-8 precur treated by the methods encompassed by the invention sor (i1-8) (monocyte-derived neutrophilchemotactic factor) include, but are not limited to, cancer of the head, neck, eye, (mdnsf) (T-cell chemotactic factor) (neutrophil-activating 45 mouth, throat, esophagus, chest, bone, lung, colon, rectum, protein 1) (nap-1) (lymphocyte-derived neutrophil-activat stomach, prostate, breast, ovaries, kidney, liver, pancreas, ing factor) (lynap) (protein 3-10c) (neutrophil-activating and brain. Additional cancers include, but are not limited to, factor) (naf) (granulocyte chemotactic protein 1) (gSp-1); kit the following: leukemias Such as but not limited to, acute ligand, stem cell factor, large tumor Suppressor, leucine leukemia, acute lymphocytic leukemia, acute myelocytic amino peptidase-3; livin; major histocompatibility complex 50 leukemias Such as myeloblastic, promyelocytic, myelo class I chain-related gene B; major histocompatibility com monocytic, monocytic, erythroleukemia leukemias and plex class I chain-related gene A, matrix metalloproteinase myelodysplastic syndrome, chronic leukemias Such as but 9; matrix metalloproteinase 12; max interacting protein 1 not limited to, chronic myelocytic (granulocytic) leukemia, (mxi 1 protein); methyl-CpG-binding endonuclease; NF chronic lymphocytic leukemia, hairy cell leukemia; poly Kappa-B; oncoprotein MDM2; oncoprotein fos; P-glyco 55 cythemia Vera: lymphomas such as but not limited to Hodg protein-1 (PGY 1); placental growth factor, plasminogen kin's disease, non-Hodgkin’s disease; multiple myelomas activator inhibitor protein; platelet derived growth factor, Such as but not limited to Smoldering multiple myeloma, beta chain; pleiotrophin, progranulin; proliferating cell nonsecretory myeloma, osteosclerotic myeloma, plasma cell nuclear antigen; protein kinase B/Akt (PBK), v-akt murine leukemia, Solitary plasmacytoma and extramedullary plas thymoma viral oncogene homolog 1, oncogeneakt1 protein 60 macytoma; Waldenström's macroglobulinemia; monoclonal kinase b. pkb rac serine/threonine protein kinase; protein gammopathy of undetermined significance; benign mono tyrosine phosphatase, 4A, 3, PTP4A3: ras; retinoblastoma clonal gammopathy; heavy chain disease; bone and connec binding protein 1-like 1; ribonuclease/angiogenin inhibitor; tive tissue sarcomas Such as but not limited to bone sarcoma, soluble-type polypeptide FZD4S. Src, oncogen Src protoon osteosarcoma, chondrosarcoma, Ewing's sarcoma, malig cogene Src Src oncogene avian sarcoma, TEK tyrosine 65 nant giant cell tumor, fibrosarcoma of bone, chordoma, kinase; thrombopoietin (TPO); TIAM1: T-cell lymphoma periosteal sarcoma, Soft-tissue sarcomas, angiosarcoma (he invasion and metastasis 1; tissue inhibitor of metalloprotease mangiosarcoma), fibrosarcoma, Kaposi's sarcoma, leiomyo US 9,493,845 B2 85 86 sarcoma, liposarcoma, lymphangiosarcoma, neurilemmoma, dotheliosarcoma, mesothelioma, synovioma, hemangioblas rhabdomyosarcoma, synovial sarcoma; brain tumors such as toma, epithelial carcinoma, cystadenocarcinoma, broncho but not limited to, glioma, astrocytoma, brain stem glioma, genic carcinoma, Sweat gland carcinoma, Sebaceous gland ependymoma, oligodendroglioma, nonglial tumor, acoustic carcinoma, papillary carcinoma and papillary adenocarcino neurinoma, craniopharyngioma, medulloblastoma, menin mas (for a review of such disorders, see Fishman et al., 1985, gioma, pineocytoma, pineoblastoma, primary brain lym Medicine, 2d Ed., J.B. Lippincott Co., Philadelphia and phoma; breast cancer including but not limited to adenocar Murphy et al., 1997, Informed Decisions: The Complete cinoma, lobular (Small cell) carcinoma, intraductal Book of Cancer Diagnosis, Treatment, and Recovery, Viking carcinoma, medullary breast cancer, mucinous breast cancer, Penguin, Penguin Books U.S.A., Inc., United States of tubular breast cancer, papillary breast cancer, Paget’s dis 10 America). It is also contemplated that cancers caused by ease, and inflammatory breast cancer, adrenal cancer Such as aberrations in apoptosis can also be treated by the methods but not limited to pheochromocytom and adrenocortical and compositions of the invention. Such cancers may carcinoma; thyroid cancer Such as but not limited to papil include, but not be limited to, follicular lymphomas, carci lary or follicular thyroid cancer, medullary thyroid cancer nomas with p53 mutations, hormone dependent tumors of and anaplastic thyroid cancer, pancreatic cancer Such as but 15 the breast, prostate and ovary, and precancerous lesions such not limited to, insulinoma, gastrinoma, glucagonoma, as familial adenomatous polyposis, and myelodysplastic vipoma, Somatostatin-secreting tumor, and carcinoid or islet syndromes. cell tumor, pituitary cancers such as but limited to Cushings Anti-cancer therapies and their dosages, routes of admin disease, prolactin-secreting tumor, acromegaly, and diabetes istration and recommended usage are known in the art and insipius; eye cancers such as but not limited to ocular have been described in such literature as the Physician's melanoma Such as iris melanoma, choroidal melanoma, and Desk Reference (56' ed., 2002). cilliary body melanoma, and retinoblastoma; vaginal can 5.9.2. Inflammatory Disorders cers such as squamous cell carcinoma, adenocarcinoma, and A compound identified in accordance with the methods of melanoma; Vulvar cancer Such as squamous cell carcinoma, the invention may be administered to a subject in need melanoma, adenocarcinoma, basal cell carcinoma, sarcoma, 25 thereof to prevent, treat or ameliorate an inflammatory and Paget’s disease; cervical cancers such as but not limited disorder or one or more symptoms thereof. A compound to, squamous cell carcinoma, and adenocarcinoma, uterine identified in accordance with the methods of the invention cancers such as but not limited to endometrial carcinoma may also be administered in combination with one or more and uterine sarcoma; ovarian cancers such as but not limited other therapies (e.g., prophylactic or therapeutic agents) to a to, ovarian epithelial carcinoma, borderline tumor, germ cell 30 Subject in need thereof to prevent, treat or ameliorate an tumor, and stromal tumor, esophageal cancers such as but inflammatory disorder or one or more symptoms thereof. not limited to, squamous cancer, adenocarcinoma, adenoid Preferably, such therapies are useful for the prevention or cyctic carcinoma, mucoepidermoid carcinoma, treatment of an inflammatory disorder. Examples of Such adenosquamous carcinoma, Sarcoma, melanoma, plasmacy therapies include, but are not limited to, immunomodulatory toma, Verrucous carcinoma, and oat cell (Small cell) carci 35 agents (e.g., methothrexate, leflunomide, cyclophosph noma; stomach cancers such as but not limited to, adeno amide, cytoxan, Immuran, cyclosporine A, minocycline, carcinoma, fungating (polypoid), ulcerating, Superficial azathioprine, and antibiotics (e.g., FK506 (tacrolimus)), spreading, diffusely spreading, malignant lymphoma, lipos anti-angiogenic agents (e.g., endostatin, angiostatin, apomi arcoma, fibrosarcoma, and carcinosarcoma; colon cancers; gren, anti-angiogenic antithrombin III, the 29 kDa N-termi rectal cancers; liver cancers such as but not limited to 40 nal and a 40 kDa C-terminal proteolytic fragments of hepatocellular carcinoma and hepatoblastoma, gallbladder fibronectin, the anti-angiogenic factor designated 13.40, the cancers such as adenocarcinoma; cholangiocarcinomas Such anti-angiogenic 22 amino acid peptide fragment of throm as but not limited to pappillary, nodular, and diffuse; lung bospondin I, the anti-angiogenic 20 amino acid peptide cancers such as non-Small cell lung cancer, squamous cell fragment of SPARC, RGD and NGR containing peptides, carcinoma (epidermoid carcinoma), adenocarcinoma, large 45 the Small anti-angiogenic peptides of laminin, fibronectin, cell carcinoma and Small-cell lung cancer, testicular cancers procollagen and EGF, acid fibroblast growth factor Such as but not limited to germinal tumor, seminoma, (“aFGF) antagonists, basic fibroblast growth factor anaplastic, classic (typical), spermatocytic, nonseminoma, (“bFGF) antagonists, vascular endothelial growth factor embryonal carcinoma, teratoma carcinoma, choriocarci (“VEGF) antagonists, and VEGF receptor (“VEGFR) noma (yolk-sac tumor), prostate cancers such as but not 50 antagonists (e.g., anti-VEGFR antibodies), TNF-C. antago limited to, adenocarcinoma, leiomyosarcoma, and rhab nists (e.g., infliximab (REMICADETM: Centacor), D2E7 domyosarcoma; penal cancers; oral cancers such as but not (Abbott Laboratories/Knoll Pharmaceuticals Co., Mt. Olive, limited to squamous cell carcinoma, basal cancers; salivary N.J.), CDP571 which is also known as HUMICADETM and gland cancers such as but not limited to adenocarcinoma, CDP-870 (both of Celltech/Pharmacia, Slough, U.K.), and mucoepidermoid carcinoma, and adenoidcystic carcinoma; 55 TN3-19.12 (Williams et al., 1994, Proc. Natl. Acad. Sci. pharynx cancers such as but not limited to squamous cell USA '91: 2762-2766: Thorbecke et al., 1992, Proc. Natl. cancer, and Verrucous; skin cancers such as but not limited Acad. Sci. USA 89:7375-7379), non-steroidal anti-inflam to, basal cell carcinoma, squamous cell carcinoma and matory drugs (NSAIDs) (e.g., aspirin, ibuprofen, celecoxib melanoma, Superficial spreading melanoma, nodular mela (CELEBREXTM), diclofenac (VOLTARENTM), etodolac noma, lentigo malignant melanoma, acral lentiginous mela 60 (LODINETM), fenoprofen (NALFONTM), indomethacin (IN noma, kidney cancers such as but not limited to renal cell DOCINTM), ketoralac (TORADOLTM), oxaprozin (DAY cancer, adenocarcinoma, hypernephroma, fibrosarcoma, PROTM), nabumentone (RELAFENTM), Sulindac transitional cell cancer (renal pelvis and/or uterer); Wilms (CLINORILTM), tolmentin (TOLECTINTM), rofecoxib (VI tumor, bladder cancers such as but not limited to transitional OXXTM), naproxen (ALEVETM, NAPROSYNTM), ketopro cell carcinoma, squamous cell cancer, adenocarcinoma, car 65 fen (ACTRONTM) and nabumetone (RELAFENTM)), steroi cinosarcoma. In addition, cancers include myxosarcoma, dal anti-inflammatory drugs (e.g., glucocorticoids, osteogenic sarcoma, endotheliosarcoma, lymphangioen dexamethasone (DECADRONTM), cortisone, hydrocorti US 9,493,845 B2 87 88 sone, prednisone (DELTASONETM), prednisolone, triamci phage migration inhibitory factor; monocyte chemotactic nolone, aZulfidine, and eicosanoids such as prostaglandins, protein 1: NF-Kappa-B; nuclear factor of kappa light poly thromboxanes, and leukotrienes), beta-agonists, antich peptide gene enhancer in B-cells 1 (p105, NF-kappaB); olingeric agents, and methylxanthines. In a specific embodi osteopontin: p38 MAP Kinase; placental growth factor; ment, the invention provides a method of preventing, treat platelet derived growth factor, beta chain; pleiotrophin; ing or ameliorating an inflammatory disorder or one or more prolactin; receptor for interleukin-4; signal transducer and symptoms thereof, said method comprising administering to activator of transcription 6: TEK tyrosine kinase; and tumor a Subject in need thereof a dose of a prophylactically or necrosis factor alpha. therapeutically effective amount of a compound identified in Inflammatory disorders that can be treated by the methods accordance with the methods of the invention. In another 10 encompassed by the invention include, but are not limited to, embodiment, the invention provides a method of preventing, asthma, encephilitis, inflammatory bowel disease, chronic treating or ameliorating an inflammatory disorder or one or obstructive pulmonary disease (COPD), allergic disorders, more symptoms thereof, said method comprising adminis septic shock, pulmonary fibrosis, undifferentitated spondy tering to a Subject in need thereof a dose of a prophylacti loarthropathy, undifferentiated arthropathy, arthritis, inflam cally or therapeutically effective amount of a compound 15 matory osteolysis, and chronic inflammation resulting from identified in accordance with the methods of the invention chronic viral or bacteria infections. Some autoimmune dis and a dose of a prophylactically or therapeutically effective orders are associated with an inflammatory condition, and amount of one or more other therapies (e.g., prophylactic or thus, can be characterized as either or both an autoimmune therapeutic agents). disorder and/or an inflammatory disorder. The invention provides methods for treating or amelio Anti-inflammatory therapies and their dosages, routes of rating an inflammatory disorder or a syptom thereof in a administration and recommended usage are known in the art Subject refractory to conventional therapies (e.g., methotrex and have been described in such literature as the Physician's ate and a TNF-C. antagonist (e.g., REMICADETM or Desk Reference (56' ed., 2002). ENBRELTM)) for such an inflammatory disorder, said meth 5.9.3. Autoimmune Disorders ods comprising administering to said subject a dose of a 25 A compound identified in accordance with the methods of prophylactically or therapeutically effective amount of a the invention may be administered to a subject in need compound identified in accordance with the methods of the thereof to prevent, treat or ameliorate an autoimmune dis invention. The invention also provides methods for treating order or one or more symptoms thereof. A compound or ameliorating an inflammatory disorder or a symptom identified in accordance with the methods of the invention thereof in a Subject refractory to existing single agent 30 may also be administered in combination with one or more therapies for Such an inflammatory disorder, said methods other therapies (e.g., prophylactic or therapeutic agents) to a comprising administering to said subject a dose of a pro subject in need thereof to prevent, treat or ameliorate an phylactically or therapeutically effective amount of a com autoimmune disorder or one or more symptoms thereof. pound identified in accordance with the methods of the Preferably, such therapies are useful for the prevention or invention and a dose of a prophylactically or therapeutically 35 treatment of an autoimmune disorder. In a specific embodi effective amount of one or more other therapies (e.g., ment, the invention provides a method of preventing, treat prophylactic or therapeutic agents). The invention also pro ing or ameliorating an autoimmune disorder or one or more vides methods for treating an inflammatory disorder by symptoms thereof, said method comprising administering to administering a compound identified in accordance with the a Subject in need thereof a dose of a prophylactically or methods of the invention in combination with any other 40 therapeutically effective amount of a compound identified in therapy to patients who have proven refractory to other accordance with the methods of the invention. In another therapies but are no longer on these therapies. The invention embodiment, the invention provides a method of preventing, also provides alternative methods for the treatment of an treating or ameliorating an autoimmune disorder or one or inflammatory disorder where another therapy has proven or more symptoms thereof, said method comprising adminis may prove too toxic, i.e., results in unacceptable or unbear 45 tering to a subject in need thereof a dose of a prophylacti able side effects, for the subject being treated. Further, the cally or therapeutically effective amount of a compound invention provides methods for preventing the recurrence of identified in accordance with the methods of the invention an inflammatory disorder in patients that have been treated and a dose of a prophylactically or therapeutically effective and have no disease activity by administering a compound amount of one or more other therapies (e.g., prophylactic or identified in accordance with the methods of the invention. 50 therapeutic agents). In this embodiment, target genes encoding proteins The invention provides methods for treating or amelio include, but are not limited to, a disintegrin and metallo rating an autoimmune disorder or a symptom thereof in a proteinase domain 33; angiopoietin1; angiopoietin2; beta Subject refractory to conventional therapies for Such an catenin; chemokine (C-C) receptor; eotaxin; fibroblast autoimmune disorder, said methods comprising administer growth factor 1; fibroblast growth factor 2: FMS-related 55 ing to said Subject a dose of a prophylactically or therapeu tyrosine kinase 1: granulocyte-macrophage colony-stimu tically effective amount of a compound identified in accor lating factor precursor (GM-CSF) (colony-stimulating fac dance with the methods of the invention. The invention also tor) (CSF) (sargramostim); GRO2 oncogene; macrophage provides methods for treating or ameliorating an autoim inflammatory protein-2-alpha precursor (mip2-alpha) mune disorder or a symptom thereof in a Subject refractory (growth regulated protein beta) (gro-beta); Hu antigen R; a 60 to existing single agent therapies for Such an autoimmune member of the Elav (Embryonic lethal abnormal vision) disorder, said methods comprising administering to said family of RNA-binding proteins; insulin-like growth factor Subject a dose of a prophylactically or therapeutically effec 1; interferon inducible protein; interferon 1 beta; interferon tive amount of a compound identified in accordance with the alpha; interleukin 17F: interleukin 1-beta; interleukin 6: methods of the invention and a dose of a prophylactically or interleukin 10; interleukin 18; interleukin 13; interleukin 4; 65 therapeutically effective amount of one or more other thera interleukin-9; leukemia Inhibitory factor Receptor; leukemia pies (e.g., prophylactic or therapeutic agents). The invention inhibitory factor; linker for Activation of T cells; macro also provides methods for treating an autoimmune disorder US 9,493,845 B2 89 90 by administering a compound identified in accordance with nomenon, Reiter's syndrome, Rheumatoid arthritis, the methods of the invention in combination with any other sarcoidosis, Scleroderma, Sjögren's syndrome, stiff-man therapy to patients who have proven refractory to other syndrome, systemic lupus erythematosus, lupus erythema therapies but are no longer on these therapies. The invention tosus, takayasu arteritis, temporal arteristis/giant cell arteri also provides alternative methods for the treatment of an tis, ulcerative colitis, uveitis, vasculitides such as dermatitis autoimmune disorder where another therapy has proven or herpetiformis vasculitis, vitiligo, and Wegener's granuloma may prove too toxic, i.e., results in unacceptable or unbear tosis. able side effects, for the subject being treated. Further, the Autoimmune therapies and their dosages, routes of invention provides methods for preventing the recurrence of administration and recommended usage are known in the art an autoimmune disorder in patients that have been treated 10 and have been described in such literature as the Physicians and have no disease activity by administering a compound Desk Reference (56" ed., 2002). identified in accordance with the methods of the invention. 5.9.4. Genetic Disorders In this embodiment, target genes encoding proteins A compound identified in accordance with the methods of include, but are not limited to, adiponectin; alpha-glucosi the invention may be administered to a subject in need dase; forkhead box C2; G-CSF, colony stimulating factor 3 15 thereof to prevent, treat or ameliorate a genetic disorder or (granulocyte); galanin; gastric inhibitory polypeptide; ghre one or more symptoms thereof. A compound identified in lin; glucagon receptor; glucagon-like peptide-1, GLP-1; accordance with the methods of may also be administered in glucokinase; glycogen synthase kinase-3B; glycogen Syn combination with one or more other therapies (e.g., prophy thase kinase-3A.; human phosphotryosyl-protein phos lactic or therapeutic agents) to a subject in need thereof to phatase (PTP-1B); IkB kinase; inositol pholyphosphate prevent, treat or ameliorate a genetic disorder or one or more phosphatase-like 1; insulin receptor; interleukin 10; leptin; symptoms thereof. Preferably, such therapies are useful for neural cell adhesion molecule 1: neuron growth associated the prevention or treatment of a genetic disorder. In a protein 43; peroxisome proliferator-activated receptor specific embodiment, the invention provides a method of gamma; phas; EIF4BP: protein kinase C, gamma; resistin; preventing, treating or ameliorating a genetic disorder or one and uncoupling protein 2. 25 or more symptoms thereof, said method comprising admin In autoimmune disorders, the immune system triggers an istering to a subject in need thereof a dose of a prophylac immune response when there are no foreign Substances to tically or therapeutically effective amount of a compound fight and the body's normally protective immune system identified in accordance with the methods of the invention. causes damage to its own tissues by mistakenly attacking In another embodiment, the invention provides a method of self. There are many different autoimmune disorders which 30 preventing, treating or ameliorating a genetic disorder or one affect the body in different ways. For example, the brain is or more symptoms thereof, said method comprising admin affected in individuals with multiple sclerosis, the gut is istering to a subject in need thereof a dose of a prophylac affected in individuals with Crohn's disease, and the syn tically or therapeutically effective amount of a compound ovium, bone and cartilage of various joints are affected in identified in accordance with the methods of the invention individuals with rheumatoid arthritis. As autoimmune dis 35 and a dose of a prophylactically or therapeutically effective orders progress destruction of one or more types of body amount of one or more other therapies (e.g., prophylactic or tissues, abnormal growth of an organ, or changes in organ therapeutic agents). function may result. The autoimmune disorder may affect In this embodiment, target genes encoding proteins only one organ or tissue type or may affect multiple organs include, but are not limited to, NAD(P)-dependent steroid and tissues. Organs and tissues commonly affected by auto 40 dehydrogenase (EC 1.1.1.-h105e3 protein); peroxisome bio immune disorders include red blood cells, blood vessels, genesis factor 1 (peroxin-1) (peroxisome biogenesis disor connective tissues, endocrine glands (e.g., the thyroid or der protein 1); and utrophin. pancreas), muscles, joints, and skin. Examples of autoim Examples of genetic disorders which can be prevented or mune disorders that can be prevented, treated or ameliorated treated in accordance with the invention include, but are not by the methods of the invention include, but are not limited 45 limited to, alopecia areata, alpha-1-antitrypsin deficiency, to, alopecia areata, ankylosing spondylitis, antiphospholipid ataxia, Fragile X Syndrome, Gaucher disease, Hemophilia, syndrome, autoimmune Addison's disease, autoimmune dis Huntington disease, Niemann-Pick disease, Retinitis Pig eases of the adrenal gland, autoimmune hemolytic anemia, mentosa, SCID (Severe Combined Immunodeficiency), autoimmune hepatitis, autoimmune oophoritis and orchitis, Thalassemia, and Xeroderma Pigmentosum. autoimmune thrombocytopenia, Behcet’s disease, bullous 50 5.9.5. Viral Infections pemphigoid, cardiomyopathy, celiac sprue-dermatitis, A compound identified in accordance with the methods of chronic fatigue immune dysfunction syndrome (CFIDS), the invention may be administered to a subject in need chronic inflammatory demyelinating polyneuropathy, thereof to prevent, treat or ameliorate a viral infection or one Churg-Strauss syndrome, cicatrical pemphigoid, CREST or more conditions or symptoms associated therewith. A syndrome, cold agglutinin disease, Crohn's disease, discoid 55 compound identified in accordance with the methods of the lupus, essential mixed cryoglobulinemia, fibromyalgia-fi invention may also be administered in combination with one bromyositis, glomerulonephritis, Graves disease, Guillain or more other therapies (e.g., prophylactic or therapeutic Barre, Hashimoto's thyroiditis, idiopathic pulmonary fibro agents) to a subject in need thereof to prevent, treat or sis, idiopathic thrombocytopenia purpura (ITP), IgA ameliorate a viral infection or one or more conditions or neuropathy, juvenile arthritis, lichen planus, lupus erthema 60 symptoms associated therewith. Preferably, such therapies tosus, Méniere's disease, mixed connective tissue disease, are useful for the prevention or treatment of a viral infection. multiple Sclerosis, type 1 or immune-mediated diabetes Examples of such therapies include, but are not limited to, mellitus, myasthenia gravis, pemphigus Vulgaris, pernicious amantadine, ribavirin, rimantadine, acyclovir, famciclovir, anemia, polyarteritis nodosa, polychrondritis, polyglandular foscarnet, ganciclovir, trifluridine, Vidarabine, didanosine, syndromes, polymyalgia rheumatica, polymyositis and der 65 stavudine, Zalciltabine, Zidovudine, interferon, an antibiotic, matomyositis, primary agammaglobulinemia, primary bil amantadine, ribavirin, rimantadine, acyclovir, famciclovir, iary cirrhosis, psoriasis, psoriatic arthritis, Raynauld's phe foscarnet, ganciclovir, trifluridine, Vidarabine, didanosine, US 9,493,845 B2 91 92 stavudine, Zalciltabine, Zidovudine, interferon, an antibiotic, (protein 3-10c) (neutrophil-activating factor) (naf) (granu PRO542 (Progenics) which is a CD4 fusion antibody useful locyte chemotactic protein 1) (gsp-1)-activating factor) (naf) for the treatment of HIV infection, Ostavir (Protein Design (granulocyte chemotactic protein 1) (gSp-1); interleukin 2: Labs, Inc., CA) which is a human antibody useful for the interleukin-12 beta chain precursor (i1-12b) (cytotoxic lym treatment of hepatitis B virus, and Protovir (Protein Design phocyte maturation factor 40 kda subunit) (climf p40) (nk Labs, Inc., CA) which is a humanized IgG1 antibody useful cell stimulatory factor chain. 