NIPB Annual Report 2019.Pdf

Annual Report

2019

ICAR-National Institute for Plant Biotechnology Lal Bahadur Shastri Centre, Pusa Campus New Delhi - 110012

Annual Report 2019

ICAR-National Institute for Plant Biotechnology Lal Bahadur Shastri Centre, Pusa Campus New Delhi - 110012

Published by Dr. Sarvjeet Kaur Director (In charge) ICAR-National Institute for Plant Biotechnology Pusa Campus, New Delhi - 110012 Tel.: 25848783, 25841787, 25842789 Fax: 25843984 Website: http://www.nipb.icar.gov.in

Compiled and Edited by Dr. Sarvjeet Kaur Dr. Monika Dalal Dr. Prasanta Dash Dr. Rohini Sreevathsa Dr. Amitha C.R. Mithra S.V. Dr. Navin C. Gupta Dr. Deepak S. Bisht Dr. Nimmy M. S. Dr. Rampal S. Niranjan

Correct Citation Annual Report 2019 ICAR-National Institute for Plant Biotechnology Pusa Campus, New Delhi - 110012

Preface ICAR-NIPB is a premier research institute of ICAR in the field of plant biotechnology with a mandate of undertaking basic plant molecular biology research for understanding molecular mechanisms underlying basic biology processes, development of capabilities of devising tools and techniques of biotechnology and genetic engineering for crop improvement, as also application of the knowledge of genomics for advancing agriculture development. Another significant mandate of the institute is to serve as a national lead center for plant molecular biology and biotechnology research and to create trained manpower in the area of plant biotechnology. The five mandated crops of NIPB are: rice, wheat, mustard, pigeon pea and chick pea. Research on addressing various aspects of crop improvement in these crops such as biotic-abiotic, stress tolerance and quality traits has been carried out in the period under report. The core research activities of our institute include, structural and functional genomics, mapping of QTLs and development of markers, transgenic development, collection/generation and maintenence of germplasm and mutant resources and bioprospecting of genes. The major achievements of the institute for the year 2019 include identification of 1 major QTL for seedling stage and 4 QTLs for reproductive stage salt tolerance in rice. The QTLs for anaerobic germination were identified in a mapping population from IR64/ NKSWR397 as well as though Genome Wide Association Studies in deep-water rice population of Assam. From wild rice collection, novel sources of submergence tolerance and resistance to brown spot pathogen were identified. From rice mutant resource, three stay-green mutants were identified and one of them showed better harvest index than Nagina 22 under drought stress. Based on large scale phenotyping of mutants at hotspots and multi-location testing, three mutants with high level of resistance against leaf and panicle blast were identified. Small RNA, lncRNAs and transcriptome analysis was carried out in rice for different traits such as deep water tolerance, nitrogen use efficiency, panicle blast resistance, sheath blight infection. Transgenic rice overexpressing Os06g10210 and Os04g0690500 were evaluated for abiotic stress tolerance and were found to be tolerant to drought, cold and salinity stress. To improve biological nitrogen fixation, transgenic rice that are able to support the formation of symbiosome compartments in rice roots for harbouring/ sequestering rhizobia and protecting them from plant defence system have been developed. Genome editing constructs for resistance to blast and fungal pathogen Rhizoctonia solani have been developed. For development of wheat varieties resistant to Bipolaris leaf spot, marker assisted backcross breeding is being carried out and QTLs for yellow rust resistance are also being introgressed in the promising leaf spot resistant lines. Three hundred diverse wheat genotypes were phenotyped for component traits of nitrogen use efficiency and genotyped by 35k SNP Breeder’s array. Two orthologs of AtNRT1.5, TaNRT2.1/2.2 and TaNAR2.2/2.2 were cloned and were shown to interact with each other using split-ubiquitin assay. Gene TaNHX1 from salt tolerant genotype Kharchia was validated in wheat. Transient expression analysis of TaPM19 Promoter deletion fragments was carried out in tobacco. Promising stress responsive genes, ZnClpB1 from Z. nummularia and EcDREB2A from finger millet were functionally

iii validated in Nicotiana tabacum. RNA-seq analysis of hexaploid bread wheat and its diploid progenitors during grain development was carried out. ICAR-NIPB participated as a collaborator in the development of a drought-tolerant variety Pusa Chickpea 10216 (BGM 10216) released by IARI. Genome-wide association mapping in a panel of 402 chickpea genotypes for seed protein content led to identification of 23 gene- based SNPs, which exhibited significant phenotypic variance in seed protein content. Based on genome wide analysis of chick pea, seven true homologs of Arabidopsis SOS genes in chickpea were identified. The work on Fusarium wilt in chickpea has been initiated this year in the institute. The full-length mitochondrial genome of the chickpea Fusarium wilt pathogen, Fusarium oxysporum f. sp. ciceris (Foc) was assembled from publicly available whole-genome short reads Illumina data for further analysis of racial diversity of Foc in different agroecological zones of India. Efficacy of a synthetic plant-preferred codon-optimized vip3Aa44 gene was determined towards Helicoverpa armigera (pod borer, cotton bollworm) and Spodoptera litura (cotton leaf worm). To improve the resistance of pigeon pea to pod borer, RNAi strategy of host- delivered-artificial microRNA-mediated targeting of acetylcholinesterase1 (HaAce1) and 20- hydroxy ecdysone receptor (EcR) genes of H. armigera, and the Bt strategy of over expression of a chimeric Bt gene, cry1AcF are being carried out. For robust and durable resistance against insect pest, a binary construct was also developed where both these strategies are being combined. To understand the mechanism of pod borer resistance, wild relatives of pigeon pea are also being analyzed through multiomics approaches. GWAS analysis of a set of 142 pigeon pea genotypes for various yield related traits, especially related to flowering and pod/seeds etc., led to identification of about 20 SNPs. Co-integration of these SNPs with the in-house transcriptome data identified two robust SNPs for days to flowering and fifty per cent flowering across three seasons, which were positioned on a 5 kb unanchored scaffold. This region codes for a novel but uncharacterized protein. A set of 100 pigeon pea genotypes were screened for various seed quality parameters including protein, iron and zinc content and contrasting genotypes for these parameters were identified. To confer aphid resistance in Indian mustard, transgenic plants using either RNAi or protease inhibitors and plant lectins over-expression-based strategies, have been developed. Cystatin from pigeon pea genome has been found to cause ~72 per cent mortality of Aphids. For deriving trait associated molecular markers, potential genomic regions and differentially expressed genes in alien introgression based Alternaria resistant lines in Indian mustard have been identified. Arabidopsis transgenic over-expressing WRKY33 gene have been developed for analysis of Alternaria resistance. Based on pathotyping of 10 isolates of Albugo candida, cv. GSL-1 of B. napus and EC206642, an accession of B. carinata, were found to be immune to all the ten isolates. A non-injury method of disease inoculation has been standardized for screening against Sclerotinia stem rot infection in B. juncea. Based on screening three tolerant genotypes, RH1222-28 of B. juncea, B. nap114 of B. napus and Bcar115 of B. carinata were identified. The whole-genome sequencing of an Indian isolate ‘ESR-01’ of S. sclerotiorum was completed. Constructs for genome editing of Cytokinin oxidase/dehydrogenase (CKX) were developed. Protoplast isolation and transformation technique in B. juncea has been standardized. An efficient regeneration protocol for B. oleracea var. botrytis cv. Pusa

Meghna has been developed using hypocotyls as explants. Stability analysis of resynthesized B. juncea lines (RBJ 1 to RBJ-92) was carried out. Genome size of wild mustard species was estimated through flow cytometry. Genome size of Orobanchea egyptica, a total root parasite of Brassica was also was estimated and found to be around 3900 Mbp, which is much larger than its host. Apart from the above significant research achievements, ICAR-NIPB is also actively involved in organizing various events for the benefit of farmers. Twenty-nine Kisan Goshthis and 330 demonstrations were conducted in the six adopted villages of Utter Pradesh under the flagship Mera Gaon Mera Gaurav (MGMG) initiative of Government of India during the year. Several trainings for farmers were held and seeds of superior varieties of rice, mustard, pigeon pea and wheat were distributed to farmers under Scheduled Caste Sub-Plan (SCSP) program. The institute also showcased its products and activities in the Kisan mela organized by ICAR-IARI. Human resource development in the area of plant biotechnology is one of the mandates of our institute. Institute undertakes postgraduate teaching in the Molecular Biology and Biotechnology discipline of ICAR-IARI. Currently 28 Ph.D. and 17 M.Sc. students are registered in this discipline in our institute. In the period under report, seven Ph.D. and five M.Sc. students were awarded degrees by ICAR-IARI. The training programs conducted for students and scientific and teaching faculty of the NARS system under NAHEP-CAAST and CAFT program of ICAR are also an integral part of the HRD activities undertaken by the institute. I would like to extend my sincere thanks to all scientific, technical and administrative staff, students, research fellows and contractual supporting staff of NIPB for their contributions in various institute activities including Hindi Chetna Maas and Swacchh Bharat Abhiyan. Special thanks are due to Dr. Monika Dalal, Dr. Amitha Mithra Sevanthi, Dr. Prasanta Dash, Dr. Rohini Sreevatsa, Dr. Navin C. Gupta, Dr. Deepak Bisht, Dr. M.S. Nimmy and Dr. R.S. Niranjan, for their help in compilation of this report. I would also like to extend my sincere thanks to Prof N K Singh (National Professor, B. P. Pal Chair, ICAR-IARI), for his vision and leadership as Director (Acting), ICAR-NIPB during the period under report. I am grateful to Hon’ble Secretary DARE and Director General, ICAR, Dr. T. Mohapatra, Dr. A. K. Singh (Ex Deputy Director General (Crop Sciences), Dr. T. R. Sharma (Deputy Director General (Crop Sciences) and Dr. D.K. Yadav, Assistant Director General (Seeds), ICAR, for their constant guidance and support in overall functioning of the institute.

Date: 4th November 2020 (Sarvjeet Kaur)

Contents

Preface iii Executive Summary viii

About the Centre ICAR-NIPB xviii

Research Achievements Search and Deployment of Genes for Stress Tolerance and Grain Quality in Rice 1 Genetic Improvement of Wheat for Climate Change Induced Stresses 40 Improvement of Stress Tolerance and Quality Traits in Chickpea 64 Stress Tolerance and Quality Improvement in Pigeonpea 76 Biotechnological Approaches for Brassica Improvement 85

Human Resource Development Post-graduate Teaching Programme 124 Training and Capacity Building 127

Extension and Outreach 129

Other Institutional Activities Institutional Projects 134 Externally Funded Projects 135 Technology Commercialization and IPR 138 Awards and Honours 139 Visits Abroad 140 Recruitments/Promotions/Retirments 141 Other Activities 142 Participation in Conference/Seminar/Symposium/Workshop 145 List of Publications 148 Important Committees 160

Executive Summary

vii

Executive Summary ICAR-NIPB is a premier research institution of ICAR, committed to applications of biotechnology tools and techniques for crop improvement, especially of rice, wheat, pigeon pea, chickpea and Brassica. The institute also undertakes teaching and training in the area of plant molecular biology and biotechnology. Extension and outreach activities of the institute are carried out under Mera Gaon Mera Gaurav and Scheduled Castes Sub Plan programmes. The salient achievements of the institute during the year 2019 are summarized below.

Wild rice collections and EMS induced mutants of Nagina 22 are the major genetic resources of the institute. From wild rice collections, novel sources of submergence tolerance other than the Sub1A gene were identified by targeted gene sequencing of five candidate genes including Sub1A. A wild rice accessions showing promising resistance to Brown spot pathogen was also identified. QTLs for anaerobic germination and coleoptile elongation under submergence were mapped in F2:3 mapping population derived from a cross between IR64/ NKSWR397. Further, four QTLs for reproductive stage salt tolerance, contributed by a wild rice accession, NKSWR173, leading to higher grain yield under salt stress, were identified on rice chromosome 2, 8 and 11. From the mutant resource, three stay-green mutants showing delayed senescence were identified and these were also tested under drought stress under field conditions. One of them showed better harvest index than Nagina 22 under drought. By combining large scale phenotyping at hotspot locations and multi- location testing of the mutants at three different locations, three mutants showing promising level of resistance against leaf and panicle blast have been identified.

A major QTL conferring seedling stage salinity tolerance has been identified in RILs derived from a cross between traditional aromatic short grain rice landrace Kolajoha and mega variety Ranjit on chromosome 1. One differentially methylated region was found to be colocalized within the QTL intervals determined on Chromosome 2 in this population which indicates their potential role in epigenetic modifications in improving salinity stress tolerance in rice. An Anaerobic germination tolerance QTL has been identified through genome wide association studies in deep-water rice population of Assam. Two robust candidate genes were identified from this analysis, namely an expressed SSXT family protein (LOC_Os12g31350) and a gene involved in purine catabolism encoding for xanthine dehydrogenase1 (LOC_Os03g31550). Further, two mapping populations segregating for sheath blight resistance has been developed in the previous year.

viii

Small RNA and transcriptome analysis of upper most internode of deep-water rice revealed 31 known and 24 novel miRNAs which were differentially expressed upon deep water stress treatment. In another experiment, 7622 lncRNAs were identified from uppermost internode transcriptome libraries. For 76 lncRNAs, endogenous target mimics (eTM) with 35 miRNAs were also identified. Co-expression network analysis of 6657 candidate genes responsive to drought, heat and salinity stresses in rice, (identified from meta-analysis of microarray data available in the public domain or databases) revealed a total of 20 modules with the top 10 modules having a total of 239 genes. Of these, 10 genes were found to be common to all the three stresses. Based on the centrality properties and highly dense interactions five more intra-modular hub genes were identified. All the 15 candidate genes showed upregulation under all stresses and in all the genotypes suggesting that they are indeed important for abiotic stress response. Global transcriptome of root and shoot tissues of rice seedlings of two rice genotypes, i.e., Nagina 22, a drought tolerant, tall and non N responsive upland variety and IR64, a semi-dwarf, drought sensitive and N-responsive lowland variety was analysed and a large number of candidate genes especially for nitrogen use efficiency were identified in rice.

Host response to compatible and incompatible diazotrophic microbes has been studied in rice vis-a-vis legumes (soybean) and early responsive genes related to infection have been identified. Comparative transcriptome analysis of panicle blast resistance and susceptible lines revealed cell wall modification as the major mechanism underlying blast resistance in rice. A previously uncharacterized protein LRK10 like gene encoding serine/threonine protein kinase has been identified to play an important role in imparting resistance to blast disease from transcriptome studies. Differentially expressed miRNA during sheath blight infection in rice plant at different time intervals post infection have been identified.

Transgenic rice overexpressing putative drought responsive genes, Os06g10210 and Os04g0690500, were developed and evaluated for physiological parameters related to several abiotic stresses and were found to be promising under water, cold and salinity stress but not heat stress. To improve biological nitrogen fixation for augmenting nitrogen needs in rice, transgenic rice that is able to support the formation of symbiosome compartments in rice roots for harbouring/ sequestering rhizobia and protecting them from plant defence system has been developed.

Genome editing construct for editing miRNA binding site in SPL4 (SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 14) has been designed. CRISPR constructs has

ix been designed to target multiple negative regulators of blast resistance in rice. Genome editing constructs and HD RNAi constructs to target the host susceptibility factors supposedly involved in making plant vulnerable to attack of fungal pathogen Rhizoctonia solani have also been developed. Transformation of rice using these constructs is underway.

Identification and isolation of gene for heat stress tolerance in the plants surviving well under extreme environmental conditions forms the foundation for development of thermotolerant transgenic crops. Ziziphus nummularia and finger millet are the crops of arid and semi-arid region, and are expected to be a rich source of genes and alleles for heat stress tolerance. Based on the available transcriptome data and subsequent expression profiling of promising candidate genes, ZnClpB1 from Z. nummularia and EcDREB2A from finger millet were isolated and functionally validated in Nicotiana tabacum. Both the genes were found to be promising in providing enhanced heat tolerance at temperatures as high as 42 °C. Similar strategy of using transcriptome data to identify promising candidate genes and subsequent functional characterization by transgenic approach was followed for mitigating salinity tolerance. In this case, TaNHX1 was isolated from Kharchia Local, a well-known salinity tolerant landrace and transformed in wheat. The transgenic plants showed higher MSI, RWC and chlorophyll content but reduced Na/ K ratio as compared to wild type under salt stress. For functional characterization of PM19, a drought inducible gene from wheat, three 5 promoter deletion constructs were made in binary vector and these were analyzed by transient expression analysis in T. benthamiana leaves and checked by GUS histochemical staining. These constructs will be genetically transformed into tobacco for detailed characterization.

Nitrogen is an essential macronutrient in plant nutrition; however continuous and indiscriminate use of N-fertilizers cause heavy soil, water and air pollution. Hence the institute is focussing on improvement of the uptake and utilization of N in wheat. Morphological and biochemical characterization of more than 300 diverse wheat genotypes for nitrogen use efficiency related parameters including N and C assimilating enzymes was carried out. Further these genotypes were genotyped using 35K SNP Breeder’s array. A preliminary population structure analysis using the SNP genotyping data revealed that the CIMMYT lines were close to the Indian varieties than the landraces. Wide genotypic variability was observed among the diverse wheat genotypes selected from the earlier field screening of a large number of genotypes, in terms of their 15N-influx, per cent N translocation and root system architecture traits, when subjected to different external low to optimum levels of nitrate. Since nitrate transporters are the major uptake related genes, they

x were studied in detail. This analysis revealed that wheat genome has two orthologs of AtNRT1.5, which differentially express at transcript level in two different wheat genotypes at high external nitrate concentration, i.e., 8mM and 12mM. The in vitro protein-protein interaction study indicated that both TaNRT2.1/2.2 and TaNAR2.2/2.2 interact with each other in split-ubiquitin system. RNA-seq analysis of hexaploid bread wheat and its diploid progenitors during grain development identified that the major differentially expressed genes belonged to nutrient reservoir, carbohydrate metabolism and defense proteins. Further, molecular characterization of GS2 and Fd-GOGAT genes were carried out in bread wheat and in its diploid progenitors. Our study confirmed the conserved nature of GS2 and Fd- GOGAT enzymes, but their expression and subsequent effects were distinct in the cultivated wheat from their progenitors.

For biotic stress tolerance in wheat, the institute is working on the development of wheat varieties resistant to Bipolaris leaf spot and combining the same with yellow rust resistance through marker assisted backcross breeding. Multi-location trials of the promising backcross derivatives (BC3F2) will be taken up the next Rabi season for Bipolaris leaf spot and these lines have also been crossed with the yellow rust resistance donor and the 15 positive BC1F2 plants identified will be backcrossed with the recurrent parent, HD3402-76 in Rabi 2020.

Helicoverpa armigera (Pod Borer, Cotton Bollworm,) is the major insect pest of chickpea, while Fusarium wilt is the foremost disease infecting this crop. Frequency distribution of vip3A-type genes in a collection of native Bt isolates recovered from diverse soil habitats in India was explored and heterogeneous distribution, ranging from 20% to 100 % in isolates from different soil types was observed. Efficacy of a synthetic plant-preferred codon- optimized vip3Aa44 gene in planta towards H. armigera and Spodoptera litura (Cotton leafworm) was determined. The work on Fusarium wilt has been initiated this year in the institute. The full-length mitochondrial genome of the chickpea Fusarium wilt pathogen, Fusarium oxysporum f. sp. ciceris (Foc) was assembled from publicly available whole-genome short reads Illumina data which would be used as a marker to study the racial diversity of Foc in different agroecological zones of India.

Among the abiotic stresses, drought is the number one constraint in chickpea productivity. In 2019, a drought-tolerant variety, Pusa Chickpea 10216 (BGM 10216), was released by IARI in which ICAR-NIPB was involved as a Collaborator. This is a drought tolerant near isogenic line of the chickpea variety, Pusa 372, introgressed with the QTL hot spot region identified from ICC4958, the donor of drought tolerance. To address the challenge of salinity

xi stress in chickpea, Salt Overly Sensitive (SOS) regulatory pathway is targeted as it is involved in ion homeostasis, which results in Na+ extrusion from the cytosol. Seven homologs of Arabidopsis SOS genes in chickpea were identified, based on the gene structure and their genomic distribution and evolution were studied.

In an effort towards underpinning the genes of importance with respect to seed protein content (SPC), an association panel of 402 chickpea genotypes was constituted. The seed protein content was measured from samples grown at three locations, Delhi, Ludhiana and Kanpur. SNP genotyping by GBS provided 31956 SNP markers with an average of 3994 SNPs per chromosome. Genome-wide association mapping identified 23 gene-based SNPs exhibiting significant association that explained 13-18 % of phenotypic variance in SPC. Transcriptome analysis of chickpea genotypes contrasting for β-carotene content identified 616 significantly differentially expressed genes. Key genes involved in β-carotene biosynthesis in chickpea were further analyzed in contrasting chickpea genotypes viz. HK 94 -134 (Low β carotene) and KWR-108 (High β carotene) content for their possible role in governing the trait variation.

