Eastern Mediterranean Health Journal

La Revue de Santé de la Méditerranée orientale

Immunizing against polio Polio has re-emerged in some countries in the Region that had previously been polio-free for years, emphasising the urgent need to ensure vaccination of all children.

Volume 19 / No. 11 2013 ¼¼Ø{L PL HnšUÐ{dœCÐ November / Novembre FeRŽi ©n›UÐŒxP> ‚G™BÐçOTogœZTÐoc›BÐ ‹x{bšUFfYwí phCn_UÐp[UÐpe^fe=ƒHŽšCÐçPUehdSüÐošcCÐŒLÚ{[>šUÐpheH}UÐpdœCЏw phýn=ŽUÐÓnh]_CÐí‹hwnaCÐíÊÐÚùÐéØn˜šUíºn4sxíGUÐíph[UÐÓnY{#Ð;Ò{x{!ÐÓÐÚØn˜CÐíÓnHnh—UÐ ŠTOÎpg@ŽYwí ƒHŽšCÐç ‹hdSl=ngfYˆd_šxnYpÉnBíºÓnYŽd_CÐŒY‰UÙEQíÔn=úÐsýnšií ~TÐ}CÐíºphf_CÐphYŽc"ÐEQÓ5^fCÐÐ|Tíºphehd_šUÐ{wn_CÐ}ýnHíph˜]UÐÓnhdcUÐíºph[UÐŒgCÐÊn\LÌ @ÚnBí‹hdSüÐ;p[Un=NešgCÐØÐ}RúÐíphCn_UÐp[UÐpe^fY Ypiín_šCÐ

EASTERN MEDITERRANEAN HEALTH JOURNAL IS the official health journal published by the Eastern Mediterranean Regional Office of the World Health Organization. It is a forum for the presentation and promotion of new policies and initiatives in health services; and for the exchange of ideas, con- cepts, epidemiological data, research findings and other information, with special reference to the Eastern Mediterranean Region. It addresses all members of the health profession, medical and other health educational institutes, interested NGOs, WHO Col- laborating Centres and individuals within and outside the Region.

LA REVUE DE SANTÉ DE LA MÉDITERRANÉE ORIENTALE EST une revue de santé officielle publiée par le Bureau régional de l’Organisation mondiale de la Santé pour la Méditerranée orientale. Elle offre une tribune pour la présentation et la promotion de nouvelles politiques et initiatives dans le domaine des ser-vices de santé ainsi qu’à l’échange d’idées, de concepts, de données épidémiologiques, de résultats de recherches et d’autres informations, se rapportant plus particulièrement à la Région de la Méditerranée orientale. Elle s’adresse à tous les professionnels de la santé, aux membres des instituts médicaux et autres instituts de formation médico-sanitaire, aux ONG, Centres collabora- teurs de l’OMS et personnes concernés au sein et hors de la Région.

EMHJ is a trilingual, peer reviewed, open access journal and the full contents are freely available at its website: http://www/emro.who.int/emhj.htm EMHJ information for authors is available at its website: http://www.emro.who.int/emh-journal/authors/

EMHJ is abstracted/indexed in the Index Medicus and MEDLINE (Medical Literature Analysis and Retrieval Systems on Line), ISI Web of knowledge, the Cumulative Index to Nursing and Allied Health Literature (CINAHL), CAB International, Lexis Nexis, Scopus and the Index Medicus for the WHO Eastern Mediterranean Region (IMEMR).

©World Health Organization 2013 All rights reserved

Disclaimer The designations employed and the presentation of the material in this publication do not imply the expression of any opinion whatsoever on the part of the World Health Organization concerning the legal status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or boundaries. Dotted lines on maps represent approximate border lines for which there may not yet be full agreement. The mentionof specific companies or of certain manufacturers’ products does not imply that they are endorsed or recommended by the World Health Organization in preference to others of a similar nature that are not mentioned. All reasonable precautions have been taken by the World Health Organization to verify the information contained in this publication. However, the published material is being distributed without warranty of any kind, either express or implied. The responsibility for the interpretation and use of the material lies with the reader. In no event halls the World Health Organization be liable for damages arising from its use. The named authors alone are responsible for the views expressed in this publication.

ISSN 1020-3397

Cover designed by Diana Tawadros Internal layout designed by Emad Marji and Diana Tawadros Printed by WHO Regional Office for the Eastern Mediterranean Eastern Mediterranean La Revue de Santé de Health Journal la Méditerranée orientale

املجلد التاسع عرش عدد Vol. 19 No. 11 • 2013 • 11 Contents

Editorial An ancient scourge triggers a modern emergency Bruce Aylward ...... 903 Research articles Arabic version of the Global Mental Health Assessment Tool—Primary Care version (GMHAT/PC): a validity and feasibility study V.K. Sharma, S. Durrani, M. Sawa, J.R.M. Copeland, M.T. Abou-Saleh, S. Lane and P. Lepping...... 905 Predictors of smoking among male college students in Saudi Arabia Y.S. Almogbel, S.M. Abughosh, F.S. Almogbel, I.A. Alhaidar and S.S. Sansgiry...... 909 Salt intake in Eastern Saudi Arabia A.M. Alkhunaizi, H.A. Al Jishi and Z.A. Al Sadah...... 915 Investigating inspection practices of pharmaceutical manufacturing facilities in selected Arab countries: views of inspectors and pharmaceutical industry employees S. Garg, R. Hasan, S. Scahill and Z. Ud-Din Babar...... 919 Pharmacovigilance in Qatar: a survey of pharmacists K. Wilbur...... 930 Isolation and identification ofLegionella pneumophila from drinking water in Basra governorate, Iraq A.A. Al-Sulami, A.M.R. Al-Taee and A.A. Yehyazarian...... 936 Molecular typing of Mycobacterium spp. isolates from Yemeni tuberculosis patients A.A. Al-Mahbashi, M.M. Mukhtar and E.S. Mahgoub...... 942 High prevalence of Klebsiella pneumoniae carbapenemase-mediated resistance in K. pneumoniae isolates from Egypt L. Metwally, N. Gomaa, M. Attallah and N. Kamel...... 947 Prognostic factors of Atractylis gummifera L. poisoning, Morocco S. Achour, N. Rhalem, S. Elfakir, A. Khattabi, C. Nejjari, A. Mokhtari, A. Soulaymani and R. Soulaymani...... 953 Case report Case of acquired lobar emphysema mimicking pneumothorax in a neonate F. Firinci, N. Duman, O. Ates, E. A. Ozer, A. Kumral, A. Erdemir and H. Ozkan...... 960 Dr Ala Alwan, Editor-in-chief Editorial Board Professor Zulfiqar Bhutta Professor Mahmoud Fahmy Fathalla Professor Rita Giacaman Dr Ziad Memish Dr Sameen Siddiqi Professor Huda Zurayk International Advisory Panel Dr Mansour M. Al-Nozha Professor Fereidoun Azizi Professor Rafik Boukhris Professor Majid Ezzati Dr Zuhair Hallaj Professor Hans V. Hogerzeil Professor Mohamed A. Ghoneim Professor Alan Lopez Dr Hossein Malekafzali Professor El-Sheikh Mahgoub Professor Ahmed Mandil Dr Hooman Momen Dr Sania Nishtar Dr Hikmat Shaarbaf Dr Salman Rawaf Editors Fiona Curlet, Guy Penet Eva Abdin, Alison Bichard, Marie-France Roux Graphics Suhaib Al Asbahi, Hany Mahrous, Diana Tawadros Administration Nadia Abu-Saleh, Yasmeen Sedky املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

Editorial An ancient scourge triggers a modern emergency Bruce Aylward 1

The Eastern Mediterranean – crossroads religious leaders to ensure that all par- innovation by commissioning the fast- of the world. Sitting for millennia on ents understood their obligation to vac- track development and use of a new ancient, vital trade and travel routes, cinate their children, the United Arab monovalent OPV (mOPV1); polio leaders here have faced a twofold chal- Emirates reconfirmed their US$ 120 transmission there stopped almost im- lenge in protecting their people from million pledge for polio made earlier mediately. In Afghanistan, the Ministry the ravages of infectious diseases: first, this year; most striking, 7 countries im- of Public Health courageously support- the control of pathogens native to these mediately agreed to coordinate the ed the painstaking work of negotiating lands and, secondly, the elimination of vaccination of 22 million children over vaccinator access to every corner of those pathogens which gain entry with the subsequent 3 weeks, and again in Kandahar and Helmand provinces; as travellers, traders and pilgrims. The most December, to again vanquish polio in of November 2013, the country passes dangerous of this latter group are those the Middle East. All countries called on its first anniversary with no child hav- organisms that enter the region silently, Pakistan to rapidly access and vaccinate ing been paralysed by an indigenous then spread widely before suddenly all of its children as a matter of urgency poliovirusa. emerging with terrible consequences to stem the international spread of its As importantly, major regional in- for the most vulnerable populations. viruses. stitutions – including the Organization This past month, an ancient virus This decisive leadership and rapid of Islamic Cooperation and the Islamic again re-emerged in the Middle East, emergency action builds on a long and Development Bank – have brought more than a decade after most health illustrious history of infectious disease their voices and resources to the effort leaders thought it had been vanquished control, vaccination and, especially, po- to secure a polio-free world. Religious there forever. lio eradication in the Eastern Mediter- leaders, led by the Grand Imam of Al On 28 October 2013, the Minister ranean Region. Azhar, have formed an Islamic Advisory of Health of the Syrian Arab Republic A few examples reinforce the strik- Group for the Global Polio Eradication announced to his counterparts from 22 ing accomplishments of this Region on Initiative to ensure parents know that countries of the Eastern Mediterranean its road to becoming polio-free. they are obligated to ensure all children Region of the World Health Organiza- When poliovirus roared out of are vaccinated and to ensure communi- tion, that after a 15-year absence, polio northern Nigeria 10 years ago follow- ties assure the safe passage and work of was again paralysing and killing chil- ing the temporary suspension of oral vaccinators. dren in his country. Genetic sequencing poliovirus vaccine (OPV) in 2 states, This central role of the Eastern showed that the virus had originated in nearly 2 dozen previously polio-free Mediterranean in polio eradication led Pakistan and already travelled to Egypt, countries became re-infected and global leaders in philanthropy, develop- Israel, the Gaza Strip and the West Bank thousands of children were needlessly ment and vaccinology to gather in Abu over the previous 12 months. paralysed; Saudi Arabia led the world Dhabi in April 2013 to launch the new Within 24 hours, the assembled in boldly introducing new polio vac- Polio Eradication & Endgame Strategic Ministers declared this re-infection of cination requirements for all travellers Plan 2013–2018 [3] and pay tribute to the Middle East an emergency for the from polio-infected countries to protect the commitment of the Region’s leaders entire Eastern Mediterranean Region, pilgrims, travellers and Saudi Arabians to immunization and disease eradica- calling for extraordinary joint action to alike [2]. When it appeared impossible tion. combat this ancient scourge [1]. The to interrupt polioviruses in Egypt due The major unresolved threat to Minister of Oman announced US$ 5 to the very high population density, the Region’s deep commitment to million in new financing for the effort, particularly in the mega-city of Cairo/ complete polio eradication is now the Saudi Arabia declared it would mobilize Giza, that country led the world in decision by a handful of local leaders in

aFor the first time in history, all polio cases detected in Afghanistan in 2013 have been due to imported viruses (originating in Pakistan’s Federally Administered Tribal Areas or FATA).

1Assistant Director-General, Polio, Emergencies and Country Collaboration, World Health Organization, Geneva, Switzerland.

903 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

parts of north-west Pakistan and south/ and Somalia to restart vaccination in and which continues to inspire the en- central Somalia to withhold vaccina- those areas. tire Global Polio Eradication Initiative. tion and protection from the devastat- 2014 must be the year in which the The first recorded image of polio in ing effects of this disease. As national Eastern Mediterranean conquers this the world is from the Eastern Mediter- and regional leaders launch their new ancient menace by backing this emer- ranean, where the consequences of this emergency eradication effort to again gency response with the leadership, gen- disease were captured in a 5000 year- eliminate polio in the Middle East, they erosity, innovation, determination and old stele from Egypt. There is absolutely must at the same time rapidly reconcile diligence that has been characteristic of no reason why the last image of polio the concerns of local leaders in Pakistan this Region’s work in polio eradication should be from this Region.

References

1. WHO Regional Committee for the Eastern Mediterranean 3. Polio eradication and endgame strategic plan 2013–2018. Ge- Resolution EM/RC60/R.3. Escalating Polio Emergency in the neva, Global Polio Eradication Initiative, 2013 (http://www. Eastern Mediterranean Region (http://applications.emro. polioeradication.org/Resourcelibrary/Strategyandwork.aspx, who.int/docs/RC60_Resolutions_2013_R3_15136_EN.pdf, ac- accessed 30 November 2013). cessed 30 November 2013). 2. International travel and health. Geneva, World Health Organi- zation (www.who.int/ith, accessed 30 November 2013).

904 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

Arabic version of the Global Mental Health Assessment Tool—Primary Care version (GMHAT/PC): a validity and feasibility study V.K. Sharma,1 S. Durrani,2 M. Sawa,3 J.R.M. Copeland,4 M.T. Abou-Saleh,5 S. Lane 6 and P. Lepping 7

النسخة العربية من األداة العاملية لتقييم الصحة النفسية – نسخة الرعاية األولية: دراسة حول صحتها وإمكانية استخدامها فيامل شارما، شازيا دوراين، ماثيو سوا، جون كوبالند، حممد أبو صالح، ستيفن لني، بيرت ليبنغ اخلالصـة:يشوب النقص خدمات الصحة النفسية يف إقليم رشق املتوسط. وملا كانت األداة العاملية لتقييم الصحة النفسية – نسخة الرعاية األولية هي أداة حموسبة ومهيكلة ًجزئيا للتقييم الرسيري، أعدت كي تساعد العاملني الصحيني عىل إجراء تقييامت رسيعة ومالئمة وشاملة ومعيارية؛ فقد أجرى الباحثون هذه الدراسة يف اإلمارات العربية املتحدة لتقييم جدوى وإمكانية استخدام النسخة العربية هلذه األداة. وقد ّطبقت ممرضات الصحة النفسية هذه االستامرة عىل مخسني ًمريضايف مواقع الصحة النفسية والتأهيل النفيس؛ ثم قارن الباحثون التشخيص لدهيم بالتشخيص الرسيري يف الطب النفيس املستقل الذي يستند عىل الطبعة العارشة من التصنيف الدويل لألمراض للمرىض ذاهتم. ووجدت املمرضات أن األداة أكثر سهولة يف التطبيق، وتستغرق 16 دقيقة، وكان هناك 94 97 0.91 توافق ّجيدبني التشخيص املستند عىل األداة وبني تشخيص األطباء النفسيني )كابا = (، وكانت احلساسية مرتفعة ) %(، والنوعية مرتفعة ) %(.

ABSTRACT Mental health services are far from satisfactory in the Eastern Mediterranean Region. The Global Mental Health Assessment Tool—Primary Care version (GMHAT/PC) is a semi-structured, computerized clinical assessment tool that was developed to assist health workers in making quick, convenient and comprehensive standardized mental health assessments. A study was carried out in the United Arab Emirates to evaluate the validity and feasibility of the Arabic version of the GMHAT/PC. Mental health nurses administered the GMHAT/ PC Arabic version to 50 patients in mental health and rehabilitation settings and their GMHAT/PC diagnosis was compared with the psychiatrist’s independent ICD-10 based clinical diagnosis on the same patients. The nurses found GMHAT/PC easy to administer in an average of 16 minutes. The GMHAT/PC-based diagnosis had a good agreement with the psychiatrist’s diagnosis (kappa = 0.91) and a high sensitivity (97%) and specificity (94%).

Version en langue arabe de l’outil d’évaluation mondial de la santé mentale dans le monde – soins primaires : étude de validité et de faisabilité

RÉSUMÉ Les services de santé mentale sont loin d’être satisfaisants dans la Région de la Méditerranée orientale. L’outil d’évaluation mondial de la santé mentale – version pour les soins primaires – est un instrument d’évaluation clinique semi-structuré assisté par ordinateur qui a été élaboré pour permettre aux agents de santé d’établir rapidement et facilement des évaluations de santé mentale standardisées et exhaustives. Une étude a été menée aux Émirats arabes unis afin d’évaluer la validité et la faisabilité de la version en langue arabe de cet outil d’évaluation. Des infirmières en santé mentale ont utilisé la version en langue arabe de cet outil d'évaluation sur 50 patients en milieu de psychiatrie et de réadaptation. Les diagnostics issus de l'évaluation ont été comparés aux diagnostics cliniques établis à l’aide de la CIM-10 par des psychiatres indépendants pour les mêmes patients. Les infirmières ont trouvé que l’outil d’évaluation mondiale de la santé mentale – version pour les soins primaires – était facile à administrer ; la tâche prenait 16 minutes en moyenne. Le diagnostic établi à l’aide de cet outil d’évaluation avait un degré de concordance satisfaisant avec le diagnostic du psychiatre (kappa = 0,91) et avait une sensibilité (97 %) et une spécificité (94 %) élevées.

1Faculty of Health and Social Care, University of Chester, Chester, United Kingdom; Consultant Psychiatry Practice, Cheshire and Wirral Partnership NHS Foundation Trust, United Kingdom (Correspondence to V.K. Sharma: [email protected]; [email protected]). 2Behavioural Science Pavillion, Shiekh Khalifa Medical City, Dubai, United Arab Emirates. 3Consultant Psychiatry Practice, Kent and Medway Mental Health and Social Care Partnership Trust, United Kingdom. 4University of Liverpool, Liverpool, United Kingdom. 5Qatar Addiction Treatment and Rehabilitation Centre Project, Doha, Qatar. 6Institute of Translational Medicine, University of Liverpool, Liverpool, United Kingdom. 7Consultant Psychiatry Practice, Betsi Cadwaladr University Health Board, Wrexham, North Wales, United Kingdom; Bangor University, United Kingdom. Received: 04/07/12; accepted: 24/09/12

905 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Introduction experience Sharma, Copeland and oth- and compulsions, phobia, mania, ers have spent over 15 years developing psychotic symptoms, disorientation, Mental health services are far from sat- the Global Mental Health Assessment memory impairment, alcohol misuse, il- isfactory in the Eastern Mediterranean Tool—Primary Care version (GM- legal drug misuse, personality problems Region (EMR). The World Health Or- HAT/PC), a computer-assisted clini- and stressors. The questions proceed ganization’s (WHO) recent report [1] cal tool to assess and diagnose and treat in a clinical order along a tree-branch highlighted limited resources available mental illness in primary and general structure. Many of the GMHAT/PC for the care of people with mental ill- health care settings. This has been fur- items have been adapted for the full ness, poor utilization of these resources ther refined by trials in routine clinical adult range from the Geriatric Mental and as a consequence a significant practice in different settings, with input State (GMS/AGECAT) schedule [12], treatment gap of up to 85%. The report from general practitioners, patients and which is extensively used worldwide concluded that mental health resources carers. GMHAT/PC was subjected in numerous epidemiological studies. were scarce, inequitably distributed and to reliability and validity studies in Ratings are made by the interviewer inefficiently used; community-based primary care as well as in medical set- using his or her clinical skills to judge the mental health services were underde- tings including among older people severity of each symptom, thus making veloped; and collaboration between the [7–11]. The aim of the present study the GMHAT/PC a semi-structured mental health system and other health was to validate the Arabic version of interview. and non-health sectors was generally the GMHAT/PC and to examine its The computer-assisted diagnostic weak in the Region. feasibility and acceptability in an Arab algorithm takes account of clinical di- Similar to more developed coun- population. agnostic practices based on presence tries, between 20% and 34% of con- of symptoms. The printable output sultations with primary health care summary report includes background facilities in the EMR are due to mental Methods descriptive details, a list of symptoms health problems [2]. Health officials with their severity as well as their Description of the GMHAT/PC need to understand and appreciate the scores, risk of self-harm, the GMHAT/ harmful effects of mental illness and The GMHAT/PC is a semi-structured, PC main diagnosis and additional give attention to prevention, treatment computerized clinical assessment tool diagnoses. The additional diagnoses and rehabilitation of mental disorders that is developed to assist health work- or comorbid states, are based on the at the primary care level as well as other ers in making quick, convenient and presence of other mental illness symp- levels of care [3]. It is high time to re- comprehensive standardized mental toms and disorders. Clinicians who duce the gap between the needs and health assessments in both primary and used GMHAT/PC found the list of all the services offered. To address the is- general health care. possible mental health diagnoses very sue of low detection rates of psychiatric The program starts with basic useful, as it helped them in their overall disorders in Arab cultures, screening instructions giving details of how to understanding of the patients’ mental instruments have been translated and use the assessment tool and rate the health issues and for planning their validated into Arabic language: the symptoms. The first 2 screens help in get- treatments. General Health Questionnaire and the ting brief background details including The program contains evidence- Self-Reporting Questionnaire [4] and present, past, personal and social history based management guidelines for new screening instruments have been including history of trauma, epilepsy most disorders, and for most psychotic developed [5] including a culture- and learning disorders. The following disorders recommends referral to oriented screening scale for anxiety screens consist of a series of questions mental health services. If interviews are and depression [6]. leading to a comprehensive yet quick repeated over time on a patient, the One pragmatic way to reduce the mental state assessment. They start with program also produces a summary table treatment gap for mental illness in the 2 screening questions about every ma- of symptom ratings of all interviews, EMR and other parts of the world is jor symptom complex followed by ad- providing a clear indication of progress by providing front-line workers with ditional questions only if the screening between interviews the skills to recognize and manage questions are positive. The questions common mental illness and to iden- cover the following symptom areas: Study design tify patients with severe illness at their worries, anxiety and panic attacks, con- The Arabic version of GMHAT/PC was earlier stage so that they can be helped centration, depressed mood, includ- developed using the standard method through specialist services. Based on ing suicidal risk, sleep, appetite, eating used in the translation of GMHAT/PC their extensive clinical and research disorders, hypochondriasis, obsessions into other languages. The GMHAT/

906 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

PC questions were translated into Rehabilitation setting the GMHAT/PC. Of the 17 cases with- standard Arabic language by a clinician In the rehabilitation unit another com- out mental illness diagnosis by the psy- with a sound knowledge of Arabic. An munity nurse used GMHAT/PC and chiatrist, 16 were correctly diagnosed independent translator translated back the psychiatrist attached to the unit as having no illness by GMHAT/PC, from Arabic to English. The English made an independent clinical assess- thus giving a kappa value for diagnostic back translation was compared with ment, as described above. Most of agreement of 0.91 (95% CI: 0.79–1.00) the original GMHAT/PC questions by the patients included had a history of with sensitivity of 97% (95% CI: 91%– the GMHAT/PC steering group. The mental health problems. The rehabilita- 100%) and specificity of 94% (95% CI: Arabic version was used in this study for tion setting included a day centre and 83%–100%). interviews. We also assessed whether community care mental health team. For anxiety and depression the the tool was acceptable in this culture. Patients were referred to this service kappa value for diagnostic agreement from outpatients, inpatients to help was 0.75 (95% CI: 0.56–0.96), with Data collection early discharge and home care teams. a sensitivity of 86% (12/14) (95% The study was carried out in 2 settings CI: 67%–100%) and a specificity of in Abu Dhabi, as follows. Results 92% (33/36) (95% CI: 83%–100%). Mental health setting For psychosis, the diagnostic agree- One trained psychiatric nurse used A total of 50 patients were interviewed ment kappa value was 0.76 (95% CI: GMHAT/PC for assessment of all (23 men and 27 women). The age range 0.52–0.96), with a sensitivity of 71% patients attending the outpatient clinic was 19–69 years, with a mean age of (10/14) (95% CI: 47%–95%) and in the Behaviour Science Pavilion, Abu 37 years. The mean time taken for the specificity of 97% (35/36) (95% CI: Dhabi, United Arab Emirates. Patients interviews was 16 minutes. None of the 91%–100%) were informed and included after ob- patients declined to be interviewed. The cross-tabulation of psychia- taining their consent to take part in the A total of 17 patients were identified trist’s ICD-10 based clinical diagnoses study. One qualified psychiatrist made by the psychiatrist has having no mental and GMHAT/PC diagnoses is given clinical assessment independently health illness, while 33 patients were in Table 1. and arrived at clinical diagnosis based identified has having mental health ill- Finally, basic feedback was also ob- on the International Statistical Clas- ness. There were no significant differ- tained from the patients and interview- sification of Diseases and Related Health ences in ages between the 2 groups: ers. All patients were asked how they felt Problems, 10th revision (ICD-10). The mean ages were 38.4 and 36.2 years about the interview and whether they psychiatrist was unaware of the com- respectively. Similarly there was also no understood the questions. The nurses puter (GMHAT/PC) diagnosis and of significant difference in the sex distribu- who administered GMHAT/PC were any previous mental health problems. tion between the 2 groups. asked about their feedback on using the Patients were referred to this clinic by Of 33 patients diagnosed as having tool. The patients easily understood the general practitioners, liaison psychiatry mental illnesses by the psychiatrist 32 questions and readily accepted the in- teams or other health teams, and had were also diagnostic cases of mental ill- terview. The feedback from the nurses’ varying degrees of mental illness. ness according to nurses administering interviews was generally very positive,

Table 1 Cross-tabulation of the number of patients diagnosed by the psychiatrist based on clinical judgement and by the nurse using the Global Mental Health Assessment Tool—Primary Care version (GMHAT/PC) Psychiatrist clinical Nurse GMHAT/PC diagnosis diagnosis No mental Organic Psychosis Depression Anxiety/ Eating Total illness mental neurosis disorder disorder No mental illness 16 0 0 0 0 1 17 Organic mental disorder 0 1 0 0 0 0 1 Psychosis 0 3 10 1 0 14 Depression 0 0 9 0 1 10 Anxiety/ neurosis 1 0 1 1 3 1 7 Eating disorder 0 0 0 1 0 0 1 Total 17 4 11 12 3 3 50

907 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

except that they wished that they had interview diagnosis, with good sensitiv- The study had some limitations, more training in using the GMHAT/ ity and specificity, which makes GM- particularly in that the number of pa- PC-based interview. HAT/PC a practical clinical tool for tients interviewed was small and the health professionals in Arabic-speaking interview setting was a hospital setting. regions. Further work is therefore needed in as- Discussion Mental health treatment needs of sessing the feasibility and psychomet- the population remain neglected in rics of the Arabic version of GMHAT/ The findings were very encouraging as PC in the primary care and general the EMR due to inadequate resources the nurses could easily administer the health setting. However, this small pi- but more importantly due to lack of GMHAT/PC interview in the Arabic lot study demonstrates the feasibility awareness, training and knowledge of population in a reasonable time frame and applicability for using GMHAT/ of approximately 16 minutes. The pa- health professionals to deal with men- PC to diagnose mental illness in this tients easily understood the questions tal health problems in their communi- population. and readily accepted the interview. The ties. Easy access to computers even in feedback from the nurses’ interviews remote regions makes it feasible to use was generally very positive, except that computers for routine assessments. Acknowledgements they wished that they had more train- GMHAT/PC could therefore fill an ing in using the GMHAT/PC based important gap in equipping health The GMHAT/PC will be available interview. workers with the skills for diagnosing for free download from: http://www. Good agreement was found be- mental illness in their populations and gmhat.org. tween the psychiatrist’s ICD-10 based directing them towards appropriate Funding: No specific grant. clinical diagnosis and the GMHAT/PC treatments. Competing interests: None declared.

References

1. Mental health systems in the Eastern Mediterranean Region. Re- 7. Sharma VK et al. The Global Mental Health Assessment Tool— port based on the WHO assessment instrument for mental health Primary Care Version (GMHAT/PC). Development, reliability systems. Cairo, World Health Organization Regional Office for and validity. World Psychiatry, 2004, 3:115–119. the Eastern Mediterranean, 2010 (EMRO Technical Publica- 8. Sharma VK et al. Mental health diagnosis by nurses using tions Series No. 37). the Global Mental Health Assessment Tool: a validity and 2. Gender and women’s mental health. Geneva, World Health feasibility study. British Journal of General Practice, 2008, Organization, 2006. 58:411–416. 3. Daradkeh TK, Eapen V, Ghubash R. Mental morbidity in pri- 9. Krishna M et al. Epidemiological and clinical use of GMHAT- mary care in Al Ain (UAE): Application of the Arabic translation PC (Global Mental Health Assessment Tool— primary care) in of the PRIME-MD (PHQ) Version. German Journal of Psychiatry, cardiac patients. Clinical Practice and Epidemiology in Mental 2005, 8:32–35. Health, 2009, 13:5–7. 4. Ghubash R et al. A comparison of the validity of two psychiatric 10. Sharma VK et al. Validation and feasibility of the Global Mental screening questionnaires: the Arabic General Health Ques- Health Assessment Tool—Primary Care Version (GMHAT/PC) tionnaire (AGHQ) and Self-Reporting Questionnaire (SRQ-20) in older adults. Age and Ageing, 2010, 39:496–499. in UAE, using Receiver Operating Characteristic (ROC) analy- 11. Sharma VK et al. The global mental health assessment tool- sis. European Psychiatry, 2001, 16:122–126. validation of GMHAT/PC in Hindi: a validity and feasibility 5. Daradkeh TK et al. The rationale, development and reliability study. Indian Journal of Psychiatry, 2010, 52:349–352. of a new screening psychiatric instrument. Social Psychiatry and 12. Copeland JR, Dewey ME, Griffiths-Jones HM. A computer- Psychiatric Epidemiology, 1999, 34:223–228. ized psychiatric diagnostic system and case nomenclature for 6. El-Rufaie OE, Absood GH, Abou-Saleh MT. The primary care elderly subjects: GMS and AGECAT. Psychological Medicine, anxiety and depression (PCAD) scale: a culture-oriented 1986, 16:89–99. screening scale. Acta Psychiatrica Scandinavica, 1997, 95:119–124.

