DOCSLIB.ORG

Vergleichende Molekulare Charakterisierung Ctnnb1- Und Ha

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Vergleichende Molekulare Charakterisierung Ctnnb1- Und Ha Vergleichende molekulare Charakterisierung Ctnnb1 - und Ha-ras -mutierter Mauslebertumoren Comparative Molecular Characterization of Ctnnb1 - and Ha-ras -mutated Mouse Liver Tumors Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität Tübingen zur Erlangung des Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) vorgelegt von Elif Bettina Unterberger aus Den Haag Tübingen 2013 Tag der mündlichen Prüfung: 13.5.2013 Dekan: Prof. Dr. Wolfgang Rosenstiel 1. Berichterstatter: Prof. Dr. Michael Schwarz 2. Berichterstatter: Prof. Dr. Klaus Schulze-Osthoff The presented thesis was prepared at the Institute of Experimental and Clinical Pharmacology and Toxicology, Department of Toxicology, at the Eberhard Karls Universität Tübingen between September 2009 and March 2013 under the supervision of Prof. Dr. Michael Schwarz. During this time period I overtook the supervision of a diploma student, Kathrin Knötzsch, who carried out mutation analysis of spontaneous mouse liver tumors. Parts of this work have been conducted in cooperation with external partners. mRNA expression and DNA methylation profiling, as well as characterization of Meg3/Gtl2 by immunohistochemistry and in situ hybridization was conducted at the Novartis Institutes for BioMedical Research in Basel, Switzerland. CXR Biosciences in Dundee, Scotland, carried out miRNA expression measurements, and reverse phase protein microarray analysis was conducted at NMI, Reutlingen, Germany. Pre-processing and statistical analysis of raw data gained from these experiments was done by Johannes Eichner, Clemens Wrzodek (University of Tübingen, Department of Computer Science, Cognitive Systems) and Raphaëlle Luisier (Department for Discovery and Investigative Safety, Novartis Institutes for BioMedical Research, Basel, Switzerland). It is not the mountain we conquer, but ourselves. Sir Edmund Hilary Acknowledgements First and foremost, I would like to thank my supervisor Prof. Michael Schwarz for giving me the opportunity to work on a fascinating and relevant topic, for his support and trust, and for generously sharing his vast knowledge about carcinogenesis. My sincere thanks go to: The IMI MARCAR consortium for financial support and for generating and sharing a large amount of the raw data analyzed in the course of this thesis. Johannes Eichner and Clemens Wrzodek for their tremendous help in bioinformatically analyzing the datasets and for never growing tired of patiently answering my innumberable questions. The members of the Novartis Institutes for BioMedical Research for their support and technical guidance in conducting immunohistochemical stainings and in situ hybridization. Elke Zabinsky for excellent technical support with immunohistochemical stainings. All members of the Department of Toxicology in Tübingen for creating a positive working atmosphere and for their constant support in all scientific, bureaucratic and personal matters. My loving thanks go to my parents, who have always supported and encouraged me in every possible way, for their love and trust and for making me regain perspective when times were rough. I thank Jörg, my angel, my best friend through thick and thin, for everything. Parts of this work have been presented: Lempiäinen H, Couttet P, Bolognani F, Müller A, Dubost V, Luisier R, Espinola Adel R, Vitry V, Unterberger EB , Thomson JP, Treindl F, Metzger U, Wrzodek C, Hahne F, Zollinger T, Brasa S, Kalteis M, Marcellin M, Giudicelli F, Braeuning A, Morawiec L, Zamurovic N, Längle U, Scheer N, Schübeler D, Goodman J, Chibout SD, Marlowe J, Theil D, Heard DJ, Grenet O, Zell A, Templin MF, Meehan RR, Wolf RC, Elcombe CR, Schwarz M, Moulin P, Terranova R, Moggs JG.: Identification of Dlk1-Dio3 imprinted gene cluster non-coding RNAs as novel candidate biomarkers for liver tumor promotion , Toxicological Sciences 131(2), 375-386, doi: 10.1093/toxsci/kfs303 Unterberger EB , Schwarz M: Biomarkers and molecular tumour classification for non- genotoxic carcinogenesis , ToxNet Baden-Württemberg Symposium, Konstanz, Germany, 2011 ( poster presentation ) Unterberger EB , Schwarz, M: Mechanisms of non-genotoxic carcinogenesis – novel insights from integrated genetic, transcriptomic and epigenomic profiling , 26 th GUM meeting (Society of mutational and environmental research), Mainz, Germany, 2012 (invited lecture) Unterberger EB , Schwarz M: Biomarkers and molecular tumour classification for non- genotoxic carcinogenesis , 78 th meeting of the German Society of Pharmacology and Toxicology, Dresden, Germany, 2012 ( oral presentation, awarded with the Sanofi- Aventis-Prize for best oral presentation) Zeller E, Kramer-Potapenja V, Unterberger EB , Braeuning A., Schwarz M: Long non- docing RNA Gtl2/Meg3 and its role in hepatic cancer, 79 th meeting of the German Society of Pharmacology and Toxicology, Halle an der Saale, Germany, 2013 (poster presentation) Table of contents 1. Introduction ..................................................................................................... 