Pigeon pea is another major pulse crop of our country which is mainly challenged by pod borer infestation. The RNAi strategy of host-delivered-artificial microRNA -mediated targeting of acetylcholinesterase1 (HaAce1) and 20-hydroxy ecdysone receptor (EcR) genes of H. armigera, and the Bt strategy of overexpression of a chimeric Bt gene, cry1AcF, were combined and a binary vector cassette harbouring both the gene constructs was developed for robust and durable resistance against this polyphagous insect pest. Further, wild relatives of pigeon pea are being exploited to understand the mechanism of pod borer resistance. Towards this, deliberate challenging of plants with pod borer followed by multiomics approaches are being used to identify genes responsible for insect resistance. These putative insect resistance genes can form novel alternatives for the management of pod borer in pigeon pea as well as other commercially important crops.

A comprehensive phenotypic data was collected and analyzed on a set of 142 pigeon pea genotypes for various yield related traits with main emphasis on days to flowering, flower structure, seed/pod, photoperiod based flowering, cleistogamy etc., for third consecutive year. GWAS analysis by use of 7 statistical models could narrow down about 20 SNPs for these traits consistently across three seasons. Co-integration of these SNPs with the in-house transcriptome data identified two robust SNPs for days to flowering and fifty % flowering across all seasons which were positioned on a 5 kb unanchored scaffold. This region codes

xii for a novel but uncharacterized protein. A set of 100 pigeon pea genotypes were screened for various seed quality parameters including protein, iron and zinc content. Comprehensive analysis revealed protein content varying between 2 to 33 %. Similarly, Fe content varied between 12 to 740 and Zn between 12 to 152 µg/g. These genotypes were selected and are being used to create appropriate mapping populations.

Indian mustard, an important oilseed crop of the country faces serious challenges from biotic factors including aphids, Alternaria blight, white rust and Scelrotinia stem rot. At ICAR- NIPB, several biotechnological approaches are being followed to find solutions to manage these diseases. Transgenic lines in Indian mustard have been developed and analyzed for host delivered RNAi-mediated resistance against aphid. Based on gene expression and transcriptome data, STP4 promoter has been identified as an aphid responsive promoter. Alternate strategies such as identification and use of potential protease inhibitors (PI) and lectins of plant origin are also being explored to control aphids. Cystatin from pigeon pea genome has been found to cause ~72% mortality of aphids. This gene can be deployed along with lectin gene reported earlier, either by crossing the two transgenic lines having these genes or by transformation methods for better results.

Alternaria causing Alternaria blight is an important pathogen of Brassica juncea and leads to a great yield loss of this crop. Potential genomic regions and differentially expressed genes in alien introgression based Alternaria resistant lines in Indian mustard have been identified for a deriving trait associated molecular markers. WRKY33 gene, known to negatively regulate SA pathway and positively regulate JA pathway and impart resistance towards the necrotrophic pathogens such as A. brassicicola and B. cinerea was cloned from Camelina sativa (CsWRKY33) in binary vector pRI101AN and used for transforming Arabidopsis Col-

0 and wrky33-mutant plants and the T1 plants are being studied for their resistance to Alternaria infection. MALDI-TOF analysis identified 40 differentially induced proteins (DEPs) in Alternaria infected samples from B. juncea, S. alba, and C. sativa of which 25 could be assigned with known function while 15 were hypothetical or unannotated.

Pathotyping using 10 isolates of Albugo candida in 35 major released cultivars of Brassica juncea, wild relatives and resynthesized lines of Brassica juncea, revealed that none of the B. juncea cultivars and B. tournefortii were resistant against all the ten tested isolates of the pathogen. A cultivar, GSL-1 of B. napus and EC206642, an accession of B. carinata, were found to be immune to all the ten isolates. A resynthesized line RBJ18 showed complete resistance against five isolates while ERJ-40, an introgressed line was immune against eight

xiii isolates of the pathogen. Further, B. fruticulosa, Camelina sativa, Diplotaxis assurgens, D. catholica, D. cretacia, D. erucoides, D. muralis, D. siettiana, D. tenuisilique, D. viminea, Erucastrum lyratus, E. abyssinicum, E. canariense, E. cardaminoides, five accessions of Crambe abyssinica and four accessions of Eruca sativa were found immune to six of the isolates. Under natural field screening 5 accessions of B. juncea, 3 of B. carinata, 5 ILs and 4 RBJ lines were found to be resistant against the white rust pathogen.

A non-injury method of disease inoculation has been standardized for screening against Sclerotinia stem rot infection in B. juncea. This method showed consistency in the results of inoculation severity index and disease severity index over two consecutive years at two different locations. From the screening experiments, a tolerant line RH1222-28 of B. juncea, resistant lines B. nap114 of B. napus and Bcar115 of B. Carinata were identified. These lines are being used to develop mapping populations which are in F3 and BC2F1 generation so as to map the causal genes. The whole-genome sequencing of an Indian isolate ‘ESR-01’ of S. sclerotiorum revealed that its genome is ~41 Mb in size and harbours ~9469 protein-coding genes amongst which 57 are novel ones. The genome-wide secretome analysis and effector identification revealed that from the 554 predicted secreted proteins, 369 had the experimental evidence for in planta expression. Further effector prediction with the developed pipeline led to the identification of the 57 effector candidates of which 30 were found to be novel.

The Cytokinin oxidase/dehydrogenase (CKX) has been targeted for editing through CRISPR/Cas9 in B. juncea for which three different sgRNA from the first and third exons of the cloned CKX3 gene sequence has been developed. Two of the sgRNA were cloned into a dual guide acceptor vector and three constructs were developed with two guide RNA in all possible combinations. Further, three different sgRNAs were designed to knockout the CENH3 gene and editing efficiency of these three sgRNA were checked through in-vitro cleavage assay. Protoplast isolation and transformation technique in B. juncea has been standardized and tested. An efficient regeneration protocol for B. oleracea var. botrytis cv. Pusa Meghna has been developed using hypocotyls as explants.

Resynthesised B. juncea lines (RBJ 1 to RBJ-92) are in S6 generations and were subjected to stability analysis. For synthetic amphidiploid development using wild species and B. rapa, seven cross combinations were identified as amphidiploids during Rabi season 2019. These will work as intermediate species and help to transfer the gene(s) from wild species to Brassica juncea.

xiv

Genome sizes of some wild mustard species were estimated through flow cytometry. Genome size of Orobanche aegyptica, a total root parasite of Brassica was also estimated and found to be around 3900 Mbp which is much larger than its host.

ICAR-NIPB organizes extension and outreach activities through two major initiatives of government of India namely Mera Gaon Mera Gaurav (MGMG) and Scheduled Castes Sub Plan (SCSP). Institute also showcases its products and activities in Kisan mela organized by ICAR-IARI. This year, 29 Kisan Gosthis and 330 demonstrations were conducted in the adopted villages of Utter Pradesh under MGMG. Under SCSP program, several trainings were conducted and seeds of varieties of rice, mustard, pigeon pea and wheat were distributed.

Human resource development in the area of plant molecular biology and biotechnology is an important activity of our institute. In this regard, currently 28 Ph.D. and 17 M.Sc. students are registered in the discipline of Molecular Biology and Biotechnology at the Centre through its postgraduate teaching activity along with ICAR-IARI. In the reporting year, seven Ph.D. and five M.Sc. students were awarded degrees. The training programs conducted for students and scientific and teaching faculty of the NARS system under NAHEP-CAAST and CAFT program of ICAR also are an integral part of the HRD activity taken up by the institute.

About the Centre

 NIPB and the Mandate  Staff Position  Financial Statement  Resource Generation  Personnel

xvi

xvii

ICAR-NIPB

National Institute for Plant Biotechnology (NIPB) is the premiere research institution of the Indian Council of Agricultural research (ICAR), engaged in molecular biology and biotechnology research. The Biotechnology Centre, established in 1985, as part of the Indian Agricultural Research Institute (IARI), was upgraded to a National Research Centre on Plant Biotechnology in the year 1993, with a vision to impart the biotechnology advantage to the National Agricultural Research System (NARS). This year in February 2019, NRCPB was elevated to the level of National Institute for Plant Biotechnology (ICAR-NIPB). This brings us much greater national responsibility to conduct basic and applied research, and human resource development in plant biotechnology. NIPB has acquired an excellent infrastructure in terms of equipment and other physical facilities and also a high degree of scientific competence. Development of transgenic crops for biotic and abiotic stress management, exploitation of heterosis through marker and genomic approaches, marker assisted selection and molecular breeding of major crops for productivity and quality enhancement, search for novel genes and promoters for efficient native and transgene expression are the major activities taken up by the centre. There is now considerable emphasis on structural and functional genomics of crop species such as rice, wheat, chickpea, pigeonpea, and mustard in the centre. In addition to research, the centre is contributing significantly to competent human resource development by way of offering regular M.Sc. and Ph.D. programmes by partnering with PG School, IARI.

Mandate

 Basic plant molecular biology research for understanding molecular basis of biological processes

 Coordination and capacity building for devising tools and techniques of biotechnology and genetic engineering for crop improvement

xviii

Staff Strength of the Centre Staff Sanctioned Filled Vacant Scientific 33+1 31 2+1 Technical 14 09 05 Administrative 18 13 05 Skilled Supporting Staff 02 - 02 Total Strength 68 52 16

Financial Statement 2019-20 (Rs. In lacs) Institute Grant Allocation Utilization Capital 199.89 184.22 Revenue Establishment 965.00 964.93 Pension & other retirement benefits 163.00 162.66 Travelling Allowances 6.40 6.40 Research and Operational Expenses 238.49 238.48 Administrative Expenses 330.70 330.69 Miscellaneous Expenses 2.41 2.40 Total 1905.89 1889.78

Network projects on transgenic crops (NPTC) Allocation Utilization Capital 30.05 28.45 Travelling Allowances 10.26 9.44 Research and Operational Expenses 384.74 384.74 Total 425.05 422.63

Resource Generation Sales of Farm Produce 0.00 License Fee 0.12 Leave Salary and Pension Contribution 11.04 Interest Earned on Short Term Deposits 29.92 Income Generated from Internal Resource Generation (Trg. 8.41 etc) Miscellaneous Receipts 19.19 Total 68.68

Fund Received through Externally Funded Projects Externally Funded Projects 789.64 Consultancy Projects 0.00 Total 789.64

xix

Scientific Staff

National Professor B. P. Pal Chair and Director (Incharge)

Dr. Nagendra Kumar Singh

Principal Scientist Senior Scientist Scientist (S. S.)

Dr. Sarvjeet Kaur Dr. Subodh Kumar Sinha Dr. S.V.Amitha Charu Rama Dr. Anita Grover Dr. Rohini Sreevathsa Mithra Dr. Rekha Kansal Dr. Amolkumar U. Solanke Dr. Sanjay Singh Dr. Navin Chandra Gupta Dr. Jasdeep Chatrath Padaria Scientist Dr. Ram Charan Bhattacharya Dr. Debasis Pattanayak Dr. Ramavatar Nagar Dr. Pranab Kumar Mandal Dr. Amritham Dinabandhu Dr. Pradeep Kumar Jain Dr. Mahesh Rao Dr. Kishor Gaikwad Dr. Nimmy M.S. Dr. Sharmistha Barthakur Dr. Anshul Watts Dr. Kanika Dr. Deepak Singh Bisht Dr. Monika Dalal Dr. Sandhya Dr. Tapan Kumar Mondal Dr. Ashish Kumar Dr. Prasanta Kumar Dash Dr. Rhitu Rai Dr. Vandana Rai

Technical Staff

Chief Technical Officer Technical Officer Technical Assistant Smt. Sandhya Rawat Dr. Rampal Singh Niranjan Mr. Deepak Kumar Rathore Smt. Seema Dargan Ms. Rita Dr. Rohit Chamola Ms. Megha Dr. Pankaj Kumar Mr. Anshul Kumar Varma

Administrative Staff

Finance & Account Officer Assistant Administration Personal Secretary Officer Sh. Suresh Kumar Sharma Sh. Krishan Dutt Sh. Anoj Kumar Jain Assistant Upper Division Clerk Lower Division Clerk Smt. Sangeeta Jain Smt. Rekha Chauhan Sh. Rajesh Kumar Pal Sh. Vipin Kumar Sh. Kunal Maan Sh. Mohit Sikka Smt. Priyanka Nair Ms. Nidhi Nailwal Mr. Mitravesh Choudhari Sh. Sudarshan Kumar Jha

Research Achievements

1. Search and Deployment of Genes for Stress Tolerance and Grain Quality in Rice 2. Genetic Improvement of Wheat for Adaptation to Climate Change Induced Stresses 3. Improvement of Stress Tolerance and Quality Traits in Chickpea 4. Stress Tolerance and Quality Improvement in Pigeonpea 5. Biotechnological Approaches for Brassica Improvement

xxi

ICAR-NIPB ANNUAL REPORT 2019

1. Search and Deployment of Genes for Stress Tolerance and Grain Quality in Rice

ICAR-NIPB ANNUAL REPORT 2019

1. Search and Deployment of Genes for Stress Tolerance and Grain Quality in Rice

A. Allele mining for agronomically important genes in wild rice germplasm and stress tolerant landraces of rice growing in the hot spots (Balwant Singh, Kabita Tripathi, Vandna Rai, Deepak Singh Bisht, Nagendra Kumar Singh)

Rice is a food crop of global importance, cultivated in diverse agro-climatic zones of the world. However, in the process of domestication many beneficial alleles have been eroded from the gene pool of the cultivated rice across the globe and eventually has made it vulnerable to a plethora of stresses. In contrast, the wild relatives of rice, despite being agronomically inferior, still harbour the potential for surviving in a range of geographical habitats. These adaptations enrich them with novel traits that upon introgression to modern cultivated varieties can offer tremendous benefits in terms increasing yield and adaptability. We at NIPB have so far collected 740 wild rice germplasm from diverse agro climatic zones of India, and a subset of which were maintained during Kharif 2019 in the IARI farm (Fig. 1.1 and Fig. 1.2).

Fig. 1.1: Wild rice collection from different agro-climatic zones of India

ICAR-NIPB ANNUAL REPORT 2019

Fig. 1.2: Evaluation and multiplication of wild rice accessions at IARI, New Delhi

Two hundred and fifty accessions with adequate number of seeds, passport data and supporting publications have been submitted to NBPGR for storage in the National Gene Bank. Salient achievements during 2019 are as follows: A total of 288 wild rice accessions were evaluated for flooding tolerance by complete submergence of 30 days old plants in submergence ponds for a period of 18 days (Fig. 1.3). From this evaluation, 18 and 35 lines were found to be highly tolerant and moderately tolerant while 235 were highly sensitive. Further, among the 441 wild rice accessions evaluated for their ability for anaerobic germination under 15 cm water depth, four showed 100 per cent germination, 61 accessions showed more than 75% germination and remaining were sensitive to water logging during germination. The quantitative trait loci (QTLs) responsible for this trait are being mapped using genome wide association analysis (GWAS) and bi-parental mapping approach.

GWAS was performed for anaerobic germination and vegetative stage submergence tolerance in 220 and 174 wild rice accessions, respectively. A compressed mixed liner model (MLM) approach revealed 20 SNPs significantly associated with anaerobic germination having P values <9.97 x10-4 with their per cent variation explained (PVE) ranging from 2.8% to 5.6%. Further, 10 SNPs were significantly associated with submergence tolerance with P values of <9.5747 x10-4 and PVE ranging from 7.6% to 11.6%. Four bi-parental crosses involving highly tolerant wild rice accessions were made for mapping of QTLs for anaerobic germination and all the populations were advanced to BC1F2 generation. Out of four crosses, one was selected for QTL mapping and introgression of the trait into rice cultivars. From BC1F2 of PB1509/NKSWR70, two tolerant progenies were selected for further backcrossing to produce 353 BC2F1seeds. A major QTL for anaerobic germination contributed by wild rice accession NKSWR70 was mapped on chromosome 7 using 95 segregating families (Table 1.1).

ICAR-NIPB ANNUAL REPORT 2019

Fig. 1.3: Screening for anaerobic germination and submergence stress tolerance

Another F2:3 mapping population from cross IR64/NKSWR397 comprising of 300 families was developed and a major QTL for anaerobic germination and coleoptile elongation under water was mapped on rice chromosome 6 using a random set of 92 families (Fig. 1.4).

Table 1.1: Mapped QTLs for Anaerobic Germination Using Pusa Basmati 1509/ NKSWR 397 Chromosome Position (cM) LOD Interval Additive effect PVE (%) qAG3.1 221.21 4.47 212.4-229.7 1.8432 12 qAG7.1 35.41 4.47 31.1-38.0 -2.7626 15 qAG7.2 45.11 9.11 43.9-46.4 -4.4046 28 qAG7.3 50.51 7.211 49.4-51.5 -5.3448 23 qAG7..4 74.41 3.29 70.5-77.9 2.481 9

20 18 16 14

IR 64

NKSWR 397 y

n 10

e u

q 8

e r F 6 4 2

0 10 20 30 40 50 60 70 80 90 100 Anaerobic Survival Percentage

Fig. 1.4: Frequency distribution plot for anaerobic germination

ICAR-NIPB ANNUAL REPORT 2019

Chloroplast genome based Oryza species specific SSR, InDels and SNP markers has been identified (Fig. 1.5). Total 15 InDel markers has been validated in PAGE and 399 SNP markers differentiating 22 Oryza species has been identified and a SNP chip has been designed.

Fig. 1.5: Phylogenetic Analysis of Chloroplast Genome Sequences of 22 Oryza Species

Two hundred and fifteen land races of rice collected from different parts of India were evaluated for submergence tolerance and novel sources of submergence tolerance other than the Sub1A gene were identified through allele mining by re-sequencing of the five target genes namely, Sub1A, Sub1B, Sub1C, Snorkel1 and Snorkel2 (Fig. 1.6).

Fig. 1.6: 3-D plot of association using TASSEL software between survival rates from submergence tolerance screening data, cultivar sub-population and SNP haplotypes of the (a) SUB1A (b) SUB1B and (c) SUB1C

ICAR-NIPB ANNUAL REPORT 2019

B. Genetic and Molecular approaches for understanding and developing mitigating strategies for abiotic stress tolerance in rice A twenty-first century challenge is the production of sufficient food to meet population demands despite reductions in the quantity and quality of arable land and water and increasingly variable weather patterns that are associated with climate change. Integrated climate change and crop production models project declines in the yields of major crops such as corn, wheat and rice with serious ramifications on global food production in this century. At ICAR-NIPB our research objectives are primarily focused on four major stressors including salinity, drought and heat, anaerobic germination and low light response that are known to inflict serious production consequences on the rice crop.

Salinity Stress tolerance in rice Rice cultivation is continuously threatened by several biotic and abiotic stresses. Amongst the variety of stresses impacting rice cultivation, soil salinity is the major abiotic stress limiting rice production in Asia and Africa where 91% of the global rice produced are sensitive to salt stress with the exception of a few traditional indica rice genotypes like ‘Pokkali’, ‘Nona Bokra’ and ‘Kalarata’. Thus, to strike a balance between demand and supply of rice and to enhance productivity in salinity prone areas, it is important to develop rice varieties tolerant to salinity stress. Several QTL mapping studies for salinity tolerance have been reported. However, QTLs and markers flanking QTLs for salinity tolerance are not being utilized in breeding programs. The main reason for this is attributed to the large chromosome intervals delimited by those QTLs. Thus, identification of candidate genes and understanding of salinity tolerance mechanism still remain a challenge. The identification of markers linked to genes contributing to salinity tolerance during reproductive stage provides opportunities to breed high-yielding rice varieties for salt stress-affected areas.

Identification and mapping of quantitative trait loci (QTL) and epistatic QTL for salinity tolerance at seedling stage in traditional aromatic short grain rice landrace Kolajoha (Oryza sativa L.) of Assam, India The genetic architecture of salt tolerance in rice has been revealed with the help of recent progress in the strategies for QTL mapping. The QTLs for traits related to salt tolerance and their utilization in rice breeding programs are largely confounded due to the unwanted linkage drag associated with the QTL region. Thus, it is strongly desirable to delimit the QTL region to a least possible chromosomal interval minimising any unwanted association. Addressing this, we have evaluated 68 recombinant inbred lines (RILs) derived from a cross between a salinity tolerant parent ‘Kolajoha’ and a salinity sensitive parent ‘Ranjit’ for identification of QTL(s) involved in imparting salinity tolerance at seedling stage (Fig. 1.7).

ICAR-NIPB ANNUAL REPORT 2019

SES = 3 SES = 7

Fig. 1.7. Contrasting response observed between parents after 7 days of salinity.