908 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

Predictors of smoking among male college students in Saudi Arabia Y.S. Almogbel,1 S.M. Abughosh,1 F.S. Almogbel,2 I.A. Alhaidar 3 and S.S. Sansgiry 1

املنبئات بالتدخني بني طالب اجلامعات يف اململكة العربية السعودية يارس املقبل، سوسن أبو غوش، فيصل املقبل، إبراهيم احليدر، سوجيت سانسجريي ٍ اخلالصـة:يعترب ُّالتعرف عىل املنبئات بالتدخني يف من واحدالبلدان التي حتتل القمة يف تدخني السجائر يف العامل خطوة بالغة األمهية يف الوقاية من التدخني. وقد أجرى الباحثون دراسة مستعرضة لتقييم منبئات التدخني لدى ٍأتراب ٍذكورمن الطالب يف ثالث جامعات يف اململكة العربية السعودية. واستخدم الباحثون ًاستبيانا تم التحقق من صحته واختباره من أجل ُّالتعرفعىل اخلصائص االجتامعية والديموغرافية، واألداء األكاديمي، وتدخني الزمالء، ووجود مدخنني ضمن األرسة. وقد شملت الدراسة 337 ًمشاركا، وكان 30.9% منهم من املدخنني ًحاليا )دخنوا سيجارة واحدة أو أكثر خالل األيام الثالثني املنرصمة(، وكانت املنبئات التي يعتد هبا ًإحصائيا والتي تم التعرف عليها بالنسبة للوضع من حيث التدخني باستخدام حتليل 5.17 1.02 95 2.29 حتويف لوجستي متعدد املتغ رِّريات هي: األداء األكاديمي املنخفض )نسبة األرجحية ، فرتة الثقة %، ترتاوح القياسات بني و (، وتدخني الزمالء )نسبة األرجحية ،4.14 فرتة الثقة 95%، ترتاوح القياسات بني 1.53 – (، 11.3ووجود مدخنني ضمن األرسة )نسبة األرجحية ،2.77 فرتة الثقة 95%، ترتاوح القياسات بني 1.37 و5.64(. وتوضح هذه النتائج تأثري ضغط األرسة والزمالء عىل البدء بتدخني السجائر بني الشباب السعوديني.

ABSTRACT Identifying the predictors of smoking in one of the top cigarette-consuming countries in the world is a vital step in smoking prevention. A cross-sectional study assessed the predictors of smoking in a cohort of male students in 3 universities in Saudi Arabia. A pre-tested, validated questionnaire was used to determine sociodemographic characteristics, academic performance, peers’ smoking, and presence of a smoker within the family. Of the 337 participants, 30.9% were current smokers (smoked 1 or more cigarettes within the last 30 days). Lower academic performance (OR = 2.29, 95% CI: 1.02–5.17), peer smoking (OR = 4.14, 95% CI: 1.53–11.3) and presence of other smokers in the family (OR = 2.77, 95% CI: 1.37–5.64) were the significant predictors of smoking status identified using multiple logistic regression analysis. These findings highlight the influence of family and peer pressure in initiating cigarette use among the youth of Saudi Arabia.

Facteurs prédictifs de tabagisme chez des étudiants de sexe masculin en Arabie saoudite

RÉSUMÉ Identifier les facteurs prédictifs de tabagisme dans l’un des premiers pays consommateurs de cigarettes au monde est une étape essentielle dans la prévention du tabagisme. Une étude transversale a évalué les facteurs prédictifs du tabagisme dans une cohorte d’étudiants de sexe masculin dans trois universités en Arabie saoudite. Un questionnaire validé et prétesté a été utilisé pour recueillir des données sur les caractéristiques sociodémographiques des répondants, leurs résultats universitaires, la présence de fumeurs parmi leurs pairs et dans leur famille. Sur 337 participants, 30,9 % étaient des fumeurs actifs, c’est-à-dire qu’ils avaient fumé au moins une cigarette au cours des 30 derniers jours. Des résultats universitaires plus faibles (O.R. = 2,29 ; IC à 95 % : 1,02–5,17), la présence de fumeurs parmi leurs pairs (O.R. = 4,14 ; IC à 95 % : 1,53–11,3) et dans leur famille (O.R. = 2,77 ; IC à 95 % : 1,37–5,64) étaient les facteurs prédictifs de tabagisme significatifs identifiés à l’analyse de régression logistique multiple. Ces résultats soulignent l’influence exercée par les membres de la famille et la pression placée par les pairs sur les jeunes d’Arabie saoudite pour qu'ils se mettent à fumer.

1Department of Clinical Sciences and Administration, College of Pharmacy, University of Houston, Houston, Texas, United States of America (Correspondence to S.S. Sansgiry: [email protected]). 2Department of Community and Family Medicine, College of Medicine, King Saud University, Riyadh, Saudi Arabia. 3Department of Pharmaceutical Sciences, College of Clinical Pharmacy, King Faisal University, Al-Ahsa, Saudi Arabia. Received: 04/09/12; accepted: 04/11/12

909 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Introduction an early age was associated with higher The teaching faculty at each institute cigarette consumption, greater nicotine assisted in distributing the surveys. Smoking is the leading prevent- dependence and longer duration of Surveys were administered to students able cause of death, responsible for smoking [16]. during the last 15–20 minutes of their 5.6 million deaths around the world Cigarette smoking is a major health lecture. Students were requested by [1–3]. Saudi Arabia is one of the top concern in the male population of Saudi teachers to participate by anonymously 10 cigarette-importing countries in the Arabia and the government needs to filling out a survey about their smoking world [3]. The estimated economic, consider addressing it using behavioural behaviour and to drop the completed social and health costs associated with and/or educational interventions. survey in a box that was available in each all tobacco use in the country was Due to the lack of adequate research lecture room. All boxes were collected estimated to be $1.3 billion in 2010, in Saudi Arabia on the predictors of after the lectures ended. Participation with males contributing the most to smoking behaviour, and considering in the study was voluntary, and an this estimate [4]. The prevalence of the cultural differences compared with informed consent letter was provided smoking in Saudi Arabia has been other nations as well as the high preva- before proceeding with the data col- reported to be as high as 52.3%, and lence of smoking in young males, our lection. The survey was approved by among school and university students study sought to identify the predictors the institutional review board at the it has reached an alarming rate of 30% of smoking in a cohort of young male University of Houston. and 50% respectively [5]. Furthermore, Saudi Arabian university students. The Survey design comparison of Global Youth Tobacco goal was to inform strategies that would Surveys of 13–15-year-olds found a improve resource allocation to anti- The questionnaire was developed in 30% increase in smoking prevalence smoking interventions. English and translated into Arabic in Saudi Arabian males between 2001 language using a translation and back- to 2007 [6]. The majority of smokers translation method [18]. The translated in Saudi Arabia start smoking before Methods survey was validated with the help of the age of 15 years [5]. The price of 3 bilingual experts and was pretested cigarettes makes them affordable to Study design and data source for reliability using the test–retest reli- most children, and there is no strict ap- An observational, cross-sectional study ability method for 10 subjects before plication of the minimum legal age for was made to predict smoking among commencing the data collection. purchasing cigarettes [7]. The reported a sample of Saudi Arabian male col- The variables considered in this prevalence among men (13%–38%) is lege students. Data were collected from study were part of a larger survey that much higher than that among women December 2011 to January 2012 using consisted of 56 questions divided into (1%–16%) [8], presumably due to the a pretested, validated, self-administered 7 sections in a 4-page-long survey. In local culture and traditions in Saudi survey [17]. The survey was distributed this study, the variables considered were Arabia whereby smoking by females is in 3 government universities in Saudi smoking status, age, age first initiated considered shameful [9]. Arabia. Two of the selected universities smoking, income, marital status, aca- Addressing factors associated with provide general higher education (un- demic performance, peer smokers and smoking is a crucial strategy for reducing specialized) opportunities. The third presence of smokers within the family, the number of smokers and improving institute is a technical college that fo- such as mother, father, brother or any the health of a nation. A considerable cuses on computer, engineering and in- other family member (non-first-degree amount of literature has been published dustrial sciences. One of the universities relative). on the predictors of smoking, but not is located in the east of Saudi Arabia (Al Smoking status was the main specifically within the Saudi Arabia pop- Hassa). The second university and the outcome variable evaluated, and a ulation. Variables such as age, income, technical college are in the Al Qassim participant was considered a current academic performance, peer pressure region, which is located in the central smoker if he had smoked 1 cigarette and family members smoking have part of Saudi Arabia. The total number or more within the last 30 days. Age been shown to be significant predictors of students within the 3 institutes was was divided in 4 groups, from 18–20 of smoking around the world [10–15]. about 70 000. years to > 26 years. Participants were In particular, smoking by young adults Convenience sampling strategy also asked to report age of initiation of was a strong predictor of smoking be- with a goal of at least 400 participants smoking. Income was divided into 2 haviour in adulthood [11]. A study of was considered in this study. Within the categories according to maximum fi- 1200 young American adults reported universities, 4 health and 1 computer nancial aid for Saudi students: > 12000 that initiation of cigarette smoking at school agreed to assist in data collection. Saudi riyals/year (US$ 3200/year)

910 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

and ≤ 12000 Saudi riyals/year (US$ had at least 1 smoker brother. About similar geographic areas to our study. 3200/year). The marital status vari- 34% of participants indicated that they One carried out in 2003 on 2203 able was classified as single or married. had 1 or more other smoker members secondary-school male students in Al Students’ academic performance was of their family at home (non-first-degree Qassim, Saudi Arabia found that 29.8% measured by asking the participant relative). of respondents were smokers [19]. The what grade they received in school, Almost one-third of participants second study in 2006 on 1652 second- with 4 choices: A, B, C or D. For peer (104, 30.9%) were current smokers. ary male students in Al Hassa, Saudi smokers, respondents were asked The average reported age for initiating Arabia found that 30.3% were current if any of their friends were smokers the smoking habit was 15.0 (SD 4.7) smokers [20]. In the current study, (yes or no). The presence of a smoker years, with a median of 16 and a range the influence of peers and families within the family was categorized using of 8–30 years. on smoking behaviour was apparent. 4 variables: mother, father, brother The results of the bivariate analy- Peer smokers such as friends and the or any other smoker at home (non- sis of smoking status are summarized presence of other smokers (other than first-degree relative). Participants were in Table 1. Significantly more smok- father, mother or brother) at home asked if any of their family members ers (29.8%) had a reported income > were significant predictors of smoking were smokers or former smokers (yes US$ 3200/year than did non-smokers status for male college students in Saudi or no). These variables were selected (19.3%) (P = 0.033). Smokers had sig- Arabia. Academic performance was based on previous studies and through nificantly lower educational grades that associated with smoking status, as low pilot testing [10–15]. non-smokers, e.g. 29.7% had achieved grades increased the risk of smoking. grade A versus 44.8% of non-smokers Smoking in American adolescence Statistical analysis (P = 0.004). Significantly more smok- and young adulthood has been reported Descriptive statistics and bivariate analy- ers than non-smokers reported having as a predictor of adult smoking [11]. In sis was used to identify the predictors of at least 1 friend who smoked (92.9% the current study, age was not associ- smoking. Any variable with a probability versus 72.3%) (P < 0.001), having at ated with smoking status because most of 0.2 or less in the bivariate analysis was least 1 smoker brother (43.7% versus smokers in Saudi Arabia begin smoking retained in the final multiple logistic re- 29.3%) (P = 0.017) and having 1 or at an early age (mostly below 15 years) gression. A multiple logistic regression more smoker non-first-degree relatives [21–23] and our sample had a narrow model was performed to determine the at home (48.2% versus 28.4%) (P = focused cohort of only university stu- predictors of smoking. Data were coded 0.001). dents. The average age of this sample was 22 years, as the entire sample was and entered using MicrosoftExcel 2010, Table 2 presents the results of the recruited from the undergraduate col- and data was analysed using SAS, ver- multiple logistic regression of smoking lege student population. Thus, the age sion 9.3. status with all variables that had a signifi- effect was not, or might not be, captured cant level of 0.2 or less in the bivariate in this study. analysis. The risk of smoking increased Results about 2-fold (OR = 2.29, 95% CI: 1.02– Income in our study was associated 5.17) with low academic performance with an increase in risk of smoking in the A total of 467 out of 920 surveys were (grades C to D). The risk of being a bivariate analysis but was insignificant received from students at the 3 universi- smoker was higher for respondents with after controlling for potential confound- ties, a net response rate of 50.8%. Due friends who smoked (OR = 4.14, 95% ers in the multiple logistic regression to data missing for the main outcome CI: 1.53–11.3) and with other smokers model. This result differs from a survey variable, 130 surveys were excluded pro- in the family (non-first-degree relatives) by Khader et al. in 2005 on 712 uni- viding a net response rate of 36.6%. The (OR = 2.77, 95% CI: 1.35–5.64). versity students in Jordan [10]. They mean age was 22.2 (SD 2.2) years. The found that income increased the risk of majority (66.5%) of participants were smoking among students. between 21 and 23 years old and single Discussion Academic performance was a signif- marital status (96.3%) (Table 1). Near- icant predictor of smoking in our study. ly two-thirds of participants (77.4%) In our cohort of male university Students with lower grades (C to D) were receiving ≤ US$ 3200/year. Most students, the percentage of current were found to have a 2.3 times greater respondents (79.5%) had scored A or B smokers, i.e. individuals who smoked at likelihood of being smokers compared throughout their academic life. About least 1 cigarette during the last month, with those who had higher (A) grades. 78.2% of participants reported that they was 30.9%. This was consistent with 2 The academic performance variable was had at least 1 smoker friend and 33.4% other studies that were conducted in used in 2 previously reported smoking

911 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Table 1 Demographic characteristics and bivariate analysis of smoking status among Saudi Arabian male college students Characteristic Total Non-smokers Smokers P-value (n = 337)a (n = 233) (n = 104) No. % No. % No. % Age group (years) 18–20 50 15.7 39 17.3 11 11.7 0.132 21–23 212 66.4 150 66.7 62 66.0 24–26 42 13.2 24 10.7 18 19.1 > 26 15 4.7 12 5.3 3 3.2 Marital status Married 12 3.7 7 3.1 5 5.0 0.391 Unmarried 316 96.3 221 96.9 95 95.0 Income (US$/year) > 3200 76 22.6 45 19.3 31 29.8 0.033 ≤ 3200 261 7 7. 4 188 80.7 73 70.2 Academic performance Grade A 133 40.2 103 44.8 30 29.7 0.004 Grade B 130 39.3 90 39.1 40 39.6 Grades C to D 68 20.5 37 16.1 31 30.7 Having a smoker friend Yes 233 78.2 154 72.3 79 92.9 < 0.001 No 65 21.8 59 27.7 6 7. 1 Current or former smoker in the family All (as a family) Yes 116 38.0 90 41.5 26 29.5 0.052 No 189 62.0 127 58.5 62 70.5 Mother Yes 60 19.9. 43 20.1 17 19.3 0.890 No 242 80.1 171 79.9 71 80.7 Father Yes 119 39.4 80 37.0 39 45.4 0.182 No 183 60.6 136 63.0 47 54.7 Brother Yes 101 33.4 63 29.3 38 43.7 0.017 No 201 66.6 152 70.7 49 56.3 Any other smokers in the family Yes 99 34.0 59 28.4 40 48.2 0.001 No 192 66.0 149 71.6 43 51.8

aThe numbers may not total 337 for some variables due to missing values.

predictor studies [12,14]. Both of these increased the likelihood of smoking Consistent with the reported lit- studies found a strong association status by 2.6-fold [10]. The second erature, our study found that having between low academic performance study was done in 2005 on Jordanian at least 1 smoker friend increased the and smoking, which was consistent students and reported that having risk of being a smoker 4-fold. A study with our study findings. The first study grade C was associated with a 4-fold in 2006 on middle- and high-school was conducted on American students risk of smoking compared with having students in Cyprus reported that the in 1992, and found that lower grades grade A [12]. strongest predictor of smoking during

912 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

Table 2 Multiple logistic regression results of smoking status among Saudi male the association between a predicted college students variable and the predictors, but cannot Variable OR (95% CI) P-value establish causality. The generalizability Age group (years) of these findings is limited to similar 18–21 1 populations of college students in 21–23 1.40 (0.59–3.35) 0.448 Saudi Arabia. Finally, this study was 24–26 1.43 (0.47–4.29) 0.527 done using a convenience sample. > 26 1.11 (0.23–5.29) 0.897 Therefore, non-participants were Income(US$/year) not characterized and the influence > 3200 1.57 (0.81–3.07) 0.186 of non-participation due to possible ≤ 3200 1 reporting of smoking behaviour was Academic performance not captured. Grade A 1 The results suggest that an educa- Grade B 1.40 (0.71–2.76) 0.328 tional and consultation programme for Grades C to D 2.29 (1.02–5.17) 0.045 families could be effective in reducing Having a smoker friend the number of smokers. Furthermore, Yes 4.14 (1.53–11.3) 0.005 educating students on the harm of No 1 smoking and the impact of peers could Current or former smoker mother aid in the prevention of smoking. Start- Yes 0.56 (0.22–1.39) 0.209 ing such educational campaigns at an early age may influence students to not No 1 initiate smoking. Educational advertise- Current or former smoker father ments that highlight the role of fam- Yes 1.58 (0.80–3.13) 0.185 ily and the role that friends play in the No 1 process can provide added benefit in Current or former smoker brother reducing smoking behaviour in Saudi Yes 0.91 (0.44–1.87) 0.8 Arabia. No 1 Any other current or former smoker in the family Conclusions Yes 2.77 (1.37–5.64) 0.005 No 1 This study identified predictors of OR = odds ratio; CI = confidence interval. smoking in male college students in Saudi Arabia. We found that lower academic performance, peer smoking both early and late adolescence was (non-first-degree relative), was signifi- and the presence of other smokers in peers’ smoking status, as it increased the cant in the bivariate analysis. But after the family were significant predictors smoking risk by 20-fold [14]. Addition- adjusting for confounders in the mul- of smoking status. Despite application ally, a study conducted in 2010 on male tiple logistic regression model, only 1 of the WHO Monitor Protect Offer Saudi Arabian school students aged variable (other smokers in the family) Warn Enforce Raise (MPOWER) 16–18 years reported that having peer was significantly associated with the framework recommendations in smokers increased the risk of smoking risk of smoking. This suggests that par- Saudi Arabia, more efforts should be by 3.5-fold [24]. ticipants in our study were influenced made to protect the youth population A longitudinal study conducted by other members of the family or in areas where youth reside such as between 1991 and 1994 on 3rd to 8th brothers, namely individuals they could universities. grade students in the United States related to in their social context, rather reported that having a family member than their father. who smoked at home was a significant A number of limitations need Acknowledgements predictor of smoking at an early age to be considered before applying [15]. In our study having 2 smokers in the findings of this study. Cross- Funding: None. the family, i.e. brother and any other sectional study designs can identify Competing interests: None declared.

913 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

References

1. Leung CM et al. Fighting tobacco smoking—a difficult but not 13. Dusenbury L et al. Predictors of smoking prevalence among impossible battle. International Journal of Environmental Re- New York Latino youth. American Journal of Public Health, search and Public Health, 2009, 6:69–83. 1992, 82:55–58. 2. Tobacco fact sheet. World Health Organization [on- 14. Christophi CA et al. Main determinants of cigarette smoking line factsheet] (http://www.wpro.who.int/mediacentre/ in youth based on the 2006 Cyprus GYTS. Preventive Medicine, factsheets/fs_201203_tobacco/en/index.html, accessed 12 2009, 48:232–236. September 2013). 15. Johnson CC et al. Fifth through eighth grade longitudinal 3. Mackay J, Eriksen M. The tobacco atlas. Geneva: World Health predictors of tobacco use among a racially diverse cohort: Organization; 2002. CATCH. Journal of School Health, 2002, 72:58–64. 4. Munif MA. Report on tobacco control program of Ministry 16. Breslau N, Fenn N, Peterson EL. Early smoking initiation and of Health in Saudi Arabia. Riyadh, Saudi Arabia, Ministry of nicotine dependence in a cohort of young adults. Drug and Health, 2009 (http://www.tcp-sa.info/photos/files/REPORT_ Alcohol Dependence, 1993, 33:129–137. ON_TCP.pdf, accessed 12 September 2013). 17. Wu IH et al. Cigarette smoking among Taiwanese adults. Epide- 5. Bassiony MM. Smoking in Saudi Arabia. Saudi Medical Journal, miology, 2011, 1:107. doi:10.4172/2161-1165.1000107. 2009, 30:876–881. 18. Brislin RW. Back-translation for cross-cultural research. Journal 6. Al-Bedah AM et al. The Global Youth Tobacco Survey—2007. of Cross-Cultural Psychology, 1970, 1:185–216. Saudi Medical Journal, 2010, 31:1036–1043. 19. Al-Damegh SA et al. Cigarette smoking behavior among male 7. Abdalla AM et al. Correlates of ever-smoking habit among secondary school students in the Central region of Saudi Ara- adolescents in Tabuk, Saudi Arabia. Eastern Mediterranean bia. Saudi Medical Journal, 2004, 25:215–219. Health Journal, 2009, 15:983–992. 20. Al-Mohamed HI, Amin TT. Pattern and prevalence of smok- 8. [Highlights demographic survey 1428H (2007)]. Demographic ing among students at King Faisal University, Al Hassa, Saudi research bulletin 1428. Saudi Arabia Central Department of Arabia. Eastern Mediterranean Health Journal, 2010, 16:56–64. Statistics and Information [online] (http://www.cdsi.gov. 21. Saeed AA, Al-Johali EA, Al-Shahry AH. Smoking habits of sa/english/index.php?option=com_docman&task=cat_ students in secondary health institutes in Riyadh City, Saudi view&gid=43&Itemid=113, accessed 12 September 2013) [in Arabia. Journal of the Royal Society of Health, 1993, 113:132–135. Arabic]. 22. Al-Faris EA. Smoking habits of secondary school boys in rural 9. Jarallah JS et al. Prevalence and determinants of smoking in Riyadh. Public Health, 1995, 109:47–55. three regions of Saudi Arabia. Tobacco Control, 1999, 8:53–56. 23. Saeed AA, Khoja TA, Khan SB. Smoking behaviour and atti- 10. Murthy P, Subodh BN. Current developments in behavioral tudes among adult Saudi nationals in Riyadh city, Saudi Arabia. interventions for tobacco cessation. Current Opinion in Psy- Tobacco Control, 1996, 5:215–219. chiatry, 2010, 23:151–156. 24. Al Ghobain MO et al. Prevalence and characteristics of ciga- 11. Weekley CK, Klesges RC, Reylea G. Smoking as a weight- rette smoking among 16 to 18 years old boys and girls in Saudi control strategy and its relationship to smoking status. Addictive Arabia. Annals of Thoracic Medicine, 2011, 6:137–140. Behaviors, 1992, 17:259–271. 12. Khader YS, Alsadi AA. Smoking habits among university stu- dents in Jordan: prevalence and associated factors. Eastern Mediterranean Health Journal, 2008, 14:897–904.

914 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

Salt intake in Eastern Saudi Arabia A.M. Alkhunaizi,1 H.A. Al Jishi 2 and Z.A. Al Sadah 2

تناول امللح يف رشق اململكة العربية السعودية أمحد منصور اخلنيزي، هالة عبد اهلادي اجليش، زينب علوي السادة اخلالصـة: يرافق تناول مقادير كبرية من امللح تأثريات جانبية ضائرة مثل ارتفاع ضغط الدم وأمراض القلب واألوعية. ومن غري املعروف كمية امللحالتي يتناوهلا السكان يف اململكة العربية السعودية. وهتدف هذه الدراسة إىل تقدير كمية املتناول من امللح بني سكان املنطقة الرشقية يف اململكة العربية السعودية من خالل قياس كمية الصوديوم املفرغ يف البول خالل 24ساعة. وقد مجع الباحثون عينات البول من 130 ً شخصاأعامرهم فوق 14 ًعاما، وقاسوا مستويات الصوديوم والكهرليات األخرى. واتضح أن 87عينة قد وفت بمعايري الدقة، فتم حتليلها. وكان وسطي إفراغ الصوديوم يف 24 ساعة يف الفئة املدروسة 140مييل مكافئ )بانحراف معياري49 مييل مكافئ(، ]للذكور 153 )بانحراف معياري 52(، ولإلناث 118مييل مكافئ )بانحراف معياري ([.37 وتتجاوز هذه القيم املقدار املوىص بتناوله ًيوميا من الصوديوم، وقد تساهم يف خطر اإلصابة بارتفاع ضغط الدم واملرض القلبي الوعائي يف اململكة العربية السعودية.

ABSTRACT High salt intake has been associated with adverse side-effects such as hypertension and cardiovascular disease. The amount of salt intake among the population of Saudi Arabia is not known. The objective of this study was to estimate the salt intake among residents of the Eastern region of Saudi Arabia by measuring 24-hour urinary sodium excretion. Urine samples were collected from 130 individuals aged over 14 years for measurement of levels of sodium and other electrolytes. A total of 87 samples met the criteria for accuracy and were analysed. Total mean 24-hour sodium excretion for the group was 140 (SD 49) mEq [153 (SD 52) mEq for males and 118 (SD 37) mEq for females]. These values exceed the recommended daily intake of sodium and may contribute to the risk of developing hypertension and cardiovascular disease in Saudi Arabia.

Apport en sel dans l’est de l’Arabie saoudite

RÉSUMÉ Un apport élevé en sel a été associé à des effets secondaires indésirables tels que l’hypertension et des maladies cardio-vasculaires. La quantité de sel consommée par la population d’Arabie saoudite n’est pas connue. L’objectif de la présente étude était d’estimer l'apport en sel chez des résidents de la région est d’Arabie saoudite en mesurant leur excrétion urinaire de sodium en 24 heures. Des échantillons d’urine ont été recueillis auprès de 130 personnes âgées de plus de 14 ans afin de mesurer les concentrations de sodium et d’autres électrolytes. Au total, 87 échantillons ont satisfait aux critères de précision et ont été analysés. L’excrétion de sodium moyenne totale en 24 heures pour le groupe était de 140 mEq (E.T. 49) (153 mEq [E.T. 52] pour les hommes et 118 mEq [E.T. 37] pour les femmes). Ces valeurs sont supérieures à celles recommandées pour l'apport en sodium quotidien et représentent un risque de survenue d’hypertension et de maladies cardio- vasculaires dans la population saoudienne.