2) (nkSf2): natural resistance for the treatment of cytomegalovirus (CMV). In a specific associated macrophage protein 1 (nramp 1); p300/CBP embodiment, the invention provides a method of preventing, associated factor (PCAF); poly(rC) binding protein 2; and treating or ameliorating a viral infection or one or more virion infectivity factor. symptoms thereof, said method comprising administering to 10 Any type of viral infection can be prevented, treated or a Subject in need thereof a dose of a prophylactically or ameliorated in accordance with the methods of invention. therapeutically effective amount of a compound identified in Examples of viruses which cause viral infections include, accordance with the methods of the invention. In another but not limited to, retroviruses (e.g., human T-cell lympho embodiment, the invention provides a method of preventing, trophic virus (HTLV) types I and II and human immunode treating or ameliorating a viral infection or one or more 15 ficiency virus (HIV)), herpes viruses (e.g., herpes simplex symptoms thereof, said method comprising administering to virus (HSV) types I and II, Epstein-Barr virus, HHV6 a Subject in need thereof a dose of a prophylactically or HHV8, and cytomegalovirus), arenavirues (e.g., lassa fever therapeutically effective amount of a compound identified in virus), paramyxoviruses (e.g., morbillivirus virus, human accordance with the methods of the invention and a dose of respiratory syncytial virus, mumps, and pneumovirus), a prophylactically or therapeutically effective amount of one adenoviruses, bunyaviruses (e.g., hantavirus), cornaviruses, or more other therapies (e.g., prophylactic or therapeutic filoviruses (e.g., Ebola virus), flaviviruses (e.g., hepatitis C agents). virus (HCV), yellow fever virus, and Japanese encephalitis The invention provides methods for treating or amelio virus), hepadnaviruses (e.g., hepatitis B viruses (HBV)), rating a viral infection or a symptom thereof in a subject orthomyoviruses (e.g., influenza viruses A, B and C), refractory to conventional therapies for such a viral infec 25 papovaviruses (e.g., papillomavirues), picornaviruses (e.g., tion, said methods comprising administering to said subject rhinoviruses, enteroviruses and hepatitis A viruses), poxvi a dose of a prophylactically or therapeutically effective ruses, reoviruses (e.g., rotavirues), togaviruses (e.g., rubella amount of a compound identified in accordance with the virus), rhabdoviruses (e.g., rabies virus). methods of the invention. The invention also provides Viral infection therapies and their dosages, routes of methods for treating or ameliorating a viral infection or a 30 administration and recommended usage are known in the art symptom thereof in a subject refractory to existing single and have been described in such literature as the Physicians agent therapies for such a viral infection, said methods Desk Reference (56" ed., 2002). comprising administering to said Subject a dose of a pro 5.9.6. Fungal Infections phylactically or therapeutically effective amount of a com A compound identified in accordance with the methods of pound identified in accordance with the methods of the 35 the invention may be administered to a subject in need invention and a dose of a prophylactically or therapeutically thereof to prevent, treat or ameliorate a fungal infection or effective amount of one or more other therapies (e.g., one or more conditions or symptoms associated therewith. A prophylactic or therapeutic agents). The invention also pro compound identified in accordance with the methods of the vides methods for treating a viral infection by administering invention may also be administered in combination with one a compound identified in accordance with the methods of the 40 or more other therapies (e.g., prophylactic or therapeutic invention in combination with any other therapy to patients agents) to a subject in need thereof to prevent, treat or who have proven refractory to other therapiess but are no ameliorate a fungal infection or one or more conditions or longer on these therapies. The invention also provides symptoms associated therewith. Preferably, such therapies alternative methods for the treatment of a viral infection are useful for the prevention or treatment of a fungal where another therapy has proven or may prove too toxic, 45 infection. Examples of Such therapies include, but are not i.e., results in unacceptable or unbearable side effects, for the limited to, amphotericin B or analogs or derivatives thereof subject being treated. Further, the invention provides meth (including 14(S)-hydroxyamphotericin B methyl ester, the ods for preventing the recurrence of a viral infection in hydrazide of amphotericin B with 1-amino-4-methylpipera patients that have been treated and have no disease activity zine, and other derivatives) or other polyene macrollide by administering a compound identified in accordance with 50 antibiotics (including, e.g., nystatin, candicidin, pimaricin the methods of the invention. and natamycin), flucytosine; flucytosine; griseofulvin; echi In this embodiment, target genes encoding proteins nocandins or aureobasidins, including naturally occurring include, but are not limited to, C1q complement receptor and semi-synthetic analogs; dihydrobenzoanapthacenequi gC1qR; chemokine (C-X3-C) receptor 1; complement nones; nucleoside peptide antifungals including the polyox decay-accelerating factor Precursor Synonym CD55 anti 55 ins and nikkomycins; allylamines such as naftifine and other gen; cyclinT1: desmoglein 1; hepatitis. A virus cellular squalene epoxidease inhibitors; azoles, imidazoles and tri receptor 1-havcr-1; hepatitis B virus X interacting protein azoles such as, e.g., clotrimazole, miconazole, ketoconazole, XIP; HIV Tat Specific Factor 1; human interferon gamma; econazole, butoconazole, oxiconazole, terconazole, itracon human damage specific DNA binding protein-DDB1. INI1/ azole or fluconazole and the like; rapamycin and rapalogs hSNF5; interferon alpha-16 precursor (interferon alpha-wa); 60 (non-immunosuppressive derivatives of rapamycin); interferon alpha-5 precursor (interferon alpha-g) (leif g) cyclosporin A; FK506; terbinafine; and natural compounds (interferon alpha-61). human leukocyte (alpha) interferon; found in goldenseal root powder, ipe roXo powder, poke root interferon alpha-1/13 precursor (interferon alpha-d) (leif d); powder, lavender oil, and tea tree oil. In a specific embodi interferon-beta 1; interleukin 8 precursor (i1-8) (monocyte ment, the invention provides a method of preventing, treat derived neutrophilchemotactic factor) (mdnsf) (T-cell 65 ing or ameliorating a fungal infection or one or more chemotactic factor) (Neutrophil-activating protein 1) (nap symptoms thereof, said method comprising administering to 1) (lymphocyte-derived neutrophil-activating factor) (lynap) a Subject in need thereof a dose of a prophylactically or US 9,493,845 B2 93 94 therapeutically effective amount of a compound identified in krusei, Candida parapsilosis, Candida pseudotropicalis, accordance with the methods of the invention. In another Candida quillermondii, Candida rugosa, Candida Stellatoi embodiment, the invention provides a method of preventing, dea, and Candida tropicalis), Coccidioides immitis, Conid treating or ameliorating a fungal infection or one or more iobolus species, Cryptococcus neoforms, Cunninghamella symptoms thereof, said method comprising administering to species, dermatophytes. Histoplasma capsulatum, a Subject in need thereof a dose of a prophylactically or Microsporum gypseum, Mucor pusillus, Paracoccidioides therapeutically effective amount of a compound identified in brasiliensis, Pseudallescheria boydii, Rhinosporidium see accordance with the methods of the invention and a dose of beri, Pneumocystis carinii, Rhizopus species (e.g., Rhizopus a prophylactically or therapeutically effective amount of one arrhizus, Rhizopus Oryzae, and Rhizopus microsporus), Sac or more other therapies (e.g., prophylactic or therapeutic 10 charomyces species, Sporothrix schenckii, Zygomycetes, and agents). classes such as Zygomycetes, Ascomycetes, the Basidiomy The invention provides methods for treating or amelio cetes, Deuteromycetes, and Oomycetes. rating a fungal infection or a symptom thereof in a subject Fungal infection therapies and their dosages, routes of refractory to conventional therapies for Such a fungal infec administration and recommended usage are known in the art tion, said methods comprising administering to said subject 15 and have been described in such literature as the Physicians a dose of a prophylactically or therapeutically effective Desk Reference (56 ed., 2002). amount of a compound identified in accordance with the 5.9.7. Bacterial Infections methods of the invention. The invention also provides A compound identified in accordance with the methods of methods for treating or ameliorating a fungal infection or a the invention may be administered to a subject in need symptom thereof in a subject refractory to existing single thereof to prevent, treat or ameliorate a bacterial infection or agent therapies for Such a fungal infection, said methods one or more conditions or symptoms thereof. A compound comprising administering to said Subject a dose of a pro identified in accordance with the methods of the invention phylactically or therapeutically effective amount of a com may also be administered in combination with one or more pound identified in accordance with the methods of the other therapies (e.g., prophylactic or therapeutic agents) to a invention and a dose of a prophylactically or therapeutically 25 subject in need thereof to prevent, treat or ameliorate a effective amount of one or more therapies (e.g., prophylactic bacterial infection or one or more conditions or symptoms or therapeutic agents). The invention also provides methods thereof. Preferably, such therapies are useful for the preven for treating a fungal infection by administering a compound tion or treatment of a bacterial infection. Examples of such identified in accordance with the methods of the invention in therapies include, but are not limited to, amoxycillin, bac combination with any other therapy to patients who have 30 teriophages, chloramphenicol, chlorhexidine, co-trimox proven refractory to other therapies but are no longer on azole, fluoroquinolones (e.g., ciprofloxacin and ofloxacin), these therapies. The invention also provides alternative isoniazid, macrollides, oxazolidinones, penicillin, quinolo methods for the treatment of a fungal infection where nes, rifampicin, rifamycins, streptomycin, Sulfonamides, another therapy has proven or may prove too toxic, i.e., and tetracyclines. In a specific embodiment, the invention results in unacceptable or unbearable side effects, for the 35 provides a method of preventing, treating or ameliorating a subject being treated. Further, the invention provides meth bacterial infection or one or more symptoms thereof, said ods for preventing the recurrence of a fungal infection in method comprising administering to a Subject in need patients that have been treated and have no disease activity thereof a dose of a prophylactically or therapeutically effec by administering a compound identified in accordance with tive amount of a compound identified in accordance with the the methods of the invention. 40 methods of the invention. In another embodiment, the inven In this embodiment, target genes encoding proteins tion provides a method of preventing, treating or ameliorat include, but are not limited to, complement decay-acceler ing a bacterial infection or one or more symptoms thereof, ating factor precursor synonym CD55 antigen; desmoglein said method comprising administering to a subject in need 1; human interferon gamma; interferon alpha-16 precursor thereof a dose of a prophylactically or therapeutically effec (interferon alpha-wa); interferon alpha-1/13 precursor (in 45 tive amount of a compound identified in accordance with the terferon alpha-d) (leifd); interferon alpha-5 precursor (inter methods of the invention and a dose of a prophylactically or feron alpha-g) (leif g) (interferon alpha-61). human leuko therapeutically effective amount of one or more other thera cyte (alpha) interferon; interferon-beta 1; interleukin 2: pies (e.g., prophylactic or therapeutic agents). interleukin-12 beta chain precursor (i1-12b) (cytotoxic lym The invention provides methods for treating or amelio phocyte maturation factor 40 kda subunit) (climf p40) (nk 50 rating a bacterial infection or a symptom thereof in a subject cell stimulatory factor chain 2) (nksf2): interleukin-8 pre refractory to conventional therapies for such a bacterial cursor (i1-8) (monocyte-derived neutrophilchemotactic fac infection, said methods comprising administering to said tor) (mdnsf) (T-cell chemotactic factor) (neutrophil-activat Subject a dose of a prophylactically or therapeutically effec ing protein 1) (nap-1) (lymphocyte-derived neutrophil tive amount of a compound identified in accordance with the activating factor) (lynap) (protein 3-10c) (neutrophil 55 methods of the invention. The invention also provides activating factor) (naf) (granulocyte chemotactic protein 1) methods for treating or ameliorating a bacterial infection or (gSp-1); and natural resistance-associated macrophage pro a symptom thereof in a subject refractory to existing single tein 1 (nramp 1). agent therapies for Such a bacterial infection, said methods Any type of fungal infection can be prevented, treated or comprising administering to said Subject a dose of a pro ameliorated in accordance with the methods of invention. 60 phylactically or therapeutically effective amount of a com Examples of fungi which cause fungal infections include, pound identified in accordance with the methods of the but not limited to, Absidia species (e.g., Absidia corymbifera invention and a dose of a prophylactically or therapeutically and Absidia ramosa), Aspergillus species, (e.g., Aspergillus effective amount of one or more other therapies (e.g., flavus, Aspergillus fumigatus, Aspergillus nidulans, Asper prophylactic or therapeutic agents). The invention also pro gillus niger, and Aspergillus terreus), Basidiobolus rana 65 vides methods for treating a bacterial infection by adminis rum, Blastomyces dermatitidis, Candida species (e.g., Can tering a compound identified in accordance with the meth dida albicans, Candida glabrata, Candida kerr, Candida ods of the invention in combination with any other therapy US 9,493,845 B2 95 96 to patients who have proven refractory to other therapies but Preferably, such therapies are useful for the prevention or are no longer on these therapies. The invention also provides treatment of a cardiovascular disease. Examples of Such alternative methods for the treatment of a bacterial infection therapies include, but are not limited to, peripheral anti where another therapy has proven or may prove too toxic, adrenergic drugs, centrally acting antihypertensive drugs i.e., results in unacceptable or unbearable side effects, for the (e.g., methyldopa and methyldopa HCl), antihypertensive subject being treated. Further, the invention provides meth direct vasodilators (e.g., diazoxide and hydralazine HCl). ods for preventing the recurrence of a bacterial infection in drugs affecting renin-angiotensin System, peripheral vaso patients that have been treated and have no disease activity dilators, phentolamine, antianginal drugs, cardiac glyco by administering a compound identified in accordance with sides, inodilators (e.g., amrinone, milrinone, enoXimone, the methods of the invention. 10 fenoXimone, imaZodan, and Sulmazole), antidysrhythmic In this embodiment, target genes encoding proteins drugs, calcium entry blockers, ranitine, bosentan, and reZu include, but are not limited to, ADP-ribosylation factor-4; lin. In a specific embodiment, the invention provides a bactericidal/permeability-increasing protein; complement method of preventing, treating or ameliorating a cardiovas decay-accelerating factor precursor synonym CD55 anti cular disease or one or more symptoms thereof, said method gen; desmoglein 1; human interferon gamma; interferon 15 comprising administering to a subject in need thereof a dose alpha-16 precursor (interferon alpha-wa); interferon alpha of a prophylactically or therapeutically effective amount of 1/13 precursor (interferon alpha-d) (leif d); interferon a compound identified in accordance with the methods of the alpha-5 precursor (interferon alpha-g) (leif g) (interferon invention. In another embodiment, the invention provides a alpha-61). human leukocyte (alpha) interferon; interferon method of preventing, treating or ameliorating a cardiovas beta 1; interleukin 2; interleukin-12 beta chain precursor cular disease or one or more symptoms thereof, said method (i1-12b) (cytotoxic lymphocyte maturation factor 40 kda comprising administering to a subject in need thereof a dose subunit) (climf p40) (nk cell stimulatory factor chain 2) of a prophylactically or therapeutically effective amount of (nksf2): interleukin-8 precursor (i1-8) (monocyte-derived a compound identified in accordance with the methods of the neutrophilchemotactic factor) (mdnsf) (T-cell chemotactic invention and a dose of a prophylactically or therapeutically factor) (neutrophil-activating protein 1) (nap-1) (lympho 25 effective amount of one or more other therapies (e.g., cyte-derived neutrophil-activating factor) (lynap) (protein prophylactic or therapeutic agents). 3-10c) (neutrophil-activating factor) (naf) (granulocyte The invention provides methods for treating or amelio chemotactic protein 1) (gSp-1); and natural resistance-asso rating one or more symptoms of a cardiovascular disease in ciated macrophage protein 1 (nramp 1). a Subject refractory to conventional therapies for Such a Any type of bacterial infection can be prevented, treated 30 cardiovascular disease, said methods comprising adminis or ameliorated in accordance with the methods of invention. tering to said Subject a dose of a prophylactically or thera Examples of bacteria which cause bacterial infections peutically effective amount of a compound identified in include, but not limited to, the Aquaspirillum family, accordance with the methods of the invention. The invention AZoSpirillum family, AZotobacteraceae family, Bacte also provides methods for treating or ameliorating one or roidaceae family, Bartonella species, Bdellovibrio family, 35 more symptoms of a cardiovascular disease in a subject Campylobacter species, Chlamydia species (e.g., Chlamydia refractory to existing single agent therapies for Such a pneumoniae), clostridium, Enterobacteriaceae family (e.g., cardiovascular disease, said methods comprising adminis Citrobacter species, Edwardsiella, Enterobacter aerogenes, tering to said Subject a dose of a prophylactically or thera Erwinia species, Escherichia coli, Hafnia species, Kleb peutically effective amount of a compound identified in siella species, Morganella species, Proteus vulgaris, Provi 40 accordance with the methods of the invention and a dose of dencia, Salmonella species, Serratia marcescens, and Shi a prophylactically or therapeutically effective amount of one gella flexneri), Gardinella family, Haemophilus influenzae, or more other therapies (e.g., prophylactic or therapeutic Halobacteriaceae family, Helicobacter family, Legional agents). The invention also provides methods for treating a laceae family, Listeria species, Methylococcaceae family, cardiovascular disease by administering a compound iden mycobacteria (e.g., Mycobacterium tuberculosis), Neisseri 45 tified in accordance with the methods of the invention in aceae family, Oceanospirillum family, Pasteurellaceae fam combination with any other therapy to patients who have ily, Pneumococcus species, Pseudomonas species, Rhizobi proven refractory to other therapies but are no longer on aceae family, Spirillum family, Spirosomaceae family, these therapies. The invention also provides alternative Staphylococcus (e.g., methicillin resistant Staphylococcus methods for the treatment of a cardiovascular disease where aureus and Staphylococcus pyrogenes), Streptococcus (e.g., 50 another therapy has proven or may prove too toxic, i.e., Streptococcus enteritidis, Streptococcus fasciae, and Strep results in unacceptable or unbearable side effects, for the tococcus pneumoniae) VampirovibrHelicobacter family, and subject being treated. Further, the invention provides meth Vampirovibrio family. ods for preventing the recurrence of a cardiovascular disease Bacterial infection therapies and their dosages, routes of in patients that have been treated and have no disease administration and recommended usage are known in the art 55 activity by administering a compound identified in accor and have been described in such literature as the Physicians dance with the methods of the invention. Desk Reference (56" ed., 2002). In this embodiment, target genes encoding proteins 5.9.8. Cardiovascular Diseases include, but are not limited to, 3-hydroxy-3-methylglutaryl A compound identified in accordance with the methods of CoA reductase; actin, alpha cardiac; acyl-coa dehydroge the invention may be administered to a Subject in need 60 nase; angiotensin 1-converting enzyme; bile salt export thereof to prevent, treat or ameliorate a cardiovascular pump (atp-binding cassette, Sub-family b, member 11); disease or one or more symptoms thereof. A compound cardiac muscle troponin T; carnitine o-palmitoyltransferase; identified in accordance with the methods of the invention emotakin ATP-binding cassette, sub-family a member 1 may also be administered in combination with one or more (atp-binding cassette transporter 1) (atp-binding cassette 1) other therapies (e.g., prophylactic or therapeutic agents) to a 65 (abc-1) (cholesterol efflux regulatory protein); erythropoi subject in need thereof to prevent, treat or ameliorate a etin, fibrillin; human trisosephosphate isomerase; iduronate cardiovascular disease or one or more symptoms thereof. 2-sulfatase: klotho, and thrombomodulin. US 9,493,845 B2 97 98 Any cardiovascular disease can be prevented, treated or vides methods for treating a CNS disorder by administering ameliorated in accordance with the methods of the inven a compound identified in accordance with the methods of the tion. Examples of cardiovascular diseases include, but not invention in combination with any other therapy to patients limited to, athlerosclerosis, stroke, cerebral infarction, who have proven refractory to other therapies but are no endothelium dysfunctions (in particular, those dysfunctions longer on these therapies. The invention also provides affecting blood vessel elasticity) ischemic heart disease alternative methods for the treatment of a CNS disorder (e.g., angina pectoris, myocardial infarction, and chronic where another therapy has proven or may prove too toxic, ischemic heart disease), hypertensive heart disease, pulmo i.e., results in unacceptable or unbearable side effects, for the nary heart disease, coronary heart disease, valvular heart subject being treated. Further, the invention provides meth disease (e.g., rheumatic fever and rheumatic heart disease, 10 ods for preventing the recurrence of a cardiovascular disease endocarditis, mitral valve prolapse, restenosis and aortic in patients that have been treated and have no disease valve Stenosis), congenital heart disease (e.g., valvular and activity by administering a compound identified in accor vascular obstructive lesions, atrial or ventricular septal dance with the methods of the invention. defect, and patent ductus arteriosus), and myocardial disease In this embodiment, target genes encoding proteins (e.g., myocarditis, congestive cardiomyopathy, and hyper 15 include, but are not limited to, acetylcholinesterase; trophic cariomyopathy). Alzheimer's disease amyloid A4 precursor, synonyms: Cardiovascular disease therapies and their dosages, routes protease nexin-II PN-II APPI; beta-site APP-cleaving of administration and recommended usage are known in the enzyme 2: catechol-O-methyltransferase: CREAM/calseni art and have been described in such literature as the Physi lin/KCh IP3; D-amino-acid oxidase; drebrin-1 dendritic cian's Desk Reference (56" ed., 2002). spine protein; glutamic acid decarboxylase 2; glutamic acid 5.9.9. Central Nervous System Disorders decarboxylase, brain, membrane form; glutamic acid decar A compound identified in accordance with the methods of boxylase 3; human D-1 dopamine receptor; huntingtin, the invention may be administered to a Subject in need kallikrein 6: monoamine oxidase-A, monoamine oxidase-B; thereof to prevent, treat or ameliorate a central nervous N-methylD-aspartate (NMDA) receptor; peroxisome assem system (“CNS) disorder or one or more symptoms thereof. 25 bly factor-2 (paf-2) (peroxisomal-type atpase 1) (peroxin-6); A compound identified in accordance with the methods of and Vanilloid receptor subunit 1 (capsaicin receptor). the invention may also be administered in combination with Any CNS disorder can be treated in accordance with the one or more other therapies (e.g., prophylactic or therapeutic methods of the invention. Examples of CNS disorders agents) to a subject in need thereof to prevent, treat or include, but are not limited to, bacterial and viral meningitis, ameliorate a CNS disorder or one or more symptoms 30 Alzheimers Disease, cerebral toxoplasmosis, Parkinson's thereof. Preferably, such therapies are useful for the preven disease, multiple Sclerosis, brain cancers (e.g., metastatic tion or treatment of a CNS disorder. Examples of such carcinoma of the brain, glioblastoma, astrocytoma, and therapies include, but are not limited to, levodopa, Parlodel acoustic neuroma), hydrocephalus, and encephalitis. (bromocriptine), Permax (pergolide), Eldepryl (selegiline CNS disorder therapies and their dosages, routes of hydrochloride), donepezil (Aricept(R), tacrine (CognexR), 35 administration and recommended usage are known in the art acyclovir, antibiotics, chemotherapeutics, and radiation and have been described in such literature as the Physician's therapy. In a specific embodiment, the invention provides a Desk Reference (56" ed., 2002). method of preventing, treating or ameliorating a CNS dis 5.10. Classification of UTRs, Compound, and Disease order or one or more symptoms thereof, said method com State prising administering to a subject in need thereof a dose of 40 The names of the compounds identified in accordance a prophylactically or therapeutically effective amount of a with the methods described herein and the names of the compound identified in accordance with the methods of the genes whose expression are modulated in response to said invention. In another embodiment, the invention provides a compounds can be maintained in a database. By performing method of preventing, treating or ameliorating a CNS dis an assay for modulators of untranslated region-dependent order or one or more symptoms thereof, said method com 45 gene expression using the same assay format for a group of prising administering to a subject in need thereof a dose of untranslated regions of target genes (i.e., an assay format in a prophylactically or therapeutically effective amount of a which the only variable between each individual assay is the compound identified in accordance with the methods of the nucleotide sequence of untranslated regions operably linked invention and a dose of a prophylactically or therapeutically to a reporter gene) and by storing all relevant data in a effective amount of one or more other therapies (e.g., 50 database, cluster analysis can be performed on the data and prophylactic or therapeutic agents). functional associations between and/or within relevant data The invention provides methods for treating or amelio sets (e.g., (a) compounds, (b) nucleotide sequences of rating one or more symptoms of a CNS disorder in a subject untranslated regions of genes, and (c) pathological condi refractory to conventional therapies for Such a cardiovascu tions associated with genes) can be determined. lar disease, said methods comprising administering to said 55 For example, if a common set of compounds modulates Subject a dose of a prophylactically or therapeutically effec the expression of a reporter gene when the latter is operably tive amount of a compound identified in accordance with the linked to a set of untranslated regions from all untranslated methods of the invention. The invention also provides regions analyzed, it can be concluded that the untranslated methods for treating or ameliorating one or more symptoms regions in the set are involved in a common process or of a CNS disorder in a subject refractory to existing single 60 processes in post-transcriptional control of gene expression. agent therapies for such a CNS disorder, said methods If functional involvement in post-transcriptional control of comprising administering to said Subject a dose of a pro gene expression has been reported for any of the untrans phylactically or therapeutically effective amount of a com lated regions in the set, the untranslated regions without pound identified in accordance with the methods of the known roles in gene expression regulation can be assigned invention and a dose of a prophylactically or therapeutically 65 a function. By performing further analysis and looking for effective amount of one or more other therapies (e.g., sets of compounds that modulate sets of untranslated regions prophylactic or therapeutic agents). The invention also pro common to a particular pathological condition, the follow US 9,493,845 B2 99 100 ing can be identified: (a) members of biochemical reaction - Continued pathways involved in the disease, (b) targets for multiple Initial Specific Target Motif: drug intervention and/or regulation, and (c) multiple patho (3) Group I AU-Rich Element (ARE) Cluster in 3 logical conditions that can be treated with a single com untranslated region: pound or set of compounds. (SEO ID NO: 7)