1 1.1 Physiology of the liver ..................................................................................... 1 1.2 Chemical carcinogenesis ................................................................................ 4 1.2.1 Canonical Wnt signaling pathway ............................................................ 5 1.2.2 Mitogen-activated protein kinase (MAPK) signaling pathway ................... 6 1.3 Epigenetic mechanisms in carcinogenesis ...................................................... 7 1.3.1 The Dlk1-Dio3 imprinted gene cluster ...................................................... 8 1.4 Aims and objectives ...................................................................................... 10 2. Material ......................................................................................................... 11 2.1 Chemicals and biochemicals ......................................................................... 11 2.2 Antibodies ..................................................................................................... 12 2.2.1 Immunohistochemistry ........................................................................... 12 2.2.2 Reverse phase protein microarray ......................................................... 13 2.2.3 Western Blot .......................................................................................... 17 2.3 Buffers and solutions: .................................................................................... 18 2.3.1 Electrophoresis ...................................................................................... 18 2.3.2 Isolation of genomic DNA ...................................................................... 19 2.3.3 Immunohistochemistry ........................................................................... 19 2.3.4 Western Blot .......................................................................................... 20 2.4 Primers ......................................................................................................... 20 2.4.1 RFLP analysis and sequencing ............................................................. 20 2.4.2 LightCycler PCR .................................................................................... 20 2.5 Laboratory equipment ................................................................................... 21 2.6 Expandable items and small devices ............................................................. 22 2.7 Software ........................................................................................................ 23 3. Methods ........................................................................................................ 24 3.1 Animal treatment and housing ....................................................................... 24 3.1.1 Tumor tissue from previous initiation-promotion experiments ................ 24 Table of contents Page I 3.1.2 PB-treatment of Connexin32-deficient mice ........................................... 24 3.1.3 Obtaining of spontaneous liver tumors ................................................... 25 3.1.4 Tumors from DEN-initiated mice after withdrawal of PB-treatment ......... 25 3.1.5 APC-knockout mice ............................................................................... 25 3.2 Mutation analysis .......................................................................................... 25 3.2.1 Isolation of genomic DNA ...................................................................... 25 3.2.2 Standard PCR ....................................................................................... 25 3.2.3 RFLP analysis ....................................................................................... 26 3.3 Quantitative Real-time PCR .......................................................................... 27 3.3.1 Isolation of RNA from frozen liver .......................................................... 27 3.3.2 Reverse transcription ............................................................................. 27 3.3.3 LightCycler PCR .................................................................................... 28 3.4 Global gene expression analysis ................................................................... 29 3.5 miRNA expression analysis ........................................................................... 29 3.6 Analysis of proteome and phosphoproteome ................................................