The parents (Ranjit and Kolajoha) , 68 F6 RILs, FL478 (positive) and IR-29 (negative) check varieties were used for phenotypic evaluation in hydroponics by imposing salinity treatment (100 mM NaCl; 7 days) in two consecutive years i.e. 2018 and 2019 in two different geographical locations i.e. Assam Agricultural University, Jorhat, Assam, India and National Institute for Plant Biotechnology (ICAR-NIPB), New Delhi, India. Plants were evaluated as per Standard evaluation system (SES). Different relevant morphological and physiological traits were scored. Genotyping by sequencing approach (GBS) was followed for SNP identification at genome wide scale. Around 3649 SNPs were identified by GBS method initially at 20% minor allele frequency. After filtering of SNPs with polymorphism with less than 15% of missing data, a total of 1248 SNPs were mapped to 1247 recombination points and the genetic map was constructed with a total map length of 1201.21 cM and resolution of 0.95 cM between markers. For 10 traits, a total of 23 additive QTLs were identified of which only 1 was a major QTL and 22 were minor QTLs. The average QTL interval size is about 2945 kb. Total 1895 genes were identified in the QTL intervals, majority of them are located in Chr1 of rice genome between 22.09 and 38.29 Mb region (Fig. 1.8). Although, this region is not very narrow, some of the genes falling in this region can be utilized for validation of QTLs in future. Epistatic QTL mapping had identified one pair of QTLs that contribute significantly in the phenotypic variation of traits among the RILs (Fig. 1.9).One differentially methylated region was found to be colocalized within the QTL intervals determined in Chr2 which indicates their potential role in epigenetic modifications in improving stress tolerance in rice. Additionally, gene ontology analysis of 909 annotated genes had identified several gene groups some of which are associated with salinity stress responsive signalling pathway.

ICAR-NIPB ANNUAL REPORT 2019 Chr1 Chr2 Chr3 Chr4

0.000 . 5.314 SChr1_24820865 0.000 . 0.000 . 0.000 . 5.377 SChr1_24381322 qRFW1.1 SChr2_35135555 SChr4_18471019 5.963 SChr1_25697125 5.866 6.277 SChr2_35306600 SChr4_18471141 7.314 SChr1_24482579 8.684 8.188 7.723 SChr1_25697005 15.135 SChr4_18470484 8.045 SChr1_25117984 15.136 SChr4_19850864 9.173 SChr1_24165168 9.207 SChr1_25440229 13.819 SChr1_27240775 15.229 SChr1_30068715 39.307 SChr1_32113968 SChr4_19980027 35.777 SChr3_9015912 35.777 39.508 SChr1_33604657 38.502 SChr2_29082259 37.219 SChr4_21099077 39.509 SChr1_32967677 39.479 SChr2_29516491 39.649 SChr4_20565503 48.775 SChr1_33732799 48.786 SChr1_34167203 49.065 SChr3_9735164 48.812 SChr1_34518032 58.798 SChr2_23107827 48.919 SChr1_37014185 58.820 SChr2_23483696 48.955 SChr1_36938157 58.852 SChr2_24168613 64.161 SChr4_24936324 49.102 SChr1_36938148 58.876 SChr2_24555068 64.189 SChr4_25122268 49.197 SChr1_37030153 SChr2_24555367 64.477 SChr4_25031618 53.778 SChr1_35406979 59.177 SChr2_24555381 64.603 SChr4_25031676 53.895 SChr1_35435216 54.029 SChr1_35881082 54.145 SChr1_34485698 qK1.1 qDW1.1 58.797 SChr1_37273148 58.980 SChr1_37578702 59.128 SChr1_37406136 62.836 SChr1_38139763 64.866 SChr1_38292649 64.981 SChr1_38250215 qNa1.1 qK1.2 qNa/K1.1 qDW1.2 64.990 SChr1_38535394 76.126 SChr1_39673292 77.308 SChr1_38959152 77.751 SChr1_38993542 102.458 SChr1_23007381 105.795 SChr1_23151093 112.454 SChr1_22090596 121.927 SChr1_39878827 qDW1.3 qDW1.4

RFW reduction in root fresh weight under salinity K potassium content in leaf under salinity Na sodium content in leaf under salinity Na/K sodium/potassium ratio in leaf under salinity DW whole plant dry weight under salinity

Fig. 1.8: A genetic linkage map of the Chromosome 1 of rice constructed from a F6 RIL mapping population derived from a cross between Ranjit/Kolajoha. The names of the markers are listed at the right and the map distances between them (cM) are shown on the left of the chromosomes. The markers enclosed in boxes indicate the approximate locations of the QTL detected for different traits related to salinity tolerance.

Fig. 1.9: Circular representation of digenic epistatic QTL graphs (ICIM-EPI); (a) reduction of root length under salinity (b) Sodium content in leaf under salinity

Identification and mapping of novel reproductive stage salinity tolerance QTL from wild rice (Balwant Singh, Dhriti Satya, Vandna Rai, Nagendra Kumar Singh)

75 BC1F2 lines developed from cross between IR64 and Indian wild rice accession NKSWR173 were screened for their reproductive stage salt-tolerance at CSSRI, Karnal (Fig. 1.10). The total four salt tolerance parameters were analysed under salt stress including days

ICAR-NIPB ANNUAL REPORT 2019 to 50% flowering (DF), plant height (PH), panicle length (PL), tiller number per plant (TN) and yield per plant. DF and PH showed good normal distribution plot (Fig. 1.11).

Fig. 1.10: Phenotypic evaluation of BC1F2 rice plants (IR64/ NKSWR173) for reproductive stage salinity tolerance

50 50

40 40 families

families 30

30 2

1 F 1 20 20 10

10 BC No.of No. of BC 0 0 84-88 89-93 94-98 99-102 >102 80-85 86-90 91-95 96-100 >100 Plant Height (cm) Days to 50% Flowering

35 30 35 30 25

25 families

2 20 families

F 20

1 2

15 F 1 15 10 10

No. of BC 5 5 0 0 of No. BC 17-18 19-20 21-22 23-24 25-26 27-28 2.0-2.5 2.5-3.0 3.0-3.5 3.5-4.0 4.0-4.5 Panicle length (cm) Tiller no. per Plant

Fig. 1.11: Frequency distribution for different agronomic traits in the BC1F2 rice families of IR64/ NKSWR173

Four QTLs for reproductive stage salt tolerance, contributed by wild rice NKSWR173 leading to higher grain yield under salt stress, were identified on rice chromosome 2, 8 and 11. QTLs for days to flowering (qDF2.1) on chromosome 2, for plant height (qPH8.1) on chromosome 8, for panicle length and yield per plant (qPL11.1, qYP11.1) on chromosome 11

ICAR-NIPB ANNUAL REPORT 2019 were identified (Table 2). Some stress responsive genes like no apical meristem (NAM), plasma memnbrane intrinsic protein (PIP), S-Adenosyl methionine (SAM), P-glycoprotein, NB ARC-domain containing protein, pentatricopeptide, amino acid transporter, pyridoxal phosphate-dependent trans membrane domain containing protein, sodium sulphate transporter, potassium uptake protein, zinc finger C2H2 transcription factors, aminopeptidase, Rubredoxin 1, drought responsive protein, chalcone and stilbene synthesis, Car-D transcription regulator and amino transferases were found within those four QTLs region. The seeds of tolerant BC1F2 were planted to perform backcrosses and 6 successful backcrosses were also generated.

Table 1.2: Quantitative trait loci (QTLs) associated with the traits: PL (Panicle Length), PH (Plant Height), DF (Days to fifty percent Flowering), yield (gm/plant; YP) and mapped on the linkage map of rice (IR64 X NKS173) A negative value indicates that given trait is derived from IR64 and a positive number indicates that the trait is derived from NKS173. QTL QTL Chr. CI Marker LOD Additive R2 Trait Position Marker Name No. (cM) Interval Score effect (%) (Mbp) SCR200- 180.4 Days to 50 CSCWR- Os02g57650 qDF2.1 2 181.51 - 3.68 31.12 14 % flowering Os02g57690 to SCR100- 183.1 Os02g57830 SCR100- Days to 50 CSCWR- 53.9 Os04g55360 qDF4.1 4 55.58 3.37 -27.25 13 % flowering Os04g55690 -58.2 to CSCWR- Os04g53700 CSCWR- 100.6 CSCWR- Os08g39250 qPH8.1 8 Plant Height 102.86 - 3.39 30.16 15 Os08g39380 to SCR100- 110.8 Os08g40630 SCR200- 40.4 Panicle SCR200- Os11g34150 qPL11.1 11 44.61 - 3.92 33.03 16 Length Os11g32720 to SCR200- 47.4 Os11g32360 SCR100- 32.9 Total Tiller CSCWR- Os02g09710 qTN2.1 2 33.71 - 3.71 30.77 15 number/Plant Os02g09530 to CSCWR- 34.3 Os02g09810 SCR200- 40.4 Yield SCR200- Os11g34150 qYP11.1 11 44.61 - 4.74 -39.98 22 (g)/Plant Os11g32720 to SCR200- 47.4 Os11g32360

Genetic improvement of deep-water rice (Bao) of Assam (Megha Rohilla, Tapan Kumar Mandal) Wide implementation of direct-seeded rice cultivation has been hampered by poorly levelled fields, poor drainage and heavy rainfall which cause accumulation of water in the fields

ICAR-NIPB ANNUAL REPORT 2019 shortly after sowing, leading to poor crop establishment. In flood effected countries of South- East Asia, direct seed sowing method is the most convenient, cost-effective and quite popular practice for rice cultivation. However, a major obstacle in preventing the large-scale acceptance of direct seed sowing method is its poor seed establishment for those areas which are highly prone to flooding. Flooding right after sowing and during germination of the seeds, force the farmers to abandon this tradition. In India, North-Eastern part including Assam is the house for several unique indigenous rice varieties as it possesses very diverse environmental condition for rice cultivation. For instance, it has huge perennial deep-water areas where the farmers have limited options and therefore, they grow traditional deep-water rice genotypes.

Identification of anaerobic germination tolerance QTL through genome wide association studies (GWAS) in deep-water rice population of Assam (Megha Rohilla, Nisha Singh, Abhishek Mazumder, Dhiren Chaudhary, Nagendra Kumar Singh, Tapan Kumar Mondal) In the present study, genetic diversity and population structure of total 94 deepwater rice landraces collected from various parts of Assam were analysed using 50K rice SNP gene chip. We screened these 94 genotypes for anaerobic germination (AG) tolerance at phenotyping facility at National Institute for Plant Biotechnology (NIPB), New Delhi, India and Net house facility, Assam Agricultural University, Jorhat, Assam, India and the experiment was repeated 3 times in a year at both the places with 6 replicates under relative humidity of 64% and temperature in the range of 25 to 35°C. Screening was conducted by direct sowing of 15 seeds per magenta box (14 cm X 6 cm X 6 cm) for each deep-water rice accession at about 1.5 cm of depth in shallow layer of finely ground field soil. Rice cultivar such as Nanhi and Kalongchi were taken as positive check and IR-64 as negative check. Data of phenotypic traits, germination percentage [G% = (number of germinated seeds/total seed number used in the test) × 100], survival percentage [S% = (number of survived seeds/total seed number used in the test) × 100] and anaerobic response index in cm (submerged coleoptile length − control coleoptile length) had been calculated after submergence in 10 cm of water depth for 3 weeks. For GWAS, we used the filtered SNPs detected through Axiom Analysis Suite version 2.0 with incorporation of phenotypic data of AG. We executed MLM in TASSEL v.5.2 where the additional genetic and residual variance components of the random factors were re-estimated for each SNP, it computed the log likelihoods of the null and alternative models and the fixed-effect weight of the SNP with its standard error. We set a p-value < 0.001 threshold to consider a SNP to be significantly associated with the trait variations, in addition q-values were also estimated. The quantile-quantile (Q/Q) plots and Manhattan plots for the AG related traits had been obtained using the STRUCTURE Q matrix are shown in figs. 1.12a, 1.12b (for percent germination), Fig. 1.12c,1.12d (for percent survival) and figs. 1.12e,1.12f (for anaerobic response index). Based on GWAS, we identified a total of 27 SNPs belonging to 20 genes from which 7 SNPs were significantly related to

ICAR-NIPB ANNUAL REPORT 2019 germination percentage, 8 SNPs for survival percentage and 12 SNPs for anaerobic response index. Out of the 20 genes, 6 genes were responsible for germination, 7 for survival and 12 were found to be associated with coleoptile length in 94 deep-water rice genotypes under AG. The obtained significant genes associated with these three AG related traits were indicated in a genetic linkage map (Fig. 1.13). The SNP markers showing a phenotypic variability (R2 = 5-20%) have been considered as minor genes and those explaining a R2>20% have been considered as major genes in this study and remaining SNPs showing less than 5% phenotypic variability were ignored. From our analysis, we found only 2 SNPs which explained phenotypic variation to more than 20% suggesting these 2 SNPs related genes were significantly associated with anaerobic germination related traits. One gene on Chr 12 conferring anaerobic response index explaining a R2=24.1% encodes an expressed SSXT family protein (LOC_Os12g31350). The other gene on Chr 3 associated with anaerobic response index explains a R2=20.2% which encodes an enzyme xanthine dehydrogenase1 (LOC_Os03g31550), involved in purine catabolism. We also evaluated the expression of these two genes among most tolerant and sensitive genotypes from 94 landraces and found that xanthine dehydrogenase1 and SSXT genes were upregulated under submergence among the most tolerant genotypes in comparison to sensitive genotype. Interestingly this gene also has significantly higher level of expression in two of the reference genotypes indicating that those two genotypes are also having similar allele for AG tolerance (Fig. 1.14). Scientifically, the genes detected in the present study increase our understanding of the genetic basis of rice AG tolerance during the germination stage of plant growth. Collectively, our work will facilitate future molecular breeding of rice for improved AG tolerance, which will help to ensure stable high yields in increasingly variable agroclimatic conditions

Fig. 1.12: Genome-wide Manhattan plots and Q/Q plots of association mapping for AG using MLM: a) Q/Q plot for germination percentage, b) Manhattan plot for germination percentage, c) Q/Q plot for survival percentage, d) Manhattan plot for survival percentage, e) Q/Q plot for anaerobic response index, and f) Manhattan Plot for anaerobic response index

ICAR-NIPB ANNUAL REPORT 2019

Fig. 1.13: Molecular genetic linkage map of rice along with positions of SNPs for AG of rice. The names of genes are listed at right and the map distance at left of chromosome. The SNPs enclosed in red boxes indicate genes related to AG in rice and SNPs enclosed in black boxes indicate most significant genes with high phenotypic variability (R2 > 20%)

Fig. 1.14: Normalized fold change (indicated by vertical value) of SSXT and xanthine dehydrogenase1 transcripts as revealed by qRT PCR analysis: the blue color indicates xanthine dehydrogenase1 and red color indicates SSXT genes. Values are the means ± standard errors (n = 3). Different letters above the columns indicate significant difference at p < 0.05

ICAR-NIPB ANNUAL REPORT 2019

Identification of novel noncoding mediated pathways for stem elongation trait of deep- water rice (Alok Kumar Panda, Hukam C Rawal, Nagendra Kumar Singh, Tapan Kumar Mondal) One of the mechanisms for deep water rice (DWR) to sustain under increasing water level is the elongation of stem to survive from deep water flooding. The fast increase in elongation keeps top portion of leaf tip outside the water that allows the rice plants to efficiently respire to exchange the gases. Stem elongation is known to be controlled by genes (Hattori et al. 2007) but there is no report on any non-coding RNA mediated pathway on this. Micro RNAs (miRNAs) are a class of short non coding RNAs that regulate post transcriptional gene expression and play a vital role in almost every biological field. Another non-coding RNA called long non-coding RNAs (lncRNAs) are RNA transcripts that contain more than 200 nucleotides and lack protein coding potential and also play important role in the transcriptional regulation of different biological processes. However, interaction of miRNAs and lncRNAs to control the stem elongation in deep water rice stem elongation has not been studied. In order to identify the miRNAs and lncRNAs in response to stem elongation, we sequenced the uppermost 1st internode (Fig. 10) tissue after 14 days of deep-water stress treatment at six leaf stage in the deep-water tank of NIPB (Fig. 1.15).

From small RNA sequencing data, we identified a total of 337 known and 68 novel miRNAs in DWR control libraries. Similarly, 347 known and 75 novel miRNAs were identified in DWR treated libraries. Among them 31 known and 24 novel miRNAs were differentially expressed. To analyze the biological function of miRNAs, we predicted their target genes using two different algorithms and found 3714 and 2813 targets for differentially expressed known and novel miRNAs respectively. From predicted target genes, a total 20 different types of transcription factors were identified. Further, target genes were in silico validated through degradome and 501 targets were found to be cleaved by miRNAs. Gene ontology and KEGG pathway analysis were performed to know the detail function of target gene and the pathways in which they were involved. On the other hand, from transcriptome data, we predicted a total 7622 lncRNAs from internode libraries. Among them, 273 lncRNAs were known and 7349 lncRNAs were novel. Out of them, we predicted 369 differentially expressed lncRNAs. Interestingly, we have identified 76 lncRNAs endogenous target mimics (eTM) with 35 miRNAs. Finally, 5 lncRNAs and 5 eTM miRNAs were selected for qRT PCR validation. Within them, expression of 4 lncRNAs and 4 miRNAs were matched with the in silico differentially expressed data. Experiments are underway to further validation of target genes through qPCR and transient expression analysis in tobacco plant.

ICAR-NIPB ANNUAL REPORT 2019

Fig. 1.15: Genetic improvement of deepwater rice. A) 1st internode was used to do the RNAseq, B) Sampling for small RNAseq in the deepwater tank, NIPB, Phenotyping facility, New Delhi

Genetics and Genomic approaches to improve Drought Tolerance in Rice Identification of major candidate genes for multiple abiotic stress tolerance by network analysis and expression profiling in rice (Oryza sativa L.) (M. K. Ramkumar, Ekta Mulani, Vasudha Jadon, Sureshkumar V, Amolkumar U Solanke, N.K. Singh and Amitha Mithra Sevanthi) A total of 6657 DEGs identified through meta-anlysis of microarray data in rice for drought (2647), heat (2321), and salinity (1689) stress response at seedling stage were used for stress- wise network construction by following a workflow shown in Fig. 1.16A. The three networks were merged into a single network based on the presence of overlapping genes across stresses (Fig. 1.16B). The node-degree distribution of this combined network followed the power law of distribution with R2 value of 0.863 (Fig. 16C). The top 10 subnetworks/modules, created based on the density of the interactions had a total of 239 genes (Fig. 1.17A). GO analysis of these 239 genes revealed that 169 were involved in biological processes, 132 in cellular development and 7 in molecular function. The smallest module had 8 nodes and 27 edges (cluster score: 7) and the highly dense module had 61 nodes and 688 edges (cluster score: 22.93). From these modules, 10 genes were found to be common DEGs under all three stress conditions. Rest of the 229 genes differentially expressed in either two or only one stress condition. Since most of the inter-modular hub genes were ribosomal proteins, intra-modular hub genes were mined. The top five modules (Fig. 1.17B to 1.17F) had a total of seven intra- modular hub genes, the selection criterion being the highest degree centrality in their respective modules. From these seven genes, five had the highest degree centrality. The expression of these 15 genes were studied in three stay-green mutants, Nagina 22 and a pair of appropriate check varieties under salinity, drought and heat stress treatments.

ICAR-NIPB ANNUAL REPORT 2019

Fig. 1.16: Network construction using the differentially expressed genes (DEGs) reported for abiotic stress response; A: workflow followed to select the candidate genes for validation, B: Distribution of DEGs among drought, salinity and heat stresses; C: Node-Degree distribution of the combined network.

All the 15 genes showed upregulation under all stress conditions though the degree of upregulation varied from a far low value of 0.098 fold (in SGM-1 for a gene encoding a putative DEAD box ATP dependent RNA helicase-30 protein under heat stress) to as high as 8.19 fold (in N22 under drought stress for a gene encoding for calmodulin related calcium sensing protein) across genes and genotypes. Under drought stress, either N22 or Vandana, the two well-known drought tolerant genotypes showed the highest upregulation for all 15 genes except for two viz., LOC_Os3g55390 (30S ribosomal protein S9, chloroplast, putative, expressed) and LOC_Os05947890 (WD domain G repeat containing protein) for which SGM-3 and SGM-2 showed the highest upregulation respectively. For an intra-modular hub gene, a ThiF family domain containing protein, N22 had 3.4 fold increase under drought and salinity stress and 4 fold increase under heat stress, and interestingly for this gene, SGM-1 had the highest (5.3) fold increase under heat stress and SGM-3 had the highest (7.3) fold increase under salinity stress. Under salinity stress, the degree of upregulation of the 10 common genes was nearly similar for all genotypes except for a HSF type DNA binding domain containing protein) for which SGM-3 had the highest expression. No genotype

ICAR-NIPB ANNUAL REPORT 2019 showed a consistent superiority in gene expression across all the stresses, except for SGM-3, a mutant of N22 for LOC_Os03g55390 encoding for chloroplast ribosomal unit.

Fig. 1.17: Identification of clusters or modules from the combined network A: GO based network of the DEGs present in the top 10 modules; B-F: Top 5 modules used for deducing the intra-modular hub genes

A novel stay-green mutant of rice with delayed leaf senescence and better harvest index confers drought tolerance (M. K. Ramkumar, Kishor Gaikwad, Rakesh Pandey, Viswanathan Chinnusamy, Nagendra Kumar Singh, and Amitha Mithra Sevanthi) Three Ethyl methansulphonate (EMS)-induced stay-green mutants (SGM-1, SGM-2 and SGM-3) and their wild-type (WT), were tested for their stay-green (SG) and drought tolerance nature as the relation between these two attributes is not yet established in rice. In the dark induced senescence assay, SGM-3 showed delayed senescence while SGM-1 and SGM-2 showed complete lack of senescence (Fig. 1.18).