6. EXAMPLE 6.2. Granulocyte-Macrophage Colony Stimulating Factor See, e.g., GenBank Accession # NM 000758 or it Therapeutic Untranslated Region Targets 10 XM 003751. The therapeutic targets presented herein are by way of General Target Regions: example, and the present invention is not to be limited by the (1) 5' Untranslated Region - nts 1 - 32 of GenBank targets described herein. The therapeutic targets presented Accession #NM 000758: herein as DNA sequences are understood by one of skill in 15 (SEQ ID NO: 8) the art that the sequences can be converted to RNA g/tctggaggat gtggctgcag agcctgctgc ticttgggcac Sequences. (2) 3' Untranslated Region - nts 468 - 789 of 6.1. Tumor Necrosis Factor Alpha GenBank Accession #NM 000758: (SEO ID NO: 9) See, e.g., GenBank Accession if XO1394. gcc ggggagctgc tictotcatga aacaagagct agaaacticag gatggit catc ttggagggac Caaggggtgg gcc acagc.ca General Target Regions: (1) 5' Untranslated Region - nts 1 - 152 of tggtgggagt ggcctggacc tgcc ctgggc cacact gacc GenBank Accession E XO1394: (SEO ID NO; 5) 25 Ctgatacagg catggcagaa gaatgggaat attittatact gcagaggacc agctaagagg gagagaagca act acagacic gacagaaatc agtaat attt atatatttat atttittaaaa cc.ccctgaaa acaaccotca gacgc.cacat cocctgacaa tatttattta tittatttatt taagttcata t t c catattt gctgcc aggc aggttct citt cotct cacat act gacccac 30 attcaagatgttitt accota ataatt atta ttaaaaatat gctitct ggaaaggaca ggct coaccc tict citc cc ct cc. Initial Specific Target Motif: (2) 3' Untranslated Region - nts 852 - 1643 of Group I AU-Rich Element (ARE) Cluster in 3 GenBank Accession E XO1394: untranslated region: (SEQ ID NO: 6) (SEQ ID NO: 10) tgaggagga cqaa catcca acct tcc.caa acgcct cocc 35 tgc.cccaatic cctitt attac ccc ct cottc agacacic citc 6.3. Interleukin 2 aacct cittct ggctcaaaaa gagaattggg ggcttagggit See, e.g., GenBank Accession # U25676. cggaac ccaa gcttagaact ttaa.gcaa.ca agaccaccac 40 General Target Regions: titcgaalacct gggatt Cagg aatgtgtggc ctgcacagtg (1) 5' Untranslated Region - nts 1 - 47 of GenBank Accession E U25676: aattgctggc aaccactaag aattcaaact gggggct coa (SEQ ID NO: 11) at Cact ct ct ttaatcacta Citcacattaa CCt Caact CC gaact cactg gggcct acag ctittgatc cc toga catctgg 45 tgccaca aatctggaga C cagggagcc tittggttctg gcc agaatgc (2) 3' Untranslated Region - nts 519 - 825 of tgcaggactt gagaagacct cacct agaaa ttgacacaag GenBank Accession E U25.676 : (SEQ ID NO: 12) tggacct tag gcc titcct ct citccagatgt titccagacitt ta attaagtgct tcc cacttaa alacatat cag gocttctatt 50 CCttgagaca C9gagcc.cag C cct ccc.cat ggagc.ca.gct tatttattta aatatttaaa ttittatattt attgttgaat c cct ct attt atgtttgcac ttgttgattat ttatt attta gtatggttgc tacctattgt aact attatt cittaatctta tittatt attt atttatttac agatgaatgt atttatttgg aaactataaa tatggat.ctt titatgattct ttttgtaagc 55 gaga.ccgggg tat cotgggg gacccaatgt aggagctgcc Cctaggggct ctaaaatggit ttacct tatt tat cocaaaa ttggct caga catgttitt co gtgaaaacgg agctgaacaa at attt atta titatgttgaa tdttaaatat agtatic tatg taggctgttc ccatgtagcc ccctggcct c tdtgc ctitct tagattggitt agtaaaacta tittaataa at ttgataaata 60 tittgattatgttttittaaaa tatttatctg attaagttgt taaaaaaaaa aaacaaaaaa aaaaa. ctaaacaatig citgatttggit gaccaactgt cact cattgc Initial Specific Target Motifs: Group III AU-Rich Element (ARE) Cluster in 3 tgagcctctg. Ct.ccc.caggg gagttgttgtc. ttaatcgc.c untranslated region: 65 (SEQ ID NO: 13) Ctactatt Ca gtggcgagaa ataaagtttg citt s' NAUUUAUUUAUUUAN 3