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • In-Depth Analysis of Genetic Variation Associated with Severe West Nile Viral Disease
    Article In-Depth Analysis of Genetic Variation Associated with Severe West Nile Viral Disease Megan E. Cahill 1, Mark Loeb 2, Andrew T. Dewan 1 and Ruth R. Montgomery 3,* 1 Center for Perinatal, Pediatric and Environmental Epidemiology, Department of Chronic Disease Epidemiology, Yale School of Public Health, 1 Church Street, New Haven, CT 06510, USA; [email protected] (M.E.C.); [email protected] (A.T.D.) 2 3208 Michael DeGroote Centre for Learning & Discovery, Division of Clinical Pathology, McMaster University, Hamilton, ON L8S 4L8, Canada; [email protected] 3 Department of Internal Medicine, Yale School of Medicine, 300 Cedar Street, New Haven, CT 06520, USA * Correspondence: [email protected] Received: 30 October 2020; Accepted: 3 December 2020; Published: 8 December 2020 Abstract: West Nile virus (WNV) is a mosquito-borne virus which causes symptomatic disease in a minority of infected humans. To identify novel genetic variants associated with severe disease, we utilized data from an existing case-control study of WNV and included population controls for an expanded analysis. We conducted imputation and gene-gene interaction analysis in the largest and most comprehensive genetic study conducted to date for West Nile neuroinvasive disease (WNND). Within the imputed West Nile virus dataset (severe cases n = 381 and asymptomatic/mild controls = 441), we found novel loci within the MCF.2 Cell Line Derived Transforming Sequence Like (MCF2L) gene (rs9549655 and rs2297192) through the individual loci analyses, although none reached statistical significance. Incorporating population controls from the Wisconsin Longitudinal Study on Aging (n = 9012) did not identify additional novel variants, a possible reflection of the cohort’s inclusion of individuals who could develop mild or severe WNV disease upon infection.
    [Show full text]
  • The Transcription Factor Pou3f1 Promotes Neural Fate Commitment
    RESEARCH ARTICLE elifesciences.org The transcription factor Pou3f1 promotes neural fate commitment via activation of neural lineage genes and inhibition of external signaling pathways Qingqing Zhu1,2†, Lu Song1†, Guangdun Peng1, Na Sun3, Jun Chen1, Ting Zhang1, Nengyin Sheng1, Wei Tang1, Cheng Qian1, Yunbo Qiao1, Ke Tang4, Jing-Dong Jackie Han3, Jinsong Li1, Naihe Jing1* 1State Key Laboratory of Cell Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China; 2Department of Neurosurgery, West China Hospital, Sichuan University, Sichuan, China; 3Key Laboratory of Computational Biology, CAS-MPG Partner Institute for Computational Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China; 4Institute of Life Science, Nanchang University, Nanchang, Jiangxi, China Abstract The neural fate commitment of pluripotent stem cells requires the repression of extrinsic inhibitory signals and the activation of intrinsic positive transcription factors. However, how these two events are integrated to ensure appropriate neural conversion remains unclear. In this study, we showed that Pou3f1 is essential for the neural differentiation of mouse embryonic stem cells (ESCs), specifically during the transition from epiblast stem cells (EpiSCs) to neural progenitor cells (NPCs). Chimeric analysis showed that Pou3f1 knockdown leads to a markedly decreased *For correspondence: njing@ incorporation of ESCs in the neuroectoderm. By contrast, Pou3f1-overexpressing ESC derivatives sibcb.ac.cn preferentially contribute to the neuroectoderm. Genome-wide ChIP-seq and RNA-seq analyses †These authors contributed indicated that Pou3f1 is an upstream activator of neural lineage genes, and also is a repressor of equally to this work BMP and Wnt signaling.