1Internal Medicine Services Division, Nephrology Section; 2Department of Nursing, Dhahran Health Centre, Dhahran, Saudi Arabia (Correspondence to A.M. Alkhunaizi: [email protected]; [email protected]). Received: 09/04/12; accepted: 14/10/12

915 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Introduction to the hot climate in this area during study population. P-values of < 0.05 the summer months and the possibil- were considered significant. High levels of salt intake in the form of ity of excessive sodium loss in sweat, sodium chloride are associated with the samples were collected during the adverse events such as the development season of temperate climate between Results of hypertension, cardiovascular events October and March. The study was and strokes [1–4]. Reducing dietary approved by the institutional review The 24-hour urinary collection was per- salt intake could substantially reduce board at Saudi Aramco Medical Ser- formed on a total of 130 participants; 43 cardiovascular events and strokes and vices Organization. samples were excluded from the analy- may increase people’s lifespan and re- The participants were given clear sis due to incorrect collection. Analysis duce national health-care expenditures instructions about urine collection for was performed on a total of 87 samples [5–9]. The World Health Organiza- a total of 24 hours. All participants (54 from males and 33 from females). tion (WHO) has recommended salt were instructed not to modify their The mean age of the participants was reduction as a top priority for tackling diet during the study period. Patients 44 (SD 18), range 14–83 years. The noncommunicable diseases and has with chronic kidney disease, those mean ages were 45 (SD 18) years and considered this a public health target receiving diuretics and patients with 41 (SD 17) years for males and females [10]. Similarly, the Institute of Medicine gastrointestinal disorders were ex- respectively. (IOM) in the United States has issued cluded. To guard against over- and Table 1 shows the demographic recommendations to decrease sodium under-collection, urinary creatinine data of the participants and the meas- intake [11]. was measured in all samples. A daily ured electrolyte excretion in male There is a great variation in salt intake creatinine excretion of 20–25 mg/kg and female participants. The sodium between different populations, ranging and 15–20 mg/kg lean body weight excretion of the male participants was from 1 mEq/day among the Yanomamo was expected for males and females particularly high (153 mEq/day), and Indians in the Amazon valley in Brazil to respectively. Samples with a total cre- much higher than that of the female 299 mEq/day in some parts of China atinine excretion outside these ranges participants (118 mEq/day). [12–15]. The amount of salt intake were rejected. In addition to urinary Correlations between 24-hour sodi- among the population of Saudi Arabia is sodium, other electrolytes including um excretion and age, BMI and systolic not known. The aim of this study was to potassium and magnesium were also and diastolic BP are shown in Table 2. measure 24-hour urinary sodium excre- measured. Among the male participants there was tion in order to estimate the sodium Blood pressure (BP), weight, and a negative correlation between sodium intake and to measure some other es- body mass index (BMI) were deter- excretion and age, and a positive cor- sential electrolytes among citizens in the mined for all participants. Casual (in relation with body weight. This did not Eastern region of Saudi Arabia. office, resting) BP was measured using reach statistical significance, however, automatic oscillometric devices fol- for the female participants. lowing the standardized National Joint Methods Commission protocol [16]. The mean of 3 BP measurements at 3 different Discussion Sample encounters was recorded. A total of 130 citizens from Eastern The electrolytes were measured by The WHO recommends that all coun- Saudi Arabia above the age of 14 dry chemistry methods using Vitros tries assess the sodium consumption years were recruited. The participants 350 Chemistry System (Ortho Clinical of the population [17]. Most of the included healthy volunteers, healthy Diagnostics). sodium in the diet is ingested in the potential kidney donors and patients form of sodium chloride. The WHO who underwent work-up for nephro- Data analysis recommends an intake of no more lithiasis. The software Microsoft Excel 2010 and than 5 g of sodium chloride or 2 g of Graphpad Prism, version 2.0 were used sodium (85 mEq) per day, while the Data collection for the statistical analysis. Data were IOM recommends that adults should Sodium intake was estimated by meas- expressed as mean values with standard not consume more than 2.3 g of sodium uring 24-hour urinary sodium excre- deviation (SD). Pearson correlation (100 mEq) per day [11,17]. Based on tion. Samples were collected between coefficient (r) was used to analyse the these recommendations and due to October and March for 4 consecutive association between electrolytes excre- the adverse health effects of dietary salt, years between 2009 and 2012. Due tion and the various variables of the many countries have adopted policies

916 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

Table 1 Demographic data and 24-hour urinary electrolyte excretion of the study participants Sex No. of Mean (SD) values people Age BMI BP (mmHg) Electrolytes 2 (years) (kg/m ) Systolic Diastolic Na+ K+ Mg2+ (mEq) (mEq) (mg) Total 87 44 (18) 27 (5) 129 (15) 75 (8) 140 (49) 56 (22) 81 (37) Male 54 45 (18) 28 (5) 132 (15) 75 (8) 153 (52) 60 (24) 88 (41) Females 33 41 (17) 27 (6) 125 (14) 74 (6) 118 (37) 50 (16) 70 (25)

BMI = body mass index; BP = blood pressure; SD = standard deviation. Na+ = sodium; K+ = potassium; Mg2+ = magnesium..

to regulate salt consumption through the Saudi population. As a result of correlation with BMI among the male educating people to reduce the use of lifestyle changes in the country, dia- participants, most likely as a result of salt in cooking and by persuading the betes and hypertension have reached the overall high calorie intake among food industry to minimize the use of epidemic levels [19]. The hot climate the young and overweight individuals. salt in their products. Estimating salt during the summer months in East- This was not observed in the female intake by measuring salt excretion is ern Saudi Arabia may result in large participants, probably due to the small an essential step towards formulat- losses of water and salt in the sweat. sample size. We did not find a cor- ing these policies. There are differ- To avoid any substantial sodium loss relation between sodium excretion ent methods for estimating sodium in the sweat, we conducted the study and either systolic or diastolic blood consumption, including 24-hour during the season of moderate cli- pressure. This may be attributed to the urinary collection, casual spot urine mate between October and March. relatively young age of the cohort. collection and timed spot urine col- The main bulk of the study sample Besides sodium intake, low potas- lection. Among these methods, the was healthy adult individuals. Sodium sium intake has also been associated first is the most accurate. In an earlier intake, as reflected in the mean 24- with the development of cardiovascu- report in 2007, the WHO suggested hour sodium excretion rate, was 140 lar disease and stroke [20]. Adequate that as few as 100 individuals from a (SD 49) mEq, which is higher than potassium intake is recommended representative sample, with each par- recommended by both WHO and to counteract the adverse effects of ticipant carrying out a single 24-hour IOM [10,11]. This was true for both sodium chloride. The IOM recom- urine collection, would be sufficient males and females, with mean values mended a daily potassium intake of to provide an estimate of the sodium of 153 (SD 52) mEq and 118 (SD 4.7 g (120 mEq) for adults [21]. Simi- intake of a population [18]. 37) mEq respectively. There was a lar to sodium, potassium homeostasis The daily intake of sodium has negative correlation between sodium is mainly regulated by the kidneys. not been officially documented in excretion and age, and a positive The amount of potassium loss in the sweat and through the gastrointes- tinal tract is minimal under normal Table 2 Correlation between 24-hour urinary sodium excretion and several conditions. Therefore, and similar to variables among male and female participants sodium, urinary excretion of potas- Sex/variable r 95% CI P-value sium is considered a surrogate for Males potassium intake. Our data showing Age –0.33 –0.55 to –0.07 0.015 a 24-hour mean excretion of 56 (SD BMI 0.27 –0.01 to –0.50 0.05 22) mEq indicated that potassium Mean SBP 0.01 –0.26 to –0.28 0.94 intake was low in the total group and Mean DBP 0.19 –0.08 to –0.44 0.167 in both sexes of the sample popula- Females tion [60 (SD 24) mEq and 50 (SD Age –0.01 –0.35 to –0.34 0.96 16) mEq in males and females re- BMI –0.07 –0.41 to –0.28 0.68 spectively]. This, in addition to high Mean SBP –0.08 –0.41 to –0.27 0.66 sodium intake, puts our population Mean DBP 0.05 0.30 to –0.39 0.78 at an increased risk for the develop-

r = correlation coefficient; CI = confidence interval; BMI = body mass index; SBP = systolic blood pressure; DBP ment of hypertension, cardiovascular = diastolic blood pressure. disease and stroke.

917 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Magnesium is another mineral magnesium in our cohort is lower than Acknowledgements that has vital biological functions. The what is recommended by the IOM. recommended dietary allowances of However, that can only be confirmed The authors acknowledge the use of Saudi magnesium are 320 mg and 420 mg by quantification of the actual content Aramco Medical Services Organization for adult women and men respectively of magnesium in the diet. (SAMSO) facilities for research data used [22]. Balance studies have shown This study gives insight into the in this article. Opinions expressed in this that the net magnesium absorption amount of sodium intake in this re- article are those of the authors and not is around 50%, with a range from gion of Saudi Arabia, and suggests necessarily of SAMSO. The authors also 10%–65% of the total intake depend- that measures should be adopted thank Mrs Fatimah A. Alkhunaizi from ing on the diet [23,24]. In the absence to improve the dietary habits of the the Krieger School of Arts and Sciences at of diarrhoea, most of the absorbed population with the hope to decrease the Johns Hopkins University, Baltimore, magnesium will be excreted in the the associated adverse health effects USA for reviewing the manuscript and for kidneys. Based on this, our data of of high salt intake. The results of this her valuable comments. 24-hour magnesium excretion [mean study could very well be extrapolated Funding: The study was funded by 81 (SD 37) mg] may not necessar- to other neighbouring regions where Saudi Aramco Medical Services Or- ily reflect magnesium intake, and we people share similar cultures and di- ganization, Saudi Arabia. can only speculate that the intake of etary habits. Competing interests: None declared.

References

1. Conlin PR. Eat your fruits and vegetables but hold the salt. Cir- 14. Stamler J et al.; INTERMAP Research Group. INTERMAP: back- culation, 2007, 116:1530–1531. ground, aims, design, methods, and descriptive statistics (non- 2. He J et al. Long-term effects of weight loss and dietary sodium dietary). Journal of Human Hypertension, 2003, 17:591–608. reduction on incidence of hypertension. Hypertension, 2000, 15. Rose G, Stamler J; INTERSALT Co-operative Research Group. 35:544–549. The INTERSALT study: background, methods and main results. 3. Cook NR et al. Long term effects of dietary sodium reduction Journal of Human Hypertension, 1989, 3:283–288. on cardiovascular disease outcomes: observational follow-up 16. Chobanian AV et al.; National High Blood Pressure Education of the trials of hypertension prevention (TOHP). British Medical Program Coordinating Committee. Seventh report of the Joint Journal, 2007, 334:885–888. National Committee on Prevention, Detection, Evaluation, 4. He FJ, MacGregor GA, McCarron DA. Salt intake and cardio- and Treatment of High Blood Pressure. Hypertension, 2003, vascular disease. Nephrology, Dialysis, Transplantation, 2008, 42:1206–1252. 23:3382–3384. 17. Strategies to monitor and evaluate population sodium consump- 5. Bibbins-Domingo K et al. Projected effect of dietary salt reduc- tion and sources of sodium in the diet. Report of a joint technical tions on future cardiovascular disease. New England Journal of meeting convened by WHO and the Government of Canada. Medicine, 2010, 362:590–599. Geneva, World Health Organization, 2010. 6. He FJ, MacGregor GA. Effect of longer-term modest salt re- 18. Salt intakes around the world: implications for public health. Ge- duction on blood pressure. Cochrane Database of Systematic neva, World Health Organization, 2007. Reviews, 2004, (3):CD004937. 19. Al-Khader AA. Impact of diabetes in renal diseases in Saudi 7. He FJ, MacGregor GA. Salt reduction lowers cardiovascular Arabia. Nephrology, Dialysis, Transplantation, 2001, 16:2132– risk: meta-analysis of outcome trials. Lancet, 2011, 378:380– 2135. 382. 20. O’Donnell MJ et al. Urinary sodium and potassium excretion 8. Strazzullo P et al. Salt intake, stroke, and cardiovascular dis- and risk of cardiovascular events. Journal of the American Medi- ease: meta-analysis of prospective studies. British Medical cal Association, 2011, 306:2229–2238. Journal, 2009, 339:b4567. 21. Institute of Medicine of the National Academies. Dietary ref- 9. He FJ, MacGregor GA. How far should salt intake be reduced? erence intakes for water, potassium, sodium, chloride, and Hypertension, 2003, 42:1093–1099. sulfate. Washington DC, National Academy Press, 2005. 10. Beaglehole R et al.; Lancet NCD Action Group; NCD Alliance. 22. Institute of Medicine of the National Academies. Dietary refer- Priority actions for the non-communicable disease crisis. Lan- ence intakes for calcium, phosphorus, magnesium, vitamin D, cet, 2011, 377:1438–1447. and fluoride. Washington DC, National Academy Press, 1997. 11. Institute of Medicine of the National Academies. Strategies 23. Schwartz R, Spencer H, Welsh JJ. Magnesium absorption in to reduce sodium intake in the United States. Washington DC, human subjects from leafy vegetables, intrinsically labeled National Academy Press, 2010. with stable 26Mg. American Journal of Clinical Nutrition, 1984, 39:571–576. 12. Oliver WJ, Cohen EL, Neel JV. Blood pressure, sodium intake, and sodium related hormones in the Yanomamo Indians, a 24. Fine KD et al. Intestinal absorption of magnesium from food “no-salt” culture. Circulation, 1975, 52:146–151. and supplements. Journal of Clinical Investigation, 1991, 88:396–402. 13. Elliott P et al.; Intersalt Cooperative Research Group. Intersalt revisited: further analyses of 24 hour sodium excretion and blood pressure within and across populations. British Medical Journal, 1996, 312:1249–1253.

918 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

Investigating inspection practices of pharmaceutical manufacturing facilities in selected Arab countries: views of inspectors and pharmaceutical industry employees S. Garg,1 R. Hasan,1 S. Scahill 1 and Z. Ud-Din Babar 1

دراسة ممارسات التفتيش عىل مرافق صناعة املستحرضات الصيدالنية يف بعض البلدان العربية: آراء املفتشني وموظفي رشكات صناعة املستحرضات الصيدالنية سانجي جارج، رانيا شعبان، شان ساهيل، زهري الدين بابار اخلالصـة:هناك عدد قليل من الدراسات حول ممارسات التفتيش عىل مرافق صناعة املستحرضات الصيدالنية من وجهة نظر املفتشني ومن وجهة نظر املوظفني يف تلك املرافق. وقد أجرى الباحثون يف هذه الدراسة املستعرضة الوصفية ًمسحاتناول املفتشني والعاملني يف ضامن اجلودة يف أربعة بلدان نامية هي اإلمارات العربية املتحدة واململكة العربية السعودية ومرص واألردن، للسؤال عن ممارساهتم يف التفتيش وعن وجهات نظرهم. وقد كان هناك قدر كبري من التفاوت يف ممارسات التفتيش بني ٍبلدوآخر وبني العاملني يف التفتيش ويف ضامن اجلودة ضمن البلد الواحد. وكان التباعد يف وجهات النظر يرتافق مع آليات الدفع لألجور. وقد كان هناك توافق متبادل بني كل من الفرق وبني املفتشني عىل قلة توافر اإلمدادات لدهيم، وعىل أهنم بحاجة إىل تدريب أفضل. وقدبدا للباحثني أن املفتشني لدهيم صالحيات أقل مما هو متوقع من أجل مراقبة صناعة املستحرضات الصيدالنية واألنشطة يف األسواق، ويزيد ذلك ًسوءا قلة السياسات التي تدعم اتباع أسلوب أكثر ًانسجاما ومنهجية ومعيارية يف عملية التفتيش ضمن كل بلد، ويف ما بني ٍبلد وآخر يف البلدان النامية.

ABSTRACT There are few studies that explore inspection practices of pharmaceutical facilities from the viewpoint of inspectors and industry employees. In this descriptive, cross-sectional study, inspectors and quality assurance staff from 4 Arab countries — the United Arab Emirates, Saudi Arabia, Egypt and Jordan — were surveyed about their inspection practices and views. There was considerable variation in inspection practices across countries and between the inspectorate and quality assurance staff within countries. Divergence was found in views associated with payment mechanisms. There was mutual agreement by both groups that inspectors were in short supply and that they needed to be better trained. Inspectors appeared to have less authority than expected in order to control pharmaceutical manufacturing and marketing activities. Compounding this was a dearth of policy which would support a more uniform and systematic approach to the inspection process within and across countries.

Enquête sur les pratiques d’inspection des établissements de production pharmaceutique dans des pays arabes sélectionnés : opinions des inspecteurs et des employés de l’industrie pharmaceutique

RÉSUMÉ Les études sur les pratiques d’inspection des établissements pharmaceutiques du point de vue des inspecteurs et des employés de l’industrie sont rares. Dans la présente étude transversale descriptive, des inspecteurs et des membres du personnel de l’assurance qualité de quatre pays arabes, à savoir l’Arabie saoudite, l’Égypte, les Émirats arabes unis et la Jordanie, ont été interrogés sur leurs pratiques en matière d’inspection et sur leurs opinions. Les écarts entre les différentes pratiques d’inspection étaient considérables entre les pays mais aussi entre les équipes d’inspecteurs et de l’assurance qualité dans un même pays. Des divergences ont été constatées dans les opinions sur les mécanismes de paiement. Il a été établi par les deux groupes que les inspecteurs étaient en nombre insuffisant et qu’ils avaient besoin d’une meilleure formation. Les inspecteurs semblaient avoir moins d’autorité que prévu dans le contrôle des activités de production et de marketing de l’industrie pharmaceutique. Ce problème était encore aggravé par l'absence de politiques qui permettraient d’appuyer une approche plus uniforme et systématique du processus d’inspection à l'intérieur des pays et entre les pays.

1School of Pharmacy, University of Auckland, Auckland, New Zealand (Correspondence to Z. Babar: z.babar @auckland.ac.nz). Received: 22/02/12 accepted: 03/09/12

919 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Introduction China [10] suggested that, when avail- [12,13]. Additional qualitative data was able, inspection procedures in devel- collected from inspectors within the Despite being profit-making businesses, oping countries are less common and 4 countries sampled. It was believed the first priority of pharmaceutical com- more variable relative to inspections in that this survey design would provide panies should be to assure the quality developed countries. optimal data collection and could also of the products they manufacture [1,2]. Our study was founded on the help to identify issues for more in-depth The process of inspection of pharma- need to better understand inspection future research [14]. Ethical approval ceutical facilities is an activity that is practices, specifically in the context of was obtained from the University of expected to assist with compliance by developing countries in the Arab world. Auckland human participant ethics the industry with internationally rec- We are not aware of any previous stud- committee (reference 2009/003). ognized guidelines that support good ies that explored dual-stakeholder views Data collection manufacturing practice (GMP). There (of inspectorate and industry staff) in a are many types of audits and inspec- single study. The objective of this study Survey instruments tions (routine or formal, concise or ab- was to describe inspection practices in Two survey instruments were devel- breviated, follow-up, special inspections 4 developing countries from the view- oped from an initial list of questions and quality system reviews) and varying point of inspectors and pharmaceutical that this study aimed to answer, as well roles of individuals within regulatory industry staff. as through a synthesis of the relevant agencies and the pharmaceutical in- literature. Question numbers were re- dustry [3,4]. The approaches to inspec- duced via an iterative process involving tions can be centred on the process, the Methods the research team, with each question product or the system or all of these [3]. critically reviewed. Questions that did Sampling frames Within high-income countries, as- not directly contribute to answering the sessing compliance with GMP is well Four developing countries were select- research question were omitted. Effort established and there are set protocols ed from the Arab Middle East, including was made to set out the questionnaire as for approaching inspections [5–8]. 2 high-income countries – United Arab clearly as possible. This included the use Inspection has become normal prac- Emirates (UAE) and Saudi Arabia – of non-ambiguous instructions, along tice and audits are accepted as routine and 2 low- to middle-income countries with a simple, clear and attractive layout and an important aspect of the supply – Egypt and Jordan. The rationale for [15]. chain process, as GMP verification is selecting these nations was based on Both survey instruments were de- required in order to meet the inspection their having an interest in development veloped in English; however, Arabic requirements of export markets. Many within Arab nations and having likely versions were developed in order to pharmaceutical companies in Eastern access to participants and organizations be able to engage more respondents Europe, the Middle East and Africa are by the lead researchers and a broad in their native tongue. The survey in- undergoing rapid development in order range of current practices which were struments were predominantly quan- to meet the requirements of industrial- anecdotally known to occur in these titative, although open questions were ized nations. It is common practice for countries. included in order to be able to explore these companies to consult with inde- A purposive sampling strategy was individual opinion about some aspects pendent professionals, either privately adopted in order to understand the of inspection practices [12,15]. The sur- or through European Union-funded viewpoints of those conducting the veys were expected to take between 15 initiatives, in order to obtain GMP certi- inspections and those subjected to the and 30 minutes to complete. The layout fication. This is required for pharmaceu- inspection process [11]. Two groups of involved tick boxes outlining a range of tical companies to submit applications participants were sampled: inspectors responses for each question. for international authorization, enabling from health regulatory authorities and The survey instrument for inspec- them to progress to export business. quality assurance (QA) staff working tors contained 37 questions divided There is some dialogue suggesting a within pharmaceutical companies. into 9 main sections: demographics, lack of trained inspectors in developing including minimum qualifications countries and consequently that the Survey design and experience; available training and local pharmaceutical companies face This was a descriptive study carried education programmes and satisfac- difficulties and delays obtaining GMP out from September 2008 to Febru- tion with these and funding; inspection certification [4,9]. There have been few ary 2009 and a cross-sectional survey planning and strategies as well as fac- studies of this issue, but one conducted design was implemented in order to tors influencing duration of the visit; in Egypt [9] and a commentary from collect predominantly quantitative data financial considerations; approaches

920 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

to visit, recording observations and in- (a) forward approaches, i.e. tracing 8 in Saudi Arabia and 5 in the United spector authority; guideline use; correc- forwards from the raw materials and Arab Emirates (UAE). Surveys were tive actions, final inspection reporting, following the system through the fac- collected from 15 QA staff by post, from approaches to communication of cor- tory to the dispatch warehouse—this 5 by face-to-face interviews and from 3 rective action and follow-up; communi- is a hypothetical exercise that focuses by email. cation obstacles that could compromise on physical systems; (b) backward ap- Regulatory context inspections; and recommendations and proaches, i.e. tracing backwards from suggestions (open question). the finished product in the warehouse Inspectors reported that the UAE The survey instrument for pharma- to review the entire history back through Ministry of Health [17,18], Jordanian ceutical industry QA staff included 20 the system—this is a fact-based exercise Food and Drug Administration [19] questions divided into 5 main parts: that focuses on documentation; and (c) and Egyptian Ministry of Health [9] preparation planning for an inspection random approaches, i.e. starting from each have 1 regulatory health authority. visit; financial budgets for inspections; points around the factory that appear to Conversely, Saudi Arabia has several internal auditing, areas of usual inspec- be significant and working either back- (Ministry of Health, Saudi Food and tion, frequency of self-inspection and wards or forwards as necessary [3]. Drug Administration and the Gulf Cen- format of inspection reports; external Data management and analysis tral Committee for Drug Registrations) [20]. auditing, types of communication with All data collected from participants who regulatory body and final report for- responded in Arabic were translated Inspectors’ views on roles, mats; and an open question asking the into English by R.H. and checked as part process, and delegated respondents for recommendations for of the data management QA process. authority increasing the inspection efficiency. Data entry and analysis was conducted Qualification and roles Procedures using SPSS, version 17 software. All The majority of inspectors specified original English and translated data Surveys were provided to participants that a bachelor of pharmacy degree was entered into a single database (in either at the time of the country visit should be required for the job (n = English format), for ease of analysis. by one of the authors (R.H.) or were 23, 71.8%) and 9 participants (28.1%) Data entries were double checked by posted. Different methods were used suggested that inspectors should be statisticians from the Student Learning required to pass a national examination to engage participants. A covering letter Centre at the University of Auckland explained the purpose of the research, of pharmacy or an equivalent certificate. and from the University of the United Three respondents (9.3%) noted that and the survey questions were concise Arab Emirates to ensure accurate data and specific. Weekly reminder emails there were no specific requirements entry. SPSS was used to calculate the to become an inspector in their coun- and telephone calls were also made to frequency and percentage of responses encourage participants to complete the tries. Along similar lines 4 respondents to each question, as appropriate. Results (12.5%) indicated that no specific quali- surveys and to return them as soon as were presented as tables and graphs fication was required for inspectors; the possible [12,15]. within SPSS. Responses to open-ended caveat being the need to have 2–5 years Definitions questions were analysed and broad of experience of conducting inspections Although the terms are used inter- themes identified, and the frequency of and the appropriate level of training. each theme quantified. changeably, for the purposes of this Inspectors’ own work experience study the term “inspection” [2] was used Most of the respondents from Egypt, rather than “audit”, because it is the term Results UAE and Saudi Arabia had up to 5 years more commonly used in the countries of experience (n = 19, 59.4%), while the that participated in this research. Country of domicile single respondent from Jordan reported For the purposes of this study, Completed surveys were received more than 15 years of experience. The the process of a GMP inspection was from 32 inspectors: 16 in the UAE, 9 large majority of respondents saw their deemed to be a systematic and method- in Egypt, 6 in Saudi Arabia and 1 in main role as policing (n = 28, 87.5%), ical review of a facility [3]. The GMP Jordan. Survey responses were collected as well as the review of required cor- Institute’s standard auditing procedure via personal interviews in the UAE and rective actions (n = 25, 78.1%). Nearly was adopted as the reference standard by post or in a few cases by email in two-thirds (n = 21, 65.6%) suggest that for this paper [16]. the other countries. In addition 23 QA providing advice and/or consultation The 3 main approaches used by staff within pharmaceutical facilities and cooperation with industry staff inspectors in the developing world are: participated in this study: 10 in Egypt, was a key part of their role. A similar

921 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

response pattern was seen from repre- authorities (n = 10, 62.5%). Access to across countries, with inspectors from sentatives in Egypt, although the role inspection records from previous visits UAE using the whole range of available of the inspector working with industry was less common, particularly in Saudi methods. Arabia where none of the respondents staff was given more emphasis than in Corrective actions and final reporting the UAE. The most common response suggest this occurs. The majority of inspectors reported from respondents from Saudi Arabia With respect to the inspection visit, that they supplied a description of the was the policing role, followed by work- the backward and forward approaches inspection list (n = 21, 65.6%) and ing with the industry to improve quality. were used by similar proportions of in- included negative and positive observa- The inspector from Jordan indicated spectors (46.9% and 50.0% respective- tions in their reports (n = 20, 62.5%). that all 4 roles were important. ly), while the random approach was less Approximately half (n = 15, 46.8%) commonly used (25.0%). Respondents Inspection plans and procedures of the respondents included recom- could provide more than one answer Nearly half of the inspectors (n = 29, mendations for improvements (n = 16, to this question and the UAE inspec- 48.2%) reported a warning period of up tors reported use of all approaches in 50.0%), required corrective actions and to 1 month prior to inspection, while al- equal measure. Saudi Arabia inspec- the time-frame for required response most one-third (n = 9, 31.0%) reported tors reported that the forward approach (n = 15, 46.8%) as part of their normal that no announcement was made at all. was the only one used. The majority of practice. Extended warnings of up to 12 months inspectors from Egypt preferred to take It would appear that inspectors from occurred less commonly (n = 3, 10.3%). a backward approach to the inspection UAE and Egypt provided the broad- Inspectors from Saudi Arabia showed process. The respondent from Jordan est range of information in their final the widest range of time frames from up reported that the backward approach reports; Saudi Arabia and Jordan less to 1 month (30.0%), 3 months (33.3%) was the only one taken (Table 1). so. Three-quarters of respondents use and 6 months (16.6%). In terms of in- Nearly two-thirds of the inspec- formal written letters as inspection fol- fluencers of the duration of inspection tors (n = 19, 59.3%) indicated that the low-up on required corrective actions visits, most inspectors reported that purpose of the inspection visit was the (n = 24, 75%). Email was used least the purpose of the visit (n = 26, 81.2%) most important factor when deciding often (n = 3, 9.3%); telephone and fax and the size of the company being in- which approach to adopt. The inspec- were used to the same degree (n = 12, spected (n = 16, 81.2%) were the main tion history was also deemed important 37.0%). Similar patterns of communica- influencers. Other factors important (n = 12, 37.5%), followed by inspector’s tion methods were reported across the to the inspectors included distance of personal choice (n = 8, 25.0%), while countries studied. The great majority of pharmaceutical facility from main cen- some suggested all of the above reasons inspectors reported using a combina- tres and the extent to which “negative” influenced the decision (n = 5, 15.6%). tion of written report and follow-up issues were observed during the visit. During the inspection, checklists were visit to check that corrective actions Close to two-thirds of inspectors (n most commonly used (n = 26, 81.2%), had been implemented (n = 23, 71.8%). = 20, 64.5%) reported that an informa- but note-taking (n = 9, 28.1%) and still Close to half the inspectors reported us- tion pack was supplied by the company cameras were also used by some in- ing a follow-up visit (n = 15, 46.8%) and prior to inspection. Inspectors in the spectors (n = 9, 28.1%) and a few used more than one-quarter (n = 9, 28.1%) UAE were more likely to have addi- flow-charts (n = 2, 6.3%) and video (n requested company reports; outlining tional information provided by health = 4, 12.5%). There was some variation that corrective actions had occurred.

Table 1 Approaches to inspection of pharmaceutical manufacturing facilities used by inspectors in the 4 countries Country (no. of inspectors Forward approacha Backward approachb Random approachc responding) No. % No. % No. % United Arab Emirates (n = 16) 8 50.0 8 50.0 8 50.0 Saudi Arabia (n = 5) 5 100.0 0 0.0 0 0.0 Egypt (n = 9) 2 22.2 7 77.7 0 0.0 Jordan (n = 1) 0 0.0 1 100.0 0 0.0 Total (n = 32) 15 46.9 16 50.0 8 25.0 Respondents could provide more than 1 answer to this question. aTracing forward from raw materials and through the factory to end at the dispatch warehouse; bTracing backward from finished product in the warehouse to review history back through the system; cStarting from points around the factory that appear to be significant and working either backward or forward as necessary [6].

922 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

Table 2 Inspectors’ views on inspection issues and difficulties Issue or difficultya No. % (n = 32) Lack of training and education programmes 13 40.6 Inadequate numbers of inspectors 9 28.1 Transportation difficulties 9 28.1 Not enough time to complete the required inspection 7 21.9 Difficulties in arranging the time of inspection between inspectors and facility 5 15.6 Inadequate salary and benefits for inspectors from the regulatory authorities 5 15.6 No specific format for reporting observations and findings 5 15.6

aItems mentioned by > 15% of respondents.