ICAR-NIPB ANNUAL REPORT 2019

Fig. 1.18: Senescence in the three stay-green mutants (SGM-1 to SGM-3) and the wild type, Nagina 22 (N22). (A) Total chlorophyll content in the flag leaf of the mutants and N22 under dark induced senescence from day 0 to day 10; (B) flag leaf images of the mutants and N22 on day 0; (C) flag leaf images of the mutants and N22 on day 10; (D) panicles of the mutants and N22 at physiological maturity (E) Photosynthetic rate of the mutants and the wild type Nagina 22 (N22) post-anthesis till physiological maturity. While N22 and SGM-3 reached physiological maturity in 28 days post-anthesis SGM-1 and SGM-2 took 35 days.

The mutants also studied for their photosynthetic activity under field conditions from post- anthesis to physiological maturity at weekly intervals. All measurements were done on flag leaf. While WT and SGM-3 matured in 4 weeks, the mutants SGM-1 and SGM-2 took 5 weeks to attain maturity. The latter two mutants had higher rate of photosynthesis which was

ICAR-NIPB ANNUAL REPORT 2019 maintained over time while SGM-3 showed a moderate decline over time. N22 showed senescence under dark and steep decline in photosynthetic rate under field conditions. Mutants showed stable transcript abundance over time (0-9 days at three days interval under dark) for 15 candidate genes (CGs) associated with senescence, compared to the WT. SGM-3 however showed moderately increasing transcript abundance over time for ATG6a, ATG4a, NYC1, NOL and NYC3. Only SGM-3 performed better than the WT for yield and harvest index under well irrigated as well as drought conditions, though all the mutants showed better performance for other agronomic traits under both the conditions and ascorbate peroxidase activity under drought. Thus, SG trait showed positive correlation with drought tolerance though only SGM-3 could convert this into higher harvest index. Sequence analysis of 80 senescence-associated genes including the 15 CGs showed non-synonymous mutations in four and six genes in SGM-1 and SGM-2 respectively, while no SNPs were found in SGM-3. Analysis of the earlier reported quantitative Trait Loci (QTL) regions in SGM-3 revealed negligible variations from WT, suggesting it to be a novel SG mutant.

Development and evaluation of transgenic rice by overexpressing putative drought responsive genes (Karikalan J, Amitha Mithra Sevanthi and Pranab Kumar Mandal) For the purpose of functional validation of two drought responsive genes Os06g10210 and Os04g0690500 from N22 were transformed in the Pusa Sugandh 2 (PSII) background under AtRD29 drought inducible promoter. At present they are at T4 stage.

Fig. 1.19: Evaluation of (T3-PS2-Os06g10210) homozygous transgenic lines under drought stress. A- Before stress. B- After 7 day’s stress. C- After 2 week’s stress. D- Recovery after 10 days re-watering.

ICAR-NIPB ANNUAL REPORT 2019

Fig. 1.20: Fig.: Evaluation of (T3-PS2-Os06g10210) homozygous transgenic lines under 7 days salt stress (top) and 12 days cold stress (bottom). Left- before stress, Right- after stress.

We have two and three with single copy insertions through Southern hybridization for Os06g10210 and Os04g0690500 respectively. Other than water stress, these transgenic lines were subjected to salinity, heat and cold stress also (Fig. 1.19 and Fig. 1.20). Phenotypically as well as related physiological parameters showed that these plants were tolerant not only to water stress but to salinity and cold stress also. However, the plants were not tolerant to heat stress. .

Investigation of the plant U-Box family of proteins (PUB) in rice (Oryza sativa) with emphasis to their roles in abiotic stress responses. (Harmeet Kaur, Akansha Chaurasia, Tapan Kumar Mondal) Plant U Box ligases (PUB) are a relatively new class of E3 ligases. U- box domain is a 70- amino acid long domain similar to the RING domain but lacks the typical zinc chelating cysteine and histidine residues present in RING domain. This U-box domain is highly conserved sequence element of plant U-box (PUB) gene family. Rice plant U-box family contains 77 putative protein coding genes and most of these are expressed proteins. Search through the publicly available microarray and RNAseq databases revealed many of the 77 PUB genes to be differentially expressed during various abiotic stresses like dehydration, salt, cold and heat stress. PUB genes shortlisted based on in silico expression analysis were further analysed for their expression under various stress conditions i.e. Heat, Cold, Salt and Dehydration. Quantitative RT- PCR was used to check the expression of these genes during above mentioned abiotic stress conditions. The results revealed two genes i.e. PUB63and PUB67 as having a higher

ICAR-NIPB ANNUAL REPORT 2019 expression under heat and dehydration stress. Based on this data both these genes were selected for further detailed characterization. PUB63 encodes for a full length CDS of 1032 bp and additionally encodes two splice variants. The predicted protein is 344 amino acids long and 39.3 KDa in molecular weight. PUB67 encodes for a single full length CDS of 1296 bp. The predicted protein length is 432 amino acids and molecular weight is 49 KDa. CDS of both the genes were amplified from cDNA and cloned into pENTR-DTOPO vector. The clones were confirmed by Colony PCR, restriction digestion and finally sequenced. PUB67 has finally been cloned into pEG103 vector for localization and PIRS154 plant expression vector for generating overexpression lines (Fig. 1.21A and 1.21B). RNAi constructs have also been made for PUB67 in pANDA RNAi vector (Fig. 1.21C). Cloning for PUB63 is underway. Finally, all the constructs will be mobilised into Agrobacterium for further plant transformation.PUB67 has also been cloned into pGBKT7 vector to check for interacting partners by yeast two hybrid library screening.

Fig. 1.21: Various constructs made for PUB67 molecular and functional characterization. (A) PUB67 cloned in pEG103 vector for localization studies (B) PUB67 cloned in plant expression vector pIRS154 for overexpression with maize Ubiquitin promoter, (C) PUB67 cloned in RNAi vector pANDA.

Strategies for improving nitrogen use efficiency in Rice (Amitha Mithra Sevanthi, Subodh Kumar Sinha, Manju Rani, Sapna Dhiman, Megha Kaushik, Manish Saini and Pranab Kumar Mandal) As interplay of N and water use efficiency is an important aspect of crop production demanding their dissection at molecular level, and no genome-wide transcriptome studies on their combined effect as have not yet been reported in rice or other crop plants, for the purpose of examining a global transcriptome of root and shoot tissues of rice seedlings of two rice genotypes, i.e., Nagina 22, a drought tolerant, tall and non N responsive upland variety and IR 64, a semi-dwarf, drought sensitive and N-responsive lowland variety, we have done

ICAR-NIPB ANNUAL REPORT 2019 physio-biochemical characterization of these two contrasting genotypes for individual and dual stresses. Morpho-physiological traits were measured and enzyme activity was assayed in the genotypes, N22 and IR64, as a prelude to identifying the QTLs responsible for nitrogen use efficiency (NUE) and characterizing their RNA-seq. The effect N- and water stress on chlorophyll and carotenoid content was also measured. Reduction in chlorophyll and carotenoid content was observed under N- and dual stresses in both the genotypes (Fig. 1.22). Under optimum condition IR64 had higher Chl B content than N22.

Fig. 1.22: Chlorophyll and carotenoid content of two rice genotypes, i.e., IR64 and N22, under low nitrogen (N) and water (W) stresses. Plus (+) and Minus (-) followed by growth conditions indicate optimal (+) and low (-) input supply. Values are mean ± SE (n = 3), different letters above the bar indicate significant difference (p<0.05) between the different stress conditions and genotypes.

Effect of low nitrogen and water stress on root system architecture (RSA) showed that under optimal (N+W+) and N-W+ conditions, the total root size (TRS) of IR64 was more than N22. However, in IR64 it got reduced significantly under W- stress while only a marginal reduction was seen in N22 (Fig. 23). Under dual stress conditions, the TRS of both the genotypes reduced considerably but the difference between the genotypes was not significant. SOLRN was more than FOLRN in both the genotypes under respective conditions. Effect of low nitrogen and drought stress on N and C metabolizing enzymes showed that under dual stress, GDH, PK, ICDH and CS showed better specific activity in IR64 than N22.

ICAR-NIPB ANNUAL REPORT 2019

Fig. 1.23: RSA of two rice genotypes, i.e., IR64 and N22, under N and water stresses.

Genetic Modifications to Improve Biological Nitrogen Fixation for Augmenting Nitrogen Needs of Cereals (Amitha Mithra Sevanthi, Subodh Kumar Sinha, Manju Rani, Sapna Dhiman, Megha Kaushik, Manish Saini and Pranab Kumar Mandal) To develop transgenic rice plants that are able to support the formation of symbiosome compartments in rice roots for harbouring/ sequestering rhizobia and protecting them from plant defense system the constructs RCS1-PA5 containing the genes MtN6, MtFL4, MtFL2, MtRPG, LjCER Medicago truncatula was transformed in Taipei 309. During the reporting period, seeds of different T2 transgenic lines containing the RCS2-PA5 construct were characterized. Amongst 7 initial T2 transgenic lines, 4 lines [(TH12(P1), TH14(P2), TH14(P3) and TH14(P4)] showed 3:1 segregation ratio of the transgenes (Table 1). After 15 days of selection, surviving seedlings were transferred to soilrite and then transgenic net house. This was followed by gene specific PCR confirmation (Fig. 1.24).

Fig. 24: Hygromycin-B selected T3 transgenic plants, their PCR confirmation and mature transgenic plants with RCS1-PA5

ICAR-NIPB ANNUAL REPORT 2019

Understanding the host response to compatible and incompatible microbial inoculations in cereals vis-a-vis legumes (Manish Kumar Saini, Amitha CR Mithra, Subodh K Sinha, P.C. Latha, Raman Sundaram, Pranab Kumar Mandal) Plant growth-promoting bacteria (PGPB) viz. Gluconacetobacter diazotrophicus, an endophyte and Bradyrhizobium japonicum a nodulating endosymbiont, fix nitrogen as well as promote the plant growth. Both the diazotrophs were infected with rice variety, TN1 and the soybean variety, SL-1028, RNA was extracted from root tissues at different time intervals up to 120 hours after inoculation and RNA-Sequencing was carried out in the previous year. Analysis result showed 43 up and 69 down-regulated genes in rice whereas 1511 up and 3156 down-regulated DEGs in soybean. We identified few common as well as uniquely up and down-regulated DEGs in rice and soybean. During the reporting period, we have validated RNA-seq data (Fig. 1.25) by qRT-PCR.

Fig. 1.25: Validation of a few important DEGs identified from compatible and incompatible microbial inoculations through qRT-PCR

Genetic improvement of rice for yield enhancement through RNA guided genome editing (CRISPR-Cas9/Cpf1) (Soumyadeep Mukherjee and Prasanta K Dash) Targeted genome editing using CRISPR/Cas has emerged as a powerful tool, alternative to classical plant breeding and transgenic (GMO) methods to improve crop plants and ensure sustainable production. In this regard, we targeted a Quantitative Trait Loci WFP (Wealthy farmer panicle) that encodes SPL14 (SQUAMOSA PROMOTER BINDING PROTEIN- LIKE 14) which promotes panicle branching and higher grain yield in rice. SPL14 is an important gene related to plant architecture in rice and a good target gene for RNA editing. However, SPL14 is targeted by a miRNA that cleaves SPL14 at specific site (TGTGC….CA) (Fig. 1.26). Thus, our objective was to mutate the site of SPL14 recognized by miRNA by CRISPR-Cas.

ICAR-NIPB ANNUAL REPORT 2019

Fig. 1.26: The complete genic sequence of the OsSPL14 gene with critical miR156 target site open to CRISPR mediated engineering highlighted in red.

Identification of target sites of OsSPL14 for genome editing in rice The selection of guide RNA for editing SPL14 was done using online available tool CRISPR- P (v 2.0) that detects highly efficient sgRNA with minimal off-target effects. Following list of putative guide RNA (Table 1.3) were generated for editing OsSPL14 gene in rice. A total of 46 gRNAs with varying off target implications could be identified upon and around the intended target of OsSPL14. The gRNA designs were weighed based on their overall structural stability, off-target potentials and the position of affected cleavage. The two best performing gRNAs were singled out and DNA oligonucleotides corresponding to the same were artificially synthesized with the adaptor sequences for cloning with the BsaI endonuclease. The reverse primers were designed to carry an adaptor sequence 5’-AAAC, whereas the forward primer would include the sequences 5’-GGCA (for gRNAs starting with A) or 5’-GGC (for gRNAs starting with G, C or T). To individually clone both the gRNAs gT1 (E-CRISP output) and g4 (CRISPR-P output) into the vector, we first digested the pRGEB32 vector with the BsaI enzyme and relieved it of the 5’- and also the 3’- phosphate groups by phosphatase. Dilutions and thermal conditions for the BsaI enzyme were as per the manufacturer instructions.

Table 1.3. gRNA spacer oligonucleotide information for g4 and gT1. Number Of S. No. Name Sequence (5’3’) Nucleotides 1. Guide4 Forward GGCAGAGAGAGCACAGCTCGAGT 24 2. Guide4 Reverse AAACACTCGAGCTGTGCTCTCTC 24 3. Guide_T1 Forward GGCAGAAGAGAGAGAGCACAGCTC 24 4. Guide_T1 Reverse AAACGAGCTGTGCTCTCTCTCTTC 24

ICAR-NIPB ANNUAL REPORT 2019

Fig. 1.27: The vector map and cloning sites of the plasmid pRGEB32, Post-transformation DH5α cells with pRGEB32 vector. Confirmation of pRGEB32 by restriction digestion with four commercially available restriction enzymes combinations.

Designing suitable gRNAs for guiding the Cas9 cascade upon the intended targets The ones corresponding to the pRGEB32 construct with g4 insert and pRGEB32 construct with gT1 insert only displayed the presence of 4 and 29 colonies each. Each transformed colony was picked and individually confirmed by re-streaking on LA plates with Kanamycin (Fig. 1.28).

Fig. 1.28: Colonies of E. coli transformed with the pRGEB32 constructs harbouring the g4 and gT1 inserts.

ICAR-NIPB ANNUAL REPORT 2019

Colony PCR for each individual bacterial population was setup with normal Taq Polymerase possessing a Hot-start feature. The primers used were M13 (-48 seq) reverse and g4 and gT1 reverse. Four colonies of each construct were screened. All the four colonies picked from the grid plate corresponding to pRGEB32 construct with gT1 insert displayed positive results and only two colonies picked from the grid plate corresponding to pRGEB32 construct with gT1 insert displayed positive results. An amplicon of 410bp size could be resolved for all the constructs from the cloned bacterial populations in an agarose gel electrophoresis (Fig. 1.29).

Fig. 1.29: Colony-Polymerase chain reaction and agarose gel electrophoresis of pRGEB32 vector harbouring gT1 and g4 inserts respectively.

The colonies harbouring positive clones were inoculated overnight at 37C shaking incubator in 5ml Luria Broth media and plasmids were individually isolated from each inoculum were sent for downstream sequencing process with M13 (-48) reverse primer. One of the clones carrying the guide4 gRNA was confirmed by Sanger sequencing result (Fig. 1.30).

Fig. 1.30: Sanger sequencing confirmation for CRISPR construct carrying the guide4 gRNA. C. Biotic stress tolerance in rice

ICAR-NIPB ANNUAL REPORT 2019

Besides abiotic stresses, several other biotic stresses including blast (BS), bacterial leaf blight (BLB) and sheath blight (ShB) are known to inflict serious damage to the rice crop. At ICAR-NIPB inclusive efforts are being undertaken to understand the molecular mechanism underlying plant immune response against diverse class of pathogens. In addition, efforts are also being undertaken to identify novel genes and QTLs imparting tolerance to different plant pathogens.

Improvement of Rice Blast resistance in Rice Identification of N22 rice mutants resistant to rice blast disease by multi-location screening (Amolkumar U Solanke, Amitha Mithra Sevanthi, Mohd. Tasleem, Ram Sewak Tomar, Umakanta Ngangkham, Someshwar Bhagat) Nagina 22 mutants generated under a DBT funded project is a great resource for trait-based gene identification. In 2017, we used 1.5 kg M2 generation mutant seeds (approximately 1 lakh seeds) for blast screening in blast nursery at NRRI-Central Rainfed Upland Rice Research Station (CRURRS) Hazaribagh. After screening at natural hotspot of blast, 60 lines with blast score of 1, 2 and 3 (in the scale of 9) were selected as promising blast resistant mutants. These lines were screened for a second time in the same location (Fig. 1.31). This year, these 60 N22 mutants were again screened for leaf and panicle blast resistance at ICAR- NIPB and for leaf blast at ICAR-Research Complex for NEH Region, Umiam-793103, Meghalaya. While screening at ICAR-NIPB, we used M. oryzae strain Dehradun for the blast disease development, whereas at Meghalaya, these mutants were screened under natural blast nursery. Out of these three mutants, namely NBM-13, NBM-16 and NBM-56 showed consistent resistance to leaf and panicle blast at all three centres, Hazaribagh, Umiam and New Delhi for both panicle and leaf blast. These lines will be now be used for genetics and genomics study to identify and introgressed the blast resistance genes.

Fig. 1.31: Screening of N22 mutants for panicle blast using artificial inoculation of M. oryzae.

ICAR-NIPB ANNUAL REPORT 2019

Cell wall modification and strengthening as one of the major mechanisms for blast resistance revealed from comparative panicle blast transcriptome (Amolkumar U Solanke, Vishesh Kumar, Priyanka Jain, Sureshkumar V, Suhas G Karkute, Amitha Mithra Sevanthi and TR Sharma) Rice blast, especially panicle blast caused by Magnaporthe oryzae results in devastating yield loss and therefore, it is prime goal of breeders to develop broad spectrum durable resistance against this disease. Comparative transcriptomics of resistant and susceptible rice cultivars is widely used approach to identify genes and mechanisms involved in resistance response. This is the first study to explore the panicle blast responsive transcriptome of a well- known resistant cultivar Tetep in comparison to a susceptible cultivar HP2216 using RNA-seq approach at three time points 48, 72 and 96 hours post infection (hpi) of M. oryzae along with non-infected control. Transcriptome data of infected panicle tissues revealed 3553 differentially expressed genes in HP2216 and 2491 genes in Tetep that are responsible for differential disease response in these two genotypes. Differentially expressed genes included typical defense responsive transcription factors, NBS-LRR genes, kinases, pathogenesis related genes, peroxidases, etc. Interestingly, many novel genes having DOMON, VWF, and PCaP1 domains were highly expressed in Tetep post infection, suggesting their role in panicle blast resistance.

Fig. 1.32: A model proposed from transcriptome study in blast infected panicle tissues of Tetep (resistant) and HP2216 (susceptible) line showing blast resistance in rice through cell wall modification and strengthening.

Several genes specifically expressing in Tetep were identified as chitinases, proteases, and cell wall modification related genes such as PMR5, dirigent, tubulin and other cell wall proteins which play an important role in cell wall strengthening. Besides several NBS-LRR genes in Tetep, present study suggests involvement of large number of genes and cell wall modification mechanism for durable blast resistance. Blast resistance in Tetep is thus, a

ICAR-NIPB ANNUAL REPORT 2019 complex phenomenon contributed by early defense response through ROS production and detoxification, MAPK and LRR signaling, accumulation of antimicrobial compounds and secondary metabolites, and cell wall strengthening to prevent entry and spread of fungi. The study thus, provided valuable candidate genes that can unravel the mechanisms of panicle blast resistance and helps in breeding programs for durable blast resistance in rice (Fig. 1.32).

Identification of putative negative regulators of rice blast and development of polycistronic tRNA-gRNA (PTG) construct with multiple gRNAs From the transcriptome data generated for panicle blast in, Tetep (resistant) and HP2216 (susceptible), two contrasting rice genotypes, six putative negative regulators of blast disease have been identified. Along with these, three known negative regulators of rice blast, Pi21, OsMPK5 and spl11 which are already characterized, were taken for analysis. These six negative regulators are WRKY27, Plant-specific domain protein, PB1 domain containing protein, MYB family transcription factor, AP2 domain containing protein and Cysteine-rich receptor-like protein kinase. The expression of these genes was confirmed in the blast infected panicle tissue of Tetep and HP2216 and observed that it is more in susceptible line. Further two gRNAs were identified for each gene and then primers were designed to clone multiple gRNAs into single binary construct to form polycistronic tRNA-gRNA (PTG) construct having each tRNA is sandwiched with two gRNA by replacing spacers between tRNA genes. Thus, two constructs one with 5 gRNA of three genes and one with 4 gRNA with two genes are developed and further confirmed with Sanger sequencing. These are now ready for plant transformation (Fig. 1.33).

Fig. 1.33: Development of polycistronic tRNA-gRNA (PTG) construct in binary vector with five gRNA from Pi21, MPK5 and Spl11 genes and its confirmation by Sanger sequencing.