    [Show full text]
  • Nebulette Is a Powerful Cytolinker Organizing Desmin and Actin in Mouse Hearts
    M BoC | ARTICLE Nebulette is a powerful cytolinker organizing desmin and actin in mouse hearts Daniel A. Hernandeza,†, Christina M. Bennetta,†, Lyubov Dunina-Barkovskayaa, Tatjana Wedigb, Yassemi Capetanakic, Harald Herrmannb,d, and Gloria M. Conovera,* aDepartment of Biochemistry & Biophysics, Texas A&M University, College Station, TX 77843-3474; bDivision of Molecular Genetics, German Cancer Research Center (DKFZ), D-69120 Heidelberg, Germany; cCenter of Basic Research, Biomedi- cal Research Foundation Academy of Athens, Athens 11527, Greece; dInstitute of Neuropathology, University Hospital Erlangen, D-91054 Erlangen, Germany ABSTRACT In the hearts of patients bearing nebulette mutations, a severe general disorgani- Monitoring Editor zation in cardiomyocytes of the extrasarcomeric desmin intermediate filament system is fre- Robert D. Goldman quently observed. However, the molecular and functional relationship between the desmin Northwestern University cytoskeleton and nebulette-containing sarcomeres is still unclear. Here we report a high-affinity Received: Apr 18, 2016 in vitro interaction between nebulette and desmin filaments. A major interaction site has been Revised: Aug 31, 2016 mapped to the desmin α-helical rod domain, indicating that the filament core is directly in- Accepted: Oct 5, 2016 volved in the binding of nebulette. The disease-mutant desmin variants E245D and T453I ex- hibited increased binding affinity for nebulette, delayed filament assembly kinetics, and caused significant weakening of networks. In isolated chick cardiomyocytes and sections from canine heart, we revealed by ground-state depletion and confocal microscopies that module 5 of nebulette extends outward from Z-disk–associated desmin filaments toward the center of the sarcomere. Accordingly, in the myocardium of Des−/− mice, elevated levels of cardiac actin cor- related with alterations in the distribution of nebulette.
    [Show full text]
  • The Role of Z-Disc Proteins in Myopathy and Cardiomyopathy
    International Journal of Molecular Sciences Review The Role of Z-disc Proteins in Myopathy and Cardiomyopathy Kirsty Wadmore 1,†, Amar J. Azad 1,† and Katja Gehmlich 1,2,* 1 Institute of Cardiovascular Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham B15 2TT, UK; [email protected] (K.W.); [email protected] (A.J.A.) 2 Division of Cardiovascular Medicine, Radcliffe Department of Medicine and British Heart Foundation Centre of Research Excellence Oxford, University of Oxford, Oxford OX3 9DU, UK * Correspondence: [email protected]; Tel.: +44-121-414-8259 † These authors contributed equally. Abstract: The Z-disc acts as a protein-rich structure to tether thin filament in the contractile units, the sarcomeres, of striated muscle cells. Proteins found in the Z-disc are integral for maintaining the architecture of the sarcomere. They also enable it to function as a (bio-mechanical) signalling hub. Numerous proteins interact in the Z-disc to facilitate force transduction and intracellular signalling in both cardiac and skeletal muscle. This review will focus on six key Z-disc proteins: α-actinin 2, filamin C, myopalladin, myotilin, telethonin and Z-disc alternatively spliced PDZ-motif (ZASP), which have all been linked to myopathies and cardiomyopathies. We will summarise pathogenic variants identified in the six genes coding for these proteins and look at their involvement in myopathy and cardiomyopathy. Listing the Minor Allele Frequency (MAF) of these variants in the Genome Aggregation Database (GnomAD) version 3.1 will help to critically re-evaluate pathogenicity based on variant frequency in normal population cohorts.