Inspector authority Inspection barriers and to the facilities, inadequate numbers Just over half (n = 17, 53.1%) of the difficulties of inspectors and insufficient time set inspectors surveyed reported that Only 12 of the 32 inspectors (37.5%) aside to complete the requirements they had the authority to delay the responded to the question about for a thorough inspection. issue of a GMP certificate and 3 re- communication with overseas in- Levels of response by QA staff to spondents (9.3%)—1 from each of spectors. Of these half (n = 6, 50.0%) the question about inspection difficul- UAE, Saudi Arabia and Jordan—re- reported that they had poor commu- ties was very low; there being a single ported the ability to revoke marketing nication with international inspec- response for most categories. No warn- authorization. Less than one-quarter tors, the highest being in the UAE. ing of inspection, no specific inspection (n = 7, 21.8%) of inspectors were in Reported barriers from inspectors plan, lack of allocated time, inspectors a position to close a facility or delay included: language (n = 15, 46.8%), without appropriate background and approval of licenses or marketing au- cultural differences (n = 10, 31.2%), imprecise questioning were highlighted thorizations. inappropriate body language (n = as difficulties. 5, 15.6%), lack of communication Guidelines from the Therapeutic QA staff views on preparation, Goods Administration in Australia between inspectors and pharmaceu- process and recommendations were most commonly referred to (n = tical industry staff (n = 16, 50.0%). Inspection visit preparation 18, 56.2%), followed by the European Inspectors identified with a long list of Medicines Agency (n = 13, 40.6%) issues and difficulties associated with The majority of QA staff had experi- World Health Organization (n = 10, inspections and the more common enced an inspection visit (n = 21, 31.2%), United States Food and Drug ones (> 15%) are outlined in Table 91.3%). A large majority of respondents Administration (n = 7, 21.8%) and In- 2. The most common were lack of agreed that maintenance records (n ternational Conference on Harmoniza- training and education programmes, = 18, 78.6%), sanitation and hygiene records (n = 15, 65.2%) and standard tion (n = 3, 9.3%). followed by transportation difficulties operating procedures (n = 14, 60.9%) were the types of documents to be Table 3 Quality assurance staff responses to question about levels of self- prepared prior to an inspection visit. inspection for good manufacturing practice (GMP) A minority of respondents suggested Aspects of GMP for self-inspection No. % that recall records (n = 9, 39.1%) and (n = 23) manufacturing batch records (n = 2, Personnel working in the facility 19 82.6 8.7%) should be prepared. Maintenance of the factory 14 60.9 Levels of self inspection Manufacturing and testing 17 73.9 All QA staff noted that facilities had self- Quality control procedure 22 95.7 inspection plans and a great majority Documentation preparation 19 82.6 (n = 20, 87.0%) had completed written Recall procedures 15 65.2 self-inspection plans. Quality control Follow-up to previous self-inspections 14 60.9 procedures were seen as critical in the Validation and monitoring procedures 15 65.2 self-inspection procedure and there was Control of printed components 16 69.6 a long list of them (Table 3).

923 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Table 4 Quality assurance staff responses to question about the components of a (n = 6, 26.1%). Participants’ responses final inspection report to a list of components included in a Components No. % final inspection report are outlined in (n = 23) Table 4. Brief summary 8 34.8 Other items concerning observa- Report with commentary 6 26.1 tions, recommendations, description Detailed report 11 47.8 of the inspection list and time-frames Recommendations for improvements 22 95.7 for the required response all had re- Corrective plans for overcoming non sponse rates > 85%. Just under half of conformity 21 91.3 the respondents (n = 10, 43.4%) sug- A time-frame for required responses 20 87.0 gested that sharing of the final inspec- Description of the inspection list 21 91.3 tion report was conditional and could Negative and positive observations 20 87.0 depend on the results in the report Inspectee signature space when corrective and the reason why another authority action completed 0 0.0 had asked to view it. A minority of par- ticipants would share their inspection reports with other authorities (n = 4, Monthly self-inspection was the External inspections and recommen- 17.5%) and the rest would not (n = 9, most common system, followed by dations 39.1%). quarterly then 6-monthly. Respond- QA staff views about the use of video or Education and training ents suggested that corrective actions photographs was split relatively evenly Most of the inspectors reported that from a self-inspection were completed between agreement (n = 11, 47.8%) and training sessions were available for within a specified time-frame n( = refusal (n = 12, 52.2%). Written formal them (n = 23, 71.9%). Half suggested 21, 91.3%); most commonly within letters were most commonly used to an internship for new inspectors was 2 weeks to 1 month (n = 8, 34.7%), communicate with inspectors (n = 13, available in some cases but that there although there was a broad range of 56.5%), followed by telephone calls (n = were no practical aspects included with responses. 8, 34.8%), emails (n = 8, 34.8%) and fax the theoretical sessions. Training pro- grammes are compulsory in the UAE and Jordan. The majority of inspectors Not satisfied from the UAE and Jordan were satis- Sparingly satisfied fied or extremely satisfied with the QA Satisfied training programmes. In contrast, the 6 Very satisfied Extremely satisfied majority of respondents from the Saudi Arabia and Egypt were not satisfied or unsatisfied with the programmes in general (Figure 1). 4 Inspectors without appropriate background and imprecise questioning Frequency (No.) Frequency were highlighted as difficulties associat- ed with inspections from the viewpoint 2 of QA staff.

Inspection fees From the viewpoint of inspectors, fees 0 were most commonly of the fixed-fee United Arab Saudi Arabia Egypt Jordan type. From the viewpoint of QA staff, Emirates variable inspection fees were deemed Country to be most common (Table 5). The inspection fee was most commonly Figure 1 Satisfaction of inspectors in the 4 countries with training sessions paid by the pharmaceutical company (Table 6).

924 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

Table 5 Inspectors’ and quality assurance (QA) staff responses to question about mentioned included lack of time, inspection fees funding, transportation and stand- Type of fee Inspectors QA staff ardization of reporting. (n = 32) (n = 23) No. % No. % QA staff views Contract (fixed fee) 10 31.3 8 34.8 There appeared to be consistency Confidential or unknown 9 28.1 2 8.7 across countries in the perceived re- Variable fee 2 6.3 13 56.5 quirements for the preparation of No specific fee – – 2 8.6 inspection visits. Furthermore, self- According to the regulatory body – – 1 4.3 inspection plans and practices were Respondents could provide more than 1 answer to this question. commonly reported and corrective actions were followed within a time- frame. Variable inspection fees were Only 3 QA staff from different The main role was deemed to be “po- reported to be the most common type, countries reported that fees were set by licing”. The level of practical training, followed by fixed fees. Letters were government. One inspector from the approaches and satisfaction with these the most common form of commu- UAE advised that the health authority programmes varied markedly across the nication with inspection agencies. QA paid the inspection fee and 1 inspector 4 Arab countries surveyed. Inspectors staff expected to receive recommen- from Egypt responded that the cost believed they had a reasonable level dations for improvement, corrective was shared between the pharmaceutical of authority/power and were able to plans, a time-frame for responding, company and the government regula- delay GMP certification if they saw fit. description of the inspection list and tor. Responses to the inspection fee The ability to cease manufacturing and both positive and negative observa- question for QA staff were evenly split product marketing outright was less tions. Sharing of reports appeared to between being paid for by the phar- common. be conditional on the findings of the maceutical company or jointly by the A range of guidelines were used inspection. Difficulties with inspec- company and the regulating health during the inspection but the Austral- tions from the viewpoint of QA staff authority. ian Therapeutic Goods Administra- included: ad hoc visits, lack of specific tion guidelines seemed to be most pre-inspection plans, inadequate time popular. Either fixed fees or fees that spent conducting the inspection and Discussion were confidential appeared to be inspectors lacking background about commonplace. Inspection follow-up departments within the industry. This study set out to investigate the was generally in the form of letters views of both inspectors and QA staff in and only half of the respondents made Contribution made by this article the context of inspection of pharmaceu- recommendations for improvement. tical manufacturing facilities in 4 Arab There would appear to be significant Academic literature addressing phar- countries. variability in the information pro- maceutical inspection processes with- in the developing world are scarce, Inspectors’ views vided in inspectors’ final reports; however, post-inspection follow-up despite an increasing trend toward the It was expected that inspectors be phar- visits appeared to be part of routine globalization of pharmaceutical regu- macists or have considerable experience. practice. Difficulties with inspection lation [21,22]. There is commentary

Table 6 Inspectors’ and quality assurance (QA) staff responses to question about source of inspection fee payments Source of staff inspection fee payments Inspectors QA staff (n = 32) (n = 23) No. % No. % Pharmaceutical company 14 43.8 9 39.1 Regulating health authority 1 3.1 3 13.0 Joint payment by pharmaceutical company and regulators 1 3.1 9 39.1 No answer or don’t know 6 18.8 2 8.7 Respondents could provide more than 1 answer to this question.

925 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

suggesting a lack of trained personnel could include more participants from addition, more operational level poli- and significant barriers to ensuring a larger range of countries. This may cies are required to inform and support inspection processes are consistent require a longer period for data collec- technical aspects of the role including within and across several develop- tion and could be more expensive to standard operating procedures and ing countries. The findings from this conduct because of telephone calls and reporting templates. study reflect that rhetoric. We are also the requirement for personal visits to In terms of practice, there are unaware of studies which compared increase engagement. In addition, the expected “flow-on” effects from -im the views of inspectors and representa- involvement of participants from more provements in policy development tives of pharmaceutical companies countries may require translation into and implementation. For example, in within the same study cohort; this multiple other languages. the longer term, inspection practices manuscript adds to that understand- are expected to be better supported ing. There appears to be a level of through educational policies that at- disconnect between inspectors and Implications and tract pharmacy students and through QA staff with regards some aspects recommendations providing basic training with a view to of inspection; both within and across their continuing a career in this area. the Arab countries studied. By taking The aim of this research was to ex- Local and international peer review and this approach across countries and plore inspection practices within the benchmarking practices will assist in through key stakeholder viewpoints, context of 4 Arab countries in order standardizing practice and reducing the misalignment of certain aspects of to understand where changes need variability in approaches to the inspec- policy and/or practice have been to be made to increase consistency, tion, reporting and follow-up. There uncovered which warrant further ex- efficiency and effectiveness [23]. It were several inconsistencies between ploration. For example, in this study is important to consider the implica- the views of inspectors and QA staff on divergence was found in viewpoints tions of the findings for policy, practice consistent payment practices and the associated with payment mechanisms. and any future research that may be expectations of the inspection process Equally, inspectors needed to be better required. Equally important is the need and reporting. Further work is required trained. to outline recommendations which to better understand and to minimize can be adopted by authorities and/ these differences through practices in- Limitations of the research or the pharmaceutical industry within formed by policy. As with any research this paper has developing countries. limitations and the results need to be Implications for future research interpreted in the light of these. The Implications for policy and sample size was small for both surveys practice A future research agenda has been and the analysis was limited to basic The findings of this study have impli- developed by identifying gaps in the descriptive statistics. Due to the small cations for policy and practice when academic literature alongside the sample size, generalizability of the data considered from the viewpoint of findings of this study (Tables 7 and may to other contexts not be appropri- both inspectors and QA staff (Tables 8). The following research streams ate because the respondents may not 7 and 8). There is some policy which represent the broad concepts in this be representative of the populations of supports more systematic approaches area of study which require further QA staff and inspectors. However, the to inspection of pharmaceutical fa- work. data set was still useful as a descriptive cilities within the context of developing Stream 1: The influence of further pol- analysis, uncovering issues for further countries; however, our study showed icy development and implementation in-depth study [14]. Another limitation there were major barriers to translat- Continued development of effective was that some participants did not an- ing this into transparent and consist- policy needs to occur and its influence swer all of the questions and declined to ent practice. What was striking was evaluated. This would include edu- provide a reason for their non-response. the variability both across and within cational policy promoting the role of However the reason may have been countries involved in this study. Policy inspectors and QA staff, evaluation of concerns about providing confidential development and implementation training programmes for inspectors, information, rather than lack of knowl- should span collaborative approaches and interventions to reduce variability edge. to education and training, delegated of the inspection process in its entirety. To increase generalizability across authority, payment mechanisms and The impact of international knowledge all Arab countries and allow cross- remuneration and policies that support sharing and collaborations needs to be country comparisons, future research and stimulate the use of technology. In assessed.

926 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

Table 7 Implications of the study for policy, practice and research: perspectives of inspectors Findings Implications for policy Implications for practice Implications for future research Inspectors should Policy to be developed to Review of pharmacy degrees Need for demographic studies be pharmacists or reflect this view. Joint policy to in developed countries to to determine the inspection have considerable be developed between health ensure the degree provides workforce. Understanding the experience. There is a authorities and pharmacy adequate basic training. Focus barriers and facilitators to being shortage. schools on attracting pharmacists to an inspector. this role

Perceived as a policing Policy to outline other Change in practice to ensure The influence of a dominant role important roles in addition to that the role is not undertaken focus on policing to be further policing exclusively as a policing role explored in terms of the overall process

Variable levels of Educational policy to be Practice better supported Evaluation of training practical training in developed which outlines what through practical on job interventions addition to theoretical constitutes effective theoretical training in addition to the aspects and practical training theoretical understanding required Approaches to Policy to be developed which Sharing of reports among Implementation and evaluation inspection and process informs standard inspection inspectors to encourage of approaches to reduce vary markedly along learning and reduction in inspection variability with information variability in amount and provided format of information delivered

Inspectors believe they Policy required around Local and international peer Audits of decision and have adequate power/ delegated authority and levels review of decisions regarding decision-making processes to authority at which inspectors can act. inadequate facilities to make reduce variability Inability of inspectors to the process more robust Understand the power stop marketing authorization differential between and close facilities in some inspectors and QA staff countries negates the point of and higher management of the inspection pharmaceutical facilities and appropriate decision-making

Inspection fees are Transparent payment policies Consistent and transparent Wide-scale surveys to better mostly confidential or are required payment practices required understand current payment fixed: different from QA mechanisms within and across staff views developed countries

Communication: Inspection policies need to Internationally recognized Implementation and evaluation • by letter support the increased use of standards need to become of cross-country information- • language barrier technology for communicating, common practice through sharing and experiential when communicating producing checklists and interaction between inspectors initiatives abroad reports. Development of cross- and authorities in developed country policies for countries and developing countries of a similar nature. Consistent policy around the use of video and photographs is required.

Difficulties with Development of SOPs and Comprehensive training and Evaluation of the impact of inspections written report template formats educational programmes training policy implementation • lack of training or needed. implemented for inspectors. and practices in a before and variable training Training and development Periodic inspectors meetings after study across countries policy required to inform to organize work, reduce • transportation compulsory inspector training deficiencies and outline • insufficient time consistent across developing responsibilities. Links needed • salary/reimbursement countries. Work towards between regulatory authority • no set format for international accreditation. administrators and inspectors inspection or report Formal examination and in terms of the process, reports licensing policies consistently and forms used and decision- required across all developing making processes. Meetings countries between inspection team members before starting the visit to ensure the inspection team is well coordinated with regard to purpose and individual responsibilities.

QA = quality assurance; SOP = standard operating procedures.

927 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Table 8 Implications of the study for policy, practice and research: perspectives of quality assurance staff Finding Implications for policy Implications for practice Implications for future research Visit preparation There is the belief that visit Although staff believe this Wider evaluation and audit and self-inspection preparation and self-inspection aspect is done relatively of whether visit preparation activities undertaken activities are being undertaken, well, there is always room for and self inspection practices but is no policy around what improvement, and support of are in fact as common as this these procedures should best-practice needed. More study suggests. Understanding constitute information may need to be what is undertaken and what provided by pharmaceutical contribution self-inspection facility visits undertaken by makes so as to inform future international inspectors best practice in the developing world Inspection fees are Payment policies required Consistent and transparent Further exploration of the variable, followed by payment practices required different views of inspectors and fixed-fees, and this QA industry staff with respect to is different from the payment is warranted inspectors Inspection Policy to facilitate the use of IT The gap between what QA Wide-scale evaluation of communication and required. QA staff have ideas staff expect to receive, what is external inspection reports recommendations about what they expect to policy and normal practice to be through content analysis would receive and this needs to be aligned help to inform policy and considered for future policy improve current practice development. Policy around inspection report sharing is required Difficulties with Policy on ad hoc visiting More information provided by Wide-scale surveys of the inspections required. Pros and cons need the pharmaceutical facility prior barriers and facilitators to • ad hoc visiting to be considered. Visits by to inspection, particularly with efficient and effective inspection • planning inspectors from authorities foreign inspectors. practices needed based on the • time outside of the country less likely Health authorities websites findings of this study • inspector insight/ to be ad hoc; joint policy may needed for the industry staff to experience need to be developed in light understand GMP requirements. of this. This practice to be put in place Training and development and supported by regulatory policy required to inform policy. inspector training Workshops to be provided by regulatory authorities for pharmaceutical facilities to explain GMP compliance and marketing authorization requirements. Appropriate amounts of time needs to be allocated by inspectors and QA staff

QA = quality assurance; IT = information technology; GMP = good manufacturing practice.

Stream 2: Understanding human inspectors rate sites and feedback to Stream 4: Better understanding of factors them will allow benchmarking to take fiscal mechanisms and their influence A better understanding of the current place. There seems to be some misalign- workforce and future potential work- Stream 3: System development, oper- ment with the experiences of QA staff force is required. Alongside this, further ational research and audit evaluation and inspectors when it comes to fee payment mechanisms. Local and work on remuneration packages for Undertaking a content analysis of international benchmarking will be inspectors is required through local and current inspection reports would required. international benchmarking. The rea- provide a baseline for measurement sons for the dominant policing culture of future policy implementation/ and how other aspects of the process initiatives. Following on from this, Conclusions might be better integrated warrants wide-scale studies of the barriers and further exploration. Understanding facilitators of change in this sector are This study set out to investigate in- aspects of decision making and how required. spection practices of pharmaceutical

928 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

manufacturing facilities in 4 Arab in the policies and practice of in- Acknowledgements countries through the viewpoints of spection. A future research agenda inspectors and QA staff. The findings is posed around 4 streams of work Funding: This research received no grant of this study have significant implica- involving human factors, systems and from any funding agency in the public, tions for policy and practice. There processes alongside fiscal considera- commercial or not-for-profit sectors. seems to be considerable variation tions. Competing interests: None declared.

References

1. Fisher J et al. A compliance management system for the phar- 12. Creswell JW. Research design: Qualitative, quantitative and maceutical industry. In: Braunschweig B, Joulia X, eds. 18th mixed methods approaches. Thousand Oaks, California, Sage, European Symposium on Computer Aided Process Engineering. 2009. Oxford, Elsevier Science, 2008:949–945. 13. Hussey J, Hussey R. Business research: a practical guide for 2. Kaplan WA et al. The impact of regulatory interventions on phar- undergraduate and postgraduate students. Basingstoke, United maceutical access and quality: what is the evidence and where Kingdom, Palgrave, 1997. are the gaps in our knowledge? Boston, Massachusetts, Boston 14. Lincoln YS, Guba EG. Naturalistic inquiry. Newbury Park, Cali- University Press, 2003. fornia, Sage, 1985. 3. McCormick K, ed. Pharmaceutical engineering series: quality. 15. Foddy N. Constructing questions for interviews and question- Oxford, Butterworth-Heinemann, 2002. naires: theory and practice in social research. Cambridge, Cam- 4. Willing SH. Good manufacturing practices for pharmaceuticals: bridge University Press, 1993. a plan for total quality control from manufacturer to consumer, 16. GMP Institute—the global leader for GMP training. International 5th ed. New York: Marcel Dekker, 2001. Society of Pharmaceutical Engineers [online resource centre] 5. Quality systems audits. United States Food and Drug Administra- (http://www.gmp1st.com, accessed 29 July 2013). tion [online manual] (http://www.fda.gov/MedicalDevices/ 17. Medical facility licensing. Health Authority Abu Dhabi (http:// DeviceRegulationandGuidance/PostmarketRequirements/ www.haad.ae/haad/tabid/125/Default.aspx, accessed 29 July QualitySystemsRegulations/MedicalDeviceQualitySystems- 2013). Manual/ucm122726.htm, accessed 29 July 2013). 18. Manufacturing licensing and GMP certification procedures and 6. European Medicines Agency [website] (http://www.emea. guidelines. Abu Dhabi, Ministry of Health, United Arab Emir- europa.eu/, accessed 29 July 2013). ates, 2009. 7. Therapeutic Goods Administration. Guidance on the GMP 19. Jordanian Food and Drug Administration [website] (http:// clearance of overseas medicine manufacturers. Canberra, Aus- www.jfda.jo/en/Departments/DeptInfo.aspx?id=614&Title, tralian Government, Department of Health and Ageing, 2008. accessed 29 July 2013). 8. New Zealand Medicines and Medical Devices Safety Author- 20. Al-Showaier I. Central Committee for Drug Regulation. Paper ity (http://www.medsafe.govt.nz/index.asp, accessed 29 July presented at the GCC Central Registration Conference, Saudi 2013). Arabia (http://www.ich.org/fileadmin/Public_Web_Site/ 9. Wahdan MA et al. Auditing in Egypt: a study of the legal frame- Meetings/C-GCG_Reports/Nov_2004_Yokohama/GCC_ work and professional standards. Paper presented at MsM's presentation_Nov._04.pdf, accessed 29 July 2013). Partners Conference. Maastricht, Maastricht School of Manage- 21. Vogel D. The globalization of pharmaceutical regulation. In- ment, 2005. ternational Journal of Policy and Administration, 1998, 11:1–22. 10. China Food and Drug Administration [website] (http://www. 22. Juillet Y. Internationalization of regulatory requirements. Phar- sfda.gov.cn, accessed 29 July 2013) [in Chinese]. maceuticals Policy and Law, 2007, 9:369–382. 11. Liamputtong P, Ezzy D. Qualitative research methods. Oxford, 23. Graetz F et al., eds. Managing organisational change. Milton, Oxford University Press, 2005. Queensland, John Wiley, 2002.

929 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Pharmacovigilance in Qatar: a survey of pharmacists K. Wilbur 1

ُّظ التيقالصيدالين يف َق َطر: استبيان للصيادلة كريي ويلرب اخلالصـة:متس احلاجة لربامج وطنية فعالة ُّللتيقظ الصيدالين من أجل رصد التأثريات الضائرة لألدوية عىل السكان املحليني. وقد هدفت هذه الدراسة إىل وصف املعارف واخلربات واملواقف والعقبات املدركة بالنسبة لإلبالغ عن التأثريات الضائرة لألدوية من قبل الصيادلة يف قطر. وقد أجاب 116 ًصيدالنيا عىل استبيان يتضمن 27 ً عرببندا اإلنرتنت )معدل االستجابة 25%(، وقد كانت املعرفة باملصطلحات وبالغرض من اإلبالغ 29.3 بالتأثريات الضائرة لألدوية مرتفعني، إال أن %فقط منهم مل يكتب ًأبدا ًبالغا حول التأثريات الضائرة لألدوية يف قطر. وقد ع ّبر معظم املستجيبني عن مواقف إجيابية نحو دور الصيديل يف ُّالتيقظ الدوائي، كام نظر املستجيبون إىل عدم القدرة عىل التعرف عىل احتامل وقوع التأثريات الضائرة لألدوية أوالوصول إىل نموذج اإلبالغ عىل أهنام من العوائق، كام نظر املستجيبون إىل التدريب املعزر وإىل الكفاءة يف تقديم البالغات بمثابة عوامل تسهيل اإلبالغ يف املستقبل. وكان الصيادلة يف املستشفيات أكثر احتامال ًلإلبالغ عن التأثريات الضائرة لألدوية بسبعة أضعاف غريهم يف قطر. ويرغب الصيادلة يف قطر يف اإلسهام بأنشطة ُّالتيقظ الصيدالين إذا ّتم دعمهم بمزيد من التدريب وبالشفافية يف عملية اإلبالغ.

ABSTRACT Active national pharmacovigilance programmes are needed to monitor adverse drug reaction (ADR) data in local populations. The objective of this study was to describe the knowledge, experiences, attitudes and perceived barriers to reporting of suspected ADRs by pharmacists in Qatar. A 27-item web-based survey was answered by 116 pharmacists (25% response rate). Knowledge of ADR terminology and reporting purpose was high, but only 29.3% had ever made a suspected ADR report in Qatar. Most respondents expressed positive attitudes towards the pharmacist’s role in pharmacovigilance. Inability to recognize a potential ADR or access a reporting form were perceived as barriers. Enhanced training and efficiency in report submissions were identified as facilitators to future participation. Hospital pharmacists were 7 times more likely to have reported a suspected ADR in Qatar. Pharmacists in Qatar are willing to engage in pharmacovigilance activities if supported by increased training and transparency in the reporting process.

Pharmacovigilance au Qatar : enquête auprès des pharmaciens

RÉSUMÉ Des programmes de pharmacovigilance nationaux actifs sont requis pour surveiller les données relatives aux réactions indésirables aux médicaments dans les populations locales. L’objectif de la présente étude était de décrire les connaissances, les expériences, les attitudes et les obstacles perçus en matière de notification des réactions indésirables par les pharmaciens au Qatar. 116 pharmaciens ont répondu à une enquête en ligne à 27 items (taux de réponse de 25 %). Leur niveau de connaissances en ce qui concerne la terminologie pour les réactions indésirables et les objectifs de notification était élevé, mais seuls 29,3 % d’entre eux avaient déjà notifié une suspicion de réaction indésirable au Qatar. La majorité des répondants ont présenté des attitudes positives au sujet du rôle du pharmacien en matière de pharmacovigilance. L’incapacité à reconnaître une réaction indésirable potentielle ou à accéder à un formulaire de notification ont été perçus comme des obstacles. Une formation et une efficacité accrues dans la transmission des notifications ont été identifiées comme des facteurs favorisant une future participation. Les pharmaciens hospitaliers étaient sept fois plus susceptibles d’avoir notifié une suspicion de réaction indésirable que les autres pharmaciens dans le pays. Les pharmaciens au Qatar sont disposés à s’impliquer dans des activités de pharmacovigilance s’ils bénéficient d’une formation et d’une transparence accrues pour le processus de notification.