ICAR-NIPB ANNUAL REPORT 2019

Elucidating the role of alternative splicing of uncharacterized LRK10 like gene encoding serine/threonine protein kinase for blast resistance in rice (Amit Pareek and Amolkumar Solanke) On the basis of available transcriptomic data from M. oryzae infected leaf of rice plants, the role of uncharacterized LRK10 like gene of rice was predicted in blast resistance. FGENESH was used to predict the structure of this gene, which shows five exons and four introns. To decipher the role of alternative splicing in blast disease resistance in rice, different primers were designed accordingly and spliced forms of this gene were analysed by PCR amplification and confirmed by sequencing. To precisely evaluate the structure of different splicing variants, full length cDNA was amplified by rapid amplification of cDNA ends (RACE) reactions using SMARTer RACE cDNA amplification kit. 5’ and 3’ RACE products were cloned into pGEM-T Easy vector and sequenced. After sequencing of RACE products, in silico alignment was done to get full length sequence of gene. The full length LRK10 cDNA sequence comprised of an ORF (3046 bp), the 5-untranslated region (5-UTR, 106 bp) and 3- untranslated region (3’-UTR, 79 bp). Sequencing of RACE products showed the real picture of gene containing four exons rather than previously predicted five exons. On the basis of above results new pair of primers was designed from UTR region and numerous alternative splicing variants were amplified using 5’ RACE cDNA. Amplified products were cloned into pGEM-T Easy vector and cloning was confirmed by restriction digestion with specific restriction enzymes and further confirmed by sequencing. Following Sequence analysis of cloned products showed two different variants of LRK10 like gene as LRK10L1.1 and LRK10L1.2 including numerous alternative splicing variants of LRK10L1.2 (Fig. 1.34) For expression profiling and northern analysis, rice seedlings were sprayed with spores of M. oryzae and fungal inoculation was also performed at panicle stage. Leaf and panicle samples were collected at different time points for further use.

Fig. 1.34: Structural organization of different spliced transcripts confirmed by sequencing of various cloned products. Blank yellow box shows 5’ UTR and 3’ UTR region.

ICAR-NIPB ANNUAL REPORT 2019

Understanding molecular mechanism of Silicon mediated resistance against biotic stress using rice blast as a system (Gitanjali Jiwani and Amolkumar Solanke) Rice blast is caused by a hemibiotropic fungus Magnoporthe oryzae, which causes chlorotic lesion in leaves. It has been observed that silicon application in plants provides protection against a broad range of pathogen. Two modes of action for silicon have been predicted. Firstly, it acts as a physical barrier, where in Si is deposited under the cuticle forming a double layer preventing penetration of fungi and leading to disruption of infection. The second mechanism is action of soluble silicon by modifying the host resistance system. Calcium silicate amendment to check the effect on disease resistance for M. oryzae infection in Tetep and HP2216: Silicon treatment was given using calcium silicate as silicon source to rice plants of Tetep and HP2216. Further infection using mo-ni-0025 fungal strain of M. oryzae was given to check the effect of silicate treatment on infection. Initially pilot experiments were conducted to streamline the effect of infection on rice leaves and Calcium silicate concentration. The experiment was conducted, and phenotype was monitored along with sample collection of rice leaves. The Calcium silicate treatment experiment was done with different combinations, wherein both the rice varieties were amended and not amended with Calcium silicate along with fungal infection with and without M.oryzae. The control plants were there for both Calcium silicate treatment and fungal infection. Calcium silicate (1g/kg soilrite) was given to rice plants 30 days before the start of this experiment, so that it gets incorporated into the plants physically and available at molecular level. The control plants were grown without Calcium silicate in the same conditions. The phenotypic symptoms were monitored for both the rice varieties and compared with the control plants which were not exposed to fungal infection. Both the rice varieties which were amended with calcium silicate and infected with M. oryzae showed lesser number of lesions and smaller in size as compared to the leaves of plants not supplied with silicate. The impact of disease was less in Tetep variety as compared to HP2216 as it is a resistant variety. Light microscopy was also done to check the difference in lesion size. It was observed that the leaves of Calcium silicate amended rice plants had smaller sized lesions as compared to plants which were not supplied with silicate. This was a clear-cut indication of Calcium silicate acting as a barrier to fungal infection of M. oryzae. The leaves were harvested for further molecular analysis. RNA isolation was done for control and experimental samples at different time point post infection. Potassium silicate amendment to check the effect on disease resistance for M. oryzae infection in Tetep and HP2216: Potassium silicate was given for a month to two rice cultivars at a concentration of 1.7mM. Further M. oryzae infection was given in the form of spray. The disease symptoms were monitored, and images were recorded along with sample collection of diseased leaves at 48 h,72 h,96 h,120 h. The control samples which were not infected were also taken. Samples were freeze dried in liquid nitrogen and stored at -70 until RNA isolation. The outcome of this experiment showed that potassium silicate supplied plants were more resistant and were less affected from fungal infection as compared to the plants

ICAR-NIPB ANNUAL REPORT 2019 which were not supplied. Further Tetep being the resistant variety, displayed more resistant phenotype. Potassium silicate supplied Tetep plants were even more resistant.

Molecular dissection of Sheath Blight tolerance in Rice Sheath Blight (ShB) is second most important disease of rice, next only to rice blast. Sheath blight is a soil-borne disease caused by the necrotrophic fungus Rhizoctonia solani . Breeding for sheath blight resistance has been a futile exercise so far, mainly due to the unavailability of a potent resistance donor source.

Evaluation of Sheath Blight resistance in BC1F2:3 mapping population. (Deepak Singh Bisht, Richa Kamboj, Tapan Kumar Mondal, Tilak Raj Sharma, Nagendra Kumar Singh) During Kharif 2016 and 2017 we have screened the wild rice germplasm collected at our centre from 13 agro-climatic zones of India. The identified germplasm was used for the development of a suitable mapping population. We have developed a BC1F2 mapping population consisting of 440 individuals. The individuals of the mapping population were evaluated for tolerance to sheath blight during Kharif 2019. Four phenotypic traits related to sheath blight tolerance viz., maximum lesion length, average lesion length, maximum disease rating and average disease rating were recorded. Based on the IRRI standard evaluation system the phenotypic scoring was done for which the phenotypic distribution is present in Fig. 1.35. Genotyping of the population is planned during 2020.

60 Distribution of Phenotypic trait in F2:F3 population

0 Highly Susceptible Susceptible Moderately Susceptible Moderately Resistant Resistant Highly Resistant

Fig. 1.35: Phenotypic distribution of F2:3 population segregating for sheath blight tolerance

ICAR-NIPB ANNUAL REPORT 2019

Identification of candidate host susceptibility factor facilitating growth of R. solani on rice plant (Deepak Singh Bisht, Nitin Kumar, Richa Kamboj, Tapan Kumar Mondal, Tilak Raj Sharma, Nagendra Kumar Singh) The use of chemical fungicide if so far, the most promising strategy adopted for the controlling of sheath blight pathogen. However, uncontrolled and prolific application of fungicides possess serious threat to environment and human health. In this context, serious attempts have been undertaken towards development of sheath blight tolerance in rice, albeit with limited success. So far, no gene(s) or QTL imparting promising resistance against sheath blight has been identified, and thus necessitating the need for identification of novel resistant loci, particularly those which can be easily targeted via modern genome engineering tools and thus could lead sustainable and durable resistance against ShB pathogen. Eukaryotic Pathogen effectors are known to alter the host cellular machinery for their growth and proliferation. However, for R. solani very little is known about how the pathogen extract nutrient from the infected host to support its sustenance and propagation. Also, limited or no information is available on how the trade-off between defense and growth is maintained upon pathogen attack. Based on some of the recent findings and our own study we have identified a novel HAD super family phosphatase, LOC_Os5g09740, gene whose expression is strongly correlated with degree of host susceptibility (unpublished results), suggesting its role in facilitating the growth of intruding pathogen. In this direction, we have designed gRNA to target the aforementioned gene using CRISPR/Cas9 toolbox. The gRNA has been cloned in vector pRGEB32 and subsequently mobilized in Agrobacterium tumefaciens LBA4404 strain (Fig. 1.36). The plant transformation is in progress.

d e d t e s t e s ig e d ig I d a s n B U

15.9 Kbp

pRGEB32

Fig. 1.36: Cloning of gRNA targeting rice HAD super family phosphatase, LOC_Os5g09740 in pRGEB32 vector

ICAR-NIPB ANNUAL REPORT 2019

Rice sheath blight pathogen, Rhizoctonia solani drives differential expression of miRNA in rice (Ramawatar Nagar and Deepak Singh Bisht) To date, no major ShB resistance genes or rice cultivars exhibiting complete resistance to R. solani have been reported. Small RNAs have been shown to play an important regulatory role in a multitude of biological processes in plants, including development, metabolism, maintenance of genome integrity, and abiotic stress responses. Besides these, increasing evidence suggests that small RNAs also play a critical role in immunity against various pathogens. To elucidate the possible association of small RNA in rice defence response against ShB, genome-wide expression profiling of small RNA was carried out in sheath blight tolerant rice line Tetep and susceptible rice line HP2216.

At the heading stage, sheath blades of tolerant and susceptible rice lines were inoculated with agar plugs containing the mycelium of R. solani AG1-IA. To monitor small RNA expression change in response to R. solani infection over a time-course, samples were collected 0, 24, and 36 hours post-inoculation (hpi). High-quality RNA was isolated all the samples, sequencing libraries were prepared, and sequenced using the Illumina HiSeq platform. Raw sequence data were quality processed and aligned to the rice reference genome (MSU-V7). For the qualification of known rice miRNA, rice miRNAs annotation file from the miRBase database (release 22) was included while quantifying small RNA from the mapping files (BAM file).

A B C

Fig. 37: Differentially expressed miRNA rice sheath blight tolerant (Tetep) and susceptible (HP2216) rice lines at different time intervals post-inoculation, A) 0 hours, B) 24 hours, C) 36 hours.

Differential expression analysis of miRNA was carried out in the R environment using edgeR tool. After stringent filtering for false positives, a set of miRNA was found to be differentially regulated in response to R. solani infection. At 0 hpi, only a few miRNA were differentially regulated while at subsequent time intervals, 24 and 36 hpi, more miRNA were

ICAR-NIPB ANNUAL REPORT 2019 differentially regulated indicating an apparent sheath blight pathogen, R. solani induced differential expression miRNA in the rice lines (Table 1.4 and Fig. 1.37).

Table 1.4: List of Differentially expressed miRNA in sheath blight resistance vs. susceptible rice at differing time intervals 0 h 24 hpi 36 hpi osa-miR1437a osa-miR528-3p osa-miR439c osa-miR1846a-5p osa-miR408-5p osa-miR2876-3p osa-miR1846b-5p osa-miR528-5p osa-miR439f osa-miR528-5p osa-miR439f osa-miR439a osa-miR408-3p osa-miR439a osa-miR439g osa-miR1437b-3p osa-miR439c osa-miR1437a osa-miR439c osa-miR439g osa-miR439e osa-miR1846a-5p osa-miR439h osa-miR1846b-5p osa-miR439d osa-miR408-3p osa-miR319b osa-miR439h osa-miR319a-3p.2-3p osa-miR439e osa-miR169a osa-miR1437a osa-miR1431 osa-miR439b osa-miR2865 osa-miR439d osa-miR439b osa-miR408-3p osa-miR1846a-5p osa-miR1846b-5p osa-miR396a-3p osa-miR396c-5p osa-miR530-5p

Down Regulation of Rhizoctonia solani endogenous genes by Host-Delivered RNA interference to enhance Sheath Blight disease resistance in Rice (Ila Mukul Tiwari and Tapan Kumara Mondal) Rhizoctonia solani is a species complex comprising of several genetically distinct groups and is estimated to infect all cultivated plants around the world. Till date, the R. solani species complex has been grouped into 14 anastomosis groups (AG) (AG-1 to AG-13 and AG-BI) each having his own host specificity. Despite its importance, research into developing efficient platform technologies to produce R. solani resistant plants is still lacking. Till date, absolute resistance to R. solani has not been identified in any crop. Although high degree of quantitative resistance has been reported in several rice lines, resistance has been attributed to

ICAR-NIPB ANNUAL REPORT 2019 the presence of defence related genes, in addition to morphological and ecological characteristics. It is for this reason that it is unlikely that, natural resistance can be transferred to other plant species. In the absence of natural resistance, genetically modifying plants with transgenes for enhanced resistance is the most suitable alternative. In principle, host delivered RNAi interference involves identification of genes essential for disease development and then engineering plants to silence these target genes via the RNAi mediated silencing pathway. However, as there is no report of pathogenicity related genes in R. solani, as an alternative approach we first identified fugal genes related to virulence in other necrotrophic fungi and later their homolog target gene in R. solani. One conserved signaling pathway in filamentous fungi that needs further investigation in relation to R. solani virulence is the heterotrimeric G protein-mediated signaling pathway. Heterotrimeric G proteins are highly conserved among the model filamentous and plant- pathogenic fungi and plays a central role in controlling cell growth, development, virulence and secondary metabolic production in fungi. This study has determined that the G-protein β subunit MGB1 from Magnaporthe grisea to be ideal target genes for my HD RNAi strategy. This gene is essential for the formation of appressoria, the fungal infection structures required for penetrating the plant cuticle, for invasive growth in plant tissue and for overall viability in plant. On the basis of these studies homolog for this pathogenesis related (PR) gene was identified in the R. solani metagenome (Fig. 1.38).

Fig. 1.38: Multiple alignment of pathogenicity gene and its R. solani homolog protein

R. solani cDNA, was used to clone the candidate gene. The RNAi cassette was produced into hairpin vector pSTARLING, a vector specialized for high level constitutive RNAi expression in monocot plants (Fig 1.39A). The RNAi cassette was then cloned into plant transformation vector PBI 121 (Fig 1.39B).

ICAR-NIPB ANNUAL REPORT 2019

A) B)

Fig. 1.39: (A) Schematic representation of RNAi Cassette cloned in pSTARLING vector (B) Restriction digestion confirmation of recombinant pSTERLINGand PBI 121 vectors

For Genetic Transformation experiments protocol, in vitro somatic embryogenesis was standardized in susceptible rice cultivar. The mature rice seeds were used as explants for culture initiation (Fig. 1.40). The embryogenic callus was generated to initiate genetic transformation experiments however, due to covid-19 situation all the cultures get infected and ultimately died during lockdown period. Efforts are now underway to again revive the cultures and initiate genetic transformation experiments to generate transgenic plants and their evaluation against fungus to validate the efficiency of HD RNAi approach

Fig. 1.40. Somatic embryogenesis in rice (A) Seeds of TP-309 on callus induction medium; (B) Isolated scutellar calli; (C) Proliferating embryogenic callus; (D) Rice calli on Regeneration medium

Natural screening of Brown Spot Resistance in Rice (Deepak Singh Bisht, Nitin Kumar, Nagendra Kumar Singh) Rice Brown spot (BS), caused by fungus Bipolaris oryzae, is historically a largely neglected disease of rice, despite the fact that it inflicts severe yield losses in major rice growing areas of the world. During Kharif 2019 chronic infection of brown spot disease was observed in our rice fields (Fig. 4). This provided us with an opportunity to conduct natural screening of the planted wild rice germplasm for resistance against brown spot pathogen. Amongst the total 586 germplasm screened, wild rice accession NKSWR_661 was found to be completely immune for the BS pathogen (Fig. 1.41). This particular genotype will be evaluated at multiple locations during Kharif 2020 and crosses will be made with susceptible mega

ICAR-NIPB ANNUAL REPORT 2019 varieties of rice for introgression of resistant trait and also development of suitable mapping populations.

NKSWR_444 (susceptible line ) NKSWR_661 (Resistant Line)

Fig. 1.41: Phenotypic screening of wild rice germplasm for brown spot pathogen.

ICAR-NIPB ANNUAL REPORT 2019

2. Genetic Improvement of Wheat for Adaptation to Climate Change-Induced Stresses

ICAR-NIPB ANNUAL REPORT 2019

2. Genetic Improvement of Wheat for Adaptation to Climate Change- Induced Stresses

A. Abiotic stress tolerance in wheat Heat stress tolerance The rapidly rising atmospheric temperature is an issue of concern for agricultural scientist world over as it is adversely affecting agricultural production. The effects of climatic change are being felt in India, with the most significant impact being experienced in wheat production in the form of terminal heat stress. Terminal heat stress substantially affects wheat grain setting, duration, rate and ultimately grain yield and quality. Therefore, genotypes that are tolerant to heat stress need to be developed. Breeding strategies have been successfully utilized for wheat improvement programmes but with the available gene pool becoming a limited factor, conventional plant breeding strategies alone may not be effective. Recombinant DNA approach needs to be employed development of thermotolerant transgenic wheat harbouring genes isolated from thermotolerant plant systems.

Isolation and characterization of high temperature stress responsive genes from Ziziphus nummularia for development of thermotolerant transgenic wheat (Kishor Panzade, and J C Padaria) The present project aims at identifying and characterizing gene(s) for thermotolerance from tolerant plant system Ziziphus nummularia which can then be employed for developing transgenic wheat tolerant to heat stress. Heat stress responsive genes were identified in the transcriptome (RNA seq) data generated from two genotypes of (genotype Jaisalmer: heat tolerant and genotype Godhra: heat sensitive) which are contrasting in their response to heat stress. The identified genes were validated by qRT-PCR for differential expression under heat stress. It was observed that expression of gene ClpB1 was upregulated under heat stress in both the genotypes, however its expression in response to heat stress was found to be higher in Z. nummularia genotype Jaisalmer in comparison to Z. nummularia genotype Godhra. Based on qRT-PCR expression analysis of different heat responsive genes and top hits in non-redundant (NR) database, gene ClpB1 was selected for full length isolation. The CDS (coding DNA sequence) of gene ClpB1 from the genotypes Z. nummularia Jaisalmer (ZnJ) and Z. nummularia Godhra (ZnG) were amplified cloned and characterized (Fig. 2.1). Nucleotide sequence variation was analysed and post-translational modifications, protein structure, and ligand binding sites were predicted for gene ClpB1 isolated from Z. nummularia Jaisalmer (Acc. No: MN398267) and Z. nummularia Godhra (Acc. No: MN398268). ZnJClpB1.

ICAR-NIPB ANNUAL REPORT 2019

Fig. 2.1: Expression analysis and cloning of gene ZnClpB1 Z. nummularia genotype Jaisalmer and Z. nummularia genotype Godhra A) qRT-PCR analysis of ZnGClpB1 in Z. nummularia genotype Godhra and ZnJClpB1 in Z. nummularia Jaisalmer genotype. B) Isolation of total RNA. M-Marker, Lane 1-3 from genotype Jaislmer, Lane 4-6 from genotype Godhra. C) PCR amplification of gene ClpB1. M-1 kb Plus Marker, Lane 1 ZnGClpB1 from genotype Jaisalmer, Lane 2 ZnJClpB1 from genotype Godhra, D) Confirmation of obtained clones by colony PCR. M-1 kb Marker, Lane 1-2 amplicon of ZnJClpB1, Lane 3-4 amplicon of ZnGClpB1 E) Restriction digestion analysis. M-1 kb Marker, Lane 1-4 for pGEM-T- ZnGClpB1; Lane 4-8 for pGEM-T-ZnJClpB1.

Gene ClpB1 isolated from Z. nummularia genotype Jaisalmer was functionally validated for heat stress tolerance in tobacco. ZnJClpB1was cloned in binary vector pRI101-AN-DNA (Fig. 2.2) and mobilized in Agrobacterium for transformation of tobacco. Callus formation was induced from leaf discs of 20 day old plants of tobacco which were transformed with the

Agrobacterium harbouring pRI101-AN-ZnJClpB1 (Fig. 2.3).The putative T0 tobacco plants obtained were confirmed by PCR using nptII and gene specific primers and southern hybridization analysis.

Fig. 2.2: ZnJClpB1 construct: Landmarks between left and right border of pRI 101-AN DNA

ICAR-NIPB ANNUAL REPORT 2019

Fig 2.3: A. Tobacco transformation with pRI 101 AN-ZnJClpB1; B. Southern hybridization analysis of tobacco transgenics having gene ZnJClpB1

A B

C D

Fig. 2.4: Physiological and biochemical assays of transgenic (ZnJClpB1) tobacco plants (T1 stage) and wild type tobacco plants, WT- wild type, L- transgenic line number, A- Relative water content, B-chlorophyll content C- Membrane Stability Index, D- malondialdehyde levels.

ICAR-NIPB ANNUAL REPORT 2019

In randomly selected transgenic lines (T1) of three independent transgenic events having a single copy insertion, physio‐biochemical analysis was carried out for heat stress tolerance. It was observed that overexpression of gene ZnJClpB1-C under a constitutive promoter in tobacco, significantly increased RWC, chlorophyll content, MSI and decreased MDA in these transgenic plants. The transgenic tobacco lines were able to confer enhanced heat stress tolerance (Fig. 2.4).