US 9,493,845 B2 109 110 - Continued - Continued totgacaggcctic ct ggaaact tccacatatttittcaactgcagtataaa ttatact cittaggg tattattittatacaaaagcc ttgaggattgcattct gt cagaaaataaagttalacataactitt cactalacacaca catatgtagat attittctatatgaccct cittgat atttaaaaaac actatoggataacaatt tt cacaaaatccaccitataattggtcaaagtggttgagaatatattittitt citt catttacctag tattatgaaagaatgaaggagttcaaacaaatgtgt agtaattgcatgcaaaatttittctagottc catc ctittctic cct cottt c titcc cagttaac tagggitt tactgtttgagcc-aatataaatgtttaactg ttctttittittgggggagctgg taact gatgaaatcttitt cocaccittitt c tttgttgatggcagtatt cotaaagtacattgcatgtttitcctaaatacag 10 tott caggaaatataagtggttttgtttggittaacgtgata cattctgta agtttaaataattt cagtaattcttagatgatticagottcatcattalaga tgaatgaaac attggagggaalacatc tactgaatttctgtaatttaaaat atat ctitttgttittatgttgagttagaaatgc ctitcatataga catagt c attittgctgctagittaactatgaacagatagaagaatcttacagatgctg titt cagacct ct actgtcagttitt catttctagotgctitt cagggittitta 15 ctataaataagtagaaaatataaattitcat cactaaaatatgctattitta tgaattitt caggcaaagctittaatttatactaagct taggaagtatggct aaatct attt cotatattg tatttctaatcagatgt attact cittattat aatgccaacggcagtttittitt cittcttaattic cacatgactgaggcatat ttctattgtatgtgttaatgattittatgtaaaaatgtaattgcttitt cat atgat citctggg taggtgagttgttgttgacaaccacaa.gc acttittittitt gagtag tatgaataaaattgattagtttgttgttittcttgtc.t.ccc.gaaaa tttittaaagaaaaaaaggtag tigaatttittaatcatctgg actittaagaa aaaaaaaaaaaaaaaaaaaaaaaaaa. ggattctggagtatact taggcctgaaattatatat atttggcttggaaa 6.11. Cyclin D1 tgttgtttittcttcaattacatctacaagtaagtacagotgaaatt cagag See, e.g., GenBank Accession No. NM 053056. gacc catalagagttcacatgaaaaaaatcaatt catttgaaaaggcaaga 25 tgcaggagagaggaagccttgcaaacctgcagactgctttittgcc caata General Target Regions: (1) 5' Untranslated Region: tagattgggtaaggctgcaaaacataagcttaattagct Cacatgct ctg (SEQ ID NO: 31) cggCCCC agaaaa.ccc.gagcgagtaggggg.cggcgc.gcaggagggaggag Ctct cacgtggcaccagtggatagtgtgagagaattaggctgtagaacaa 30 aactgggggcgcgggaggctggtgggtgtcgggggtggagatgtagalaga atggccttct ctitt cago attcacaccactacaaaatcatcttittatat c tgtgacgc.cgcggc.ccggcgggtgccagattagcggacggctgc.ccg.cgg aacagaagaataagcataaactaagcaaaagg to aataagtacctgaaac ttgcaacgggatc.ccgggcgctgcagcttgggaggcggacticcCC aggcg caagattggctagagatatat cittaatgcaatccatttitctgatggattg 35 gcgt.ccgcggaga cacc catc.cgtgs acccCagg toccgggcc.gc.cggct ttacgagttggctatataatgitatgtatgg tattittgatttgttgtaaaag cgcc.gc.gcacCagggg.ccggcggacagalaga.g.cggcc.gagcggct C9agg ttittaaaaatcaagctittaagtacatggacatttittaaataaaat attta Ctgggggac aaga caatttagaaaattgccittaatat cattgttggctaaatagaatag 40 (2) 3' Untranslated Region (3.2 kb) : ggga catgcatattaaggaaaaggt catggagaaataatattggit at Caa (SEQ ID NO: 32) tgaggg.cgcCaggcagg.cggg.cgc.ca.ccgccaccc.gcagcgaggg.cggag acaaatacattgatttgtcatgatacacattgaatttgat coaatag titt ccggcc cc aggtgct cocctgacagt cc ct cotctic cqgagcattttgat aaggaatagg taggaaaatttggitttctatttitt cattt cagtaaatca 45 accagaagggaaagctt cattct cottgttgttggttgttttitt cctittg gtgacataaataattcttagct tattittatattt cottgtc.ttaaatact ct ctitt cocc ctitccatct ctdacttaa.gcaaaagaaaaagattacccaa gagotcagtaagttgttgttaggggattatttcticagttgagactitt Ctta aaactgtc.tttaaaagaga.gaga.gagaaaaaaaaaatag tatttgcatala tatgacattt tact atttittgact tcctgact attaaaaataaatagta 50 cc ctgagcggtgggggaggagggttgttgct acagatgatagaggattitta gaaacaattitt cataaagtgaagaattatataat cactgctittataactg taccc.caataatcaact cqtttittat attaatgtacttgtttct citgttg actittatt at atttatttcaaagttcatttaaaggctactatt catcctic taagaataggcattalacacaaaggaggcgt.ct cqggagaggattaggttc tgttgatggaatggit caggaatttgttittct catagtttaattic caacaac 55 catcctttacgtgtttaaaaaaaag cataaaaac attittaaaaacataga aat attagt cqtat coaaaataacctittaatgctaaactt tactgatgta aaaatt cagcaaaccatttittaaagtagaagagggittittagg tagaaaaa tatic caaagcttct cottitt cagacagattaatccagaagicagt cataaa catatt Cttgttgcttitt Cotgataaagcacagctgtagtggggttctagg cagaagaataggtgg tatgttcc taatgat attatttic tactaatggaat catctotgtactittgcttgct catatgcatgtag to actittataagt cat aaactgtaat attagaaattatgctgctaattatat cagotctgagg taa 60 tgitatgtt attatatt cogtagg tagatgtgtaacct citt cacct tatt c tittctgaaatgttcagacticagt cqgaacaaattggaaaatttaaattitt atggctgaagt cacct Cttggittacagtagcgtagcgtggc.cgtgtgcat tatt cittagctataaagcaagaaagtaaacacattaattitcct caac att gtcc tittgcgc.ctgttgaccaccaccc caacaaac catccagtgacaaacc tittaa.gc.caattaaaaatataaaagatacacaccaat atc.ttctt caggc 65 at CC agtggaggtttgtcgggcaccago Cagcgtag cagggtcgggaaag