1College of Pharmacy, University of Qatar, Doha, Qatar (Correspondence to K. Wilbur: [email protected]). Received: 25/07/12; accepted: 01/10/12

930 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

Introduction Methods and multiple logistic regression analyses were used to examine differences in Suspected adverse drug reaction Sample ADR reporting (dependent variable) (ADR) reporting is the cornerstone of Using workplace contact information, among pharmacists according to a priori pharmacovigilance activity; however, all known pharmacists in Qatar (n = defined criteria including independent its infrastructure varies throughout 568) were invited by email to participate variables: age; sex; years in practice; and the world. Surveillance programmes in an anonymous web-based survey. practice setting. All data analyses were within individual health care facilities The research was approved by both the conducted using SPSS for Mac®, version may supplement a central national University of Qatar and London School 19.0. registry, which may in turn augment an of Hygiene and Tropical Medicine in- international database. Most reporting stitutional review boards. systems are voluntary and while spon- Results Questionnaire development taneous reporting offers advantages of Background characteristics low expense and less complexity, bar- A comprehensive review of the English riers such as time, ambiguity in ADR language literature was conducted us- The survey remained open between 30 April and 30 June 2011. Of the 142/568 identification and lack of feedback ing pertinent electronic health data- responses (25.0% response rate), 116 contribute to under-reporting in sev- bases (PubMed, Embase, International (81.7%) surveys included information eral countries [1–6]. Pharmaceutical Abstracts, Cumulative Index to Nursing and Allied Health Lit- about prior experiences with reporting Qatar is an affluent Arab emirate suspected ADRs. with a population of 1.9 million (pre- erature) from 1990 to December 2010 A total of 17 different countries of dominantly expatriates). The Qatar using a combination of predetermined origin were represented and almost half Supreme Council of Health (SCH) keywords and phrases. Hand-searching of pharmacists had practised in Qatar has a pharmacy and drug control of references of retrieved articles was for < 5 years (Table 1). Most respond- department subdivision assuming also performed. The questionnaire was developed according to the domains of ents represented hospital inpatient various medication regulation roles, interest evaluated in this existing litera- practices (64.0%). Only 14 (12.1%) had but there is no coordinated national ture: subject demographics; ability to never worked in a hospital pharmacy. pharmacovigilance programme. A re- detect suspected ADRs (knowledge); cent inventory of pharmacovigilance experiences reporting suspected ADRs; Knowledge of ADRs activity in Qatar inpatient settings attitudes towards the pharmacists’ role Pharmacists’ knowledge of ADR termi- found that suspected ADR reporting in ADR reporting; perceived barriers nology was assessed and over 90% iden- policies and procedures are in place and facilitators to suspected ADR tified the World Health Organization within all public hospitals, but in only reporting; and recommendations for description of an ADR; however, ap- 1 of the 5 private hospitals [7]. improvements in this process locally. proximately 1 in 5 selected statements The success of any surveillance The questionnaire draft was formatted were inconsistent with accepted ADR system relies on the active participa- as an electronic survey and reviewed descriptions. Most pharmacists were tion of its reporters and is the respon- for face and content validity and piloted able to correctly distinguish an ADR sibility of everyone involved in the by a small randomly selected group of from a medication error [9,10]. medication use process. Pharmacists Qatari pharmacists. working in Qatar are a multinational Experience of ADR reporting group, emerging from heterogeneous Analysis Less than half of the respondents (49, curricula and training programmes Incomplete surveys were analysed if 42.2%) had made suspected ADR abroad, who may have been exposed a response to the dependent variable reports in the past and 34 (29.3%) to different processes of suspected question (history of suspected ADR reported doing so in Qatar. Most of ADR reporting and experiences with reporting in Qatar) was given. Fre- these local reports (29, 85.3%) were by pharmacovigilance activities in gen- quencies of correct answers to ADR hospital pharmacists, 4 (11.7%) from eral [8]. The objective of the present knowledge questions were assessed. Re- ambulatory clinics and 1 from a non- study was to describe pharmacists’ sponses were further stratified according direct patient care position. None of knowledge, experiences, attitudes and to categorical demographic parameters the community pharmacists surveyed perceived barriers to ADR reporting as well as comparisons between ADR had ever made a suspected ADR report in Qatar. reporters and non-reporters. Univariate in Qatar. Reporters mostly submitted

931 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Table 1 Demographic characteristics of pharmacists responding to the survey of their documentation to their hospitals adverse drug reporting (n = 116) (97.0%), but also directly to the SCH Variable Value (14.7%) or drug manufacturer (5.9%); Mean (SD) 18 (52.9%) described receiving some Age (years) 36.2 (8.3) form of acknowledgement for their sub- No. % mission. When asked to describe the Sex (female) 61 52.6 ultimate fate of a submitted suspected Country of origin (n = 114) a ADR report in Qatar, over half of all Qatar 4 3.4 surveyed pharmacists (54.3%) were Other GCC country 1 0.9 unsure. Egypt 40 34.5 Attitudes and barriers to ADR Jordan 13 11.2 reporting Other Middle Eastern country 13 11.2 Respondents uniformly agreed with the Sudan 21 18.1 aims of pharmacovigilance activity to Other African country 3 2.6 promote new understanding of medica- India/Pakistan 8 6.9 tion; patient safety; and transparency of Philippines 5 4.3 reporting. A high proportion (84.4%) Canada/United States 5 4.3 felt that suspected ADR reporting was United Kingdom 1 0.9 a professional obligation and if faced Highest pharmacy degree with a patient experiencing a serious Bachelors 102 87.9 ADR, the majority (90.5%) thought Masters 9 7. 8 they would initiate a suspected ADR Doctorate (PhD or PharmD) 5 4.3 report. Year of highest pharmacy degree Although many respondents agreed 2000–11 62 53.4 that lack of access to a reporting form 1990–99 38 32.8 and remuneration were problematic, a 1980–89 12 10.3 larger proportion disagreed that these 1970–79 4 3.4 issues were barriers. Time constraints Country where highest pharmacy degree obtained were also rated low (21.2%) as a poten- (n = 109) tial impediment. Inability to recognize GCC country 2 1.7 a suspected ADR was a barrier stated Egypt 41 35.3 by 39.4% of respondents. Pharmacists Jordan 20 17.2 identified an increased likelihood of Other Middle Eastern country 7 6.0 reporting a suspected ADR if the re- Sudan 12 10.3 actions were: serious for the patient Other African country 2 1.7 (96.2%); novel (90.2%) or associated India/Pakistan 10 8.6 with a new medication (88.8%); and Philippines 5 4.3 if some acknowledgment was offered Other European or Asian country 2 1.7 (75.2%). Many respondents (81.6%) United Kingdom 6 5.2 felt more pharmacovigilance training Canada/United States 2 1.7 and an ability to submit online (68.6%) Duration of working as a pharmacist (years) (n = 115) would facilitate reporting. < 2 6 5.2 2–5 14 12.1 Factors influencing ADR reporting 6–10 41 35.3 11–15 26 22.4 There were no significant differences < 15 28 24.1 among respondents when stratified according to sex, age, practice setting

932 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

Table 1 Demographic characteristics of pharmacists responding to the survey of greater than that reported elsewhere adverse drug reporting (n = 116) (concluded) recently [2,5]. Respondents illustrated Variable Value a good understanding of purpose and Duration of practice in Qatar (years) (n = 109) No. % positive attitudes towards suspected < 2 21 18.1 ADR reporting by pharmacists as the 2–5 27 23.3 majority considered it a professional 6–10 42 36.2 obligation. 11–15 14 12.1 One-third of respondents had sub- < 15 12 10.3 mitted a suspected ADR report in Qatar. Pharmacy practice site This rate is higher than in community Community 19 16.4 pharmacist populations documented Ambulatory care (private or public) (n = 5) 16 13.8 recently in the region (approximately Hospital (private or public) (n = 3) 72 64.0 10% in Saudi Arabia, 21% in Turkey), Other 9 7. 8 but within reported ranges when sur- aExamples of countries represented in the categories include: GCC (Oman, Kuwait); other Middle Eastern veys among hospital pharmacists in (Lebanon, Palestine, Syrian Arab Republic); other African (Nigeria, South Africa). the past decade are considered [2,6]. GCC = Gulf Cooperation Council; SD = standard deviation. Hospital pharmacists were most likely to have made a suspected ADR report and years in practice (Table 2). Only Discussion and this is consistent with studies con- availability of an ADR form was con- ducted elsewhere. Factors for such inpa- sidered a greater barrier for ambula- This is the first study evaluating sus- tient site-related differences in reporting tory care pharmacists when compared pected ADR reporting among phar- have been previously proposed and with their hospital-based colleagues macists in Qatar. Knowledge of ADR include greater familiarity with phar- (11.4% versus 40.3%, P = 0.002). When classification was assessed, as it follows macovigilance; constant contact with controlling for all other factors in the that poor knowledge would lead to patients experiencing serious ADRs; model, respondents working in hospital low declared reporting rates. Correct and close relationships with physicians settings were over 7 times more likely identification of ADRs through rec- who may delegate reporting of ADRs. to have reported a suspected ADR in ognition of definitions and patient de- When controlling for other variables Qatar. scriptions was high in our sample and in our model, increased age was also

Table 2 Logistic regression analysis of influence of personal and professional characteristics on adverse drug reporting (ADR) reporting by pharmacists in Qatar Characteristic Ever reported ADR Crude analysis Adjusted analysis a in Qatar No Yes OR (95% CI) P-value OR (95% CI) P-value Sex Male 34 20 1.00 Female 47 14 0.51 (0.23–1.14) 0.100 0.33 (0.11–0.95) 0.04 Age (years) b 1.01 (0.96–1.06) 0.653 0.86 (0.76–0.99) 0.03 Practice site Outpatient 31 4 1.00 Inpatient 43 29 5.23 (1.67–16.4) 0.002 7.42 (1.90–27.8) 0.003 Duration of practice in Qatar (years) < 2 19 2 1.00 2–5 22 5 2.15 (0.38–12.4) 0.390 1.43 (0.22–9.40) 0.790 6–10 11 3 6.46 (1.20–21.4) 0.020 11.2 (1.60–77.6) 0.020 11–14 25 17 2.59 (0.37–17.9) 0.340 6.78 (0.61–75.7) 0.12 > 15 5 7 13.3 (3.50–84.9) 0.006 23.7 (6.70–83.8) 0.003

aAdjusted for the effects of the other variables in the table; bIn the adjusted analysis, OR of 0.86 indicates that for each additional year of age, a respondent was 0.86 times less likely to reported a suspected ADR in Qatar, controlling for other factors in the model. OR = odds ratio; CI = confidence interval.

933 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

associated with decreased reporting. Uncertainty exists about how sub- study methodology to assess the fac- Older pharmacists in Qatar may have mitted suspected ADR reports are tors associated with ADR reporting graduated from product-centred edu- handled in Qatar. There is no directive was not possible. As our study relies cation models historically offered in in which reports are automatically ad- on self-reporting, we cannot confirm the Middle East region as opposed to vanced to the SCH from patient care pharmacists’ declared pharmacovigi- more contemporary patient-oriented sites and there is no indication that lance activities. programmes and, despite greater prac- reports received by the SCH are con- tical experience, have less clinical con- sistently or systematically addressed. fidence in detecting potential ADRs Local (hospitals, primary-care cen- Conclusions [8]. However, pharmacists with longer tres) and national (SCH) bodies alike practice history in the country in theory could enhance pharmacovigilance The results indicated that pharmacists’ have had greater opportunities to en- awareness and reporting with imple- workplaces exerted a strong influence counter, detect and report suspected mentation of a feedback mechanism; on the reporting of suspected ADRs in ADRs in Qatar. only half of our respondents described Qatar. Most responding pharmacists Unavailability of a reporting form receiving some form of acknowledge- had never submitted a report in the has been a stated constraint to volun- ment for their submission [15]. country, although they expressed posi- tary participation in pharmacovigilance There were a number of limita- tive attitudes towards pharmacovigi- activities in other studies [11–13], but tions to our survey warranting dis- lance activity and good knowledge of this was not a collective barrier in our cussion. Survey completion was by its purpose. population; this may be due to the an internet-based questionnaire. large number of hospital practitioners Community pharmacies in Qatar do responding who may have a standard not generally have computers and Acknowledgements form in place at their site. Pharmacists so pharmacists with limited or no The statements made herein are solely preferred a single and accessible sus- internet access at home may have pected ADR reporting form with web- been disadvantaged. Non-response the responsibility of the author. The based submission capability. Qatar error compromises the accuracy of author wishes to thank undergradu- pharmacists did express sentiments our conclusions and may further con- ate University of Qatar College of similar to both community and hos- tribute to selection bias and restrict Pharmacy students, Hala Sonallah and pital pharmacists elsewhere who were the generalizability of our study find- Amna Fadul, for their efforts in the unsure if a patient reaction was truly ings. Those who did not participate in initial development and translation of an ADR [14]. Communication and the study may have had less pharma- the pharmacist survey. education from regulatory and health covigilance awareness; therefore our Funding: This report forms one part professional bodies should emphasize findings regarding knowledge and of a larger project evaluating pharma- that clinical certainty is not a prerequi- attitude may be overestimations and covigilance in the Middle East made site for report submission, as causality the barriers to reporting underestima- possible by an undergraduate research assessment can be performed by the tions. Finally, because it is not possible experience project award from the pharmacovigilance authority accord- to access the identity of pharmacists Qatar National Research Fund (a ing to documentation of the suspected who have made suspected ADR member of the Qatar Foundation). ADR provided by the reporter. submissions in Qatar, a case–control Competing interests: None declared.

References

1. Belton KJ; The European Pharmacovigilance Research Group. 4. Al-Sultan MS, Bawazir SA. Adverse drug reaction reporting by Attitude survey of adverse drug-reaction reporting by health hospital pharmacists in Saudi Arabia. Saudi Pharmaceutical care professionals across the European Union. European Jour- Journal, 2009, 17:95–105. nal of Clinical Pharmacology, 1997, 52:423–427. 5. Su C, Ji H, Su Y. Hospital pharmacists’ knowledge and opinions 2. Toklu HZ, Uysal MK. The knowledge and attitude of the Turk- regarding adverse drug reaction reporting in Northern China. ish community pharmacists toward pharmacovigilance in Pharmacoepidemiology and Drug Safety, 2010, 19:217–222. the Kadikoy district of Istanbul. Pharmacy World and Science, 6. Nita Y, Batty KT, Plumridge RJ. Adverse drug reaction report- 2008, 30:556–562. ing: attitudes of Australian hospital pharmacists and doctors. 3. Bawazir SA. Attitude of community pharmacists in Saudi Ara- Journal of Pharmacy Practice and Research, 2005, 35:9–14. bia towards adverse drug reaction reporting. Saudi Pharma- 7. Wilbur K. Pharmacovigilance in Qatar hospitals. Pharmaceuti- ceutical Journal, 2006, 14:75–83. cal Medicine, 2012, 26:23–25.

934 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

8. Kheir N et al. Pharmacy education and practice in 13 Middle community pharmacists in Malaysia. Journal of Pharmaceutical Eastern countries. American Journal of Pharmaceutical Educa- Health Services Research, 2011, 2:71–78. tion, 2009, 72:1–13. 13. Al-Sultan MS, Bawazir SA. Adverse drug reaction reporting by 9. World Health Organization. International drug monitoring— hospital pharmacists in Saudi Arabia. Saudi Pharmaceutical the role of the hospital. A WHO report. Drug Intelligence and Journal, 2009, 17:95–105. Clinical Pharmacy, 1970, 4:101–111. 14. Nebeker JR, Barach P, Samore MH. Clarifying adverse drug 10. Aronson JK. Medication errors: definitions and classification. events: a clinician’s guide to terminology, documentation, and British Journal of Clinical Pharmacology, 2009, 67:599–604. reporting. Annals of Internal Medicine, 2004, 140:795–801. 11. Irujo M et al. Factors that influence under-reporting of sus- 15. Vallano A et al. Obstacles and solutions for spontaneous re- pected adverse drug reactions among community pharmacists porting of adverse drug reactions in the hospital. British Journal in a Spanish region. Drug Safety, 2007, 30:1073–1082. of Clinical Pharmacology, 2005, 60:653–658. 12. Elkalmi RM et al. A qualitative study exploring barriers and facilitators of reporting adverse drug reactions (ADRs) among

935 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Isolation and identification ofLegionella pneumophila from drinking water in Basra governorate, Iraq A.A. Al-Sulami,1 A.M.R. Al-Taee 2 and A.A. Yehyazarian 2

ِ استفراد َالف ْي َلقية ُالـم ْس َ ْتو َ ة حوالتعرف عليها يف مياه الرشب يف حمافظة البرصة، العراق أمني عبد اجلبار عبد اهلل السلمي، أسعد حممد رضا الطائي، أنيتا أرزروين حييا زاريان

اخلالصـة: أجرى الباحثون هذه الدراسة يف العراق للتعرف عىل معدل وجود الفيلقية ُالـم ْس َ ْتر ِو َ ةيف حمصادر خمتلفة ملياه الرشب يف حمافظة البرصة، ومدى استجابة خمتلف املستفردات لعدد من املضادات احليوية. وقد بلغ عدد عينات املياه 222 عينة مجعت يف الفرتة 2008 – 2009، وكان فيها 49 عينةمن حمطات تصفية املياه )يف نقاط الدخول، ويف صهاريج الرتسيب ويف صهاريج الرتشيح ويف نقاط اخلروج(، و127 عينة من مياه الصنابري، و46 عينةمن مياه اإلمدادات للصهاريج واملشاريع مجعت من خالل التناضح العكيس. وقد أكدت النتائج وجود الفيلقية املسرتوحة يف مصادر املياه اخلام، ويف إمدادات مياه الرشب العامة ويف صهاريج مياه الرشب. ومن بني 258 مستفردة، كان 77.1% منها من النمط املصيل 1 وكان 22.9% من األنامط 15 – 2 املصلية . وقد أظهرت مجيع َاملستفردات مقاومة لألدوية، والسيام األمبيسيلني، إال أهنا تستجيب للدوكيس سيكلني مئة باملئة. ّوتدل الدراسة عىلأن معدالت انتشار الفيلقيات املسرتوحة، والسيام املجموعة املصلية 1مؤرش قوي عىل عدم مالءمة مياه الرشب وعىل رضورة اختاذ إجراء ٍعاجل.

ABSTRACT This study in Iraq investigated the occurrence of Legionella. pneumophila in different drinking- water sources in Basra governorate as well as the susceptibility of isolates to several antibiotics. A total of 222 water samples were collected in 2008–2009: 49 samples from water purification plants (at entry points, from precipitation tanks, from filtration tanks and at exit points), 127 samples of tap water; and 46 samples from tankers and plants supplying water by reverse osmosis. The findings confirmed the presence ofL. pneumophila in sources of crude water, in general drinking water supplies and drinking water tankers. Of 258 isolates 77.1% were serotype 1 and 22.9% serotypes 2–15. All examined isolates displayed drug resistance, particularly to ampicillin, but were 100% susceptible to doxycycline. The prevalence of L. pneumophila, especially serogroup 1, is a strong indicator of unsuitability of drinking water and requires appropriate action.

Isolement et identification de Legionella pneumophila dans l’eau potable dans le gouvernorat de Bassora (Iraq)

RÉSUMÉ Une étude en Iraq visait à évaluer l’occurrence de Legionella pneumophila dans différentes sources d’eau potable dans le gouvernorat de Bassora ainsi que la sensibilité des isolats à plusieurs antibiotiques. Au total, 222 échantillons d’eau ont été prélevés en 2008 et 2009 : 49 échantillons de stations d’épuration des eaux usées (aux points d’entrée, dans les cuves de précipitation, dans les cuves de filtration et aux points de sortie), 127 échantillons d’eau du robinet et 46 échantillons d’eau de camions-citernes et d’établissements fournissant de l’eau par osmose inverse. Les résultats ont confirmé la présence de L. pneumophila dans les sources d’eau brute, dans les sources d’approvisionnement générales et les camions-citernes d’eau de boisson. Sur 258 isolats, 77,1 % étaient de sérotype 1 et 22,9 % de sérotypes 2–15. Tous les isolats examinés étaient pharmacorésistants, en particulier à l’ampicilline, mais 100 % étaient sensibles à la doxycycline. La prévalence de L. pneumophila, notamment du sérogroupe 1, est un puissant indicateur du caractère impropre à la consommation de l’eau de boisson et appelle des mesures adéquates.

1Department of Biology, College of Education, University of Basra, Basra, Iraq (Correspondence to A.A. Al-Sulami: [email protected]). 2Department of Marine Environmental Chemistry, Marine Science Centre, Basra, Iraq. Received: 06/04/12; accepted: 30/07/12

936 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

Introduction tap water collected from 18 districts; Antimicrobial susceptibility and 46 water samples collected from testing The Legionella pneumophila species of reverse-osmosis water suppliers (from Isolates were tested for antimicrobial bacteria comprises over 15 serogroups tankers supplying water by reverse os- susceptibility by the Stoke disk diffusion [1], of which serogroup 1 is responsible mosis in 19 different places and from 5 method [9] using Mueller–Hinton agar for the majority of human infections [2]. water-supply plants). and antibiotic disks (Bioanalyse). The Two clinical manifestations have been The samples were collected accord- following disks were used: doxycycline defined within this spectrum: Legion- ing to Standard methods for examina- (30 µg), erythromycin (15 µg), strep- naires’ disease, which is a pneumonic tion of water and wastewater [7] into tomycin (10 µg), gentamicin (10 µg), illness caused by an acute bacterial sterile sampling bottles, with 10 mL chloramphenicol (30 µg) and ampicil- infection of the lower respiratory tract; of a sodium thiosulphate solution at lin (10 µg). The plates were incubated at and Pontiac fever, which is an influenza- 1% in order to neutralize any residual 37 °C overnight. The diameter of zone like illness [3]. This Gram-negative chlorine. The water samples were di- of inhibition of each antimicrobial agent bacterium survives in water systems as rectly placed in ice, for transportation was measured and recorded as resistant, a parasite of protozoa [4], which are and examination within the same day. sensitive or intermediate according to readily found in cooling towers, hot- The concentration of residual chlorine the manufacturer’s table. water distribution systems, bathrooms, for each sample was measured using a swimming pools and fountains [5,6]. chlorine meter (Lovibond 2000) at the Infection results when L. pneumophila time of collection. Results are transmitted from an environmental Purification plant samples source (water or soil) to a host via the Isolation inhalation of contaminated aerosols. A duplicate of 5 mL of each sample from The logarithmic numbers ofL. pneu- However, there have been no reports water purification plants and tap water mophila and faecal coliforms from the of human-to-human transmission [1]. and 100 mL of water samples from 13 water purification plants in Basra Therefore, studies concerning the pres- reverse-osmosis plants and tankers was governorate are shown in Figure 1. All ence of these organisms in drinking- filtered by the membrane filtration tech- stations (except 1) showed the pres- water distribution systems are very nique using 47 mm cellulose acetate ence of both L. pneumophila and faecal important to ensure the good quality of membrane filters with a nominal pore coliforms in raw water. There was no public water. size of 0.45 µm (Sartorius). The mem- obvious reduction of these 2 groups in The present study in Iraq aimed to brane filter papers were placed on m-FC precipitation and filtration tanks. Few investigate the occurrence of L. pneu- agar and incubated in a water bath at stations, (5/13) showed the presence of mophila in different drinking-water 44.5 °C for 24 h and on Legionella agar L. pneumophila, whereas 9/13 were posi- sources in Basra governorate (water base (LAB) medium [8] containing tive for faecal coliforms in water coming sanitation plants, drinking water from Legionella growth supplement and from treatment plants. In precipitation different districts and reverse-osmosis Legionella-selective supplement which tanks 3/13 stations showed higher water-supply plants), as well as the sus- contained dyes, colistin sulphate, vanco- number of L. Pneumophila, while in the ceptibility of isolates to several antibiot- mycin, trimethoprim and amphotericin filtration tanks 2/13 stations showed ics. B (Himedia). They were incubated at higher numbers of L. pneumophila. 35 °C in an incubator with humidified Of the 106 isolates recovered from atmosphere for 24–72 h. purification plant samples on LAB Method medium, 55 of them belonged to L. Identification pneumophila serogroup 1 while the rest Water samples Suspected colonies were subcultured belonged to L. pneumophila serogroups A total of 222 water samples were in parallel onto LAB medium and were 2–15. collected in Basra governorate during subjected to Gram stain, oxidase, cata- the period from August 2008 to April lase, nitrate reduction, motility, gelatin Tap water samples 2009. These included: 49 samples from liquefaction, urease and hippurate test. Table 1 shows the average of the loga- all 13 water purification plants in the In addition the slide-agglutination test rithmic numbers of L. pneumophila and governorate (13 samples from entry [1] (HiLegionella latex kit, HiMedia) faecal coliforms and the concentration points, 13 from precipitation tanks, 10 was used for confirmatory identification of residual chlorine for the 127 samples from filtration tanks and 13 samples of L. pneumophila to serogroup 1 and of drinking tap water collected from 18 from exit points); 127 samples of serogroups 2–15. districts.

937 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Table 1 Average residual chlorine concentration and average frequency of Legionella pneumophila and fecal coliforms isolated from drinking water (tap water) in Basra governorate, Iraq District No. of Average of Average log no. of Average of log no. of No. of L. pneumophila samples residual chlorine fecal coliforms L. pneumophila isolates concentration (mg/L) Old Basra 9 1.03 2.89 1.66 10 Al-Jame’eyat 3 0.05 3.03 1.84 5 Al-Ashar 17 0.04 3.44 1.72 18 Al-Ma’aqal 13 0.17 3.43 1.71 15 Al-Hakeemya 8 0.63 2.91 1.50 5 Shatt-Al-Arab 10 0.44 2.66 2.14 8 Al-Esmae’e 5 0 2.32 1.30 4 Al-Hussain 8 1.01 2.78 1.81 8 Al-Tuwaisa 6 0 3.18 2.61 8 Al-Hadi 4 0 3.60 1.44 6 Al-Abela 3 0 3.44 1.54 7 Al-Jubaila 5 1.4 4.00 1.54 7 Al-Jazae’er 3 0 2.87 1.30 5 Al-Jumhurya 3 0 2.33 89.1 3 Al-Junaina 5 0.02 3.72 1.57 5 Al-Mowafakai 5 0 2.66 8 7. 1 5 Al-Fayhaa 9 0.31 2.32 2.31 8 Abu-Al-Khaseeb 11 1.32 2.34 1.60 12 Total 127 – – – 139

A total of 133 isolates of L. pneu- the presence of L. pneumophila in only other hand, isolates of serogroups 2­–15 mophila serogroup 1 were isolated from 1/5 stations as compared to 3/5 sta- showed 75.0% resistance to ampicillin, these districts, while only 6 isolates of tions harbouring faecal coliforms. Only 100% intermediate sensitive to erythro- serogroups 2–15 were isolated from 3 isolates of L. pneumophila serogroup 1 mycin and streptomycin, 50% sensitive Al-Jubaila and Al-Junaina districts. All were isolated from the reverse-osmosis to chloramphenicol and gentamicin stations were positive for L. pneumophila plants of the General Company of Pet- and 100% sensitive to doxycycline. at frequencies much higher than those rochemical Industries. recorded for the water coming from treatment plants. Serogroups Discussion The total number ofL. pneumophila Reverse-osmosis water isolated on LAB medium were 258; Water is a fundamental need for all samples serogroup 1 (199 isolates) comprised forms of life, yet human beings con- A total of 41 samples were collected 77.1% of total isolates and serogroups tinue to pollute the reserves which still from reverse-osmosis water-supply 2–15 (59 isolates), comprised 22.9% of remain, thus increasing the risk of dis- tankers in 19 different districts in Basra total isolates. eases that can jeopardize the population governorate. The average of logarithmic [10]. In this study using LAB medium numbers of L. pneumophila and faecal Antibiotic susceptibility tests as a selective medium for isolating L. coliforms indicated the presence of L. Antibiotic susceptibility testing was pneumophila, most of the water sam- pneumophila in 6/19 stations while fae- done for 10 L. pneumophila isolates, ples in Basra governorate were found cal coliforms was recorded in 12/19 sta- 8 isolates belonging to serogroup 1, to be positive for growth of L. pneu- tions. Only 8 isolates of L. pneumophila and 2 isolates belonging to serogroups mophila. These bacteria were isolated serogroup 1 were isolated from reverse- 2–15. Among serogroup 1 isolates from raw water entering the plants and osmosis water tankers. there was 83.0% resistance to ampicillin, their numbers were uncountable in In addition 5 main reverse-osmo- 37.5% to erythromycin and 50.0% to some plants, confirming that water is a sis plants in Basra governorate were chloramphenicol and gentamicin, but natural reservoir for Legionella spp. The tested for L. pneumophila, indicating 100% sensitivity to doxycycline. On bacterium is ubiquitous in fresh water

938 املجلة الصحية لرشق املتوسط املجلد التاسع عرش

العدد احلادي عرش

n a r j a h u M

a l i a h u M

n a y s a w U

b a r A - l A t t a h S

n a d m a H

r

e l a q a ' a M - l A

a t

s a b b A - l A w

i n a b a L - l

A a w

R

a a h y a F - l A

t a b u R - l A

I I a l i a b u J - l A

I a l i a b u J - l A

a y i h d a r a B - l A

n a r j a h u M

a l i a h u M

n a y s a w U

b a r A - l A t t a h S

s

k n a d m a H

a n

l a q a ' a M - l A t

n

o s a b b A - l A i

a t

t i n a b a L - l A i p

i

c a a h y a F - l A

e

r

t a b u R - l A P

I I a l i a b u J - l L. pneumophila A

I a l i a b u J - l A

a y i h d a r a B - l A

e g a r e v A

n a r j a h u M

a l i a h u M

n a y s a w U

b a r A - l A t t a h S

s

k n a d m a H

a n

l a q a ' a M - l A Iraq governorate, plants in Basra water treatment and fecal coliforms isolated from t

n

o s a b b A - l A i

a t

r i n a b a L - l A t l

F i

a a h y a F - l Faecal A

t a b u R - l A

I I a l i a b u J - l A

I a l i a b u J - l A

a y i h d a r a B - l A

Legionella pneumophila

n a r j a h u M

a l i a h u M

n a y s a w U

t

b a r A - l A t t a h S

a n

l

n a d m a H p f

o l a q a ' a M - l

A t

u

s a b b A - l A o

g

n i n a b a L - l A i

m

a a h y a F - l A o

c

r

t a b u R - l A e

I I a l i a b u J - l A

W a t

I a l i a b u J - l A

a y i h d a r a B - l A Average ofAverage logarithmic numbers per mL of 1 3 2 4 0

1 . 5

3 . 5 2 . 5 0 . 5

L m / g o l Figure 1 Figure

939 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

sources [11], which may be due to the For the samples of water emerg- in which L. pneumophila was the pre- inadequacy of sewage water processing ing from plants, it was noted that L. dominant species in freshwater and before it is dumped into rivers. This pneumophila was absent in most plants municipal drinking water supplies [23] bacterium is also able to infect protozoa, and the number of isolates varied and L. pneumophila serogroup 1 was a relationship that provides protection between plants, which may be due to isolated at high frequencies in buildings for the bacterium against adverse envi- the differences in remaining chlorine [24]. ronmental conditions [12], in addition concentrations in the emission water, Regarding samples of water treated to the presence of organic materials as chlorine activity depends on factors by reverse osmosis it was found that that provide nutrients for Legionella spp. such as temperature and pH [2]; these 20 samples were positive for L. pneu- growth. This study was similar to that of results are compatible with Hsu et al. mophila, which is compatible with what Wullings and van der Kooij who used [16]. L. pneumophila is more resistant Goutziana et al. have observed [25]. culture methods and polymerase chain than other organisms to common Sunlight, temperature, pH and biofilms reaction techniques [13]. standard disinfecting methods. It may, are factors that affect bacterial activity L. pneumophila were also isolated therefore, be found even in disinfected [13]. This is in addition to the risk of from precipitation tanks and it was waters with residual chlorine content pollution of water during transportation noted that in some plants the numbers [17]. A decrease in, or even absence and storage, due to inadequate clean- were higher than the numbers in raw of, chlorine at the extreme ends of the ing and drying practices which provide water. This may be a result of ineffi- water distribution system increases the suitable conditions for the growth and ciency in the primary treating stage of risk of growth of the bacterium. reproduction of pollutants in the stored the raw water entering the plants, sug- L. pneumophila was isolated from water. gesting that the precipitation tanks work drinking (tap) water in different per- No association was observed be- as a reservoir for the growth of these centages from district to district and in tween L. pneumophila and the presence bacteria, perhaps due to the presence of different areas in the same district of the of faecal coliforms in our study as L. suitable conditions such as precipitants governorate. The difference in the num- pneumophila were detected in water and growth of algae. bers of isolates across different districts samples in the absence of faecal coli- L. pneumophila were also present in may be due to differences in the biologi- forms. This opportunistic pathogen has the filtration units in some of the puri- cal membranes (biofilms) formed in commonly been isolated in the absence fication plant samples in Basra and this the distribution pipe networks [18]. of faecal contamination [26]. could be ascribed to the fact that some Biofilms are essential for growth and Development of resistance to anti- of the plants are old and/or the filters proliferation of this bacterium [19]. biotics may be due to increasing use of used in these units are old and there is The combination of organic elements, antibiotics for medical and agricultural no maintenance or periodic cleaning or inorganic elements and the right water purposes and there has been a rise in changing of filters. It was observed that temperature create a good environ- resistance to these drugs [27]. In the in other water treatment plants these ment for L. pneumophila proliferation present study isolates were more resist- bacterium were not detected which [20,21]. Several studies have indicated ant to ampicillin and less resistant to provides evidence for the efficiency of that the type of materials of water sup- erythromycin, chloramphenicol and filtration units in some cases, which is in ply systems (rubber, stainless steel or gentamicin. Resistance to ampicillin agreement with the findings of Bomo et polyvinyl chloride) affects the forma- has been reported previously among al. [14]. The high growth in the filtration tion biofilms [22]. It is well known that Legionella spp., due to beta-lactamase stage of water treatment plants is known Iraq suffers from chronic water defi- production [28]. Erythromycin has to occur in areas of slow-moving water, ciency and therefore water treatment usually been considered the anti- which may allow growth-supporting plants may not operate in a continuous biotic of choice for the treatment of materials to accumulate. Passage of manner. This creates conditions that Legionnaires’ disease, but newer anti- water through the rapid sand-filters of contribute to the deterioration of water biotics that are more potent and less the plant almost completely reduces quality, mainly due to the precipitation toxic are now replacing it [29]. For the potential for growth of bacteria, due and regrowth of pollutants in network aminoglycosides such as gentamicin, to removal of growth-enhancing fac- pipes, as most of the networks undergo the mechanism of resistance that is tors and reducing the residence time of continuous breakage and corrosion predominantly observed clinically is bacteria; these findings are similar to the that facilitates the entry of pollutants chemical alteration of the drug cata- observations of Hoekstra et al. on water from rain water or infiltration of sewage lysed by aminoglycoside-modifying passing through rapid and slow sand water into networks. These results are enzymes [30,31]. In this study as all filters [15]. similar to data reported in the literature, examined isolates were sensitive to

940 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

doxycycline, confirming the efficacy of water sanitation plants, reverse-osmosis supplies and tankers of drinking water. doxycycline on L. pneumophila isolates water supplies and samples of tap water The prevalence ofL. pneumophila, espe- as demonstrated in 7 European coun- from different districts of Basra city, cially serogroup 1, is a strong indicator tries [32]. Iraq. The findings confirmed the pres- of unsuitability of drinking water and This is the first report of L. pneu- ence of L. pneumophila in crude water requires appropriate action. mophila in water samples including sources and in general drinking water Competing interests: None declared.