Overexpression of EcDREB2A transcription factor from Finger millet in tobacco enhances tolerance to heat stress through ROS scavenging (Amolkumar U Solanke, Sonam Singh, Ramakrishna Chopperla, Jasdeep C Padaria and TR Sharma) The rise and fall in temperature lead to heat and chilling stress in crop plants, respectively. These stresses are one of the primary constraints for plant development and yield, especially in crop plants. Finger millet, being a climate resilient crop, is a potential source of novel stress tolerant genes. The present study aimed at functional characterization of finger millet DREB2A gene in different abiotic stress conditions. This novel EcDREB2A transcription factor isolated from finger millet is a truncated version of DREB2A gene compared to previously reported DREB genes from other plant species. The overexpression of EcDREB2A in transgenic tobacco exhibits improved tolerance against heat stress by altering physiology and biochemical means at 42°C for up to 7 days. However, same transgenic lines were unable to provide tolerance to 200 mM NaCl and 200 mM Mannitol stress. Under heat stress conditions, increased seed germination with improved lateral roots, fresh and dry weight compared to wild type (WT) were observed. The EcDREB2A transgenics exposed to heat stress showed improved rate of stomatal conductance, chlorophyll and carotenoid contents, and other photosynthesis parameters compared to WT plants. EcDREB2A overexpression also resulted in increased activity of important enzymatic antioxidants (SOD, CAT, GR, POD and APX) with decreased electrolyte leakage (EL), H2O2 and malondialdehyde (MDA) content than WT plants after heat stress. Quantitative real time expression analysis demonstrated that all eight downstream genes were significantly upregulated in transgenic plants only after heat stress. Our data provide a clear demonstration of the positive impact of overexpression of EcDREB2A governing heat stress tolerance to plants.

ICAR-NIPB ANNUAL REPORT 2019

Fig. 2.5: Seed germination analysis of transgenic tobacco plants under heat stress. (a) Morphology, (b) percent seed germination analysis, (c) fresh weight, (d) lateral root length, (e) dry weight of transgenic lines and WT plants of 12 d old seedlings for 24 h and 48 h heat stress. (f and g) Leaf disc senescence assay of WT and transgenic plants.

Fig. 2.6: Biochemical assay of plant defense enzymes in EcDREB2A transgenics after heat stress at 42°C. Effects of heat stress on SOD (a), CAT(b), GR (c), POD (d) and APX (e) activities in transgenics and WT leaves after heat treatments.

ICAR-NIPB ANNUAL REPORT 2019

Development of wheat transgenics with heat inducible genes (Namrata Pandey, Praful Jaiswal, Shyamananda Arambam and Sharmistha Barthakur) RNA binding proteins (RBPs) are involved in post transcriptional modification that control mRNA metabolism allowing cells to rapidly adapt to changing physiological and environmental conditions. A mature embryo based tissue culture protocol was developed for transformation of wheat. The current protocol was further used for wheat transformation using a RRM domain rich RNA binding protein (RBP) identified and isolated from wheat in the lab earlier (Accession number KJ830757.1) . The putative transformants after antibiotics screening, PCR analyses were advanced into next generation and T2 seeds collected. Preliminary molecular analyses are being carried out (Fig. 2.7).

Fig. 2.7: Wheat plants over expressing a RRM domain rich RNA binding protein, harvesting of T2 seeds

Fig. 2.8: Molecular analyses of SKP1 putative transgenic lines at T3 stage a.Lane M: 1kbp DNA ladder, Lane 1-8: Putative transgenic plants DNA (b) PCR with HptII primer Lane M: 100bp DNA ladder, Lane 1: Vector DNA Lane 2: Wild type DNA Lane 3-10: Putative transgenic DNA (c). PCR confirmation with HptII primer Lane M: 100bp DNA ladder, Lane 1: Vector DNA Lane 2-7: Putative transgenic DNA (d) PCR non-radioactive DIG southern confirmation Lane M: Dig labeled DNA ladder Lane 1: Vector DNA Lane 2-7: Putative transgenic plants DNA (e) Non-radioactive Southern blot of transformed plants

ICAR-NIPB ANNUAL REPORT 2019

Molecular analyses of SKP1 over expressing wheat lines at T4-T5 generation developed by apical meristem based tissue culture independent in planta technique are being analyzed at molecular level (Fig. 2.8). Another group of wheat transgenics developed using a calcium signaling gene Annexin, also by apical meristem based technique. T1 generation plants were screened by antibiotic segregation, GUS Histochemical assay and further advanced into next generation and T2 seeds collected (Fig. 2.9).

Fig 2.9: Development of wheat transformants using Annexin gene

Elucidating acquired and transgenerational thermotolerance in wheat vide hormonal and heat priming and clarifying the role of ubiquitin proteasome system (Praful Jaiswal and Sharmistha Barthakur) Stress memory can be defined as genetic, epigenetic and physiological changes under stress conditions which alters response to reoccurring stress in the same generation (in generation) or in the next generation (trans-generation). The primability of plant stress response is a means to prevent the delay that a plant takes to respond to a stress. Thus, primability is the ability to become prepared or primed for improved inducible response to a subsequent stress. Numerous environmental cues have been shown to prime a plant for improved resistance to repeated environmental stress. Ubiquitin proteasome system (UPS) is intricately involved in protein turn over and signalling of various plant growth regulators vide post translational modifications. Towards isolating and functionally characterizing role of individual hormone in modulating heat stress response, we are studying their modulation and regulatory effect on wheat under heat stress. The SKP1 gene involved in protein turnover which is an essential component of SCF complex (Skp1-Cullin-F-box protein) was used as heat inducible transcript marker for molecular characterization. Differential modulation of SKP1 gene was observed. Selected panel of plants in primed2 (P2) and primed3 (P3) generation are being further evaluated for elucidating molecular mechanisms of heat stress memory at the

ICAR-NIPB ANNUAL REPORT 2019 mechanistic level by extensive phenotyping as well as molecular characterization. In fig. 2.10 evaluation of various agronomic parameters after epibrassinolide and heat priming is shown. Chlorophyll index of primed plants is shown in fig 2.11. Allele mining for SKP1 was also carried out in a panel of diverse wheat germplasm by real time RTPCR under ambient and heat stress condition which showed differential expression (Fig. 2.12).

120 25 Ambient Heat stress a Ambient Heat stress b 100 a ab b a 20 c b d d d d d cd bc bcd 80 e e 15 a a 60 ab ab a bc abc ab

10 c bcd cd 40 Height in (cm) d de de Tillerno./plant d e 20 5 0 0 NP HT EBR EBR +HT NP HT EBR EBR +HT NP HT EBR EBR +HT NP HT EBR EBR +HT P1 P2 25 P1 AmbientP2 Heat stress Treatments a a a a Treatmentsa 3 c d a Ambient Heat stress 20 b b b b ab a b b 2 b b abc c ab c c bcd 15 c c c c cde cde c c de e 2 10

Width(cm) 1 FLLength (cm) 5

1 0 NP HT EBR EBR +HT NP HT EBR EBR +HT 0 P1 P2 NP HT EBR EBR +HT NP HT EBR EBR +HT 25 Treatments Ambient Heat stress P1 P2 a ab Treatments b 20 cd bc a a a f b ab ab ee e de c 15 d

PD PD Length(cm) 5

0 NP HT EBR EBR +HT NP HT EBR EBR +HT P1 P2 Treatments

Fig. 2.10: Morphological analyses of HD2967 cultivar grown in natural condition in net house after seed primed with Epibrassinolide; NP: no priming, HT: high temperature primed, A: Ambient, HT: high temperature EBR: epibrassinolide a) tiller number b) height c) flag leaf length d) flag leaf width e) peduncle length f) In situ heat trap chamber and a view of plants exposed to high temperature inside the chamber at the post- anthesis stage.

Fig 2.11: Chlorophyll index of epibrassinolide and heat primed plants. NP: no priming, HT: high temperature primed, A: Ambient, HT: high temperature EBR: epibrassinolide

ICAR-NIPB ANNUAL REPORT 2019

Fig. 2.12: Real time RTPCR analysis of SKP1 in a panel of wheat germplasm under ambient and heat stress condition a: Flag Leaf, b. Ear head

Salinity tolerance in wheat Identification and cloning of genes for salinity tolerance in wheat (Kanika and Priyanka) Soil salinity is a major constraint to wheat production around the world. Modern high yielding varieties are particularly sensitive to high salt stress. There are salt tolerant landraces and but there is limited information on genomic regions (QTLs) and genes responsible for their tolerance and their mechanism of action. Kharchia Local is a well-known genetic resource which can be used to improve our understanding of mechanisms of salinity tolerance. In the present study functional validation of gene Ta NHX1 cloned from Kharchia local was carried out using transgenic approach. Floral dip method of transformation was used for generating transgenics. The transgenics status of the plant was confirmed by Polymerase chain Reaction and Southern blotting (Fig. 2.13). The southern positive single copy transgenics were subsequently evaluated for their tolerance to salt stress. Changes in various parameters including MSI, RWC and chlorophyll content were monitored under stress and control conditions. Ratio of Na/K ion was measured in the leaves of these plants under control and salt stress conditions. The transgenics were able to maintain higher MSI, RWC and chlorophyll content as compared to wild type. The leaves of transgenics were able to reduce the increase in the Na/ K ratio as compared to wild type under salt stress (Fig. 2.14).

ICAR-NIPB ANNUAL REPORT 2019

M 1 2 3 M 1 2 3 4 4 5 5 6

B-6 29-3

B-2

Fig. 2.13: Southern blot analysis of T1 plants of wheat genotype (a) HD 2967 and (b) Bobwhite. Genomic DNA digested with KpnI was hybridized with PCR amplified DIG- labeled hptII gene fragment as probe. Lane M: lambda-HindIII marker, Lane-1: plasmid DNA sample as positive control, Lane-2: non-transformed genomic DNA as negative control,

(B) Lane 3-5: DNA samples from different T1 plants of HD 2967, (C) Lane 3-6: DNA

samples from different T1 plants of Bobwhite.

Fig. 2.14: a: Analysis of CHL content at 20 days under control and stress conditions in leaves of both WT and transgenic lines; b: analysis of Na+/K+ ratio at 20 days under control and stress conditions in leaves of both WT and transgenic lines

ICAR-NIPB ANNUAL REPORT 2019

QTL mapping is one of the most common approaches for the genetic dissection of quantitative traits, which provides the basis for map-based cloning of genes and marker- assisted selection (MAS) in crop breeding. In order to identify the (QTLs) governing salinity stress tolerance in wheat, generation advancement of mapping populations involving Kharchia 65 as one of the parent is underway. The parents are being phenotyped under salt stress conditions in hydroponics (Fig. 2.15).

Control Salt stress Kharchia-65 HD 2851 Kharchia-65 HD 2851

Fig. 2.15. Effect of salt stress on wheat varieties Kharchia-65 and HD 2851, after 14 days of salt treatment under control and salt stress (10 ECiw) in hydroponics conditions

Drought tolerance in wheat Cloning of promoter deletion fragments and transient GUS assay of PM19 promoter from wheat (Johan Ajnabi and Monika Dalal) PM19 is an ABA induced plasma membrane protein which is involved in seed dormancy, embryo development and influx of ABA in plants. Preliminary studies on PM19 gene from wheat in our lab showed that it is an early drought responsive gene with significantly higher expression in roots under drought stress. A 2.5 kb promoter of PM19 gene has been cloned from wheat genotype Raj3765. To identify the cis-regulatory regions regulating the expression of PM19 gene, four promoter deletion fragments viz. PM19p1 (-1481), PM19p2 (- 672), PM19p3 (-301) and PM19p4 (PM19p3 with 66 bp 5 UTR) of PM19 gene from Raj3765 were amplified and cloned upstream of GUS reporter gene (Fig. 2.16). These constructs were transformed into agrobacterium. The response of the promoter deletion fragments to hormones such as ABA, IAA, and osmotic stress (15% PEG) was analysed at two time points (2 h and 16 h) by transient expression in N. benthamiana leaves (Fig. 2.17). Promoter fragments PM19p1 and PM19p2 showed GUS activity after 2 h of treatment which increased significantly in 16 h treated leaf tissues. PM19p3 and PM19p4 showed very low GUS activity after 2 h.

ICAR-NIPB ANNUAL REPORT 2019

Fig. 2.16: Amplification and cloning of 5 deletion fragments of PM19 promoter from Raj3765. a) amplification of promoter deletion fragments and b) confirmation of cloned promoter fragments in to binary vector by restriction analysis. M, 1 kb molecular weight marker

Fig. 2.17: Transient GUS expression analysis of PM19 promoter fragments from Raj3765 (PM19p1, PM19p2, PM19p3 and PM19p4) in N. benthamiana leaves after treatment with different growth regulators (100 μM ABA, 50 μM IAA) and 15% PEG treatment for a) 2 h and b) 16 h.

However, after 16 h, moderate GUS staining was visible in PM19p3 and PM19p4 infiltrated tissues. The GUS activity by PM19p3 and PM19p4 was significantly lower than that of tissues infiltrated with PM19p1 and PM19p2. The transient expression analysis of these four constructs revealed that the region between -301 to -1481 may be responsible for higher and early expression of PM19 gene. The region of -301 bp upstream to 5 UTR might be the minimal promoter of PM19 gene. A detailed functional characterization would help in understanding the role of these cis-regulatory regions in spatio-temporal and abiotic stress mediated regulation of PM19 gene in wheat. Hence these constructs will be genetically transformed into Tobacco for detailed characterization.

ICAR-NIPB ANNUAL REPORT 2019

Nitrogen use efficiency in wheat Morphological and biochemical phenotyping of diverse wheat genotypes for nitrogen use efficiency (Gayatri, Subodh Kumar Sinha, Nagendra Kumar Singh and Pranab Kumar Mandal) Morphological (Shoot and Root length, Shoot and Root fresh and dry weight) and biochemical phenotyping (Key N-metabolizing enzyme assay of NR, GS, GOGAT, ICDH and AlaT; soluble protein, Chlorophyll and Carotenoids) of >300 wheat genotypes (including those from UK and India) in three replications has been completed during the reporting period. The observation showed that the distribution of the data of different parameters was almost normally distributed. We have repeated the experiments with the genotypes wherever there was doubtful observations. The compiled data will be used for GWAS.

Population structure analysis from SNP genotyping data of Indian wheat accessions (Pranab Kumar Mandal and K. Venkatesh) A preliminary population structure analysis has been carried out using the SNP genotyping data of Modern Indian Wheat, CIMMYT collection in India and Watkin’s collection (mostly land races) (Fig. 2.18). Overall it was observed from the study that how the Watkin land races collected from India is related with the CIMMYT collected and Indian varieties. CIMMYT lines were close to the Indian varieties than that of landraces.

Fig. 2.18: Relation between the Landraces (Green), CiMMYT lines (Red) and Indian Varieties (Blue)

Transcriptome analysis of hexaploid bread wheat and its diploid progenitors of during grain development (Megha Kaushik, Subham Rai, Subodh Kumar Sinha, Sumedha Mohan and Pranab Kumar Mandal) A comparative RNA-Seq analysis was conducted between hexaploid wheat and its individual diploid progenitors to know the major DEGs involved during grain development. Two libraries from each species were generated with an average of 55.63, 55.23, 68.13 and 103.81 million reads and their functional annotation of transcripts resulted in 79.3K, 113.7K, 90.6K

ICAR-NIPB ANNUAL REPORT 2019

Fig. 2.19: Stage-specific expression (blue—2WAA; red—3WAA; green—4WAA; purple— 5WAA) of highly expressed genes belonging to three major classes (NR, CM, and DP) (SRP—sulphur rich seed storage protein; ABG—alpha/beta gliadin; G—germin; GG— gamma gliadin; HMW—high molecular weight glutenin; AG—alpha- glucosidase; AM— alpha-amylase; BG—beta-glucosidase; GBSS—granule bound starch synthase; BA—beta- amylase; TI—trypsin inhibitor CMe; TH—thionin; BTI—Bowman-Birk trypsin inhibitor; SCI—subtilisin chymotrypsin inhibitor; WMAI—wheat monomeric amylase inhibitor).

ICAR-NIPB ANNUAL REPORT 2019 and 121.3K number of transcripts in A, B, D and ABD respectively. Number of expressed genes in hexaploid wheat was not proportional to its genome size, but marginally higher than that of diploid progenitors. However, to capture all the transcripts in hexaploid wheat, sufficiently higher number of reads was required. Functional analysis of DEGs in all three comparisons showed their predominance in three major classes of genes during grain development i.e. nutrient reservoirs, carbohydrate metabolism and defence proteins; and the DEGs were validated through qRT-PCR. Further, developmental stage specific gene expression of these three classes showed overall defence protein expressed during initial stages in hexaploid contrary to the diploids at later stages; carbohydrates anabolic genes expressed during early stages whereas catabolic genes at later stages in all species; and no uniform trend was observed in case of different nutrient reservoirs (Fig. 2.19). This data could be used to study the comparative gene expression among the three diploid species and also homeologue specific expression in hexaploid.

Molecular characterization of GS2 and Fd-GOGAT genes in bread wheat (Triticum aestivum L.) and in their diploid progenitors (Gayatri, Karikalan Jayaraman, Subodh Kumar Sinha, and Pranab Kumar Mandal) We aimed to analyse GS2 and Fd-GOGAT genes at their molecular level to derive the extent of variation occurred during evolution from ancient diploid progenitors to the modern hexaploid bread wheat. We also assayed both the enzymes and studied the gene expression pattern under nitrogen stress in cultivated wheat and their progenitors. Moreover, we also investigated the degree of resilience under nitrogen stress among these species in terms of few important morpho-physiological and biochemical parameters.

Fig. 2.20: Differential gene expression under N stress in shoot tissues (left) GS2 gene expression (right) Fd-GOGAT gene expression.

Protein structure and phylogenetic analysis of these genes revealed their conserved nature and close relatedness during the evolution. Through Southern blot analysis, both genes were found to be present in three copies in bread wheat, two copies in durum wheat; and single

ICAR-NIPB ANNUAL REPORT 2019 copy in their diploid progenitors. Genome species specific enzyme activity as well as differential gene expression (Fig 2.20) suggested the major differences in gene regulation, and not in their protein structure. All growth parameters except root length got decreased or unchanged with different degree of plasticity in the genotypes under nitrogen stress. Combined PCA analysis of all the parameters revealed that GS2/Fd-GOGAT enzyme activity, N accumulation, protein, chlorophyll and carotenoids content were nitrogen responsive. Our study confirmed the conserved nature of GS2 and Fd-GOGAT enzymes, but their expression and subsequent effects were different in cultivated wheat and their progenitors.

Cloning important ATIs and their in silico characterization (Megha Kaushik, Subodh Sinha and Pranab Kumar Mandal) During the reporting period, cloning of six ATIs (CM1, CM2, CM3, CM16, 0.19, 0.53) from haploid bread wheat variety HD 2967 is complete. Sequences and their differences in derived protein structure have been analysed. These genes do not have any intron and there are negligible differences among the homeologues. To confirm the homeologues differences, all the six genes were cloned from their diploid progenitor Triticum monococcum (AA), Aegilops speltoides (BB) and A. tauschii (DD) and also from T. durum (AABB). The genes were confirmed to be conserved across the genome species.

Identification, cloning and expression studies of AtNRT1.5 ortholog in wheat (Triticum aestivum L.) (Muhammed Shamnas V, Pranab Kumar Mandal, Subodh Kumar Sinha) Arabidopsis NRT1.5 (NPF7.1) has been demonstrated to be a key low affinity nitrate transporter responsible for root to shoot nitrate transport. Genome wide identification, cloning and quantitative sub-genome specific expression of AtNRT1.5 orthologs in bread wheat was studied. Two orthologs, TaNRT1.5A and TaNRT1.5B, located in chromosome 6 of all three sub-genomes were identified using AtNRT1.5 (AT1g32450) mRNA as seed sequence. Phylogenetic analysis indicated two separate groups of the two orthologs in which one is more closure to brachypodium, whereas the other is with rice (Fig. 2.21). Genome organization, cDNA length, protein length, number and length of 5′ and 3′ UTRs of both genes and their homeologs were found to be very different; however amino acid sequences were quite conserved. The homeolog specific expression of both TaNRT1.5A and TaNRT1.5B genes in root tissues of 21 days old seedlings of two wheat genotypes, e.g., HD2985 and K9107, at two external nitrate concentrations demonstrated that D sub-genome specific TaNRT1.5A expressed maximally than that of A and B genomes at both the concentrations of N, but expression level was more in K9107 than HD2967. Whereas, A sub-genome specific TaNRT1.5B expression was more than the other two sub-genomes again in K9107 compared to HD2985 (Fig. 2.22). Homeolog specific cDNA sequence was cloned from root tissue of K9107. Interestingly,

ICAR-NIPB ANNUAL REPORT 2019 restriction pattern of two clones of TaNRT1.5A resulted in two slightly different length of released fragment which was not differentiated during cDNA amplification. Sequencing results confirmed presence of additional 147 nucleotide sequence in one of the clones, whereas nucleotide sequence of the other one was similar to that of Chinese Spring wheat cultivar sequence. Hence, the two clones were termed as TaNRT1.5A (L/S). Putative amino acid sequences of homeologs of both the genes, TaNRT1.5A and TaNRT1.5B, showed high degree of similarity.

Fig. 2.21: Phylogenetic tree showing evolutionary relationship of NRT1.5 cDNA sequences of wheat, rice, brachypodium and Arabidopsis (above), and genome organization of TaNRT1.5A and TaNRT1.5B homeologs (below).