US 9,493,845 B2 127 128 - Continued - Continued gcagttittaatacttgtaatticc cc talaccataagatt tactgctgctgt gagaaactgaatagotgtcataaaatgctttctitt.cctaaagaaagatac ggatat ct coatgaagtttitcc.cactgagt cacat cagaaatgcc ctaca to acatgagttcttgaagaatagt catalactagattaagatctgtgttitt t cittatttitcct cagggct caagagaatctgacagataccatalaagggat agtttaat agtttgaagtgcctgtttgggataatgataggtaatttagat ttgacctaat cactaattitt caggtggtggctgatgctittgaa catctat gaatttaggggaaaaaaaagttatctgcagttatgttgagggccCatctic tgctg.cccaatic cattagcgacagtaggattatcaa.ccctgg tatgaata to cocc cacaccc.ccacagagctaactgggittacagtgttittatc.cgaaa gacagaac cct atc.cagtggaaggaga atttaataaagatagtgcagaaa 10 gttt coaatticc gaattic cittagg taatctataac tagg act actic ctdgta acagtaatac attic cattgttt tagta accagaaatctt catgcaatgaaaaatactitta 6.25. Target of Antiproliferative Antibody See, e.g., GenBank Accession No. M33680 and Trifillis et att catgaagct tacttitttitttttittggtgtcagagt ct cqct cittgtc 15 al., 1999, RNA 5:1071-1082. acccaggctggaatgcagtggcgc.cat citcagct cactgcaac Cttic cat Cttic cc aggttcaa.gcgattct cqtgccticggcctic ctgagtagctggga General Target Regions: (1) 5' Untranslated Region: ttacagg.cgtgtgcact acact caactaattitttgt atttittaggagaga (SEQ ID NO: 61) c cattgttgct ggaaaggcgc gcaacggcgg cgacggcggc cggggttt CacctgttggcCaggctggtct Caact cotgacct Caagtg gaccccaccg cgcatcCtgc Caggc ct cog CCCC agcc.g attcacccaccittggcct cataa acct gttittgcagaact catttatto a cc cacgc.gcc ccc.gc.gc.ccc gcgcc.ccgac cctitt citt.cg gcaaat atttattgagtgcctaccagatgc.cagt caccgcaca aggcact 25 cgc.ccc.cgcc cct cqgc.ccg C caggcc.ccc ttgc.cggc.ca gggtatatggitatic cccaaacaa.gaga cataatc.ccggtcCttagg tact cc.cgc.caggc cc.cgc.gc.cgg ccc.gc.ccgcc gcc caggacc gctagtgtggtctgtaat atctt acta aggcCtttggtatacgacccaga gata acacgatgcg tattt tagttittgcaaagaaggggtttggtctctgt 30 (2) 3' Untranslated Region: gccagotctataattgttittgctacgattic cactgaaact ctitcqat caa (SEQ ID NO: 62) g gCCCC9gagc tictogC Caca giggacCtctg. CagtgcCCCC gctactittatgtaaat cactt cattgttittaaaggaataaacttgattat taagtgaccc gga cact tcc gagggggcca t caccgc.ctg attgtttittittatttgg catalactgtgatt cittittaggacaattact.gta 35 tgtatataac gtttic cqgta t tact ctogct acacgtagcc cacattaaggtg tatgtcagatatt catattgacccaaatgtgtaatatt ttitt tact tt tggggittittg ttitttgttct gaactitt cot c cagttitt citctgcatalagtaattaaaatatact taaaaattaatag titt gttaccttitt Cagggctgat gtcacatgta ggtggcgtgt tatctggg tacaaataaac agtgcctgaactagttcacagacaagggaaa atgagtggag acgggcctgg gtCttgggga Ctggagggca cittctatotaaaaat cactatgatttctgaattgctatgtgaaactacag 40 ggggtcCttic tic cc ctggg gtc.cc agggit gctctgcctg atctttggaacactgtttagg tagggtgttalagacittgacacagtacct c CtcagcCagg cct ct cotgg gagcc acticg cccagagact gtttct acacagagaaagaaatggc catactt Caggaactgcagtgctta Cagcttggcc aacttggggg gctgttgtc.ca cc.cagc.ccgc tgaggggatatttaggcct Cttgaatttittgatgtagatgggcatttittt 45 cc.gtc.ctgtg ggctgcacag ctic accttgttcc ct cotgc taagg tagtggittaattacctittatgtgaactittgaatggitttaacaaaa cc.cggttctga gag.ccgagtic tgtgggcact citctgcc titc gatttgtttttgtagagattittaaagggggagaattictagaaataaatgt atgcacctgt cctittctaac acgtc.gc.ctt caactgtaat tacctaattattacago cittaaaga caaaaatcc ttgttgaagtttittitt 50 cacaac atco tact cogtc atttaataaa gaaggaacat aaaaaaagactaaattacatagacittaggcattalacatgtttgttggalaga caggcatgct aaaaaaaaaa aaaaaa atatagcagacgtatattgtat catttgagtgaatgttcc caagtaggca ttctaggctic tatttaactgagt cacactgcataggaatttagaacctaa 6.26. Downstream Regulatory Element-Antagonist 55 Modulator cittittataggittatcaaaactgttgtcaccattgcacaattttgtcc taa See, e.g., GenBank Accession No. AJ131730. tatata catagaaactttgtgggg.catgttaagttacagtttgcacaagt tdatctoatttgtatto cattgattitttttittittctitctaaacatttittt General Target Regions: 60 (1) 5' Untranslated Region: cittcaaaacagtatatata acttitttittaggggatttatttagacagcaa (SEQ ID NO: 63) gaattic.cggc aaa catgagg cagctgc.cag ccggcctggg aaaact atctgaagatttic catttgtcaaaaagtaatgatttcttgataa Cagticttgtc. tcct cq9ct gtgaagtggg gaggctggca ttgttgtag togaatgttttittagaac ccagoagttaccttgaaagctgaat 65 acagttittct tcago.gc.cca gg titat atttagta acttctgtgttaatactggatagoatgaattctgcatt