    [Show full text]
  • List of Genes Associated with Sudden Cardiac Death (Scdgseta) Gene
    List of genes associated with sudden cardiac death (SCDgseta) mRNA expression in normal human heart Entrez_I Gene symbol Gene name Uniprot ID Uniprot name fromb D GTEx BioGPS SAGE c d e ATP-binding cassette subfamily B ABCB1 P08183 MDR1_HUMAN 5243 √ √ member 1 ATP-binding cassette subfamily C ABCC9 O60706 ABCC9_HUMAN 10060 √ √ member 9 ACE Angiotensin I–converting enzyme P12821 ACE_HUMAN 1636 √ √ ACE2 Angiotensin I–converting enzyme 2 Q9BYF1 ACE2_HUMAN 59272 √ √ Acetylcholinesterase (Cartwright ACHE P22303 ACES_HUMAN 43 √ √ blood group) ACTC1 Actin, alpha, cardiac muscle 1 P68032 ACTC_HUMAN 70 √ √ ACTN2 Actinin alpha 2 P35609 ACTN2_HUMAN 88 √ √ √ ACTN4 Actinin alpha 4 O43707 ACTN4_HUMAN 81 √ √ √ ADRA2B Adrenoceptor alpha 2B P18089 ADA2B_HUMAN 151 √ √ AGT Angiotensinogen P01019 ANGT_HUMAN 183 √ √ √ AGTR1 Angiotensin II receptor type 1 P30556 AGTR1_HUMAN 185 √ √ AGTR2 Angiotensin II receptor type 2 P50052 AGTR2_HUMAN 186 √ √ AKAP9 A-kinase anchoring protein 9 Q99996 AKAP9_HUMAN 10142 √ √ √ ANK2/ANKB/ANKYRI Ankyrin 2 Q01484 ANK2_HUMAN 287 √ √ √ N B ANKRD1 Ankyrin repeat domain 1 Q15327 ANKR1_HUMAN 27063 √ √ √ ANKRD9 Ankyrin repeat domain 9 Q96BM1 ANKR9_HUMAN 122416 √ √ ARHGAP24 Rho GTPase–activating protein 24 Q8N264 RHG24_HUMAN 83478 √ √ ATPase Na+/K+–transporting ATP1B1 P05026 AT1B1_HUMAN 481 √ √ √ subunit beta 1 ATPase sarcoplasmic/endoplasmic ATP2A2 P16615 AT2A2_HUMAN 488 √ √ √ reticulum Ca2+ transporting 2 AZIN1 Antizyme inhibitor 1 O14977 AZIN1_HUMAN 51582 √ √ √ UDP-GlcNAc: betaGal B3GNT7 beta-1,3-N-acetylglucosaminyltransfe Q8NFL0
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Olig1 and Sox10 Interact Synergistically to Drivemyelin Basic
    The Journal of Neuroscience, December 26, 2007 • 27(52):14375–14382 • 14375 Cellular/Molecular Olig1 and Sox10 Interact Synergistically to Drive Myelin Basic Protein Transcription in Oligodendrocytes Huiliang Li,1 Yan Lu,2 Hazel K. Smith,1 and William D. Richardson1 1Wolfson Institute for Biomedical Research and Department of Biology, University College London, London WC1E 6BT, United Kingdom, and 2Medical Research Council, Clinical Sciences Centre, Imperial College London, London W12 0NN, United Kingdom The oligodendrocyte lineage genes (Olig1/2), encoding basic helix-loop-helix transcription factors, were first identified in screens for master regulators of oligodendrocyte development. OLIG1 is important for differentiation of oligodendrocyte precursors into myelin- forming oligodendrocytes during development and is thought to play a crucial role in remyelination during multiple sclerosis. However, itisstillunclearhowOLIG1interactswithitstranscriptionalcofactorsandDNAtargets.OLIG1wasreportedlyrestrictedtomammals,but we demonstrate here that zebrafish and other teleosts also possess an OLIG1 homolog. In zebrafish, as in mammals, Olig1 is expressed in the oligodendrocyte lineage. Olig1 associates physically with another myelin-associated transcription factor, Sox10, and the Olig1/Sox10 complex activates mbp (myelin basic protein) transcription via conserved DNA sequence motifs in the mbp promoter region. In contrast, Olig2 does not bind to Sox10 in zebrafish, although both OLIG1 and OLIG2 bind SOX10 in mouse. Key words: Olig1; Olig2; Sox10; Mbp; oligodendrocyte; myelin; zebrafish; mouse; evolution; development Introduction directly regulates Mbp transcription (Stolt et al., 2002), and over- Myelin, the multilayered glial sheath around axons, is one of the expression of SOX10 alone is sufficient to induce myelin gene defining features of jawed vertebrates (gnathostomes). It is expression in embryonic chick spinal cord (Liu et al., 2007).