Fig. 2.22: Real time quantitative PCR showing the relative homeologs expression of TaNRT1.5A and TaNRT1.5B grown under different high nitrate concentration.

ICAR-NIPB ANNUAL REPORT 2019

Differential 15N-influx, its translocation and modulation of root system architecture of diverse wheat genotypes under different external N-levels (Amresh Kumar, Pranab Kumar Mandal, Subodh Kumar Sinha) In order to identify the genetic variations in root system architecture traits and their influence on high and low affinity nitrate transport system, study was performed on genetically diverse set of wheat genotypes grown in N-free solid media under two external nitrogen levels (optimum and limited nitrate conditions) at two growth points at seedling stage (e.g., 14 and 21 days old seedling). The nitrate uptake and its transport under different combinations of 15 15 - nitrate availability in external media were measured using a N-enriched N-source ( NO3 ). It has been observed that nitrate starvation invariably increases the total root size in all genotypes. However, the variation of component traits of total root size under nitrate starvation is genotypes specific at both stages (Fig. 2.23).

Fig. 2.23: Root system architecture traits of wheat seedling at two growth stages (14DG and 21DG) in response to external N-concentration. (A and B) Total Root Size (TRS; cm), (C and D) Main Root Pathlength (MRP; cm), (E and F) Lateral Root Size (LRS), (G and H) First Order Lateral Root Number (FOLRN), (I and J) Second Order Lateral Root Number (SOLRN) at 14DG and 21 DG respectively. X-axis denotes name of genotypes studied and represented by two bars denoting N+ and N- external conditions respectively for each genotype. The significance of a treatment (p<0.005) effect (N+ vs N-) among genotypes is indicated with letters above bars.

ICAR-NIPB ANNUAL REPORT 2019

Genotypic variation in both 15N-influx and N-translocation (%N) was observed depending on growth stage, external nitrate concentration and growing conditions of seedlings (Fig. 2.22).

Fig. 2.23: 15N-influx and %-N translocation of ten wheat genotypes (see the legend of Fig. 2.22) at two growth stages and four external N-levels.

Cloning of TaNRT2.1/2.2 and TaNAR2.1/2.2 in suitable vector for in-vitro protein- protein interaction (Amresh Kumar, Pranab Kumar Mandal, Subodh Kumar Sinha) In order to identify potential partner proteins of two component proteins of high affinity nitrate transport system in wheat, open reading frame of previously reported two nitrate transporters genes (i.e., TaNRT2.1 and TaNRT2.2) and two accessory proteins genes, (i.e., TaNAR2.1 and TaNAR2.2) were subsequently cloned in yeast split-ubiquitin protein-protein

ICAR-NIPB ANNUAL REPORT 2019 interaction system consisting of bait and prey vector (pBT3-C and pR3-N) at SfiI site, to study their physical interaction in in-vitro system (Fig. 2.24).

Fig. 2.24: Transformed colonies containing TaNRT2s and TaNAR2s ORFs in bait and prey vector (Above panel: left), PCR amplification of respective genes from transformants (above panel; right), restriction digestion of TaNAR2s and TaNRT2s fragment along with uncut plasmid (lower panel; left and right respectively).

B. Biotic stress tolerance in wheat Marker-assisted introgression of genes/QTLs for resistance to Bipolaris leaf spot (Bipolaris sorokiniana) in wheat (Sanjay K. Singh, Jasdeep C. Padaria, P.K. Singh, Vaibhav K. Singh) Bipolaris leaf spot is an important disease in wheat especially in the hilly regions and cooler altitudes. A marker-assisted backcross breeding program to improve HD2733 has been taken up for this purpose by introgressing the resistant alleles from three different sources namely, Chiyra, SW89-5422 and Shangai. The schematic representation of the breeding using Chiyra source is shown in figure 2.25. The other two crosses, HD 2733 x SW89-5422 and HD 2733 x Shangai are also in the similar stage.

ICAR-NIPB ANNUAL REPORT 2019

Fig. 2.25: Marker assisted improvement of wheat variety HD2733 for Leaf spot

Fig 2.26: Foreground selection in BC3F1 progenies with QTL linked : A. Xgwm425 linked with (Qsb.bhu-2A) and another SSR marker (B) Xgwm67 (Qsb.bhu-5B) associated with spot blotch resistance QTL. , P1= recurrent parent, P2= donor parent, M= 100bp ladder).

Screening lines for Bipolaris Leaf Spot under field condition Field evaluation of all three crosses was taken up at BHU Varanasi. A total of 315 plants were screened of BC3F1generation from three crosses, out of which 158 were found to be

ICAR-NIPB ANNUAL REPORT 2019 resistant. In BC2F2 generation of the three crosses, 324 plants were screened of which 189 showed resistance (Table 2.1 and Fig. 2.27).

Table 2.1: Summary of backcrossed and selfed plants sampled and positive plants identified in different generations

Generations Chiyra x HD2733 SW89-5422 x HD2733 Shangai x HD2733 Total plants

Plants Plants Plants Plants Plants Plants Plants Plants screene positive screened positive screene positive screene

d d d positive

BC3F2 123 62 87 42 105 54 315 158

BC2F2 112 69 95 53 117 67 324 189

Fig. 2.27: Evaluation of Back crosses early generation material Marker assisted improvement of spot blotch resistance lines for resistance to yellow rust The backcross with F1 plants of cross between Lamayuru local resistant line of yellow rust crosses with BC3F2 resistant Line (YR) x (HD 3402-76 (SBR) of, HD 3501-54 of HD2733x

SW89-5422 and HD 3601-112 of HD 2733 x Shangai with the recurrent parents using F1 plants as male at Lahul and Spiti (Fig. 2.28). The BC1F1 seed grow during rabi season at IARI New Delhi. Parental polymorphic survey of Lamayuru local , HD 3402-76, HD 3501 and HD 3601-112 was conducted using selected SSRs. Foreground section of 180 BC1F1

ICAR-NIPB ANNUAL REPORT 2019 plants will be followed by second backcross using 15 plants carrying the favourable alleles in the 2020 Rabi season at New Delhi.

Fig. 2.28: Marker assisted improvement of wheat SBR breeding line for rust

ICAR-NIPB ANNUAL REPORT 2019

3. Improvement of Stress Tolerance and Quality Traits in Chickpea

ICAR-NIPB ANNUAL REPORT 2019

3. Improvement of Stress Tolerance and Quality Traits in Chickpea A. Abiotic stress tolerance in Chickpea Release of a drought tolerant variety in chickpea (PK. Jain and C Bharadwaj) In 2019, a variety was released by IARI in which our Institute is involved as a collaborator. Pusa Chickpea 10216 (BGM 10216) is a marker assisted backcross derived drought tolerant introgression line of chickpea variety “Pusa 372” possessing introgression of “QTL hot spot” for drought tolerance from ICC 4958 (Fig. 3.1). Pusa Chickpea 10216 (BGM 10216) gave an overall weighted mean yield of 1475 kg/ha and has an yield potential of 2575 kg/ha under drought stress conditions over the recurrent parent Pusa 372 which yielded 1272 kg/ha (Fig. 3.2). It has an excellent grain color, size and shape. Its average 100-seed weight is 22.2 g. The grain protein content is 22.6 per cent.

Fig. 3.1: Notification and release of chickpea variety through MABC

Fig. 3.2: Single plant view of the newly released drought tolerant variety BGM10216

ICAR-NIPB ANNUAL REPORT 2019

Identification and structural characterization of SOS gene family in chickpea for salinity tolerance (Cicer arietinum L.) (Nimmy M.S., Vinod Kumar, Panneerselvam Krishnasamy, Ramawatar Nagar and P.K. Jain) Salinity is an important environmental factor limiting plant survival with negative influence on growth and productivity. Genes that are induced in response to salt stress are thought to play major role in conferring stress tolerance. One of the mechanism for achieving plant salt tolerance is by intra-cellular compartmentation ie, ion homeostasis pathway. Salt Overly Sensitive (SOS) regulatory pathway is one good example of ion homeostasis which results in Na+ extrusion from the cytosol. It has been well characterized in the model plant Arabidopsis. SOS3, the first SOS gene cloned, encodes a Ca binding protein and SOS3 interacts directly with SOS2. The SOS2 gene encodes a Ser/Thr protein kinase of 446 aa. SOS1 is a plasma membrane localized Na+/H+ antiporter. To the best of our knowledge, till today there are no reports in case of chickpea for detailed analysis of SOS family genes and their role in salt tolerance.We have identified a total of six SOS genes in Arabidopsis. Using the protein sequences of 6 Arabidopsis SOS genes, we could identify a total of 7 SOS genes in Cicer arietinum CDC Frontier which are true homologs (Table 3.1).

Table 3.1: A total of seven SOS genes were identified in Cicer arietinum CDC Frontier Arabidopsis Description CDC % identity Araport11 Frontier SOS1 AT2G01980 Na+/H+ Antiporter Ca_05086 62.54 SOS2 AT5G35410 Protein Kinase domain Ca_06677 70.50 SOS3 AT5G24270 EF-hand domain pair Ca_03979 72.44 Ca_05834 59.09 SOS4 AT5G37850 Phosphomethyl pyrimidine kinase Ca_16133 80.13 SOS5 AT3G46550 Fasciclin domain Ca_20284 55.31 SOS6 AT1G02730 Cellulose synthase Ca_00986 78.59

A comparison of genomic distribution of SOS genes in both Arabidopsis and chickpea has been carried out. It has been observed that the SOS genes are distributed on all 5 chromosomes of Arabidopsis except chromosome 4. In case of chickpea the SOS genes are distributed on all 8 chromosomes except chromosome 4 and 8. Gene structure analysis (Fig.3.3) of chickpea SOS genes revealed that the number of exons ranges from 1-2.

ICAR-NIPB ANNUAL REPORT 2019

Fig. 3.3: Gene structure analysis of Chickpea SOS genes

Chickpea SOS protein length varied from 191-1167 aminoacids whereas the Arabidopsis SOS proteins ranged from 446-1146 aminoacids in length indicating there are more variations in chickpea compared with Arabidopsis. The predicted molecular weights (MW) of chickpea SOS proteins range from 21.74 to 130.76 kDa, and the predicted pI values are between 4.67 and 7.47. The predicted subcellular localization of chickpea SOS proteins include plasma membrane, cytoplasm, nucleus and chloroplast. 3D structure of all SOS proteins in chickpea reveals the transmembrane helices. Several stress - responsive cis elements such as ABRE, ARE, HSE, MBS, TCA elements were identified in the 1500bp upstream region of these seven CarSOS genes. To know the evolutionary relationship of SOS proteins a phylogenetic tree was constructed (Fig.3.4). This study provides a foundation to further investigate the functions of this identified genes in salt tolerance in chickpea.

Fig. 3.4: Phylogeny of SOS1 genes from legume crops

ICAR-NIPB ANNUAL REPORT 2019

B. Biotic stress tolerance Isolation and characterization of insecticidal genes from native Bacillus thuringiensis isolates (Sarvjeet Kaur, Anupma Singh, Mamta Gupta, Deepak Kumar Rathore and Vinay Kalia) Chickpea is an important pulse crop and a rich source of protein in Indian diet. Polyphagous lepidopteran insect pests such as Helicoverpa armigera (cotton bollworm/gram pod borer) cause extensive damage to chickpea and several other economically important crops. H. armigera is a major pest of national significance on chickpea, causing 10 to 90 per cent yield loss (NCIPM 2014). This pest has increasingly developed resistance to chemical insecticides, necessitating alternative methods of control. Endogenous defense towards this pest is largely not available in the cultivated chickpea varieties. Bacillus thuringiensis (Bt), is an aerobic, spore-forming Gram-positive bacterium that produces insecticidal crystal proteins (Cry), cytolytic (Cyt) and vegetative insecticidal proteins (Vip), which have specific toxicity towards insect pests of different insect orders, while being safe for non-target species. Bt has been extensively used as microbial biopesticide for the past five decades, but its use has been limited due to the problems of narrow host range, low persistence on plants and inability of foliar application to reach the insects feeding inside the plants. Development of transgenic crops expressing Bt genes is a promising approach; however, single-gene transgenic crops pose the serious threat of resistance development in the target pests. Gene pyramiding is an efficient strategy in resistance management of Bt-transgenic crops, wherein more than one insecticidal gene having different binding sites in the insect midgut to delay the onset of resistance, are deployed. Since development of efficacious transgenics requires new insecticidal genes for use in a stacking mode, identification of insecticidal genes from Bt isolates is important. We report work carried out in our laboratory on vip3Aa-type genes, which may have potential for deployment in pest control.

Efficacy of vip3Aa44 gene towards Helicoverpa armigera (Cotton Bollworm) and Spodoptera litura (Cotton leaf worm) The vip3Aa-type genes are promising candidate toxins against lepidopteran insects, and have different receptor binding sites in the target insect midgut, as compared with that of cry genes. Therefore, vip3Aa-type genes are useful in pyramiding of genes for durable insect resistance. The vip3Aa genes have been used in transgenic events of Bt cotton e.g. Bollgard III (cry1ac +cry2Ab+ vip3a) to increase longevity of resistance against target pests, as the three toxins act on different receptors in the insect midgut. Helicoverpa armigera (pod borer, cotton boll worm) and Spodoptera litura (cotton leaf worm) both are polyphagous insects. Vip3A has been found efficacious against H. armigera (Fang et al 2006; Lee et al., 2003) and S. litura (Song et al., 2016). In our study, laboratory bioassays under controlled conditions (25+ 2 C, 60 % RH) were performed with H. armigera and S. litura neonate larvae on detached leaves of five putative T0 transgenic tobacco (N. tabacum cv. Petite Havana) lines developed with Agrobacterium tumefaciens strain EHA105 mediated transformation using

ICAR-NIPB ANNUAL REPORT 2019

BinAR-vip3Aa44 construct carrying codon-optimized synthetic version (GenScript) of vip3Aa44 gene (NCBI Accession No.HQ650163), cloned from B. thuringiensis subsp. thuringiensis strain (4A6, BGSC). Larval mortality after 72 h, was observed to be 56% and 60%, for H. armigera and S. litura respectively (Fig.3.5). Therefore, vip3Aa44 gene can be a candidate for deployment for gene pyramiding in transgenic crops for protection from these two important pests.

A B

Fig. 3.5: Insect bioassay of vip3Aa44 putative T0 transgenics A) Bar graph representing per cent corrected mortality (Abbott’s formula) of H. armigera on Vip3Aa44 tobacco transgenic T0 lines. B) Bar graph representing per cent corrected mortality of S. litura on putative T0 tobacco transgenics. The bioassay was performed under controlled conditions with non-transgenic tobacco leaves as control and the mortality percentage was calculated using corrected mortality. Corrected mortality=T-C/100-C*100. Ten larvae per plate with three replicates for each putative transgenic line (30 larvae/ line) were used. Mortality data was taken at every 24 h. Bar graph was prepared by comparing the mean value of corrected mortality of different lines and one way ANOVA analysis at p<0.05 using GraphPad Prism 8.0 software.

Frequency distribution of vip3A-type genes in native Bt isolates from diverse habitats Frequency distribution of vip3 genes in Bt isolates recovered from various soil habitats in India was carried out to analyze the effect of type of soil on distribution by PCR using primers designed from the conserved regions of vip3-type genes. Heterogeneous distribution (20%-100%) of vip3-type genes in Bt isolates was observed, which may be due to ecological and nutritional conditions of soil (Fig. 3.6). The overall frequency of occurrence of vip3-type genes was found not to be significantly different in native Bt isolates recovered from soil samples of cropped and non-cropped areas. Nevertheless, Bt isolates recovered from forest soil samples were found to be least abundant in vip3-type genes. Results indicated that our Bt collection from various soil habitats is a rich source of vip3-type genes, which can be further explored for isolation of full length unique vip3-type genes having toxicity against agriculturally important lepidopteran insects for deployment in insect pest control.

ICAR-NIPB ANNUAL REPORT 2019

Fig. 3.6: Frequency distribution of vip3 genes in native Bt isolates from various soil habitats in India.

Assembling and annotation of chickpea fusarium wilt pathogen Fusarium oxysporum f. sp. ciceris. (Ramawatar Nagar, Nimmy M.S and PK Jain) High racial heterogeneity in the chickpea fusarium wilt pathogen Fusarium oxysporum f. sp. Ciceris in the different agro-ecological zones of India has been challenging in breeding stable Foc resistant chickpea lines. Therefore, understanding Foc racial diversity to delineate prevalent races in a given agro-ecological zone is critical for breeding stable wilt resistant chickpea lines. Mitochondrial DNA has been a marker of choice for molecular ecology, phylogeographic, and phylogenetic studies. The high mutation rate can generate signals about population history in a short time. Besides, the uniparental inheritance makes mtDNA being transmitted clonally through either of the parents enabling inferring evolutionary histories of an organism without the complexities introduced by biparental recombination. We have assembled mt-genome (Fig.3.7) of chickpea wilt pathogen, Foc which will be used as a maker to understand Foc diversity in the different agroecological zone of India. To assemble the mitochondrial genome of Foc, we used publicly available whole-genome sequencing data of Foc isolate, Foc-38-1(SRR837400). The reads of mitochondrial origin were enriched from whole-genome sequencing data by aligning the Foc-38-1 reads to the mt- genome of close relatives, Fusarium oxysporum f. sp. lycopersici race 3 isolate D11 mt- genome (GenBank: CM012197.1) using bwa version 0.7.15-r1140. The reads of mt-origin were then mapped to the Fol race 3 isolate D11 mt-genome to construct Foc mt-genome using a baiting and iterative mapping approach implemented in the MITObim. At the end of the mapping process, it produced a novel Foc mitochondrial genome of 46504kb. The mt-genome was annotated with two independent mt-genome annotation tools, GeSeq web browser, https://chlorobox.mpimp-golm.mpg.de/geseq.html and MITO web server using genetic code 4, http://mitos.bioinf.uni-leipzig.de/index.py.

ICAR-NIPB ANNUAL REPORT 2019

The Foc mt-genome was found to contain all protein and non-coding genes typical of fungal mt-genome. The Foc mt-genome codes for 14 protein-coding genes that specify components of the electron transport chain and oxidative phosphorylation, including three copies of the ATP synthase complex (atp6, atp8 and atp9), seven subunits of the nicotinamide adenine dinucleotide ubiquinone oxidoreductase complex (nad1, nad2, nad3, nad4 ,nad4L, nad5 and nad6), one cytochrome b (cob), and three subunits of cytochrome c oxidase (cox1, cox2 and cox3). Introns were also identified in two protein-coding genes nad5 and cob. Also, the Foc mt-genome encodes for a set of 21 tRNA and one large and small subunit of rRNA gene. This would be the first report of Foc mt-genome which would be submitted to GenBank. The Foc mt-genome will used for the phylogenetic and phylogeographical study of the Foc in India.

Fig. 3.7: Full-length mitochondrial genome of chickpea wilt pathogen, Fusarium oxysporum f. sp. ciceris isolate Foc-38-1

C. Quality traits Genome –wide association study of seed protein content in chickpea (Yashwant Yadav, Hegde and PK. Jain) An association panel of 402 chickpea genotypes was constituted and seed protein content was measured from samples grown at Delhi, Ludhiana and Kanpur (Fig. 3.8). DNA was isolated from all these samples and GBS analysis was done for Seed Protein Content (SPC).

ICAR-NIPB ANNUAL REPORT 2019

8 9 5 4 0 6 7 0

3 1 6 1 6 5 1 8 1 1 5 3 1 1 1 4

Crude Protein (%)

Fig. 3.8: Distribution of seed protein content in chickpea genotypes

Genome-Wide SNPs discovery, population structure and genetic diversity analysis of the association panel used for studying quality traits The 96-plex GBS libraries were made by digesting the genomic DNA of chickpea accessions (association panel) with ApeKI and ligating the digested DNA to adapters containing unique barcodes. The total number of high-quality SNPs identified was 151,006 out of 215,0951 after filtering the missing and monomorphic data. Of the 151,006 SNP markers, 119,050 were not assigned to any chromosomal location and the remaining 31956 SNP markers were distributed across eight chromosomes with an average of 3994 SNP markers per chromosome with a genome coverage ranging from 7197 on chromosome 4 to 1642 SNPs on chromosome 8. Distribution of SNP markers are depicted in detail in Fig. 3.9.

Fig. 3.9: Distribution of SNP markers on different chromosomes

The population structure was assessed by “Ad hoc” statistics to identify the best estimation indicating the number of sub-populations using STRUCTURE software. The results of the

ICAR-NIPB ANNUAL REPORT 2019 analysis indicated that the population architecture was best represented at a subpopulation number of K = 3 value with cultivated accessions (including desi and kabuli), named as POPI, POPII and POPIII (Fig. 3.10).

Fig. 3.10: Population structure (with population number K = 3) illustrating the best possible population genetic structure among different chickpea accessions.