References

1. Forbes BA, Sahm DF, Weissfeld AS. Bailey and Scott’s diagnostic 18. Momba MNB, Makala N. Comparing the effect of various microbiology, 12th ed. St Louis, Missouri, Mosby, 2007. pipe materials on biofilm formation in chlorinated and com- 2. De Jong MD, Hien TT. Avian influenza A (H5N1). Journal of bined chlorine-chlorinated water systems. Water SA, 2004, Clinical Virology, 2006, 35:2–13. 30(2):175–182. 3. Hoge CW, Breiman RF. Advances in the epidemiology and 19. Lin YS et al. Disinfection of water distribution systems for Le- control of Legionella infections. Epidemiologic Reviews, 1991, gionella. Seminars in Respiratory Infections, 1998a, 13:147–159. 13:329–340. 20. Prevost M, Laurent P, Servais P. Biodegradable organic matter 4. Fields BS. The molecular ecology of legionellae. Trends in Mi- in drinking water treatment and distribution. Denver, Colorado, crobiology, 1996, 4:286–290. American Water Works Association, 2005. 5. Abrail D, Riffard S. Detection and identification ofLegionella 21. Al-Wazzan Y et al. Desalting of subsurface water using spiral- species from ground waters. International Journal of Hygiene wound reverse osmosis (RO) system: technical and economic and Environmental Health, 2004, 67(Part A):1845–1849. assessment. Desalination, 2002, 143:21–28. 6. Sabria M et al. A community outbreak of Legionnaires’ disease: 22. Kuiper MW et al. Intracellular proliferation of Legionella pneu- evidence of a cooling tower as the source. Clinical Microbiol- mophila in Hartmannella vermiformis in aquatic biofilms grown ogy and Infection, 2006, 12:642–647. on plasticized polyvinyl chloride. Applied and Environmental 7. Standard methods for the examination of water and wastewater, Microbiology, 2004, 70:6826–6833. 20th ed. Washington DC, American Public Health Associa- 23. Gião MS et al. Incorporation of natural uncultivable Legionella tion/American Water Works Association/ Water Environment pneumophila into potable water biofilms provides a protective Federation, 1995. niche against chlorination stress. Biofouling, 2009, 25:345–351. 8. Water quality—detection and enumeration of Legionella. ISO 24. Pelaz C, Martín C. Legionella infection in Spain: analysis of 11731:1998. Geneva, International Organization for Standardi- human and environmental strains isolated between 1980 and zation, 1998. 1999. [Infección por Legionella en España: análisis de las cepas 9. Stokes EJ. Ridgway GI, eds. Clinical bacteriology, 5th ed. Lon- humanas y ambientales aisladas entre 1980 y 1999.] Enferme- don, Arnold, 1980:215. dades Emergentes, 2000, 2:214–219 10. Companhia de Saneamento Básico do Estado de São Paulo S.A 25. Goutziana G et al. Legionella species colonization of water dis- (Sabesp) [website] [http://www.sabesp.com.br/, accessed 14 tribution systems, pools and air conditioning systems in cruise July 2013) [in Portugese]. ships and ferries. BMC Public Health, 2008, 8:390. 11. Riffard S et al. Occurrence of Legionella in groundwater: 26. Lehtola MJ et al. Survival of Mycobacterium avium, Legionella an ecological study. Water Science and Technology, 2001, pneumophila, Escherichia coli, and caliciviruses in drinking wa- 43:99–102. ter-associated biofilms grown under high-shear turbulent flow. Applied and Environmental Microbiology, 2007, 73:2854–2859. 12. Decludt B et al. Clusters of travel associated Legionnaires’ disease in France, September 2001–August 2003. Euro Surveil- 27. Čižman M. The use and resistance to antibiotics in the com- lance, 2004, 9:11–13. munity. International Journal of Antimicrobial Agents, 2003, 21:297–307. 13. Wullings BA, van der Kooij D. Occurrence and genetic diver- sity of uncultured Legionella spp. in drinking water treated at 28. Fung-Tomc JC et al. Activity of carbapenem BMS-181139 temperatures below 15 degrees C. Applied and Environmental against Pseudomonas aeruginosa is not dependent on porin Microbiology, 2006, 72:157–166. protein D2. Antimicrobial Agents and Chemotherapy, 1995, 39:386–393. 14. Bomo AM et al. Bacterial removal and protozoan grazing in biological sand filters. Journal of Environmental Quality, 2004, 29. Baltch AL et al. Antibacterial activities of gemifloxacin, levo- 33:1041–1047. floxacin, gatifloxacin, moxifloxacin and erythromycin against intracellular Legionella pneumophila and Legionella micdadei 15. Hoekstra AC, van der Kool D, Unen WAMH. Bacteriologi- cal, chemical, and physical characteristics of samples from in human monocytes. Journal of Antimicrobial Chemotherapy, two hot water systems containing Legionella pneumophila 2005, 56:104–109. compared with drinking water from municipal water works. 30. Wright GD. Mechanisms of resistance to antibiotics. Current In: Thornsberry C, et al. eds. Legionella. Proceedings of the 2nd Opinion in Chemical Biology, 2003, 7:563–569. International Symposium. Washington DC, American Society 31. Wybenga-Groot LE et al. Crystal structure of an aminoglyco- for Microbiology, 1984:343–346. side 6′-N-acetyltransferase: defining the GCN5-related N- 16. Hsu SC, Martin R, Wentworth BB. Isolation of Legionella spe- acetyltransferase superfamily fold. Structure, 1999, 7:497–507. cies from drinking water. Applied and Environmental Microbiol- 32. Critchley IA et al. In vitro activity of levofloxacin against con- ogy, 1984, 48:830–832. temporary clinical isolates of Legionella pneumophila, Myco- 17. Legionella drinking water health advisory. Washington DC, plasma pneumoniae and Chlamydia pneumoniae from North United States Environmental Protection Agency, Office of America and Europe. Clinical Microbiology and Infection, 2002, Water, 2001. 8:214–221.

941 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Molecular typing of Mycobacterium spp. isolates from Yemeni tuberculosis patients A.A. Al-Mahbashi,1 M.M. Mukhtar 2 and E.S. Mahgoub 3

حتديد األنامط اجلزيئية َللمستفردات من أنواع ِّاملتفطرات لدى مرىض السل يف اليمن أنس أمحد املحبيش، معاوية خمتار، الشيخ حمجوب

اخلالصـة: أجرى الباحثون هذه الدراسة ُّ ف للتعرعىل أنواع رِّاملتفطرات َاملستفردة من مرىض السل الرئوي يف اليمن، وقد مجع الباحثون عينات البلغم 170 يف الصباح الباكر من ًتم مريضاحتويلهم إىل املعهد الوطني للسل يف صنعاء لالشتباه بإصابتهم بالسل الرئوي، وقد تم تلوين العينات ّبملون تسيل rpoB – نيلسون وزرعت يف َطمستنب أوغاوا ولفينشتني جنسن، وتم تضخيم املتتاليات املستهدفة يف اجلني باستخدام مواد تسبب الطفرة للبادئات 98.3 118 120 HindIII لألمام وللخلف، ثم تال ذلك استخدام اإلنزيم للهضم. ومن بني َمستفردة حللها الباحثون تبني أن منها ) %( قد تم ُّالتعرف 1.7 عليها عىل أهنا َّدمعق املتفطرة السلية، وأن 2 منها ) %( تم ُّ ف التعرعليهام عىل أهنام متفطرتان غري سليتني. وتوضح النتائج التي توصل إليها الباحثون أن هاتني َاملستفردتنيمها من املتفطرات املقاومة لألدوية، كام أن حتليل متتاليات الدنا أظهر أن تراصف احلمض النووي يف الدنا يف َاملستفردات من املتفطرات غري السلية كان خيتلف عام هو عليه يف معقد املتفطرات السلية.

ABSTRACT This study was done to characterize at the species level Mycobacterium spp. isolates from Yemeni pulmonary tuberculosis patients. Early-morning sputum samples were collected from 170 patients referred to the National Tuberculosis Institute in Sana’a city with suspected pulmonary tuberculosis. Samples were processed with Ziehl–Neelsen stain and cultured in Ogawa and Lowenstein–Jensen media. The rpoB gene target sequence was amplified using mutagenesis forward and reverse primers followed by HindIII enzyme digestion. Of the 120 isolates analysed, 118 (98.3%) were identified as M. tuberculosis complex and 2 (1.7%) were identified as mycobacteria other than M. tuberculosis. The results showed that those 2 isolates were multi-drug resistant and the DNA sequencing analysis showed that the alignment of nucleic acid of DNA in isolates of mycobacteria other than M. tuberculosis was different from that of M. tuberculosis complex.

Typage moléculaire des isolats de Mycobacterium spp. prélevés chez des patients yéménites atteints de tuberculose

RÉSUMÉ La présente étude a été menée afin de caractériser l’espèce des isolats de Mycobacterium spp. prélevés chez des patients yéménites atteints de tuberculose. Des échantillons d’expectoration ont été prélevés tôt le matin chez 170 patients qui avaient été orientés vers l’Institut national de la tuberculose de la ville de Sanaa pour suspicion de tuberculose pulmonaire. Les échantillons ont été traités par coloration de Ziehl-Neelsen et mis en culture sur milieux Löwenstein–Jensen et Ogawa. La séquence cible du gène rpoB a été amplifiée selon la méthode des amorces mutagènes directe et inverse suivie par une digestion par l’enzyme HindIII. Sur les 120 isolats analysés, 118 (98,3 %) ont été identifiés comme appartenant au complexeM. tuberculosis et 2 (1,7 %) comme étant des mycobactéries d’un autre type que M. tuberculosis. Nos résultats ont révélé que ces deux isolats étaient pharmacorésistants tandis que l’analyse des séquences d’ADN a montré que l’alignement d’acide nucléique dans les isolats des mycobactéries d’un autre type que M. tuberculosis était différent de celui du complexe M. tuberculosis.

1Department of Microbiology, Faculty of Science, University of Sana’a, Sana’a, Yemen. 2Institute of Endemic Disease; 3Department of Microbiology and Parasitology, Faculty of Medicine, University of Khartoum, Khartoum, Sudan (Correspondence to E.S. Mahgoub: [email protected]). Received: 04/06/12; accepted: 25/09/12

942 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

Introduction Methods DNA extraction Two colonies were taken from the Tuberculosis (TB) is a disease of Sample collection culture medium and placed in 100 major public health concern world- The study was conducted on patients µL of sterile distilled water; 100 µL of wide. It is a bacterial infectious disease referred to the National Tuberculosis phenol-chloroform reagent was added that is considered the second most Institute in Sana’a city with suspected and the mixture was vortexed for about important cause of death due to an pulmonary TB based on their presen- 10 s and heated at 80 °C for 20 min. identifiable infectious agent [1]. Ap- tation with cough more than 2 weeks. The mixture was stored at –20 °C proximately one-third of the world’s The Institute is a specialist referral in microcentrifuge tubes (free from population is infected with latent TB centre for TB diagnosis and therapy DNA or RNA) until needed [7]. and 5%–10% of this population will and is situated in Sana’a the capital develop active stages of the disease Polymerase chain reaction city of Yemen. The Institute receives technique during their life time [2]. TB patients from all regions of Yemen TB is a highly transmissible disease and provides free treatment. Primers specific for the rpoB gene, encoding the B-subunit of RNA and infection can occur via inhalation An early-morning sputum sam- polymerase ( DNA, 342–360 of droplet particles aerosolized from ple was collected from 170 patients rpoB base pairs) was the target region for persons infected with Mycobacterium into wide-mouthed plastic contain- amplification and identification of tuberculosis or by consumption of milk ers. Baseline data of the patients My- spp. [8]. The polymerase infected with bovine M. bovis. The dis- was collected by completion of a cobacterium chain reaction (PCR) mixture was ease can infect humans and animals, questionnaire administered during prepared as follows: distilled water with outcomes ranging from localized the collection of samples. Samples 5.0 µL, sample DNA 4.0 µL, PCR lesions to disseminated disease. The were collected between January 2004 buffer 2.5 µL, PCR MgCl 2.0 µL, genus Mycobacterium comprises more and October 2005 and the study was 2 than 70 species, some of which are completed in 2008. PCR dNTP 2.5 µL, primers 3 µL, Tag polymerase 1.0 µL. The PCR mixture potentially pathogenic to humans and The study was approved by the animals and some of which are sapro- was gently mixed and amplified using a University of Sana’a ethics committee phytic. Mycobacteria that cause TB thermocycler (Perkin Elmer) adjusted and consent was obtained from the in mammals form the Mycobacterium to the cycling programme for 30 cy- participants before their enrolment in tuberculosis complex (MTC) and in- cles. The sequence of rpoB primers for the study. clude M. tuberculosis, M. africanum, M. the mutagenesis forward primer was bovis or M. bovis BCG, M. microtti and Laboratory methods 5′-CGA CCA CTT CGG CAA CCG-3′ M. canetti. Other forms of mycobacte- and for the mutagenesis reverse primer Antibiotic sensitivity testing, using ria that are considered opportunistic was 5′-TCG ATC GGG CAC ­ ATC standard methods, was carried out on are termed mycobacteria other than CGG-3′. cultures from all 170 samples. For cost Mycobacterium tuberculosis (MOTT) reasons, PCR was done on only 120 of Restriction fragment length polymor- [3]. the samples. phism (RFLP) Yemen is one of the poorest of Staining and culture methods Following amplification of the rpoB the world’s low-income countries gene the product was subjected to Sputum samples were treated with 4% and TB is one of the most infectious digestion by HindIII restriction en- NaOH and stained by Ziehl–Neelsen diseases that are endemic in the Yem- zymes (Roche) as follows: 15 µL from stain to detect acid-fast bacilli [5]. eni population. The absolute number PCR product was pipetted into PCR The sputum samples were cultured of TB cases in Yemen is not known, tubes, 2 µL of enzyme was added to on a special egg-based solid medium but 37 000 cases were recorded as the tube, 2 µL of enzyme buffer was (Ogawa medium) according to the under treatment throughout the also added to the tube, then 1 µL of procedures of the Japan International country in the year 2002 [4]. The distilled water was added to the mix- Cooperation Agency [6]. Typically main objective of this study was to ture and mixed well [9]. use molecular techniques to identify growth of Mycobacteria spp. appears and characterize Mycobacterium spp. within 3–4 weeks. The colonies are DNA sequencing analysis isolated from pulmonary TB patients buff in colour with a dry and friable PCR-amplified DNA of the drug- in Yemen. surface and irregular edges. resistant isolates was commercially

943 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

sequenced by Macrogen Company us- Table 1 Age and sex distribution of the study patients who were sputum-smear ing the BigDye terminator cycling and positive for tuberculosis universal primers. Variable No. % Age group (years) 10–< 20 40 24 Results 20–< 30 67 39 30–< 40 27 16 The age of the whole sample of 170 40–< 50 18 11 patients ranged between 12–70 years 50–< 60 10 6 old, and the largest proportion was in > 60 8 5 the age group 20–30 years (Table 1). Sex There were significantly more males (117, 69%) than females (53, 31%) Male 117 69 (P < 0.05). Female 53 31 Total 170 100 After culture and sensitivity test- ing of isolates, 15 antibiotic resistant isolates were found: 5 (33.3%) were resistant to 1 drug, 4 (26.6%) to 2 diseases recorded in the national highest prevalence was among the age drugs, 4 (26.6%) to 3 drugs and 2 disease list [11]. A rapidly increas- group 20–30 years. These results are (13.3%) to 4 drugs. The resistance ing population, poor quality health in agreement with previous reports data were as follows: isoniazid 14/15 services, very low annual income of from the national disease surveillance (93%), rifampicin 8/15 (53%), strep- individuals and the whole country’s tomycin 5/15 (33%) and ethambutol infectious diseases centre and the 6/15 (40%). poor economic status are the most Ministry of Health [11,12]. As previ- important factors responsible for the Our results showed that mycobac- ously reported, in this study males high incidence of TB in the country terial DNA was amplified successfully were significantly more affected than using the relevant primers and the size [12]. females [13]. In Yemen the higher of DNA was 360 bp compared with In the present study 170 patients rate of TB in males may be attributed the molecular weight marker (100 were recruited who were suspected of to the different habits of males, espe- bp) (Figure 1). having pulmonary TB based on their cially smoking the waterpipe (nargile The PCR-RFLP results showed presentation with cough more than 2 or mada’a), which is usually shared that 118/120 (98.3%) of the isolates weeks. The age of the patients ranged between different persons. Another were MTC, whereas 2/120 (1.7%) between 12–70 years old, and the prevalence study on pulmonary TB were MOTT (Figure 2A and B). The DNA sequencing analysis re- sults showed that the DNA sequence M N P 1 2 3 4 5 6 7 8 9 10 11 12 13 of MTC strains were different from MOTT strains (Figure 3).

500 bp Discussion 400 bp A recent health report on Arab 300 bp countries by the World Health Or- 200 bp ganization declared that TB was an 100 bp important public health problem in the 19 Arab countries of the Eastern Mediterranean Region, affecting Figure 1 Polymerase chain reaction assay results using the MF and MR primers for 240 000 people with 53 000 deaths detection and amplification of theMycobacterium rpoB gene from the isolates every year; 85% of the deaths occurred with leader marker (100 bp) to detect the size of amplified DNA in adults [10]. In Yemen, TB is con- M = molecular weight control marker (100 bp); P = positive control; N = negative control; lanes 1–13 from patient samples sidered one of the major infectious

944 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

attributed the low prevalence of TB M 1 2 3 4 5 6 N among women to underdetection of TB in females because women often choose medical care providers operat- ing outside the national TB control centres [14]. Routine sputum smears and Myco- bacterium spp. cultures confirmed the presence of acid-fast bacilli in the 170 sputum samples examined. However, acid-fast staining does not identify the Figure 2A Polymerase chain reaction–restriction fragment length polymorphism assay using restriction enzymes of confirmed tuberculosis patients; lanes Mycobacterium to the species level. In 1,2,3,4,5,6 were Mycobacterium tuberculosis complex isolates that showed 2 addition the time required to detect fragments. M = control marker 100 bp; N = negative control the organism by routine culture is approximately 4–8 weeks. PCR assay was therefore used to characterize M N P 1 2 3 4 5 6 7 8 9 120 of the isolates. The rpoB gene was successfully amplified in all isolates and enabled identification ofMyco - bacterium spp. following restriction of the PCR product by HindIII restric- tion enzyme that produced 2 DNA fragments in the amplicons of M. tuberculosis. The PCR-RFLP results identified Figure 2B Polymerase chain reaction–restriction fragment length polymorphism 98.3% of isolates as MTC and 1.7% assay using restriction enzymes of confirmed tuberculosis patients; lanes samples as MOTT. Interestingly the 1,2,3,4,5,6,7,9 were Mycobacterium tuberculosis complex isolates that showed 2 MOTT isolates were resistant to iso- fragments, whereas lane 8 is Mycobacteria other than M. tuberculosis that showed 1 fragment. M = control marker 100 bp; N = negative control; P = positive control niazid, rifampicin and streptomycin. MOTT have been reported to cause infection in humans and to compli-

1- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCGACAA cate treatment regimens since they may not respond to routinely used 2- ACCA-TCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA anti-TB drugs [15–17]. Based on the 3- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA results of this study we recommend 4- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA M N P 1 2 3 4 5 6 7 8 9 10 11 12 13 the use of molecular techniques for 5- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA identification of the Mycobacterium 6- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA spp. before initiation of treatment. 7- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA 8- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA 9- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA Acknowledgements 10- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA Funding: This research was supported 11- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA by the Ministry of Higher Education of 12- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA Yemen as part of a PhD degree for the 13- ACCGCGTCGTGTATGACTCTGTATACACAGAGGAGTCACGGCGCGCGTGGTGGTCTCCAT first author. Competing interests: None declared. Figure 3 DNA sequence analysis alignment showing the difference between nucleic acid of Mycobacterium tuberculosis complex (samples 1–12) and Mycobacteria other than M. tuberculosis (sample 13)

945 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

References

1. Tiruviluamala P, Reichman LB. Tuberculosis. Annual Review of 10. Tuberculosis. In: Overview of child health in Arab countries, 2nd Public Health, 2002, 23:403–426. ed. Alexandria, Egypt, World Health Organization Regional 2. Jones-Lopez EC, Ellner JJ. Tuberculosis and atypical mycobac- Office for the Eastern Mediterranean, 2002. terial infections. In: Guerrant RL, Walker DH, Weller PF, eds. 11. Tuberculosis infection: disease surveillance of infectious disease. Tropical infectious diseases: principles pathogens and practice. Sana’a, Yemen, Ministry of Health and World Health Organiza- New York, Elsevier, 2011 (Chapter 36). tion Country Office, 2000:49–52. 3. Annual heath report. National tuberculosis control programme. 12. National tuberculosis programme. Tuberculosis in Republic of Sana’a, Yemen, Ministry of Health, 2004. Yemen. Sana’a, Yemen, Ministry of Health, 1996. 4. Edsel M, Gregory SC, Robert AS. Mycobacterium other than 13. Abassi A, Mansourian AR. Efficacy of DOTS strategies in tuberculosis (MOTT) infection: an emergency disease in inflixi- treatment of respiratory tuberculosis in Gorgan, Islamic Re- mab treated patients. Journal of Infection, 2007, 10:1–4. public of Iran. Eastern Mediterranean Health Journal, 2007, 5. Cheesbrough M. District laboratory practice in tropical coun- 13(3):664–669. tries. Volume 2. Cambridge, Cambridge University Press, 14. Thorson A et al. Do women with tuberculosis have a lower 2000:207–213. likelihood of getting diagnosed? Prevalence and case detec- 6. Kawai M, Fujiki A. Minimum essentials of laboratory procedure tion of sputum smear positive pulmonary TB, a population- for tuberculosis control. Tokyo, Japan Anti-Tuberculosis As- based study from Vietnam. Journal of Clinical Epidemiology, sociation, Research Institute of Tuberculosis in Japan, 1996. 2004, 57(4):398–402. 7. Yates MD, Drobniewski FA, Wilson.SM. Evaluation of a rapid 15. Kearns AM et al. Epidemiology and molecular typing of an PCR-based epidemiological typing method for routine studies outbreak of tuberculosis in a hostel for homeless men. Journal of Mycobacterium tuberculosis. Journal of Clinical Microbiology, of Clinical Pathology, 2000, 53(2):122–124. 2002, 40(2):712–714. 16. Sharaf-Eldin GS et al. Molecular analysis of clinical isolates 8. Kim BJ et al. Differentiation of mycobacterial species by of Mycobacterium tuberculosis collected from patients with PCR-restriction analysis of DNA (342 base pairs) of the RNA persistent disease in the Khartoum region of Sudan. Journal of polymerase gene (rpoB). Journal of Clinical Microbiology, 2001, Infection, 2002, 44:244–251. 39:2102–2109. 17. Sanguinetti M et al. Routine use of PCR-reverse cross-blot 9. Kim BJ et al. Identification of mycobacterial species by com- hybridization assay for rapid identification ofMycobacterium parative sequence analysis of the RNA polymerase gene species growing in liquid media. Journal of Clinical Microbiol- (rpoB). Journal of Clinical Microbiology, 1999, 37:1714–1720. ogy, 1998, 36:1530–1533.

946 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

High prevalence of Klebsiella pneumoniae carbapenemase-mediated resistance in K. pneumoniae isolates from Egypt L. Metwally,1 N. Gomaa,1 M. Attallah 2 and N. Kamel 3

معدل انتشار مرتفع للمقاومة للكلبسيال الرئوية بتواسط إنزيم كاربابينيامز يف ُمستفردات الكلبسيال الرئوية يف مرص لبنى متويل، ناهد مجعة، مكرم عطا اهلل، هنا كامل bla إن البزوغاخلالصـة: واالنتشار الرسيع ملستفردات الكلبسيال الرئوية املقاومة للمضادات احليوية والتي حتتوي عىل اجلني kpc الذي يرمز إلنتاج إنزيم كاربابينيامز قد أدى إىل تعقيد التدبري العالجي للمرىض املصابني بالعدوى. وقد أجرت الباحثات هذه الدراسة يف مستشفى للرعاية الثالثية يف مرص باستخدام مقايسة التفاعل السلسيل للبوليمرياز يف الزمن احلقيقي الختبار مستفردات الكلبسيال الرئوية التي ال تستجيب لإلرتابنيم لكشف bla وجود اجلني kpc وملقارنة النتائج مع اختبار هدج َّل. املعدوقد درست الباحثات االستجابة للمضادات احليوية بالطرق املعيارية، ُوق ْم َن بتفسريها باتباع نقاط الفصل القديم املعتمدة لدى معهد املعايري الرسيرية واملختربية )M100-S19( بالنسبة ملركبات كاربابينيم، إىل جانب نقاط الفصل َّاملنقحة )M100– S22(. وشملت الدراسة 45 مستفردة غري مزدوجة للكلبسيال الرئوية أخذت من عينات رسيرية خمتلفة، واتضح للباحثات أن معدل انتشار ًمرتفعا للمستفردات غري املستجيبة لإلرتابينيم )44.4%(قد تم تسجيله باستخدام نقاط الفصل املنخفضة واجلديدة املعتمدة لدى معهد املعايري 70 20 14 bla الرسيرية واملختربية، كام تأكد للباحثات وجود اجلني kpc يف من بني مستفردة ) (،% ويعزى ارتفاع معدل انتشار عدم االستجابة لإلرتابينم يفمستشفى الرعاية الثالثية يف مرص عىل األغلب إىل آليات املقاومة التي تتواسطها إنزيامت كاربابينيامز يف مستفردات الكلبسيالت الرئوية.

ABSTRACT The emergence and rapid spread of antibiotic-resistant Klebsiella pneumoniae isolates harbouring the

blaKPC gene that encodes for carbapenemase production have complicated the management of patient infections. This study in a tertiary care hospital in Egypt used real-time PCR assay to test ertapenem-nonsusceptible isolates of

K. pneumoniae for the presence of the blaKPC gene and compared the results with modified Hodge test. Antibiotic sensitivity was performed by standard methods, and interpreted following both the old CLSI breakpoints (M100-S19) for carbapenems and the revised breakpoints (M100-S22). From the 45 non-duplicate isolates of K. pneumoniae recovered from different clinical specimens, a high prevalence of ertapenem-nonsusceptible isolates (44.4%)

was reported using the new lower CLSI breakpoints. The blaKPC gene was confirmed in 14/20 (70.0%) of these isolates. The high prevalence of ertapenem nonsusceptibility at a tertiary care hospital in Egypt was predominantly attributed to K. pneumoniae carbapenemase-mediated resistance mechanisms in K. pneumoniae isolates.