US 9,493,845 B2 131 132 - Continued Zino & Pan, 2000, Angiogenesis—Research frontiers. A atticoagaat citgtttatat ggctggtaac atgtaaaaac basic science conference of the New York Academy of Medicine. Exp. Opin. Invest. Drugs 9:1-7: and Hichlin et al., cc cataaccc cqccaaaagg ggit cotaccc ttgaacatala 2001, DDT 6: 517-528). There are several ongoing clinical agcaataacc aaaggagaaa agcc.caaatt attggttcca trials (phase I-phase III) indicating that either VEGF neu tralizing antibodies or VEGFR2-mediated signal transduc aatttagggit ttaaacttitt togaa.gcaaac tttitttittag tion inhibitors are effective for tumor therapy (Carmeliet & ccttgtgcac togcagacct g g tact cagat tttgctatoga Jain, 2000, Nature 407:249-257 and Matter, 2001, Drug Discovery Today 6:1005-1024). ggittaatgaa gtaccaa.gct gtgcttgaat aacgatatgt 10 VEGF protein expression is tightly regulated at both the transcriptional and post-transcriptional levels. Under titt ct cagat tittctgttgt acagtttaat ttagcagt cc hypoxic conditions, tumor cells express high levels of VEGF atat cacatt gcaaaagtag caatgacct cataaaat acc that can promote angiogenesis and thus Support the growth of tumor cells. Increase of VEGF protein is due to both tottcaaaat gcttaaattic attt cacaca ttaattittat 15 increased transcription and enhanced mRNA stability. cticagtic titg aagccaattic agtaggtgca ttggaat cala Hypoxia-inducible factor 1 (HIF-1) is responsible for the transcriptional activation of the VEGF gene in hypoxic cells gcc tdgctac ctdcatgctg titccttittct tttcttctitt by binding to a hypoxia response element (HRE) located 1 kb upstream of the transcription initiation site. In addition, tagccatttit gctaagagac acagt cittct caaac acttic the abundance of VEGF mRNA is increased due to stabili gtttct cota ttttgttitta citagttittaa gat cagagtt zation of the mRNA by binding of HuR to the 3' UTR (untranslated region). Under hypoxic conditions, cap-depen cactittctitt ggactctgcc tatattittct tacctgaact dent translation is replaced by cap-independent translation tittgcaagtt ttcaggtaaa cct cagotca ggactgctat of the VEGF mRNA which is mediated by an internal 25 ribosome entry site (IRES) within the VEGF 5' UTR. ttagctic ctic ttalagaagat taaaaaaaaa. aaaaaa. This Example demonstrates the generation of stable cell lines, harboring VEGF 5' and 3'UTR sequences, which can 6.28. Her-2 be used to identify Small molecular weight compounds that inhibit VEGF IRES-dependent translation or modulate General Target Regions: 30 VEGF mRNA stability. (1) 5' Untranslated Region: 7.2. Materials and Methods (SEO ID NO: 67) 7.2.1. Generation of VEGF 5' and 3'UTRS gcgc.ccggcc.cccaccc ct coagc acccc.gc.gc.ccc.gc.gc.cctic cc agc The VEGF 5'UTR was generated using PCR from human cgggtc.ca.gc.cggagc.catggggc.cggagcc.gcagtgagcaccatggag genomic DNA. The full-length 5' UTR was prepared by the 35 ligation of two separate PCR products (FIG. 1A). The first (2) 3' Untranslated Region: half of the 5' UTR (designated VEGF 5' UTR2, encompassing (SEQ ID NO: 68) tgalaccagaaggccaagttc.cgcagaag.ccctgatgtgtcCtcagggagca nucleotides 1 to 498) was amplified with primer 1 (5'-AAA GTC GAC GTA ATC GCG GAG GCT TGG GCA GCC gggaaggcctgactitctgctggcatcaagaggtgggagggc.catc.cgacc GG-3', SEQ ID NO: 69, and primer 2 (5' TTT GCG ACT 40 GGT CAG CTG CGG GAT CCCAAG3', SEQID NO: 70). actitcc aggggaac Ctgcc atgc.caggaac Ctgtcc talaggalacctt cat The second half of the VEGF 5' UTR (designated VEGF Cctgcttgagttcc cagatggctggaaggggtc.ca.gc.ct cqttggaagag 5'UTR1, from nucleotide 337 to 1038, plus the first 45bp of the VEGF open reading frame) was amplified using primer gaac agcactggggagt ctttgttggattctgaggcc ctg.cccalatgagac 3 (5'-AA GTC GAC GTA AGAGCTCCA GAGAGA AGT 45 tctagggit coagtggatgccacagcc.ca.gcttggcc attcatcCagat CC CGAG-3, SEQID NO: 71 and primer 4 (5'-AAA CCCGGG CAG CAA GGC AAG GCTCCAATG CAC-3', SEQ ID tggg tactgaaagccttagggaagctggcctgagaggggaagcggcc ct a NO: 72). Each PCR product was digested with BamHI, and ligated together to produce the full length 5' UTR. To facili agggagtgtctaagaacaaaag.cgacc cattcagagactgtc.cctgaaac tate downstream cloning into dicistronic plasmid p2luc-i, Ctag tact gcc.ccc catgaggaaggaacagcaatggtgtcagtat coagg 50 primers 1 and 3 were designed to include a Sal I site and a stop code (TAA), immediately after the Sal I site at the 5' Ctttgtacagagtgatttctgtttagttitt tactitt ctittgattgtattt end, and primer 4 for VEGF 5'UTR1 includes a Xma I site at the 5' end (FIG. 1C). taalagacgaaataaagacic caggggagaatgggtgttgtatggggaggca The entire VEGF 3' UTR (shown in FIG. 1B) was agtgtggggggtcc titaccacac cc actttgtc.catttgcaaatatatta 55 amplified by genomic PCR using primer 5 (5'-GCC GGG CAG GAG GAA GGA GCC TCC CTC AGG GTTTGG ggaaaac GGA 3', SEQID NO: 73) and primer 6 (5'-CTG CAC TAG AGA CAA AGA CG T GAT GTT AAT-3', SEQ ID NO: 74. 7. EXAMPLE The Bg II and EcoR I restriction sites were used for 60 Subsequent cloning. Vascular Endothelial Growth Factor 7.2.2. Plasmid Construction Each PCR fragment (VEGF 5'UTR1, VEGF 5' UTR2 and 7.1. Introduction VEGF 3'UTR) was cloned into pT-Adv vector for confir Vascular endothelial growth factor (VEGF) plays a key mation by DNA sequencing using the Clontech advantage role in tumor angiogenesis. Considerable evidence demon 65 cloning kit. A SalI-Xmal VEGF 5'UTR1 fragment was strates that VEGF is a viable target for tumor therapy subcloned into the p2luc-i dicistronic plasmid (FIG. 2A, (Carmeliet & Jain, 2000, Nature 407:249-257; Sepp-Loren Grentzmann et al., 1998, RNA 4:479-486). The sequence of US 9,493,845 B2 133 134 the polylinker site is GAA CAAATG TCG ACG GGG GCC 77); the primer pairs for GAPDH were as follows: 5'-GGT CCT AGG AGA TCT AGC GCT GGA TCC CCC GGG GAA GGT CGG AGT CAA CGG A-3' (SEQ ID NO: 78) GAG CTC AUG GAA GAC (SEQ ID NO: 75, FIG. 2A). and 5'-GAGGGATCT CGCTCCTGGAAG A-3' (SEQID The resulting plasmid (designated p21uc/VEGF5UTR1, see NO: 79). The PCR products were separated on 1% agarose FIG. 2B) contains VEGF 5'UTR1 between the two reporter 5 gel, stained with ethidium bromide and quantified on UVP genes (renilla luciferase and firefly luciferase) with a stop with Labworks software. code (TAA) immediately after the Sal I site and a fusion 7.2.6. High Throughput Screening translation junction between the first 15 AA of VEGF and High throughput screening (“HTS) for compounds that firefly luciferase open reading frame. To construct the dicis inhibit untranslated region-dependent expression of vascular tronic plasmid containing the full length VEGF 5' UTR, 10 endothelial growth factor (“VEGF) is accomplished using VEGF 5' UTR2 was then subcloned into p2luc/VEGF5UTR1 Stable cell lines described in Section 7.2.3. The 293T cell between Sall and BamHI (designated p2luc/VEGF5UTR-fl; line contained stably integrated copies of the firefly FIG. 2B). This plasmid also has a stop code (TAA) imme luciferase gene flanked by both the 5' and 3' UTRs of VEGF. diately after the Sal I site to prevent read-through from the Cell lines exhibiting consistently high levels of firefly first reporter to the second. 15 luciferase expression are further expanded and optimized for To map the region of the IRES essential for activity, HTS. dicistronic plasmids containing various deletions within the Screening of compounds is done using one hundred VEGF 5'UTR were prepared (FIG. 2B). Plasmid p21uc/ 384-well plates per day. Each 384-well plate contains a vegfö'utr-delta51-476 is derived from p2luc/vegfö'utr-fl by standard puromycin titration curve that is used as a reference removing the Nhe I fragment (nt51 to 746); plasmid p21uc/ to calculate % inhibition and the statistical significance of vegföutr-delta476-1038 was derived from p2luc/vegfsutr-fl the data points generated in the assay. This curve occurs in by removing the sequence from BamHI site to the 3'end of wells from column 3 and 4 of the 384-well plate. The 5' UTR; plasmid p21uc/vegföutr-delta1-476 was derived concentration of puromycin is 20 mM serially diluted 2-fold from p2luc/vegföutr-fl by removing the sequence from to 0.078 mM plated in quadruplicate. Columns 1 and 2 BamH I to the 5'end of 5' UTR. 25 contain 16 standards each of a positive control 0.5% DMSO To generate stable cell lines for high throughput screen and a negative control consisting of the puromycin at 20 ing, a monocistronic reporter plasmid (pluc/VEGF5'+ mM. The difference between the two controls is used as the 3'UTR) containing the VEGF 5' and 3'UTRs and firefly window to calculate the percentage of inhibition of luciferase gene (FIG. 3A) was constructed. Briefly, a Sal luciferase expression in the presence of a compound. Col I-Not I fragment, containing the full length VEGF 5'UTR 30 umns 5 through 24 contain compounds from a library of and firefly reporter gene, from p2luc/VEGF5'UTR-fl was Small molecules. subcloned into pCDNA5/TO between EcoRV and Not I, Two confluent T175 flasks of the VEGF stable cell line and then the VEGF 3'UTR was subcloned into the interme described above (B9) are split into twenty T175 flasks three diate plasmid at the Not I site by blunt-end ligation. days prior to Screening. On each day of the HTS assay, the 7.2.3. DNA Transfection and Generation of Stable Cell 35 cells are dislodged from the flask with 3 ml of 0.25% Lines trypsin-EDTA (Gibco, cat no. 25200-056) and diluted to 10 293T cells were transfected with pluc/VEGF5'+3'UTR ml with non-selective media. This is repeated for all twenty using the Fugene 6 transfection reagent (Roche) according flasks and the cells are combined, counted and diluted to a to manufactures instruction. 48 hours after transfection, the concentration of 263.15 cells/ml. 38 to 39 ml are then added cells were lysed and plasmid function was monitored by 40 to each well containing 1 to 2 ml of compound from a small measuring luciferase activity using Promega’s luciferase kit molecule library to a final compound concentration of 7.5 according to manufacture’s instruction. mM (3.75 mg/ml) in 0.5% DMSO. The puromycin standard To generate stable cell lines, plasmid pluc/VEGF5'+ curve also contains 0.5% DMSO. The stable cell line is 3'UTR was transfected into 293T cells as described. 48 incubated in the presence of compound overnight (approxi hours after transfection, the cells were trypsinized, resus 45 mately 16 hours) at 37 C in 5% CO. To monitor firefly pended in culture media plus 200 mg/ml hygromycin B, then luciferase activity, LucLite Plus (Packard cat no. 6016969) seeded in 96 well plates at 100 to 500 cells per well for is prepared according to manufactures instructions and 20 selection. The media containing hygromycin B was changed ml is added to each well. Following a brief incubation at every 3 to 4 days. After 10 to 14 days of selection, hygro room temperature (minimum 2 min.), firefly luciferase activ mycin resistant clones were screened under a microscope 50 ity in each well is detected with the ViewLux 1430 ultraHTS and wells harboring a single colony were expanded under Microplate Imager (Perkin Elmer). All data obtained is hygromycin selection for further experiments. uploaded into Activity Base for % inhibition calculations 7.2.4. Luciferase Assay and statistical analyses. F. luciferase and R. luciferase activities were measured 7.3. Results using the Luciferase reporter assay system (Promega) 55 The ability of VEGF 5'UTR sequences to modulate inter according to manufacturers instruction. nal translation initiation was tested using the plasmid vector 7.2.5. Semi-Quantitative PCR that encodes a dicistronic mRNA (FIG. 2A). The renilla DNA and RNA were isolated from B9 cells using TRIZol luciferase is translated from the first cistron by a cap reagent (GIBCO BRL) according to the manufacturers dependent scanning mechanism, while the firefly luciferase instructions. cDNA was synthesized using Promega's 60 in the second cistron is translated only if preceded by an reverse transcription system. Semi-quantitative PCR was internal ribosome entry site. In this study, five discistronic performed with gene specific primers for firefly luciferase or plasmids containing various deletions of the VEGF 5'UTR glyceraldehyde phosphodehydrogenase (GAPDH) as an (FIG. 2B) were generated and transiently transfected into internal control. The primer pairs for firefly luciferase ampli 293T cells to monitor IRES-dependent translation of firefly fication were as follows: 5'-CGG TGT TGG GCG CGT TAT 65 luciferase. 48 hours after transfection, extracts were pre TTATCG GAG TTG-3 (SEQID NO: 76) and 5'-TTG GCG pared and assayed for renilla and firefly luciferase activities AAGAATGAAAAT AGGGTTGGT ACT-3' (SEQID NO: using the dual luciferase kit from Promega. As shown in US 9,493,845 B2 135 136 FIG. 2C, deletion of either the first 336 or the first 476 highly expressed in all of the most common cancers in a cell nucleotides has no significant effect on firefly luciferase cycle-regulated manner. Disruption of Survivin expression/ activity compared to full length VEGF5'UTR directed function by antisense or dominant-negative mutation luciferase levels. However, deletion between nucleotides 51 resulted in deregulation of mitotic progression and sponta and 746 decreased firefly luciferase activity more than 75% 5 neous apoptosis. It has been demonstrated that Survivin (33.68+/-4.91 vs 161+/-30.49). Deletion of nucleotides 476 targeting in vivo increased apoptosis and reduced prolifera to the 3' end of the VEGF 5' UTR decreased firefly luciferase tion of tumor cells, but did not affect cell viability of activity more than 90% (12.15+/- 1.2 V.S. 161+/-30.49). proliferating normal cells. It has also been showed that Taken together, these results confirm that the VEGF 5'UTR Survivin targeting induces apoptosis and sensitizes tumor harbors IRES activity, and also indicates that the region of 10 cells to chemical agents. Therefore, inhibition of survivin the VEGF IRES essential for function is located within may be of great benefit for refractory cancer therapy when nucleotide 476 to the 3' end of VEGF 5' UTR. combined with standard chemotherapy. Another benefit for To generate stable cell lines for High Throughput Screen this project will below toxicity because survivin expression ing (“HTS”), a monocistronic reporter plasmid under the is absent in normal adult tissues. Taken together, these transcriptional control of the CMV promoter (pluc/vegfö'+ 15 indicated Survivin is valid target for cancer therapy. 3'UTR; FIG. 3A) was constructed. This plasmid contains Translation of survivin might be cap-independent/IRES both the VEGF 5’- and 3'-UTRs separated by the firefly dependent since it is maximally expressed in metaphase. In luciferase gene. After confirmation of luciferase production G2/M phase, the eIF4E-binding proteins (4E-BPs) become by transient transfection (data not shown), transfected 293-T hypophosphorylated. 4E-BPs compete with eIF4G for eIF4E cells were seeded in 96 well plates at a concentration of 20 binding, thus preventing eIF4F formation and cap-depen 100-500 cells per well, and then cultured under hygomycin dent translation initiation. In addition, survivin mRNA has a B selection. After two weeks of selection, 19 clones were long 3'UTR featuring a poly(U) sequence and multiple CU screened for luciferase activity, three of which demonstrated repeats. high levels of luciferase activities (clones B9, D3, H6; FIG. This Example demonstrates the generation of stable cell 3B). To determine which cell line demonstrated the highest 25 lines, harboring survivin 5' and 3'UTR sequences, to identify level of expression, the luciferase activities of clones B9, Small molecular weight compounds that inhibit Survivin D3, H6 were compared and normalized against the protein IRES-dependent translation or modulate survivin mRNA concentrations extracted from each cell line. The results stability. shown in FIG. 4 demonstrate that the luciferase activity from 8.2. Materials and Methods B9 cells was two fold greater than H6 cells, and more than 30 8.2.1. Generation of Survivin 5' and 3' UTRS three fold higher than D3 cells. The 5' UTR of survivin was generated by filling-in To determine if the B9 cells are stable, these cells were partially overlapping oligonucleotides with Taq polymerase. maintained under hygromycin selection for more than three A 5' UTR forward oligonucleotide (5' AAAGTCGACG months, with intermittent monitoring of luciferase activity. TAACCGCCAGATTTGAATCGCGGGACCCGTTGGCA The results indicate that this cell line is stable and sustains 35 GAGGTGGC GG 3', SEQ ID NO: 80) encompassing a high level of luciferase expression when continuously nucleotides 1 to 42 of the 5' UTR of Survivin and a 5' UTR cultured in vitro for more than three months (FIG. 5). eVeSe oligonucleotide (5' AAAGGATC Sustained expression of luciferase by B9 cells indicated that CGGGCAACGTCGGGGCACCCATGCCGCCGCCGC the monocistronic plasmid integrated into the genomic CACCTCTGCCAA C 3', SEQ ID NO: 81) encompassing DNA. Semi-quantitative PCR was performed to determine 40 nucleotides 26 to 49 of the 5' UTR of Survivin as well as the the number of copies of the reporter plasmid integrated per first 21 nucleotides of the open reading frame of survivin B9 cell. As FIG. 6A shows, series diluted plasmid pluc5'+ were annealed at 45 C and extended at 72 C with Taq 3'vegf-UTR were included as positive control to make sure polymerase. The Sal I and BamH I restriction sites (under the reaction for sample (genomic DNA from B9 cells) was lined) were used for Subsequent cloning. within the linear range, i.e., not saturated. The PCR standard 45 The 3' UTR of survivin was amplified from human curve was plotted with the PCR product intensity against the genomic DNA using the 3' UTR forward oligonucleotide (5' amount of positive plasmid control loaded for PCR (FIG. AAAGCGGCCGCGGCCTCTGCCGGAGCTGCCTG 6B). Sigma plot regression indicated that PCR product GTCCCAGA 3', SEQ ID NO: 82) and the 3' UTR reverse intensity for B9 genomic DNA (50 ng) is about the same oligonucleotide (5' AAATCTAGACTCAGGAACAGC level of 6.4 pg plasmid control. As 1 mg of 8 kb plasmid 50 CGAGATGACCTCCAGA 3', SEQ ID NO: 83). The Not I roughly contains 10' copies and 10° cells have 10 mg and Xba I restriction sites were used for Subsequent cloning. genomic DNA, the results here indicated that approximately 8.2.2. Plasmid Construction 100 copies of the plasmid were integrated per cell. The survivin 3' UTR PCR product generated in Section High throughput screening (“HTS) for compounds that 8.2.1 was cloned into the pT-Adv for sequence verification. inhibit untranslated region-dependent expression of vascular 55 A positive clone was subsequently digested with Not I and endothelial growth factor (“VEGF) is accomplished with Xba I and the resulting 1.1 kb survivin 3' UTR PCR the generated stable cell lines. fragment was subcloned into pcDNA3.1/Hygro (Invitrogen cat. no. V87020) to generate the intermediate plasmid 8. EXAMPLE Surv3'UTR/pcDNA3.1/Hygro. 60 The survivin 5' UTR DNA fragment generated in Section Survivin 8.2.1 was digested with Sal I and BamHI and was subcloned into p2.luci (see, e.g., Grentzmann et al., 1998, RNA 4:479 8.1. Introduction 486) to generate the intermediate plasmid, Survis'UTR/ Survivin, a member of IAP (inhibitor of apoptosis pro p2luci, which contains the 5' UTR of survivin between the teins) gene family, is critically required for Suppression of 65 open reading frames of the renilla and firefly luciferase apoptosis and ensuring cell division through the G2/M phase reporter genes. Survis'UTR/p2luci was then digested with of the cell cycle. It is absent in normal adult tissues, but either Sal I and Not I or BamHI and Not I to isolate and gel US 9,493,845 B2 137 138 purify the 1.75 kb survivin 5' UTR-firefly luciferase or the single well in a six or twenty-four well plate using trypsin 1.7 kb firefly luciferase DNA fragments. The Sal I 5' soaked filter discs according to manufacture’s instructions. overhang of the 1.75 kb survivin 5' UTR-firefly luciferase Individual cell lines are then selected for further studies fragment was filled-in with T4 DNA polymerase and was based on firefly luciferase expression levels. subcloned into both Surv3'UTR/pcDNA3.1/Hygro and 8.2.4. Luciferase Assays pcDNA3.1/Hygro digested with EcoR V and Not I to Firefly luciferase activity was measured with the generate the plasmids, Surviš'UTR-Fluc-Surv3'UTR/ luciferase reporter assay system (Promega) according to pcDNA3.1/Hygro and Surviš'UTR-Fluc/pcDNA3.1/Hygro. manufacture’s instructions. The former plasmid contains the firefly luciferase reporter 8.2.5. High Throughput Screening gene surrounded by both the 5' and 3' untranslated regions 10 High throughput screening (“HTS) for compounds that of survivin while the latter plasmid contains the firefly inhibit untranslated region-dependent expression of Survivin luciferase reporter gene preceded only by the 5' UTR of is accomplished with stable cell lines described in Section survivin and will be used as a '5' UTR-only” control plasmid 8.2.3. The 293T cell line contained stably integrated copies in future experiments. The 1.7 kb BamH I-Not I firefly of the firefly luciferase gene flanked by both the 5' and 3' luciferase fragment was subcloned into both Surv3'UTR/ 15 UTRs of survivin. Cell lines exhibiting consistently high pcDNA3.1/Hygro and pcDNA3.1/Hygro to generate the levels of firefly luciferase expression are further expanded plasmids, Fluc-Surv3'UTR/pcDNA3.1/Hygro and Fluc/ and optimized for HTS. pcDNA3.1/Hygro. The former plasmid contains the firefly Screening of compounds is done using one hundred luciferase reporter gene followed only by the 3' UTR of 384-well plates per day. Each 384-well plate contains a survivin and will be used as a “3' UTR-only” control plasmid standard puromycin titration curve that is used as a reference in future experiments. The latter plasmid contains only the to calculate % inhibition and the statistical significance of firefly luciferase reporter gene lacking any Surrounding the data points generated in the assay. This curve occurs in untranslated regions of Survivin and will be used in Subse wells from column 3 and 4 of the 384-well plate. The quent studies as a “no UTR control plasmid. concentration of puromycin is 20 mM serially diluted 2-fold Since the 5' UTR of survivin is small (49 nucleotides), it 25 to 0.078 mM plated in quadruplicate. Columns 1 and 2 is likely that cap-dependent and cap-independent firefly contain 16 standards each of a positive control 0.5% DMSO luciferase expression in the Survivin expression plasmids and a negative control consisting of the puromycin at 20 described above cannot be distinguished. One method of mM. The difference between the two controls is used as the separating cap-dependent from cap-independent translation window to calculate the percentage of inhibition of is through the introduction of a stable hairpin or secondary 30 luciferase expression in the presence of a compound. Col structure upstream or near the 5' end of the 5' UTR of the umns 5 through 24 contain compounds from a library of expression vector (see, e.g., Muhlrad et al., 1995 Mol. Cell. small molecules. Biol. 15:21.45-2156). Therefore, two complementary oligo Two confluent T175 flasks of the survivin stable cell line nucleotides, SL top (5' CTAGAAGCTTAGGGCCGCG described above are split into twenty T175 flasks three days GATCCGCGCGCGGTTCGCCGCGCGCGGATCCGCG 35 prior to screening. On each day of the HTS assay, the cells GTAGCAAGTTAGTC 3', SEQ ID NO: 84) and SL bottom are dislodged from the flask with 3 ml of 0.25% trypsin (5 GACTAAGCTTGCTACCGCGGATCCGCGCGCGGC EDTA (Gibco, cat no. 25200-056) and diluted to 10 ml with GAACCGCGCGCGGATCCGCG GCCCTAAGCTTCTAG non-selective media. This is repeated for all twenty flasks 3', SEQ ID NO: 85) were synthesized, digested with Hind and the cells are combined, counted and diluted to a con III, annealed and Subcloned into the Survivin expression 40 centration of 263.15 cells/ml. 38 ml are then added to each vectors described above. A stable stem-loop structure with well containing 2 ml of compound from a Small molecule an 18 base-pair stem and a UUCG loop sequence will form library to a final compound concentration of 7.5 mM (3.75 and effectively block cap-dependent translation (see, e.g., mg/ml) in 0.5% DMSO. The puromycin standard curve also Beelman & Parker, 1994. J. Biol. Chem. 269:9687-9692 and contains 0.5% DMSO. The stable cell line is incubated in the Muhlrad et al., 1995 Mol. Cell. Biol. 15:2145-2156). 45 presence of compound overnight (approximately 16 hours) 8.2.3. DNA Transfection and Stable Cell Line Generation at 37 C in 5% CO. To monitor firefly luciferase activity, 293T cells were transiently transfected with equal LucLite Plus (Packard cat no. 6016969) is prepared accord amounts of each of the survivin expression vectors described ing to manufactures instructions and 20 ml is added to each in Section 8.2.2 (both with and without each of the 5' and 3' well. Following a brief incubation at room temperature UTRs of survivin and in the presence and absence of the 50 (minimum 2 min.), firefly luciferase activity in each well is stem-loop secondary structure) using the Fugene 6 transfec detected with the ViewLux 1430 ultraHTS Microplate tion reagent (Roche) according to manufacture’s instruction. Imager (Perkin Elmer). All data obtained is uploaded into Untranslated region-dependent firefly luciferase activity was Activity Base for % inhibition calculations and statistical monitored forty-eight hours post-transient transfection analyses. according to manufacture’s instruction (see, e.g., Section 55 8.3. Results 8.2.4.). To determine the effect of the survivin untranslated To generate stable cell lines, 293T cells were transiently regions on post-transcriptional control of gene expression, transfected as above. Instead of lysing the transiently trans transient transfections of the Survivin expression vectors fected 293T cells to monitor firefly luciferase activity, the described in Section 8.1.2., containing both, one or none of cells were trypsinized, counted and seeded (10 ml) in 10 cm 60 the 5' and 3' UTRS of Survivin both in the absence or petri dishes at a concentration of 5000 cells/ml. The follow presence of the stem-loop secondary structure were per ing day, hygromycin B was added in culture media to a final formed. In the absence of the stem-loop secondary structure, concentration of 200 mg/ml to select for cells in which the cap-dependent and cap-independent translation are equally transiently transfected plasmid has stably integrated into the favored and no significant difference in firefly luciferase genome. Following ten to fourteen days of hygromycin B 65 expression could be detected when either or both of the 5' selection, individual hygromycin-resistant clones were and 3' UTRs are present or absent (FIG. 7A). This results expanded by transferring the cells from the petri dish to a confirms the earlier notion that, in the Survivin expression US 9,493,845 B2 139 140 vectors without the stem-loop secondary structure, the 5' sense minus uORF Nicol primer is: gg.ccccatggcticcggctg UTR of survivin is unable to block cap-dependent transla gacceggctgggacceggctgggagggegegggagggegegg (SEQ ID tion. In the presence of the stem-loop secondary structure, a NO:91). The primers (10 micrograms) were denatured at 95 3-fold increase in firefly luciferase expression can be C for 2 minutes, annealed at 60C for 5 minutes and extended detected only in the Survivin expression vectors that contain at 72 C for 10 minutes using Taq polymerase (Clontech). the 5' UTR of survivin (FIG. 7B). This result strongly After buffer-exchange, the product was digested with NcoI suggests that the 5' UTR of survivin can function as an and HindIII and cloned in the HindIII/Nicol sites of the in internal ribosome entry site and promote cap-independent vitro expression vector pT7Luc and pT7Luc/3'UTR, yield translation and helps explain the increase in the endogenous ing pT7Luc/5'UTR minus uORF and pT7Luc/5'UTR minus levels of survivin in the G2/M phase of the cell cycle when 10 uORF and 3' UTR. Both plasmids were digested with overall translation is dramatically reduced. High throughput screening (“HTS) for compounds that HindIII and KpnI and the Her-2 containing fragment was inhibit untranslated region-dependent expression of Survivin subcloned into the HindIII/KpnI site of pcDNA (+) (Invit is accomplished with the generated stable cell lines. rogen) for cell-based studies. 15 9.2. Stable Cell Line Production 9. EXAMPLE Stable cell lines were generated in HeLa, 293T, and MCF-7. First, transient transfection was carried out using HER-2 the Fugene 6 transfection reagent (Roche) according to manufacturers instructions. Untranslated region-dependent This Example demonstrates the generation of stable cell firefly luciferase activity was monitored forty-eight hours lines, harboring Her-2 5' and 3'UTR sequences, to identify post-transient transfection with the luciferase reporter assay small molecular weight compounds that inhibit Her-2 5' system (Promega) according to manufacture’s instructions. UTR-dependent translation or modulate Her-2 mRNA sta Next, stable cell lines were generated by first transiently bility. transfecting the above cell lines. Instead of lysing the 9.1. Her-2 Constructs 25 transiently transfected 293T cells (or other), the cells were 9.1.1. Generation of her-2 In Vitro Expression Constructs trypsinized, counted and seeded (10 ml) in 10 cm petri The 99 nucleotide 5' UTR of Her-2 was PCR-amplified dishes at a concentration of 5000 cells/ml. The following from a human genomic DNA (Promega) using the following day, hygromycin B was added in culture media to a final primers: Sense/HindIII: CAAGAAGCTTg.cgcccggc concentration of 100 mg/ml for 293T cells and 200 mg/ml cccccacccctcg (SEQID NO: 86) and Antisense/NcoI: AGC 30 CCATGGtgcticactg.cggcticcgg.cccc (SEQ ID NO: 87). The for MCF-7 and Hela, to select for cells in which the Advantage-GC2-PCR kit was used according to the manu transiently-transfected plasmid has stably integrated into the facturers instructions (Clontech) with the following condi genome. Following ten to fourteen days of hygromycin B tions: PCR cycle conditions were 94 C, 3 minutes, followed selection, individual hygromycin-resistent clones were by 35 cycles of 94 C, 30 seconds, and 68 C, 30 seconds. The 35 expanded by transferring the cells from the petri dish to a PCR-amplified product was cloned using the pT Adv kit single well in a six or twenty-four well plate using trypsin (Clontech) according to the manufacturers instructions. All soaked filter discs according to manufacture’s instructions. clones were confirmed by sequencing. The resulting clone Individual cell lines are then selected for further studies was digested with HindIII/NcoI and the fragment was based on firefly luciferase expression levels. cloned into pT7Luc, upstream of the luciferase gene, to 40 9.3. In Vitro High Throughput Screen generate pT7Luc/5'UTR. Construct pT7Luc/5' and 3'UTR is utilized as a template The 615 nucleotide 3'UTR was PCR-amplified from for large-scale T7 polymerase transcription according to the human genomic DNA (Promega) using the following prim manufacturer's protocol (Ambion). The mRNA template ers: sense/BglII: agactctgaaccagaaggccaa (SEQID NO: 88) containing the Her-2 5' and 3' UTR and the Luciferase ORF and antisense/KpnI: ctcggtaccagttccaaaatatatttgcaaatgg 45 is uncapped and used at 100 nanograms/reaction for a (SEQID NO: 89). The Titanium Taq kit (Clontech) was used typical in vitro HTS. The number of samples run determines according to the manufacturers instructions with the fol the amount of transcription yield that must be obtained. For lowing amplification conditions: 94 C, 1 minute, followed example, for 100,000 reactions, using 100 nanograms of by 35 cycles at 94 C, 30 seconds to denature, 60 C 30 RNA/reaction, 10 milligrams of RNA must be produced. seconds to anneal, 72 C 1 minute to extend. The product was 50 Typical yields from the Ambion T7 Transcription Kit for this gel purified and cloned using pT Adv (Clontech) according template are 5 mg/ml of transcription. to the manufacturer's instructions. All clones were sequenced. The resulting clone was digested with BglII/ Screening of compounds is done using one hundred KpnI and cloned into a BglII/KpnI digested pT7Luc and 384-well plates per day. Each 384-well plate contains a pT7Luc/5'UTR to generate pT7Luc/3'UTR and pT7Luc/5' 55 standard puromycin titration curve that is used as a reference and 3'UTR, respectively. to calculate % inhibition and the statistical significance of 9.1.2. Generation of Her-2 In Vivo Expression Constructs the data points generated in the assay. This curve occurs in Constructs for cell-based expression were generated by wells from column 3 and 4 of the 384-well plate. The isolation of Her-2 containing fragments of pT7Luc/5' UTR, concentration of puromycin is 20 mM serially diluted 2-fold pT7Luc/3'UTR and pT7Luc/5' and 3'UTR digested with 60 to 0.078 mM plated in quadruplicate. Columns 1 and 2 HindIII and KpnI and cloned into pcDNA (+) (Invitrogen). contain 16 standards each of a positive control of 4% DMSO 9.1.3. Generation of Her-2 uORF Mutants and a negative control consisting of the puromycin at 20 The uORF contained within the Her-2 5' UTR was mM. The difference between the two controls is used as the removed by extending the overlapping long primers. The window to calculate the percentage of inhibition of overlapping sequence is underlined. The sense minus uORF 65 luciferase expression in the presence of a compound. Col HindIII primer is: cccaagctitcgcgcccggccccccacccctcgcag umns 5 through 24 contain compounds from a library of cacccc.gc.gccccg.cgccctccc (SEQ ID NO: 90) and the anti Small molecules. US 9,493,845 B2 141 142 The in vitro translation reaction of the Her-2 driven 10. EXAMPLE Luciferase ORF consists of four microliters of rabbit reticu locyte lysate (Green Hectares) supplemented with 0.013 Cell Expression Vectors mgs/ml hemin (Sigma), 0.05 mgs/ml creatine kinase Stable cell line expression vectors (pCMR1 and pCMR2) (Roche), and 0.125 mgs/ml tRNA (Sigma Type XII, rabbit are shown in FIGS. 8A and 8C. pCMR1, a high-level stable liver), 100 nanograms uncapped mRNA and buffer contain and transient mammalian expression vector designed to ing 100 mM KOAc, 0.5 mM Mg(OAc), 10 mM creatine randomly integrate into the genome and pCMR2 is an phosphate, 0.03 mM amino acid mix, in a reaction Volume episomal mammalian expression vector. pMCP1 (FIG. 8B) of 20 ml. The reaction is then incubated at 30 C for 45 is a high level stable and transient mammalian expression 10 vector designed to site-specifically integrate into the genome minutes. At the end of incubation, 20 mL of LucLite of cells genetically engineered to contain the FRT site (Packard) is added to the reaction and the light output specific recombination site via the Flp recombinase (see, resulting from luciferase catalyzed conversion of luciferin, e.g., Craig, 1988, Ann. Rev. Genet. 22: 77-105; and Sauer, is monitored on a ViewLux uHTS Plate reader (Perkin 1994, Curr. Opin. Biotechnol. 5: 521-527). The nucleotide Elmer). sequences are presented below.