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Onc2010217.Pdf
    Oncogene (2010) 29, 4671–4681 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 www.nature.com/onc ORIGINAL ARTICLE DEK oncoprotein regulates transcriptional modifiers and sustains tumor initiation activity in high-grade neuroendocrine carcinoma of the lung T Shibata1,2, A Kokubu1, M Miyamoto1, F Hosoda1, M Gotoh2, K Tsuta3, H Asamura4, Y Matsuno5, T Kondo6, I Imoto7,8, J Inazawa7,8 and S Hirohashi1,2 1Cancer Genomics Project, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan; 2Pathology Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan; 3Clinical Laboratory Division, National Cancer Center Hospital, Chuo-ku, Tokyo, Japan; 4Division of Thoracic Surgery, National Cancer Center Hospital, Chuo-ku, Tokyo, Japan; 5Department of Surgical Pathology, Hokkaido University Hospital, Sapporo, Hokkaido, Japan; 6Proteome Bioinfomatics Project, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan; 7Department of Molecular Cytogenetics, Medical Research Institute and Graduate School of Biomedical Science, Tokyo Medical and Dental University, Tokyo, Japan and 8Center of Excellence Program for Frontier Research on Molecular Destruction and Reconstitution of Tooth and Bone, Tokyo Medical and Dental University, Tokyo, Japan Lung cancer shows diverse histological subtypes. Large- Introduction cell neuroendocrine cell carcinoma and small-cell lung carcinoma show similar histological features and clinical Lung cancer is one of the most prevalent cancers behaviors, and can be classified as high-grade neuro- worldwide, and shows diverse histological subtypes, endocrine carcinoma (HGNEC) of the lung. Here we including adenocarcinoma, squamous cell carcinoma, elucidated the molecular classification of pulmonary large-cell carcinoma, large-cell neuroendocrine carcino- endocrine tumors by copy-number profiling. We compared ma (LCNEC) and small-cell lung carcinoma (SCLC; alterations of copy number with the clinical outcome of Travis and Brambilla, 2004).
    [Show full text]
  • SYMPOSIUM References 1
    J Orthopaed Traumatol (2008): 24 November 2008 DOI 10.1007/s10195-008-0030-6 24 NOVEMBER 2008 SYMPOSIUM References 1. Pola E, Lattanzi W, Pecorini G, Logroscino CA, Robbins PD (2005) Gene therapy for in vivo bone formation: recent TISSUE ENGINEERING advances. Eur Rev Med Pharmacol Sci 9(3):167–174 2. Pola E, Gao W, Zhou Y, Pola R, Lattanzi W, Sfeir C, et al (2004) A CLINICALLY RELEVANT GENE THERAPY APPROACH Efficient bone formation by gene transfer of human LIM miner- TO INDUCE OSTEOGENESIS: STUDY OF THE NEW alization protein-3. Gene Ther 11(8):683 –693 GROWTH FACTOR LIM MINERALIZAZION PROTEIN-3 3. Lattanzi W, Parrilla C, Fetoni A, Logroscino G, Straface G, Pecorini G, Tampieri A, Bedini R, Pecci R, Michetti F, E. Pola Gambotto A, Robbins PD, Pola E (2008) Ex-vivo transduced autologous skin fibroblasts expressing human Lim Minera - Department of Orthopaedics and Traumatology, Università lization Protein-3 efficiently form new bone in animal models. Cattolica del Sacro Cuore, School of Medicine (Rome-IT) Gene Therapy [Epub ahead of print] Recombinant proteins, such as the bone morphogenetic proteins have been used to enhance repair of non-union fractures and facil- TYPE-I COLLAGEN MEMBRANE AS A SCAFFOLD FOR itate new bone formation in animal models as well as in clinical TENDON REPAIR: AN IN VITRO AND IN VIVO STUDY applications. However, a significant amount of recombinant BMP is required to promote osteogenesis and frequently the extent of A. Gigante, E. Cesari, A. Busilacchi, S. Manzotti, F. Greco new bone formation is low. In contrast, local gene transfer of BMPs has been shown to be more efficient in promoting osteogenesis in Department of Orthopaedics, Polytechnic University of Marche rodents than the use of recombinant proteins.
    [Show full text]