Prévalence élevée de la résistance de Klebsiella pneumoniae médiée par les carbapénèmases dans des isolats de K. pneumoniae en Égypte

RÉSUMÉ L’émergence et la propagation rapide des souches de Klebsiella pneumoniae résistantes aux antibiotiques

et porteuses du gène blaKPC codant la production de carbapénèmases ont compliqué la prise en charge des infections des patients. La présente étude menée dans un hôpital de soins tertiaires en Égypte a utilisé la méthode

de PCR en temps réel pour évaluer la présence du gène blaKPC dans les isolats de K. pneumoniae non sensibles à l’ertapénème, puis a comparé les résultats à l’aide du test de Hodge modifié. La sensibilité aux antibiotiques a été évaluée à l’aide des méthodes standards, puis a été interprétée selon les anciens seuils du Clinical and Laboratory Standards Institute (M100-S19) pour les carbapénèmes et selon les seuils révisés (M100-S22). Après l’analyse des 45 isolats non-dupliqués de K. pneumoniae prélevés à partir de différents échantillons cliniques, une prévalence élevée d’isolats non sensibles à l’ertapénème (44,4 %) a été rapportée selon les nouveaux seuils plus bas du Clinical

and Laboratory Standards Institute. La présence du gène blaKPC a été confirmée dans 14 isolats sur 20 (70,0 %). La forte prévalence de la non sensibilité à l’ertapénème dans un hôpital de soins tertiaires en Égypte était principalement imputable aux mécanismes de résistance médiés par les carbapénèmases dans les isolats de K. pneumoniae.

1Department of Microbiology; 3Department of Clinical Pathology, Faculty of Medicine, Suez Canal University, Ismailia, Egypt (Correspondence to L. Metwally: [email protected]). 2Department of Microbiology, Faculty of Medicine, Ain Shams University, Cairo, Egypt. Received: 28/08/12; accepted: 17/10/12

947 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Introduction production of an extended-spectrum ampicillin, amoxicillin/clavulanic acid, beta-lactamase, AmpC or both [19,21]. ceftriaxone, cefepime, cefazolin, cefoxi- tin, ciprofloxacin, gentamicin, tobramy- Klebsiella pneumoniae carbapenemases Molecular detection of the blaKPC (KPCs) are Ambler class A plasmid- gene by polymerase chain reaction cin, imipenem, ertapenem, meropenem, encoded enzymes that are capable of (PCR) assay provides laboratories trimethoprim/sulfamethoxazole, piper- hydrolyzing all beta-lactam antibiotics, with a means to quickly identify the acillin, piperacillin/tazobactam and including monobactams, extended- presence of this important resistance tobramycin (Oxoid). spectrum cephalosporins and carbap- determinant [22,23]. Considering Isolates were further subjected to enems [1,2]. Originally described in the demonstrated potential for rapid minimum inhibitory concentration 2001 [3], pathogens harbouring these horizontal and vertical transmission of (MIC) testing for imipenem and mero-

antibiotic-resistance enzymes have the blaKPC gene, prompt recognition penem using the Oxoid MIC evaluator been reported from the United States of is important to controlling the spread strip (Thermo Fisher Scientific) and for America (USA) [4–7], France, China, of KPCs. In the present study we de- ertapenem using the gradient strip E- Sweden, Norway, Colombia, Brazil, scribe a real-time PCR assay to detect test (bioMérieux); boxes were allowed

Scotland, Germany and Spain [8–11]. all variants of the blaKPC gene and the use to equilibrate at room temperature Epidemic situations have also been of this assay to test clinical isolates of K. for at least 1 h before opening. For all reported in Israel and Greece [12,13]. pneumoniae. We also tested ertapenem- isolates the inocula for strip tests were An important challenge to developing a nonsusceptible isolates using MHT. matched to a 0.5 McFarland standard. standardized definition of bacterial iso- Results were read in accordance with lates resistant to carbapenems is a recent the manufacturers’ directions and in- (mid-2010) change in the Clinical and Methods terpreted following both the old CLSI Laboratory Standards Institute (CLSI) M100-S19 breakpoints and the revised interpretative criteria (breakpoints) Study isolates breakpoints in the M100-S22 docu- for determining susceptibility to car- A prospective study was conducted ment issued in January 2012 [14–16]. bapenems among Enterobacteriaceae over a period of 6 months (June 2011 Suspension of a known KPC-pro- [14,15]. These new recommendations to December 2011) at the Suez Canal ducing isolate [K. pneumoniae American lowered the breakpoints and removed University hospital, Ismailia, Egypt. A Type Culture Collection (ATCC) the requirement for testing for carbap- total of 45, single-patient K. pneumo- BAA-1705], recovered on the MacCo- enemases, e.g. by modified Hodge test niae isolates were included in the study. nkey agar, was used as quality control (MHT), to determine susceptibility. These isolates were recovered from strain. A second carbapenem-suscepti- However, based on clinical and micro- urine (n = 13), blood (n = 8), respiratory ble K. pneumoniae (ATCC 700603) was biological data, ertapenem breakpoints tract (n = 12) and other clinical sites used as negative control. were modified again in January 2012 (n = 12) from patients admitted to the Stocks of 20 distinct single-patient (M100-S22) by doubling the dilution intensive care unit and different wards K. pneumoniae isolates representing (to ≤ 0.5 µg/mL) [16]. of the hospital. Full identification was different antibiogram patterns and In addition to beta-lactam/car- carried out using the API 20E system showing MIC ≥ 1 µg/mL (n = 20) for bapenem resistance, nonsusceptible (bioMérieux). ertapenem, using the revised carbapen- organisms can carry genes that confer Ethical approval to perform the em breakpoints (M100–S22, January high levels of resistance to many other study was obtained from the ethics 2010), were tested for carbapenemases antimicrobials, often leaving very lim- committee in the Faculty of Medicine, by MHT and stored in tryptic soy broth ited therapeutic options [17,18]. The Suez Canal University and the man- with 20% glycerol at –20 °C until further bla gene encodes for KPC enzyme agement board of the hospital. All the KPC testing by blaKPC real-time PCR. production. Although carbapenemases included patients consented to the col-

have been identified in many species lection of specimens before the study Detection of blaKPC by real- of Enterobacteriaceae, K. pneumoniae was initiated. time PCR remains the most common organism Fresh, well-isolated test colonies grown carrying resistance-encoding genes Susceptibility testing on sheep-blood agar plates following [2]. Carbapenem resistance in K. pneu- Antibiotic susceptibility testing was overnight incubation were used for moniae may also be due to production determined using the modified Kirby– DNA extraction using the QIAamp of other carbapenemases [19] or to Bauer method following the CLSI DNA mini kit (Qiagen) according to changes in outer membrane porin guidelines. The following antimicro- the manufacturer’s protocol. Briefly, proteins [20], often combined with bial agents were included in the panel: a 2.0 McFarland standard bacterial

948 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

suspension was prepared in saline, and gene using the following PCR cycling ertapenem susceptibility disk (Oxoid) bacterial DNA was extracted from 200 conditions; after an initial denaturation was placed in the centre of the test area. µL (1.2 × 108 colony forming units) step of 3 min at 95 °C, a 2-step PCR Test isolates were subcultured onto of the suspension. Extracted bacterial procedure was used consisting of 30 s at sheep-blood agar plates (Becton Dick- DNA was eluted from the columns in 95 °C and 1 min at 60 °C for 45 cycles. inson) to establish pure cultures. The 100 µL elution buffer and stored at Data were obtained during the an- isolate was then streaked in a straight –20 °C. nealing period. Fluorescence was meas- line from the edge of the disk to the The TaqMan real-time KPC PCR ured once every cycle immediately after edge of the plate and was incubated assay uses previously published primers the 60 °C incubation (extension step). overnight at 35 °C in ambient air. After and probes which detect all currently Fluorescence curves were analysed with 24 hours of incubation, the plate was described KPC variants [24]. The se- the LightCycler software, version 4.0. examined for a cloverleaf-shaped in- quences were as follows: for the KPC The results were expressed by deter- dentation at the intersection of the test forward primer, 5′-GCG GAA CCA mination of the threshold cycle (Ct) organism and the E. coli ATCC 25922 TTC GCT AAA CTC GAA-3′; for value which marked the cycle at which within the zone of inhibition. The pres- the KPC reverse primer, 5′-AGA AAG the fluorescence of the sample became ence of a cloverleaf-shaped indentation CCC TTG AAT GAG CTG CAC-3′; significantly different from the base- was considered MHT positive. and for the KPC probe, 5′-/6-FAM/ line signal. A sample was regarded as ATA CCG GCT CAG GCG CAA positive when the LightCycler software CTG TAA GTT A/6-TAMRA/-3′ determined a Ct in the quantification Results (where 6-FAM represents 6-carboxy- analysis screen. By using current breakpoints (M100- fluorescein and 6-TAMRA represents When analysing the results, it is S22) for carbapenem interpretation, 6-carboxytetramethylrhodamine). important to only consider amplifica- tion between 10–35 cycles as positive. 20 out of 45 K. pneumoniae isolates Real-time PCR was performed (44.4%) were reported as nonsuscep- with 2 µL template DNA in a total Amplification prior to 10 cycles means the template should be diluted before tible (intermediate and resistant) to reaction volume of 10 µL containing ertapenem (Table 1). However, when 1× LightCycler FastStart DNA master repeating. Amplification after 35 cycles can indicate trace contamination. The the old 2009 breakpoints were used, hybridization probe reagent (Roche no template (water) control should not ertapenem interpretation classified only Diagnostics), 3.5 mM MgCl , and 2 µM 2 yield a product (Ct > 40). PCR positive 15 (33.3%) of isolates as nonsuscep- of primers for bla and the TaqMan KPC isolates with reduced ertapenem MIC tible and 30 (66.7%) as susceptible. probe. were considered to be KPC positive. Of the 5 isolates that was counted as A negative control consisting of the susceptible by the 2009 guidelines yet reaction mixture and water (in place Detection of KPC by the MHT nonsusceptible by the new guidelines, of template DNA) was added in each Isolates that were nonsusceptible to er- 3 isolates were positive for the blaKPC run. In addition to negative controls, a tapenem (i.e. resistant and intermediate gene; these isolates were susceptible to reference K. pneumoniae strain (ATCC isolates) were also tested by the MHT meropenem and imipenem. Among BAA-1705) was selected as the positive previously described [25]. Briefly, a 0.5 the isolates tested, 40.0% and 37.8% control. McFarland suspension of Escherichia coli were nonsusceptible to imipenem and The LightCycler 2.0 instrument (ATCC 25922), was used to prepare a meropenem respectively at the new (Roche Diagnostics) was used for the lawn culture on a Mueller–Hinton agar CLSI resistance breakpoint of ≥ 2 µg/

amplification and detection of the blaKPC plate (Becton Dickinson), and a 10 µg mL for both drugs (Table 1).

Table 1 Minimum inhibitory concentration results for carbapenem antibiotics on Klebsiella pneumoniae isolates (n = 45) using different Clinical and Laboratory Standards Institute (CLSI) breakpoints Antibiotic agent Older breakpointsa Current breakpointsb Susceptible Nonsusceptiblec Susceptible Nonsusceptiblec No. % No. % No. % No. % Imipenem 34 75.6 11 24.4 27 60.0 18 40.0 Meropenem 33 73.3 12 26.7 28 62.2 17 37.8 Ertapenem 30 66.7 15 33.3 25 55.6 20 44.4

aCLSI M100-S19 criteria [14,15]; bCLSI M100-S22 criteria [16]; cIntermediate and resistant.

949 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Table 2 Results of modified Hodge test (MHT) and polymerase chain reaction indicating that the increased prevalence (PCR) assay for bla gene on nonsusceptible Klebsiella pneumoniae isolates KPC of ertapenem non-susceptibility was (n = 20) predominantly attributed to KPC- Modified Hodge test results Polymerase chain reaction Total mediated resistance mechanisms in results K. pneumoniae. Prevalence rates of KPC- PCR+ve PCR–ve positive K. pneumoniae isolates of > 30% MHT+ve 14 3 17 have been recorded in some institutions MHT–ve 0 3 3 in the eastern USA, in association with Total 14 6 20 nosocomial outbreaks [27]. +ve = positive; –ve = negative. Our results suggest performing confirmatory testing for the presence Real-time KPC PCR assay results breakpoints for ertapenem were used of KPC for all ertapenem-resistant were used to confirm that carbapenem (resistant > 4 µg/mL; susceptible ≤ 2 bacteria. All KPC-producing bacteria resistance in K. pneumoniae isolates was µg/mL), only 33.3% would be counted were also MHT positive, indicating the usefulness of doing this phenotypic test- due to production of a KPC. Of the 20 as nonsusceptible. A high prevalence ing. However, due to the more rapid K. pneumoniae isolates with reduced of ertapenem resistance was similarly turnaround time of PCR assays, this susceptibility to ertapenem (defined as reported by many investigators in dif- assay might be more suitable as an ≥ 1 µg/mL), according to the revised ferent countries [5,19]. For instance, initial screening test for detecting KPC- clinical breakpoints, 14 isolates were in a study from China none of the 77 mediated carbapenem resistance. On found positive for KPCs by MHT and clinical isolates collected from 2002 to the other hand, PCR is more technically by PCR detection of the bla gene 2009 were susceptible to ertapenem KPC challenging, prone to inhibition and (Table 2). Of the remaining 6 isolates and only 6.5% and 1.3% of isolates were may miss new variants of KPC arising that were negative by PCR, 3 isolates susceptible to imipenem and mero- from genetic mutation were positive by MHT. penem respectively [28]. Of the ertapenem-nonsusceptible Of the 5 isolates that were counted isolates 6 were negative by real-time as ertapenem-susceptible by the old Discussion bla PCR and, of those, 3 isolates CLSI M100-S19 breakpoints but non- KPC were positive by MHT. Two possi- susceptible by the revised breakpoints, The emergence and rapid spread of bilities exist that may explain these 3 3 isolates were positive for bla genes antibiotic-resistant K. pneumoniae iso- KPC MHT-positive/KPC-PCR-negative and MHT, signifying the improved rate lates harbouring the blaKPC gene that isolates. First, as reported by Schechner encodes for carbapenemase production of detection of KPC-meditated resist- et al. KPC PCR could be falsely nega- have complicated the management of ance when using the new CLSI break- tive due to inhibitory substances in the patients’ infections [1,2]. To our knowl- points. Likewise, the new breakpoints reaction or to technical inexperience of edge, this is the first published report of increased the proportion of isolates the laboratory [29]. However, the most KPC-producing K. pneumoniae isolated counted as nonsusceptible to imipenem probable reason could be the presence from patients at a tertiary care hospital and meropenem (to 40.0% and 37.8% of other carbapenemases, such as the in Egypt. In our study we used ertap- respectively), although these were less metallo-beta-lactamases and the mem- enem to screen for carbapenemases, than for ertapenem. ber of the Serratia marcescens (SME) as ertapenem is the least active carbap- We also described in this study, a family of carbapenem-hydrolyzing enem against KPCs [26] and as the use real-time PCR designed to detect and beta-lactamases, SME-1, which can of this drug in automated or manual characterize genes encoding all KPC produce a positive result for MHT but variants. Using this assay, we docu- susceptibility testing has been found negative for blaKPC. So although the to be a highly sensitive method for the mented for the first time in Egypt the new CLSI recommendations lowered detection of KPCs [26,27]. Despite the presence of isolates producing KPCs. the breakpoints of carbapenems and limited number of isolates included, we Isolates with ertapenem MIC ≥ 1 µg/ removed the requirement for testing were able to show a high prevalence of mL were further investigated to deter- for carbapenemase (e.g. MHT) to de- ertapenem non-susceptibility, account- mine the prevalence of KPC enzymes. termine susceptibility [15], performing ing for 44.4% of K. pneumoniae isolates We were able to confirm the presence MHT as an adjunct to KPC PCR may

tested. This high prevalence reflected of blaKPC genes in 14 (70.0%) of ertap- increase the likelihood of detecting the new lower CLSI breakpoints for enem-nonsusceptible isolates, which other carbapenemases. Furthermore, carbapenems. When the previous CLSI comprised 31.1% of all isolates tested, the current recommendation is to still

950 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

to perform MHT for infection control the new lower CLSI breakpoints for the presence of KPCs is required for all and epidemiological purposes. interpretation. Thirdly, we did not ertapenem-resistant bacteria. Real-time Our study had some limitations. screen our isolates for other resistance PCR assay described here provides a First, the number of isolates included determinants, such as AmpC or outer useful tool to rapidly and accurately membrane proteins, owing to limited in the study was limited by the low in- detect blaKPC-positive bacteria, which cidence of K. pneumoniae-associated funding available. is an important step in controlling their infections in our institution during the In summary, our data showing an spread. study; nonetheless, the available results increased prevalence of ertapenem- provided robust pilot data. Secondly, nonsusceptible K. pneumoniae isolates Acknowledgements molecular detection of blaKPC genes partly reflects lowering of clinical break- was further limited to isolates nonsus- points but also indicates the spread ceptible to ertapenem. However, this of carbapenemases, principally KPC Funding: No specific funding was re- did not substantially compromise our types, in Suez Canal University hos- ceived for this study. study findings, especially when using pital, Egypt. Confirmatory testing for Competing interests: None declared.

References

1. Nordmann P, Cuzon G, Naas T. The real threat of Klebsiella moniae in a Greek university hospital: molecular characteriza- pneumoniae carbapenemase-producing bacteria. Lancet Infec- tion, epidemiology, and outcomes. Clinical Infectious Diseases, tious Diseases, 2009, 9:228–236. 2010, 50:364–373. 2. Arnold RS et al. Emergence of Klebsiella pneumoniae carbap- 14. Performance standards for antimicrobial susceptibility testing: enemase-producing bacteria. Southern Medical Journal, 2011, 19th informational supplement. CLSI document M100-S19. 104:40–45. Wayne, Pennsylvania, Clinical and Laboratory Standards In- 3. Yigit Het al. Novel carbapenem-hydrolyzing beta-lactamase, stitute, 2009. KPC-1, from a carbapenem-resistant strain of Klebsiella pneu- 15. Performance standards for antimicrobial susceptibility testing, moniae. Antimicrobial Agents and Chemotherapy, 2001, 45:1151– 20th informational supplement: M100-S20 & M100-S-20-U. 1161. Wayne, Pennsylvania, Clinical and Laboratory Standards In- 4. Hirsch EB et al. Emergence of KPC-producing Klebsiella pneu- stitute, 2010. moniae in Texas. Diagnostic Microbiology and Infectious Dis- 16. Performance standards for antimicrobial susceptibility testing; ease, 2011, 69:234–235. 22nd informational supplement. M100-S22. Wayne, Pennsylva- 5. Centers for Disease Control and Prevention (CDC). Carbap- nia, Clinical and Laboratory Standards Institute, 2012. enem-resistant Klebsiella pneumoniae associated with a long- 17. Endimiani A et al. Presence of plasmid-mediated quinolone term-care facility—West Virginia, 2009–2011. Morbidity and resistance in Klebsiella pneumoniae isolates possessing blaKPC Mortality Weekly Report, 2011, 60:1418–1420. in the United States. Antimicrobial Agents and Chemotherapy, 6. Bratu S et al. Rapid spread of carbapenem-resistant Klebsiella 2008, 52:2680–2682. pneumoniae in New York city: a new threat to our antibiotic 18. Neuner EA et al. Treatment and outcomes in carbapenem- armamentarium. Archives of Internal Medicine, 2005, 165:1430– resistant Klebsiella pneumoniae bloodstream infections. Diag- 1435. nostic Microbiology and Infectious Disease, 2011, 69:357–362. 7. Brandon Kitchel et al. Molecular epidemiology of KPC-pro- 19. Pfeifer Y, Cullik A, Witte W. Resistance to cephalosporins and ducing Klebsiella pneumoniae isolates in the United States: carbapenems in Gram-negative bacterial pathogens. Interna- clonal expansion of multilocus sequence type 258. Antimicro- tional Journal of Medical Microbiology, 2010, 300:371–379. bial Agents and Chemotherapy, 2009, 53:3365–3370. 20. Doumith M et al. Molecular mechanisms disrupting porin 8. Steinmann Jet al. Outbreak due to a Klebsiella pneumoniae expression in ertapenem-resistant Klebsiella and Enterobacter strain harbouring KPC-2 and VIM-1 in a German university hos- spp. clinical isolates from the UK. Journal of Antimicrobial pital, July 2010 to January 2011. Eurosurveillance, 2011, 16:19944. Chemotherapy, 2009, 63:659–667. 9. Chung KP et al. Arrival of Klebsiella pneumoniae carbapen- 21. Cuzon G et al. In vivo selection of imipenem-resistant Klebsiella emase (KPC)-2 in Taiwan. Journal of Antimicrobial Chemo- pneumoniae producing extended-spectrum beta-lactamase therapy, 2011, 66:1182–1184. CTX-M-15 and plasmid-encoded DHA-1 cephalosporinase. 10. Beirao EM et al. Clinical and microbiological characterization International Journal of Antimicrobial Agents, 2010, 35:265–268. of KPC-producing Klebsiella pneumoniae infections in Brazil. 22. Raghunathan A, Samuel L, Tibbetts RJ. Evaluation of a real-time Brazilian Journal of Infectious Diseases, 2011, 15:69–73. PCR assay for the detection of the Klebsiella pneumoniae car- 11. Gomez-Gil MRet al. Detection of KPC-2-producing Citrobacter bapenemase genes in microbiological samples in comparison freundii isolates in Spain. Journal of Antimicrobial Chemothera- with the modified Hodge test. American Journal of Clinical py, 2010, 65:2695–2697. Pathology, 2011, 135:566–571 12. Leavitt A et al. Molecular epidemiology, sequence types, and 23. Hindiyeh M et al. Rapid detection of blaKPC carbapenemase plasmid analyses of KPC-producing Klebsiella pneumoniae genes by internally controlled real-time PCR assay using Bac- strains in Israel. Antimicrobial Agents and Chemotherapy, 2010, tec blood culture bottles. Journal of Clinical Microbiology, 2011, 54:3002–3006. 49(7):2480–2484. 13. Souli Met al. An outbreak of infection due to beta-lactamase 24. Doern CD, Dunne WM Jr, Burnham CA. Detection of Klebsiella Klebsiella pneumoniae carbapenemase 2-producing K. pneu- pneumoniae carbapenemase (KPC) production in non-Kleb-

951 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

siella pneumoniae Enterobacteriaceae isolates by use of the enem susceptibility. Journal of Clinical Microbiology, 2010, Phoenix, Vitek 2, and disk diffusion methods. Journal of Clinical 48:4417–4425. Microbiology, 2011, 49:1143–1147. 28. Hu F et al. Emergence of carbapenem-resistant clinical En- 25. Carvalhaes CG et al. Cloverleaf test (modified Hodge test) for terobacteriaceae isolates from a teaching hospital in Shanghai, detecting carbapenemase production in Klebsiella pneumo- China. Journal of Medical Microbiology, 2012, 61:132–136. niae: be aware of false positive results. Journal of Antimicrobial 29. Schechner V et al. Evaluation of PCR-based testing for surveil- Chemotherapy, 2010, 65:249–251. lance of KPC-producing carbapenem-resistant members of 26. Landman D et al. Accuracy of carbapenem nonsusceptibility the Enterobacteriaceae family. Journal of Clinical Microbiology, for identification of KPC-possessing Enterobacteriaceae by use 2009, 47:3261–3265. of the revised CLSI breakpoints. Journal of Clinical Microbiol- ogy, 2011, 49:3931–3933. 27. Endimiani A et al. Evaluation of updated interpretative criteria for categorizing Klebsiella pneumoniae with reduced carbap-

952 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

Prognostic factors of Atractylis gummifera L. poisoning, Morocco S. Achour,1,2 N. Rhalem,2,3 S. Elfakir,4 A. Khattabi,2,3 C. Nejjari,4 A. Mokhtari,2 A. Soulaymani 2 and R. Soulaymani 3,5

العوامل ّاإلنذارية يف التسمم باإلشخيص )شوك العلك( يف املغرب سناء عاشور، نعيمه غامل، سمرية الفقري، أسامء خطايب، شكيب نجاري، عبد الغني خمتاري، عبد املجيد سليامين، رشيدة الشيخ سليامين اخلالصـة:يمثل التسمم بنبات اإلشخيص )شوك العلك( يف املغرب السبب الرئييس للتسمم بالنباتات، والسيام بني األطفال. وقد أجرى الباحثون هذه الدراسة التي شملت مجيع املصابني بالتسمم الذين راجعوا املركز املغريب ملكافحة التسمم يف الفرتة من كانون الثاين/يناير 1981 وكانون األول/ ديسمرب 2009، وعددهم ، 467وهي دراسة استعادية للخصائص ولعوامل اخلطر للتسمم باإلشخيص. ووجد الباحثون أن أكثر فئات األعامر ًتعرضا 75.5 63.4 للمخاطر هم األطفال ) %من احلاالت(، وأن معظم احلاالت سببها ُّالتعرض العارض )غري املقصود( ) %(، إال أن بعض احلاالت نجمت عن استخدامات بقصد املعاجلة )18.1 ( %أو حماوالت اإلجهاض )7.4 (. %وقد راجع املرىض بأعراض وعالمات تسمم معتدلة الشدة )الدرجة (2 يف 22.3% من احلاالت، وشديدة )الدرجة (3 يف 21% من احلاالت. وبلغ معدل الوفيات 39.2 ،% وكانت معظم حاالت الوفيات )81.1 ( %بني األطفال الذين تقل أعامرهم عن 15 ًعاماتلو التعرض العارض )غري املقصود(. وقد اتضح من حتليل التحوف اللوجستي املتعدد املتغريات أن عوامل اختطار الوفاة هي الغيبوبة )نسبة األرجحية 20.5(، وااللتهاب الكبدي )نسبة األرجحية = (، 52.7والسكن يف األرياف )نسبة األرجحية = (،7.26 يف حني كان تنظيف املعدة من العوامل الواقية )نسبة األرجحية 0.26(.

ABSTRACT In Morocco, acute Atractylis gummifera L. poisoning represents the leading cause of death by plant poisoning especially for children. All cases received in the Moroccan poison control centre from January 1981 to December 2009 (n = 467) were included in a retrospective study of the characteristics and risk factors of A. gummifera L. poisoning The most vulnerable age group was children (63.4% of cases). Most cases were due to accidental exposure (75.5%), but some were from therapeutic use (18.1%) or attempted abortion (7.4%). Patients presented with moderate poison severity signs (grade 2) in 22.3% of cases or severe signs (grade 3) in 21.0%. The mortality rate was 39.2%. The majority of deaths (81.1%) occurred in children aged < 15 years following accidental exposure. Multivariate logistic regression analysis revealed that risk factors for mortality were coma (OR = 20.5); hepatitis (OR = 52.7) and rural residence (OR = 7.26), while gastric decontamination was a protector factor (OR = 0.26).

Facteurs pronostiques d’intoxication par Atractylis gummifera L. au Maroc

RÉSUMÉ Au Maroc, l’intoxication aiguë par Atractylis gummifera L. représente la principale cause de décès dus à une intoxication par les plantes, en particulier chez les enfants. Tous les cas reçus au centre antipoison marocain entre janvier 1981 et décembre 2009 (n = 467) ont été inclus dans une étude rétrospective des caractéristiques et des facteurs de risque d’une intoxication par A. gummifera L. Le groupe d’âge le plus vulnérable était les enfants (63,4 % des cas). La plupart des cas étaient dus à une exposition accidentelle (75,5 %), mais certaines expositions avaient des visées thérapeutiques (18,1 %) ou abortives (7,4 %). Les patients présentaient des signes d’intoxication d’une intensité modérée (grade 2) dans 22,3 % des cas, ou d’une intensité sévère (grade 3) dans 21,0 % des cas. Le taux de mortalité était de 39,2 %. La majorité des décès (81,1 %) se sont produits chez des enfants de moins de 15 ans, à la suite d’une exposition accidentelle. L'analyse de régression logistique multivariée a révélé que les facteurs de risque de mortalité étaient un coma (O.R. = 20,5), une hépatite (O.R. = 52,7) et la résidence en milieu rural (O.R. = 7,26), tandis qu’une décontamination gastrique constituait un facteur protecteur (O.R. = 0,26).