pCMR1 (SEQ ID NO: 92) gacggat.cgggagat citcc.cgatcc cc tatggtgcact ct cagtacaatctgctctgatgcc.gcatagittaa.gc.cagtatctgctic cct gcttgttgttgttggaggtogctgagtag tecgc.gagcaaaatttaa.gctacaacaaggcaaggcttgaccgacaattgcatgaagaat Ctgcttagggittaggcgttittgcgctgct tcgcgatgtacgggccagatatacgc.gttgacattgattattgact agtt attaatagtaatc aattacgggg.tc attagttcatagoccatatatggagttc.cgcgttacatalacttacggtaaatggc.ccgc.ctggct gaccgcc caac gaccc.ccgcc cattgacgt caataatgacg tatgttcc catagtaacgc.caatagggactitt coattgacgtcaatgggtggag tattt

accidtaaactdcc.cactitcCCactaCat99 9 ggcag Caactictatoatatoccaadtgtg 9 9 accCCCCCtatto9 gacg acct CaatcaccidtaaatcCCCCCCgacgg 99 9 ctggcattatgcc.cagtacatgacct tatggg acttitcct acttggcagta catctacgt attagt catcgct attaccatggtgatgcgg ttittggcagtacat caatgggcgtggatagcggtttgact cacggggattt coaagtaccaccc cattgacgt caatgggagtttgttt tggcaccaaaatcaacgggactitt C caaaatgtcgtaacaacticcgc.cc cattgacgcaaatgggcgg taggcgtgtacggtggga ggtctatataag cagagct Ctctggctaactalagctitt cqgcgc.gc.cgagg taccatgggat.ccgalagacgc.caaaaac at aaaga aaggc.ccggcgc.cattctatcct ctagaggatggaaccgctggaga.gcaactgcataaggctatgaagagatacgcc ctggttcct ggaacaattgcttt tacagatgcacat atcgaggtgaa catcacgtacgcggaat actitcgaaatgtc.cgttctggttggcagaa.gctat