1Laboratory of Toxicology, University Hospital and Faculty of Medicine and Pharmacy of Fez, Fez, Morocco (Correspondence to S. Achour: [email protected]). 2Laboratory of Genetics and Biometry, Ibn Tofail University, Faculty of Science and Technology, Kenitra, Morocco. 3Moroccan Poison Control and Pharmacovigilance Centre, Rabat, Morocco. 4Laboratory of Epidemiology and Public Health Faculty of Medicine of Fez, Fez, Morocco. 5Faculty of Medicine and Pharmacy of Rabat, Rabat, Morocco. Received: 02/04/12; accepted: 24/09/12

953 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Introduction [6]. The thistle is available in herbal stalls Statistical analysis and markets and is frequently found Epi 2000, version 3.3.2 program was Atractylis gummifera L. also called “glue in nature in the wild, except in desert used to perform the analysis. The thistle” or “addad” is a poisonous plant areas or dry lands and the Anti-Atlas chi-squared test was used to assess widespread in North Africa (Tunisia, mountains [7]. From 1980 to 2008, the the significance of differences in the Morocco, Algeria), Asia Minor and poison control centre of Morocco has distribution of selected sociodemo- southern Europe (Spain, Portugal, collected 4287 cases of poisoning by graphic characteristics, circumstances, Italy, Greece), but also in France plants, of which death occurred in 7.3%. clinical symptoms, therapeutic aspects (Corsica) [1]. This thistle, acciden- The glue thistle was implicated in 77.6% and frequency of deaths among the tally injested or used in traditional of these deaths [6]. participants. medicines, causes serious poisoning Published data about A. gummifera A logistic regression was performed incidents with fatal outcome in many L. poisoning are rare and limited to a few with death versus living as the depend- cases, and constitutes a public health clinical cases. A comprehensive study ent variable. We compared the groups problem especially for children in the with a determination of risk factors has of survivors and deceased to determine Mediterranean region [2]. Victims of never been made. The current study some prognostic factors. The explana- intoxication are mainly rural children, aimed to evaluate a series of cases of tory factors were coma, hepatitis, gastric who confuse the root with other acute A. gummifera L. poisoning in the decontamination, and residence area. edible plants, such as the artichoke Moroccan population to determine Odds ratios (OR) with 95% confidence Scolymus hispanicus L., or use the white the characteristics and the prognostic interval (CI) and degree of significance substance, which it exudes as chewing factors of this type of poisoning in our (P-value) was determined for each vari- gum. Intoxication can also occur dur- context. able. A P-value of < 0.05 was considered ing use of the glue thistle as a medicinal significant. plant because of its antipyretic, diuret- ic, abortifacient, emetic and purgative Methods properties [3]. Results The toxic effect of this plant arises Study population and data collection from 2 diterpenoid toxicants causing In our study 467 cases of A. gummifera L. toxicity—atractyloside and carboxy- The present retrospective study was poisoning were included, representing atractyloside—which are a powerful performed in Morocco. All cases related 10.6% of all cases of plant poisoning mitochondrial inhibitors of oxidative to acute A. gummifera L. poisoning re- collected over the same period. Declara- phosphorylation and interact with a ceived in the Moroccan poison control tions came from health professionals in mitochondrial protein involved in mi- centre from January 1981 to December 94.4% of cases and from the public in tochondrial membrane permeabiliza- 2009 were included. 5.6%. tion. This action is exerted especially The survey collected information in cells rich in mitochondria such as on sociodemographic characteris- Profile of poisoning cases hepatocytes and in proximal tubular ep- tics (age, sex, origin), circumstances Although the number of cases fluctu- ithelial cells. The consequences are cell (accident, therapeutic use, suicide), ated annually, they decreased slightly necrosis with extensive liver damage clinical symptoms, therapeutic as- after 2006 (Figure 1). The number and kidney failure. Poisoned patients pects (symptomatic treatment and varied between 2 cases in 1982 to 53 manifest characteristic symptoms such gastric decontamination) and out- cases in 1996 (11.1%). This type of poi- as nausea, vomiting, epigastric and come (mortality rate). The patient's soning was found in all regions of our abdominal pain, diarrhoea, hepatitis, clinical state was classified accord- country with a clear predominance in anxiety, headache and convulsions, ing to the Poisoning Severity Score the region of Fez-Boulemane (27.4% of often followed by coma. No specific [8]. Treatment at the centre is based cases), followed by the regions of Taza- pharmacological treatment for A. gum- on symptomatic treatment such as Al Hoceima-Taounate (16.3%) and mifera intoxication is yet available and the correction of hypoglycaemia by Marrakech-Tensift-Al Haouz (10.2%). all the current therapeutic approaches infusion of glucose solution, the ad- The mean age of cases was 15.3 are only symptomatic. ministration of oxygen or intubation- (SD 12.5) years, ranging from 1 to 70 In Morocco, poisoning by this plant ventilation in case of respiratory or years. The most vulnerable age group is very common and frequently fatal neurological distress and correction was children (63.4% of cases), followed [4,5] and represents the leading cause of metabolic acidosis and hydroelec- by adults (22.4%). Children aged 4–10 of death by plant poisoning in Morocco trolyte disorders. years and from rural areas were more of

954 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

Poisoning Death

60

50

40

30 No.

20

10

0 1 1 1 3 5 3 3 5 5 7 7 7 2 2 2 4 4 8 9 6 8 9 6 6 8 9 0 0 9 8 0 9 9 8 8 9 8 9 8 9 0 0 0 0 9 9 9 8 8 8 0 9 0 0 0 0 9 9 0 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 0 0 0 0 9 0 0 0 0 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 2 2 2 2 2 2 2 2 2

Year

Figure 1 Distribution of cases of poisoning (n = 467) and deaths (n = 130) due to Atractylis gummifera L. by year (1981–2009)

the cases (51.7%). The sex ratio (male/ in 106 cases, associated with jaundice Risk factors associated with female) was 0.76 in favour of females and elevation of serum transaminases death (203 males versus 264 females). and bilirubin. Prothrombin time was In order to identify clinical risk factors The route of intoxication was in- specified in 61.1% of cases and it was less associated with death, we compared dicated in 380 cases. Ingestion was than 50% in 96 cases, while fulminant the 2 groups (survivors and deaths) the most common route of exposure hepatitis was described at admission using univariate analysis. The parame- (98.0%), followed by topical adminis- in 36 cases. Furthermore, hyperglycae- ters statistically associated with death tration in only 2.0% of cases. Acciden- and elucidated by P-value < 0.05 are mia followed by hypoglycaemia was tal exposure was the most common reported in Table 2. Death was sig- reported in 30.3% of cases and renal circumstance (75.5%); therapeutic nificantly more common in children use was noted in 18.1% and the plant failure in 16.2% of cases. aged < 15 years (P < 0.001), among was used for attempted abortion in The management delay after in- females (P = 0.05), rural residents (P 7.4%. Adult females were more impli- toxication was less ≤ 4 hours in 72.2% < 0.001) and in cases of accidental cated in therapeutic use (48.4%) and of the cases. Gastric decontamination poisoning (P < 0.001). Death was male children in accidental exposure was performed in 40.3% of cases and significantly associated with pres- (51.6%). symptomatic treatment was made in ence of tachycardia, dizziness, mio- Patients were symptomatic in 67.3% 71.1% of cases. The outcome was speci- sis, haemorrhage/bleeding, history of hepatitis or coma. Patients with of cases; the evaluation of clinical sever- fied in 332 cases, of which 130 deaths abdominal pain and having gastric ity at admission according to Poisoning were recorded. The mortality rate was Severity Score showed that 22.3% were decontamination were significantly 39.2%. The majority of deaths (81.1%) in grade 2 with pronounced signs and less likely to die. occurred in children aged < 15 years 21.0% of patients were in grade 3 with Table 3 gives the adjusted OR life-threatening symptoms. Hepato- following accidental exposure. The dis- from multivariate logistic regression digestive disorders were the most com- tribution of cases and deaths according models to tease out the adjusted asso- monly observed symptoms (57.0%) to year is shown in Figure 1. The num- ciation between different characteris- followed by neurological disorders ber of deaths varied in each year with a tics and survival status. The analysis (26.9%) (Table 1). Hepatitis was found pronounced decrease after 2002. revealed that a history of coma was

955 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Table 1 Symptoms presented by patients affected by Atractylis gummifera L. Discussion poisoning Signs and symptoms No. with signsa % Despite the plant’s well-known Hepato-digestives disorders toxicity, ingestion of A. gummifera L Hepatitis 106 12.6 continues to be a common cause of Vomiting 150 17.9 poisoning in Morocco. In our study Nausea 88 10.5 467 cases were compiled, mainly in the Abdominal pain 73 8.8 Fez-Boulemane and the Taza-Al Ho- Intestinal bleeding 38 4.5 ceima-Taounate regions. This number Diarrhoea 24 2.9 is likely to be an underestimate be- Total 479 57.0 cause a large number of patients who Neurological disorders died were not declared to the poison Coma 76 9.1 centre. Poisoning by this plant is com- Dizziness 32 3.8 mon in the Mediterranean region and Headache 30 3.6 frequently fatal. It has been described Mydriasis 26 3.1 since the mid-19th century [9]. About Sensorymotor deficit 18 2.1 200 cases have been reported since Drowsiness 16 1.9 then [4,10], mainly by accidental sub- Convulsions 14 1.7 stitutions or due to children chewing Restlessness 14 1.7 the sweet gum obtained from the latex of its subterranean parts. Although Total 226 26.9 most poisoning cases occur in North Cardio-respiratory disorders Africa [10] they have also been re- Dyspnoea 40 4.8 ported among European countries: Collapse: hypotension 34 4.1 Greece [11]; Spain [12]; Italy [13]. Hypertension 10 1.2 If used internally it is extremely toxic, Arrhythmia 6 0.7 even at very low doses. Bronchospasm 3 0.3 A report by Hamouda et al. stated Apnoea 2 0.2 that from 1983 to 1998 the Tuni- Cyanosis 2 0.2 sian poisoning centre collected 56 Total 97 11.5 medical records of patients admitted General signs to the toxicological intensive care Anuria 11 1.3 unit for poisoning with 11 species Dry mouth 9 1.1 of plants [14]. The principal plants Sialorrhoea 8 1.0 involved were A. gummifera (18 cases; Asthaenia 7 0.8 32%), Datura stramonium L. (14 Skin rash 3 0.4 cases; 25%) and Ricinus communis L. Total 38 4.5 (5 cases; 9%). Of these 56 cases 16 All signs 840 100.0 were lethal and all of them involving aEach patient may have presented 1 or more clinical signs, and therefore the number of symptoms exceeded the A. gummifera. number of patients. Because A. gummifera L. is easily confused with a wild artichoke Scoly- significantly associated with higher those without (OR = 52.7, 95% CI: mus hispanicus L., most poisonings are risk of death compared with the 15.0–185). Living in a rural area (OR unintentional (75.5% in our study) and involved mainly children because subjects without a history of coma = 7.26, 95% CI: 2.68–19.6) was also this thistle has sweet-tasting juice and (OR = 20.5, 95% CI: 5.0–84.0), inde- a risk factor for death. Gastric decon- children enjoy chewing the chewing- pendent of the potential confounders. tamination was the only protector gum-like substance from the roots Subjects with a history of hepatitis factor of death (OR = 0.26, 95% CI: [15]. Therapeutic circumstances were had a greater likelihood of death than 0.07–0.96). reported in 18.1% and attempted

956 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

Table 2 Univariate analysis of factors associated with mortality among patients affected by Atractylis gummifera L. poisoning Variables Survived Died P-value No. % No. % Demographic data Age group (years) Child (0–14) 104 53.6 109 87.9 0.001 Teenager (15–19) 27 13.9 6 4.8 Adult (20–74) 63 32.5 9 7. 3 Sex Female 123 63.1 65 52.4 0.05 Male 72 36.9 59 47.6 Residence 0.001 Urban 82 72.6 26 35.1 Rural 31 2 7. 4 48 64.9 Circumstances Voluntary 52 27.7 6 5.1 0.001 Accidental 136 72.3 111 94.9 Clinical signs Abdominal pain No 152 76.7 123 94.6 0.001 Yes 46 23.2 7 5.4 Tachycardia No 188 94.9 115 88.5 0.030 Yes 10 5.1 15 11.5 Dizziness No 190 96.0 114 87.7 0.005 Yes 8 4.0 16 12.3 Miosis No 195 98.5 122 94.6 0.045 Yes 3 1.5 7 5.4 Coma No 190 96.0 90 69.2 0.001 Yes 8 4.0 40 30.8 Haemorrhage/ bleeding No 197 99.5 122 93.8 0.002 Yes 1 0.5 8 6.2 Hepatitis No 182 91.9 41 31.5 0.001 Yes 16 8.1 89 68.5 Gastric decontamination No 154 77.8 115 88.5 0.014 Yes 44 22.2 15 11.5

Data missing in some categories.

abortion in 7.4% of cases. In fact, in folk In traditional Arabic medicine it was in folk veterinary medicine [17]. In medicine, A. gummifera has been used used to cauterize abscesses. The plant the popular medicine of North Africa to treat several conditions including was also known for its antipyretic, diu- it is still used to treat syphilitic ulcers, intestinal parasites, ulcers, snake-bite retic, purgative and emetic properties induce abortion and bleach the teeth poisoning, hydrops and drowsiness. [16]. It is also used against parasites [18].

957 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Table 3 Multivariate logistic regression analysis of factors associated with mortality among patients affected by Atractylis gummifera L. poisoning Variables ORa 95% CI P-value Coma 20.5 5.0–84.4 0.001 Hepatitis 52.7 15.0–185 0.001 Gastric decontamination 0.26 0.07–0.96 0.04 Rural origin (rural versus urban 7.26 2.68–19.6 0.001

ORa = adjusted odds ratio; CI = confidence interval.

Several case reports of poisoning revealed that mortality in A. gummifera evacuation, gastric decontamination have been published in the literature L. poisoning correlated with coma and and administration of activated char- and provide useful information on the hepatitis and the presence of these signs coal [21]. The majority of these treat- symptoms and laboratory findings that increased the risk of death. This can be ments were performed in our patients, help to identify victims of A. gummifera explained by the pathologic action of except activated charcoal, because it poisoning. The symptoms begin 6–36 atractyloside and carboxyatractyloside, is not available in our country. In our hours after the ingestion of the extract which involves inhibition of adenosine study, gastric decontamination was of the A. gummifera rhizome [16]. The diphosphate triphosphate conversion a protector factor against death, and signs and symptoms found in our through inhibition of P450 cytochrome, indeed, by reducing the toxic load, series corroborate those found in the thus leading to damage of tissues. The this type of treatment improves the literature already cited. The laboratory organs with the greatest oxygen require- prognosis of poisoned patients. Symp- findings (marked increased in serum ments appear to be especially sensitive tomatic treatment is still insufficient glutamic oxaloacetic transaminase, se- to damage; these include the brain and in patients who have taken quanti- rum glutamic-pyruvic transaminase and liver. ties theoretically lethal of the poison. bilirubin) may indicate severe hepato- No specific pharmacological treat- In spite of the progress achieved in cellular damage and acute renal failure ment (antidote) is currently available the fields of toxicology and associated [19]. In our series, hepatitis was present to treat A. gummifera intoxication and therapy, A. gummifera L. poisoning is in 106 patients and was associated with all therapeutic approaches including still responsible for a high rate of a high mortality. fluid and electrolyte replacement, mortality (39.2% in our study). New A. gummifera L. poisoning is respon- cardiovascular and respiratory sup- therapeutic approaches could come sible for a heavy burden of morbidity port, seizure control and conventional from immunotherapy research: some and mortality and to our knowledge the therapeutic methods for severe hepatic studies have already tried to produce factors that determined death were and renal failure are only symptomatic polyclonal Fab antibody fragments never investigated. Our study is the first [20]. Some authors recommend that against the toxic components of A. one to focus on the study of prognos- standard therapeutic practice should gummifera [22]. tics factors. The multivariate analysis include induction of vomiting, bowel Competing interests: None declared.

References

1. Skalli S et al. L’intoxication par le chardon à glu (Atractylis gum- 5. Vallejo JR et al. Atractylis gummifera and Centaurea ornata in mifera L.); à propos d’un cas clinique [Poisoning by Atractylis the province of Badajoz (Extremadura, Spain). Ethnopharma- gummifera L: about one clinical case]. Bulletin de la Société de cological importance and toxicological risk. Journal of Ethnop- Pathologie Exotique, 2002, 95:284–286. harmacology, 2009, 126:366–370. 2. Madani N et al. Intoxication par le chardon à glu chez une 6. Rhalem N et al. Etude rétrospective des intoxications par les femme enceinte [Poisoning by glue thistle in a pregnant plantes au Maroc : Expérience du Centre Anti Poison et de woman]. Presse Medicale (Paris, France), 2006, 35:1828–1830. Pharmacovigilance du Maroc (1980–2008) [A retrospective 3. Ahid S et al. Atractylis gummifera : de l’intoxication aux méthodes study of poisoning by plants in Morocco: experience of the analytiques [Atractylis gummifera: from poisoning to the analytic poison and pharmacovigilance centre of Morocco (1980– methods]. Annales de Biologie Clinique, 2012, 70:263–268. 2008]. Toxicologie Maroc., 2010, 5:5–8. 4. Hami H et al. Intoxication par Atractylis gummifera L. Don- 7. Charnot A. La toxicologie au Maroc [Toxicology in Morocco]. nées du centre antipoison et de pharmacovigilance du Maroc Mémoire de la Société des Sciences Naturelles du Maroc, 1945, [Poisoning by Atractylis gummifera l. Morocco poison control XLVII:572–598. center data]. Bulletin de la Société de Pathologie Exotique, 2010, 8. Person HE et al. Poisoning severity score. Grading of acute 104:53–57. poisoning. Clinical Toxicology, 1998, 36:205–213.

958 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

9. Lefranc E. Étude botanique, chimique et toxicologique sur 17. Viegi L et al. A review of plants used in folk veterinary medicine l’Atractylis gummifera [Botanical, chemical and toxicological in Italy as basis for a databank. Journal of Ethnopharmacology, studies on Atractylis gummifera]. Bulletin de la Société Botanique 2003, 89:221–244. de France, 1866, 13:146–157. 18. Larrey D, Pageaux GP. Hepatotoxicity of herbal remedies and 10. Hamouda C et al. Plant poisonings from herbal medica- mushrooms. Seminars in Liver Disease, 1995, 15:183–188. tion admitted to a Tunisian toxicological intensive care unit, 19. Masria, W. et al. Intoxication par Atractylis gummifera L : à pro- 1983–1998. Veterinary and Human Toxicology, 2000, 42:137–141. pos de deux cas cliniques [Poisoning by Atractylis gummifera L: 11. Georgiou M et al. Hepatotoxicity due to Atractylis gummifera L. about two clinical cases]. Revue Francophone des Laboratories, Clinical Toxicology, 1988, 26:487–493. 2009, 413, 87–91. 12. Salas J et al. Intoxicaciones por Atractylis gummifera L. en Bada- 20. Stewart MJ, Steenkamp V. The biochemistry and toxicity of joz (Espana) [Poisoning by Atractylis gummifera L. in Badajoz atractyloside: a review. Therapeutic Drug Monitoring, 2000, (Spain)]. Studia Botanica, 1985, 4:201–204. 22:641–649. 13. Santi R, Cascio G. Ricerche farmacologiche sul principio attivo 21. Ben Salah N et al. Quelques spécialités de chez nous: in- dell’Atractylis gummifera [Pharmacological research on the toxications par les plantes, le chloralose et le methanol [Some active ingredient of Atractylis gummifera]. Archivio Italiano di specialties from us: poisoning by plants, chloralose and metha- Scienze Farmacologiche, 1955, 5:354. nol]. Memoire Online [online journal] (http://www.samu.org/ 14. Hamouda C et al. A review of acute poisoning from Atrac- JAMU2003/jamu2001/chez%nous11.htm, accessed 31 July tylis gummifera L. Veterinary and Human Toxicology, 2004, 2013). 46:144–146. 22. Danielea C et al. Atractylis gummifera L. poisoning: an ethnop- 15. Stickel F et al. Hepatotoxicity of botanicals. Public Health Nutri- harmacological review. Journal of Ethnopharmacology, 2005, tion, 2000, 3:113–124. 97:175–181. 16. Capdevielle P, Darraq R. Poisoning by bird-lime thistle. Mede- cine Tropicale, 1980, 40:137–142.

959 EMHJ • Vol. 19 No. 11 • 2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale

Case report Case of acquired lobar emphysema mimicking pneumothorax in a neonate F. Firinci,1 N. Duman,1 O. Ates,2 E. A. Ozer,3 A. Kumral,1 A. Erdemir 3 and H. Ozkan 1

Introduction

Despite the improvements in pre- vention of acute respiratory disease in preterm infants, the incidence of bronchopulmonary dysplasia (BPD) remains largely unchanged. Acquired lobar emphysema (ALE) is an increas- ingly recognized complication of advanced BPD. Barotrauma, oxygen toxicity and lung immaturity are pre- sumed to play an important role in the development of ALE in children with BPD and most cases present overinfla- tion [1,2]. We report on an infant with BPD who developed ALE mimicking pneumothorax.

Case report

Following a 30-week of gestation complicated with premature rupture of membranes for 3 days, a 1275 g Figure 1 Chest radiographs of a case of acquired lobar emphysema mimicking male infant was delivered by caesarean pneumothorax in a neonate. (A) Postnatal day 21: bilateral diffuse cystic changes section. The initial chest radiography in lung parenchyma, consolidation on the left retrocardiac side. (B) Postnatal showed a grade IV respiratory distress day56: emphysema on the right lower lobe of the lung, deviation of the heart and mediastinal structures to the left, diffuse cystic parenchymal changes on the syndrome (RDS), requiring a total of right upper lobe and left lobe of the lung. (C) Postnatal day 59: emphysema on the 3 surfactant administrations. The initial right lower lobe of the lung, deviation of the heart and mediastinal structures to the left. (D) Postnatal day 63: bilateral diffuse cystic parenchymal changes and no situation was complicated by a systemic emphysema after right lower lobectomy inflammatory response syndrome. Ven- tilatory support was performed to treat respiratory acidosis and severe RDS. Although vitamin A supplementation was inserted. However, the infant dete- On postnatal day 28, when the child and dexamethasone treatment were riorated clinically and repeated radiog- had been on mechanical ventilation, a administered, the infant did not tolerate raphy revealed lobar emphysema on the right pneumothorax developed. A chest extubation. On postnatal day 56, severe right lower lung. The infant underwent tube was inserted and removed after 3 acute hypoxaemia developed. Chest right lower lobectomy and a marked days. On postnatal day 31, radiographic radiography confirmed the diagnosis clinical improvement after surgery was evidence of BPD was noted (Figure 1). of right pneumothorax and a chest tube evident. The patient was extubated on

1Department of Paediatrics; 2Department of Paediatric Surgery, Dokuz Eylul University School of Medicine, Izmir, Turkey (Correspondence to F. Firinci: [email protected], [email protected]). 3Department of Paediatrics, Izmir Tepecik Training and Research Hospital, Izmir, Turkey. Received: 16/01/12; accepted: 06/12/12

960 املجلة الصحية لرشق املتوسط املجلد التاسع عرش العدد احلادي عرش

postnatal day 67. The infant was then developing RDS complicated with dexamethasone [4–9]. In our case, re- transferred to another hospital due to BPD and ALE during mechanical ven- section of the large emphysematous his family’s request on postnatal day tilation. Initially he was managed with bulla was successfully performed with- 125. On discharge, he was clinically chest tube drainage due to diagnosis out any perioperative complications. stable and receiving only supplemental of pneumothorax. However repeated Considering the surgical approach the oxygen. radiologic examination revealed the postoperative outcome was encourag- diagnosis of ALE. ing, although the long-term outcome ALE is an usual complication of of the child remains unclear. In the lit- Discussion mechanical ventilatory support in neo- erature concerning infants who failed nates with RDS. Although numerous medical management, lobectomy is The pulmonary air leak syndromes, therapeutic approaches to this com- clearly beneficial [1]. including pneumomediastinum, plication have been described, there In conclusion, ALE should be kept pneumothorax, pulmonary inter- is no widely accepted management in mind as a complication in infants stitial emphysema and pneumo- strategy in current practice. Therapeu- with severe BPD on mechanical venti- pericardium, comprise a spectrum tic options include positioning of the lation. Early diagnosis of the ALE is im- of disease with the same underlying neonate on the affected hemithorax, portant for conservative management. pathophysiology. They are common selective ventilation of the unaffected A misdiagnosis of pneumothorax in preterm neonates with RDS during lung with conventional ventilation, should be avoided. Obviously, preven- treatment with mechanical ventila- selective occlusion of the affected tion is better than treatment. Therefore tion. The incidence is about 10% of mainstem bronchus, surgical resection clinical trials in patients with BPD will the ventilated preterm infants treated of the affected lung portion, applica- provide additional therapeutic options with surfactants [3]. This is tion of high-frequency ventilation for the treatment and prevention of a case report of a preterm newborn to the trachea and administration of complications of BPD.

References

1. Azizkhan RG et al. Acquired lobar emphysema (overinflation): 6. Lewis S et al. Pulmonary interstitial emphysema: selective clinical and pathological evaluation of infants requiring lobec- bronchial occlusion with a Swanganz catheter. Archives of Dis- tomy. Journal of Pediatric Surgery, 1992, 27:1145–1152. ease in Childhood, 1988, 63:613–615. 2. Miller KE et al. Acquired lobar emphysema in premature 7. Andreou A et al. One-sided high-frequency oscillatory ven- infants with bronchopulmonary dysplasia: an iatrogenic dis- tilation in the management of an acquired neonatal lobar ease? Pediatric Radiology, 1981, 138:589–592. emphysema: a case report and review. Journal of Perinatology, 2001, 21:61–64. 3. Ozkan H et al. Synchronized ventilation of very-low-birth- weight infants; report of 6 years’ experience. Journal of Mater- 8. Weintraub Z, Oliven A. Succesful resolution of unilateral pulmonary interstitial emphysema in a premature infant by nal-Fetal and Neonatal Medicine, 2004, 15:261–265. selective bronchial balloon catheterization. Journal of Pediatric 4. Leonidas JC, Hall RT, Rhodes PG. Conservative management Surgery, 1988, 96:475–477. of unilateral pulmonary interstitial emphysema under tension. 9. Martin JS et al. Emphyseme lobaire geant acquis chez un Journal of Pediatrics, 1975, 87:776–778. premature sous ventilation artificielle. Guerison par la corti- 5. Dickman GI, Short BI, Krauss DR. Selective intubation in the cotherapie [Acquired giant lobar emphysema in an artificially management of unilateral pulmonary interstitial emphysema. ventilated premature infant. Cured by corticosteroid therapy]. American Journal of Diseases of Children, 1977, 131:365. Annales de Pediatrie, 1993, 40:49–50.

961 Members of the WHO Regional Committee for the Eastern Mediterranean

Afghanistan . Bahrain . Djibouti . Egypt . Islamic Republic of Iran . Iraq . Jordan . Kuwait . Lebanon Libya . Morocco . Oman . Pakistan . Palestine . Qatar . Saudi Arabia . Somalia . South Sudan Sudan . Syrian Arab Republic . Tunisia . United Arab Emirates . Yemen

‚G™BÐçOTogBm^TÐoœZTÐod]eBogdgcRüÐoe›cTÐÊm[KÌëÐzc—TÐ

phYĆHüÐëÐ}xÎpxڎg+ nh˜hU iŽ> Œx}˜UÐ ënš—Tn= Ò{šCÐph=}_UÐÓÐÚnYüÐ ënš—in`RÌ ëØÚúÐ WY ënf˜U qxŽcUÐ }]S N]—dR ë5Lô  çÐ}_UÐ énYŽ[UÐ ëÐ؎—UÐ .Ž˜h@ ëÐ؎—UÐюf@ ŒehUÐ pxڎ—UÐph=}_UÐpxڎge!Ð px؎_—UÐph=}_UÐpcdeCÐ Ñ}`CÐ

Membres du Comité régional de l’OMS pour la Méditerranée orientale

Afghanistan . Arabie saoudite . Bahreïn . Djibouti . Égypte . Émirats arabes unis . République islamique d’Iran Iraq . Libye . Jordanie . Koweït . Liban . Maroc . Oman . Pakistan . Palestine . Qatar . République arabe syrienne Somalie . Soudan . Soudan du Sud . Tunisie . Yémen

Correspondence

Editor-in-chief EMHJ WHO Regional Office for the Eastern Mediterranean P.O. Box 7608 Nasr City, Cairo 11371 Egypt Tel: (+202) 2276 5000 Fax: (+202) 2670 2492/(+202) 2670 2494 Email: [email protected]

Subscriptions and Distribution Enquiries regarding subscriptions and distribution of the print edition of EMHJ should be addressed to: Printing and Marketing of Publications at: email: [email protected]; tel: (+202) 2276 5000; fax: (+202) 2670 2492 or 2670 2494

Permissions Requests for permission to reproduce or translate articles, whether for sale or non-commercial distribution should be addressed to EMHJ at: [email protected] Contents

Editorial

An ancient scourge triggers a modern emergency ...... 903 Research articles

Arabic version of the Global Mental Health Assessment Tool—Primary Care version (GMHAT/PC): a validity and feasibility study ...... 905 Predictors of smoking among male college students in Saudi Arabia ...... 909 Salt intake in Eastern Saudi Arabia ...... 915 Investigating inspection practices of pharmaceutical manufacturing facilities in selected Arab countries: views of inspectors and pharmaceutical industry employees ...... 919 Pharmacovigilance in Qatar: a survey of pharmacists ...... 930

Isolation and identification of Legionella pneumophila from drinking water in Basra governorate, Iraq ...... 936 Molecular typing of Mycobacterium spp. isolates from Yemeni tuberculosis patients ...... 942 High prevalence of Klebsiella pneumoniae carbapenemase-mediated resistance in K. pneumoniae isolates from Egypt...... 947 Prognostic factors of Atractylis gummifera L. poisoning, Morocco ...... 953 Case report

Case of acquired lobar emphysema mimicking pneumothorax in a neonate ...... 960