gaaacgatatgggctgaatacaaat cacagaatcgt.cg tatgcagtgaaaact ct cttcaattctt tatgc.cggtgttgggcgcgittattt

atcggagttgcagttgcgc.ccgcgaacga catttataatgaacgtgaattgct caacagtatgaac attitcgcagcct accgtagtgtt

tgtttccaaaaaggggttgcaaaaaattittgaacgtgcaaaaaaaattaccaataatccagaaaattattat catggattictaaaacgga

ttaccagggattitcagt cqatigtacacgttcgtcacat ct catctacct cocq gttittaatgaatacgattttgtaccagagtic ctittgatcg

tgacaaaacaattgcactgataatgaatticcitctggat ct actgggttacctaagggtgtggcc ct tcc.gcatagaactgcctg.cgtca

gattct cqcatgccagagatcct atttittggcaatcaaat cattccggatactg.cgattittaagtgttgttcc attc catcacggttittggaa

tgtttact acacticggatatttgatatgtggattitcgagt cqtcttaatgtatagatttgaagaagagctgtttittacgat.ccctt caggatta

caaaattcaaagtgcgttgctag taccaa.ccc tattitt catt citt cqccaaaag cactctgattgacaaatacgatttatctaatttacacg

aaattgct tctggggg.cgcacct ctitt.cgaaagaagttctggggaag.cggttgcaaaacgct tccatctt.ccagggatacgacaaggat

atgggctic actgagactacat cagctatt Ctgattacaccc.gagggggatgataa accgggcgcggtcggtaaagttgttc cattttitt

gaagcgalaggttgttggatctggataccgggaaaacgctgggcgittaatcagagaggcgaattatgtgtcagaggacctatgatt at

gtc.cggittatgtaaacaatcc.ggaagc gaccalacgc.cttgattgacaaggatggatggct acattctggagaCatagct tactggga

cgaagacgaacactitctt catagttgaccgcttgaagttctittaattaaatacaaaggatat caggtggcc.ccc.gctgaattggaatcga

tattgttacaac accc.caa.catctt.cgacgcgggcgtggCaggtott CC cacgatgacgc.cggtgaactt CCCdcc.gc.cgttgttgt

tittggagcacggaaagacgatgacggaaaaagagat.cgtggattacgtc.gc.cagt caagtaacaac cqcgaaaaagttgcgcgg

aggagttgttgtttgttggacgaagtaccgaaaggit cttaccggaaaacticgacgcaagaaaaatcagagagatcct catalaaggc.ca

agaagggcggaaagtic caaattgcgcggcc.gcta actic gagaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcatt C

US 9,493,845 B2 155 156 EQUIVALENTS foregoing description and accompanying figures. Such - modifications are intended to fall within the scope of the The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various appended claims. modifications of the invention in addition to those described 5 Various publications are cited herein, the disclosures of will become apparent to those skilled in the art from the which are incorporated by reference in their entireties.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 9 O

<21 Os SEQ ID NO 1 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: consensus G-quartet element from synthetic sequences 22 Os. FEATURE: <221s NAMEAKEY: misc feature <222s. LOCATION: 3, 7, 8, 11 <223> OTHER INFORMATION: n = a, t, c, or g 22 Os. FEATURE: <221s NAMEAKEY: misc feature <222s. LOCATION: (7) . . (8) <223> OTHER INFORMATION: This represents one form of the sequence as described, other forms described may have up to five nucleotides in this variable region <4 OOs SEQUENCE: 1 ggntggningg intgg 14

<21 Os SEQ ID NO 2 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: synthetic G-quartet oligonucleotide 22 Os. FEATURE: <221s NAMEAKEY: misc feature <222> LOCATION: 3, 4, 7, 8, 11, 12 <223> OTHER INFORMATION: n = a, t, g or c 22 Os. FEATURE: <221s NAMEAKEY: misc feature <222> LOCATION: 3, 4, 7, 8, 11, 12 <223> OTHER INFORMATION: This represents one form of the sequence as described, other forms described have longer variable regions, typical is 2 - 10 nucleotides <4 OOs SEQUENCE: 2

ggninggningg ningg 14

<21 Os SEQ ID NO 3 &211s LENGTH: 61 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Antisense minus uoRF NooI primer

<4 OOs SEQUENCE: 3 ggCCC catgg CtcCggctgg accCggctgg gaccc.ggctg gaggg.cgcg ggaggg.cgc.g 60

9 61

<21 Os SEQ ID NO 4 &211s LENGTH: 19 212s. TYPE RNA <213> ORGANISM: Oryctolagus cuniculus 22 Os. FEATURE: <223> OTHER INFORMATION: subunit of 15-LOX-DICE