Association mapping analysis of seed protein content The data set of high-quality SNP markers was used for association mapping analysis and approximately 80% of the markers were eliminated from the raw sequence data by filtering missing data. The CMLM model-based association mapping approach identified 23 genomic loci (gene-based SNPs) exhibiting significant association and explained 13-18 % phenotypic variance with SPC. Four gene-based SNP loci were strongly associated (16–18% R 2 with P: 1.9 × 10 −6 to 2.1 × 10 −7 ) with SPC in chickpea (Fig. 3.11). Amino acid transporters (AATs) have been identified in analysis and they are the integral membrane proteins which mediate the transport of amino acids across cellular membranes in higher plants, and play an indispensable role in various processes of plant growth and development. The regulatory SNPs in the known/candidate genes associated with SPC concentrations delineated by GWAS in our study have functional significance towards quantitative dissection of these complex seed quality component traits in chickpea. These inputs further can essentially be utilized for establishing the rapid marker-trait linkages and efficient identification of potential genes/QTLs governing seed protein in chickpea.

ICAR-NIPB ANNUAL REPORT 2019

Fig. 3.11: Manhattan plot showing significant P-values (estimated integrating GLM, MLM, EMMA and CMLM) associated with seed protein contents (SPC) using genome wide distributed 31956 SNPs. The x-axis indicates the relative density of identified reference genome- and de novo-based SNPs physically mapped on eight chromosomes. The y-axis represents the -log10 P-value for significant association with traits. The SNPs with P values ≤ 1x10−6 showing strong trait association are demarcated with lines. The SNPs with P-values ≤ 10−4 are considered significant for trait association.

Transcriptome Analysis and identification and expression analysis of Beta-carotene biosynthesis pathway genes in chickpea (Nimmy M. S; Yashwant Yadav; Deshika Kohli; Ila Joshy and P.K. Jain) Chickpea (Cicer arietinum L.) mostly grown in the semi-arid tropics is the second most important legume crop after common bean (Phaseolus vulgaris L.) (Varshney et al., 2013b) globally in terms of production. Carotenoids consist of a group of more than 600 naturally occurring lipophilic pigments, at least 50 of which occur in plants. Plant carotenoids are tetraterpenes derived from the 40-carbon isoprenoid phytoene. Beta-carotene is the most widely distributed and the best-studied carotenoid in plants and the one most efficiently converted to vitamin A. To develop chickpea cultivars with higher carotenoid concentration, information on the genetic basis of carotenogenesis in chickpea as well as the key genes of the pathway are important. In this study, we aimed to identify and quantify the expression of

ICAR-NIPB ANNUAL REPORT 2019 key genes of carotenoid biosynthesis pathway in chickpea by transcriptomics approach using two different chickpea cultivars. Selected genotypes for transcriptome analysis include HK 94 -134(Low β carotene) and KWR-108 ((High β carotene). We have carried out expression analysis of all the pathway genes for β-carotene biosynthesis in chickpea. Among pathway genes 11 shown significant expression (Fig.3.12). Results of this study is an insight into carotenoid biosynthesis in chickpea and it also provides an important reference for further study in this area in related pulse crops.

Fig. 3.12: Gene expression analysis (β-carotene pathway genes) by Real Time quantitative RT-PCR in 2 contrasting chickpea cultivars with respect to β-carotene content

ICAR-NIPB ANNUAL REPORT 2019

4. Stress Tolerance and Quality Improvement in Pigeonpea

ICAR-NIPB ANNUAL REPORT 2019

4. Stress Tolerance and Quality Improvement in Pigeonpea A. Genomics for molecular dissection of yield related traits in pigeonpea Functional genomics of flowering traits in pigeonpea for identification of genes and markers (Kuldeep Kumar, K Durgesh, Sandhya and Kishor Gaikwad)

Pigeonpea (Cajanus cajan (L.) Millsp.) is an important and nutritionally rich grain legume grown majorly in south and south-east Asia. The days to flowering in pigeonpea varies from 60 to 180 days in cultivated lines, encompassed by its large genetic diversity. Although the shorter duration crops are more beneficial to farmer as they can go for multiple cropping but particularly in pigeonpea, farmer prefers long duration varieties due to their high yield potential. In an effort to dissect the days to flowering and associated traits using advance genomics tools, a diverse set of 142 lines showing significance diversity in term of days to flowering were selected. This panel comprises of cultivated lines as well as wild relatives. Besides the variation in term of days to flower the panel also has sufficient variations for other agronomic traits like plant height, determinacy, seed/pod etc. We have used GWAS, QTL-seq, GBS based mapping as well as transcriptomics approach to identify the genomic regions associated with these traits. A comprehensive phenotypic data was collected over 3 seasons for the important traits and it was observed that frequency distribution curve of both days to flowering (DAFF) and days to fifty percent flowering (DAFPF) (Fig. 4.1) depicted that majority of accessions fall in mid duration flowering category and there was a direct correlation between DAFF and DAFPF. The population structure revealed that all the studied accessions stratified into three groups (Fig. 4.2). Association analysis through GAPIT 3.0 for both phenotypes, constructed PCs, LD decay, QQ-plot, heterozygosity analysis was done using default parameters. The QQ Plot showed a very significant correlation between observed and expected values for both DAFF and DAFPF as indicated by the straight line (Fig. 4.3). Similarly, the Manhattan plot indicated presence of stable and consistent SNPs linked to both the traits for all three seasons (Fig. 4.4). Subsequent GWAS analysis revealed a significant association of a particular SNP on NW_017988637.1 scaffold, in all the three year of analysis for both days to first flowering trait and days to fifty percent flowering trait. This is currently in validation and marker development stages in the current season.

To look into the gene expression profiling and its change during the transition from vegetative to reproductive stage, transcriptomics data from vegetative leaf, meristem, reproductive leaf and bud at different time intervals was generated. The transcriptome data has been analysed and candidate genes that are associated with the traits have been identified by aligning with the scaffold identified in the GWAS study (Fig. 4.5). These code for novel and uncharacterized genes and further efforts are being undertaken to confirm their functions. To aid on the overall analysis and look for rare alleles, QTL-seq and GBS based mapping of

F2 plants developed from crossing the early flowering and late flowering genotypes was

ICAR-NIPB ANNUAL REPORT 2019 developed. Two separate population of size 574 and 475 have been developed, one for mapping and other for validation purpose. Sequencing of both parents, bulk and genotyping of F2 by GBS have been finished and the data is under analysis. In an another approach, genome wide analysis and characterization of flowering related genes was taken up in pigeonpea genome in an effort to use the available data and then combine with GWAS data to arrive at a set of candidate genes and understand the molecular pathways. Among these, MADS-box genes are classes of transcription factors actively involved in various physiological and developmental processes in plants. In the present study, genome wide identification of MADS-box genes was done in Cajanus cajan, leading to identification of 102 members, which were then classified into two different groups on the basis of their structure. The gene-based phylogeny of C. cajan MADS-box genes and those of some grain legumes was carried out to detect C. cajan paralogs and orthologs (Fig. 4.6). The characterization of all these MADS-box genes was in three wild types i.e. C. scarabaeoides (ICP15747), C. platycarpus (ICP15665) and C. cajanifolius (ICP15629) revealed that 41 MADS-box genes were missing in the wild cultivars indicating the role of these genes during the process of domestication and evolution. Single copy of Flowering locus C (FLC) and Short vegetative phase (SVP) were found, while Suppressor of activation of Constans 1 (SOC1) was found to be present in three copies in C cajan. One SOC1 gene i.e. CcMADS1.5 was found to be missing in all three wild type, also forming separate clade in the phylogeny, revealing its origin through duplication followed by divergence. Expression profiling of major MADS-box genes like SOC1, FLC, SVP was done in four different tissues viz vegetative meristem, vegetative leaf, reproductive meristem and reproductive bud (Fig. 4.7). Gene based time tree of FLC and SOC1 gene dictates their divergence from Arabidopsis before 71 and 23 million year ago (mya) respectively. The CcMADS1.5 gene is present only in the genome of cultivated variety, indicating its probable role in domestication. This study provides valuable insights into the functions, characteristics and evolution of MADS-box proteins in grain legumes with emphasis on C. cajan.

Fig. 4.1: Phenotypic observations on DAFF and DAPFF for the 142 genotypes

ICAR-NIPB ANNUAL REPORT 2019

Fig. 4.2: Population structure analysis revealed that the undertaken collection stratified into three different groups

Fig. 4.3: QQ plots of the estimated − log 10 (p-value) from association analyses using seven different models

Fig. 4.4: Manhattan plot for days to first flowering and days to fifty % flowering in 2018-19 year phenotypic data generated

ICAR-NIPB ANNUAL REPORT 2019

Fig. 4.5: Expression pattern of the transcript flanking the associated SNP in the scaffold.

Fig. 4.6: Gene based phylogeny of all MADS-box genes identified in C. cajan

20 18 16 14 Rep_leaf 12 10 Rep_SAM

8 Veg_leaf 6 4 Veg_SAM 2 0 SVP CcMADS7.1 CcMADS1.6 CcMADS1.5 FLC FRI

Fig. 4.7: Expression pattern of some important floral regulator in different tissues as revealed by quantitative RT-PCR

ICAR-NIPB ANNUAL REPORT 2019

B. Biotic stress tolerance in pigeonpea RNAi-Bt combinatorial for durable resistance against Helicoverpa armigera (Manjesh Saakre, Venkat Raman, Saurav Tyagi, Krishnayan Paul, Megha, Rohini Sreevathsa and Debasis Pattanayak) Helicoverpa armigera (Lepidoptera: Noctuidae) is the most important polyphagous insect- pest which affects many crop plants and has an extensive distribution in tropical, subtropical and warm temperate regions. In India, it causes huge losses to pigeonpea, chickpea, cotton and vegetable crops like potato, tomato and brinjal. Conventional breeding for imparting resistance against H. armigera is not successful due to lack of resistant gene pool in the crop germplasm. Long-term sustainability of Bt, which has so far been successful against insect pests, is the major concern as the targeted insect pest develops resistance against the Bt protein within a few years of deployment. Studies in the past few years clearly demonstrated that HD-RNAi technology has the potential to generate insect tolerant crops. Potent and sustainable H. armigera resistance could be achieved by combining RNAi and Bt approaches. Hence, attempt has been made to develop multiplexed RNAi construct in combination with the Bt gene cassette. Efforts had been made for development of RNAi-Bt combinatorial binary vector construct harbouring chimeric Bt gene, cry1AcF, and multiplexed amiR cassette targeting H. armigera acetylcholinesterase and 20-hydoxyecdysone receptor genes and development of transgenic tobacco plants expressing RNAi-Bt combinatorial and evaluation of its efficacy against H. armigera. Potential miRNA target regions from the coding sequence of HaAce1 and HaEcR genes were identified. Arabidopsis thaliana pre-miRNA164 a and b backbone was used for Ace1-EcR artificial microRNA expression. NOS promoter, HaAce1 amiR, GBSS intron, HaEcR amiR and NOS terminator were PCR amplified and cloned respectively onto pUC19 vector (Fig. 4.8). The assembled Ace1-EcR amiR expression cassette was confirmed by Sanger’s sequencing and restriction analysis. HaAce1- HaEcR amiR expression cassette from pUC19 was subcloned onto binary vector pC2300 for plant transformation.

Fig. 4.8: Assembly of NOS promoter, HaAce1, GBSS intron, HaEcR and NOS terminator through PCR amplification, restriction digestion and ligation onto pUC19 vector.

ICAR-NIPB ANNUAL REPORT 2019

Fig. 4.9: Vector map of pC2300: C-amiR: cry1AcF binary construct.

Chimeric Bt gene cry1AcF expression cassette from the source vector pBinAR was cloned onto pCAMBIA 2300 binary vector and validated by restriction analysis. RNAi-Bt combinatorial binary vector harbouring chimeric Bt gene, cry1AcF under CaMV 35S promoter and Ace1-EcR amiR-com under NOS promoter was developed (Fig. 4.9). Development of H. armigera resistant transgenic tobacco lines is underway through Agrobacterium mediated transformation by introducing RNAi-Bt combinatorial binary vector construct for simultaneous silencing of two vital genes, acetylcholinesterase1 and ecdysone receptor, of the insect pest and also expressing the Bt gene, cry1AcF to cause mortality and growth retardation in H. armigera.

Identification and validation of possible insect resistance genes from Cajanus platycarpus, a wild relative of pigeonpea against Helicoverpa armigera (Maniraj R., Karthik K., Shaily Tyagi, Debasis Pattanayak and Rohini Sreevathsa)

Exploitation of pigeonpea wild relative, C. platycarpus is underway for the identification of the resistance mechanism towards pod borer. A combined transcriptomics and proteomics approach is being utilized for assessment of the comparative response of the wild relative as well as its cultivated counterpart to continued herbivory. RNA-seq and differential gene expression analysis were carried out between C. platycarpus and cultivar TTB7 at different time points after challenge with the insect larvae. Genes with probable role in (i) insect structural destruction; (ii) interference in digestion; (iii) reduction in availability of nutrients; and (iv) insect toxic products have been shortlisted for validation. Fifteen herbivory-specific genes with >2-fold differential expression have been selected. These putative insect resistance genes have been cloned from C. platycarpus into binary vectors and are being validated in Nicotiana tabacum (Fig. 4.10).

ICAR-NIPB ANNUAL REPORT 2019

Fig. 4.10: Identification and validation of possible insect resistance genes from Cajanus platycarpus

C. Quality traits in pigeonpea Screening of various pigeonpea genotypes for quality traits (protein content and cooking quality) (Sandhya, Kumar Durgesh, Kishor Gaikwad) Under this subproject, more than 100 pigeon pea genotypes were screened for high, medium and low protein content using both Bradford method as well as Kjeldahl methods. The Kjeldahl is a quantitative method used to determine nitrogen content in organic substances, where samples to be analysed are subjected to Pre-digestion (overnight) followed by digestion, distillation and titration. Since this is not a direct method, in order to obtain protein content, a conversion factor is used (for protein conversion factor is 6.25) which is then multiplied by N percentage to get the actual protein content in sample. Protein content varied from as low as 1.3 % to as high as 33% among the tested pigeonpea genotypes (Fig. 4.11). On the basis of protein%, genotypes were grouped as high, medium and low protein containing genotypes. Four genotypes with protein content > 25% while 3 genotypes with protein content <10% were found.

ICAR-NIPB ANNUAL REPORT 2019

Fig. 4.11: Protein content in various pigeonpea genotypes using Kjeldahl method

Estimation of micronutrients (Fe and Zn) in various pigeonpea genotypes

Seed samples of 100 pigeon pea genotypes (minicore) were digested using strong HNO3 followed by perchloric acid digestion. Samples were filtered and diluted for mineral content particularly Fe and Zn analysis under atomic absorption spectroscopy (AAS). Fe content varied from 12-740 µg/g while Zn content varied from 12-152 µg/g among the tested genotypes (Fig. 4.12).

Fe Content Zn Content 85

90 100

82 80 70 80 60 60 50 40 40 30 12 20 6 20 9 6

10 0 No. of genotypes of No. 0 genotypes of No. High Medium low High Medium Low

Fig. 4.12: Micronutrient content (Fe and Zn) among various pigeonpea genotypes estimated using atomic absorption spectroscopy

ICAR-NIPB ANNUAL REPORT 2019

5. Biotechnological Approaches for Brassica Improvement

ICAR-NIPB ANNUAL REPORT 2019

5. Biotechnological Approaches for Brassica Improvement

In India, Brassica juncea (Indian mustard) is a major oil yielding crop which alone contributes 25% of the total oilseed production. In Indian mustard, the major challenges are lack of adequate genetic diversity and infestation by many biotic factors, namely, aphids, Alternaria (leaf blight pathogen), Albugo candida (white rust pathogen). Sclerotinia (causing stem rot) and Orobanche. To address these issues, the institute relies on the wild relatives of B. juncea and the synthetic B.juncea germplasm developed by the institute. The latter is one of the major activities of the institute under Brassica improvement. The achievements made in addressing each of these activities are given below:

A. Biotic stress Development of aphid resistance in Indian mustard through RNAi approach (Deepa Dhatwalia, Chet Ram, Raghavendra Aminedi, Muthuganeshan Annamalai, Rohit Chamola, Ramcharan Bhattacharya) Major biotic stress that cripples the productivity of mustard is damage due to mustard aphid (Lipaphis erysimi), a hemipteran insect-pest. Aphids constitute a major group of crop pests that limit the productivity of many crops and cause serious damage to plants both by direct feeding and indirectly as vectors of many diseases. Lack of genetic resistance within the crossable gene pool made it imperative to explore biotechnological avenues such as transgenic technology. Over the past few years, RNAi mediated gene silencing and the occurrence of RNAi pieces of machinery have been demonstrated in insect species including aphids. It was also demonstrated in our laboratory that the host-mediated delivery of dsRNA can elicit RNAi response and transcript attenuation of the target gene. Therefore, we envisaged genetic manipulation of Indian mustard for synthesizing dsRNA homologous to important aphid genes.

Development of aphid resistance in Indian mustard through RNAi mediated gene silencing Several early studies indicated the importance of the target genes in the efficacy of the strategy in developing RNAi mediated insect resistance. Thus, initially, we screened several dsRNAs homologous to important aphid genes for their likely effect on survival and reproduction of aphids by diet based insect bioassay experiments. The experimental dsRNAs were supplemented in the diet for analyzing their effect on fecundity and survival of the feeding aphid-nymphs. Based on the results of diet bioassay, a gene encoding an important digestive enzyme related to carbohydrate metabolism and osmoregulation in aphid gut was selected as a potential target for RNAi mediated silencing. Gene expression study across the developmental stages of a late nymphs showed differential expression of the target gene across the growth stages

ICAR-NIPB ANNUAL REPORT 2019

(Fig. 5.1). The highest level of gene expression was observed in the wingless adults followed by other growth stages. The constitutive gene expression pattern indicated an essential physiological role of the target gene in osmoregulation inside the insect gut, as well as amenability of the transcripts to RNAi, mediated gene silencing irrespective of the growth stages.

The target gene sequence was analyzed in silico and a domain (LeRIS) was predicted to generate multiple potential siRNAs. The siRNA encoding domain was PCR amplified and cloned in a binary vector in tandem repeats separated by an intron under a CaMV35S promoter (Fig. 5.2). The vector construct was transferred in Agrobacterium tumefaciens strain GV3101 and several putative transgenics of B. juncea cv. Varuna was generated by plant transformation. Three transgenic plants which were advanced to T2 generation were further analyzed to assess the transgene integration, expression and generation of siRNAs in the host plants. Gene transfer and expression of the LeRIS encoded dsRNA and their variable levels in the transgenic lines were studied by PCR and qRT-PCR analyses using gene-specific primers (Fig. 5.3). The three transgenic lines were further analysed for the generation of the gene-specific siRNAs by stem-loop PCR and northern hybridization. While initial bioassay with aphids showed promise of the plants in restricting aphid infestation, further analysis is under progress.

Fig. 5.1: Expression analysis of the sucrase gene at different developmental stages of L. erysimi, namely early (1-2 day old nymphs), Intermediate (3-5-day old nymphs) and late (7-9 day old wingless adults,) were determined by qRT-PCR.

Fig. 5.2: T-DNA map of the RNAi constructs for expressing dsRNA of LeRIS domain under a CaMV 35S promoter. LB: left border, Bar: selective marker under FMV 34S promoter, MAS-mannopine synthase terminator, OCS: octopine synthase terminator and RB: right border.

ICAR-NIPB ANNUAL REPORT 2019

Fig. 5.3: Screening of putative LeRIS transgenic plants by gene-specific PCR (A) and RT- qPCR (B). Lane M: 100 bp DNA ladder, Lane 1: Non-template control, Lane 2: wild type, Lane 3: positive control, Lane 4-14 putative transgenic plants. LeRIS 7-9: Independent transgenic plant and WD: Wild type or control B. juncea.

STP4 promoter in Indian mustard Brassica juncea shows aphid responsive promoter activity Aphids while colonizing on the host-plants modulate the source-to-sink relationship of the host towards its favour. Thus, upon probing by aphids many of the early activated host-genes are essentially involved in facilitating the transport of carbon and nitrogen assimilates such as sugars, amino acids, etc. to the growing tissues of the plants. STP4 gene encoding a monosaccharide transporter showed a gradual increase in gene-expression as the aphids rapidly multiplied on the B. juncea plants. The induced expression of STP4 gene was observed in leaves, stem, flowers and siliques of aphid infested B. juncea plants (Fig. 5.4).

Fig. 5.4: Gene-expression of STP4 in different tissues of B. juncea under aphid infestation. The fold-change in gene expression was determined by qRT-PCR. The lower-case alphabets if different indicate a significant difference in mean derived from three biological replicates with three technical replicates each. The significant difference in mean was evaluated by student’s t-test at P < 0.05 and represented as mean ± SE (n = 3).

ICAR-NIPB ANNUAL REPORT 2019

Fig. 5.5: Aphid-responsive promoter activity of proBjSTP4 (a, b) and its deletion constructs (c, d). The promoter activity was assessed through histochemical analysis of GUS-activity and qRT-PCR based quantification of GUS-transcripts. Mean was derived from three biological replicates with three technical replicates each time and different lower-case letters indicate a significant difference in mean, evaluated by student’s t-test at P < 0.05.

The upstream sequence of STP4 was identified in the available genomic resources of B. rapa. Based on the sequence information in B. rapa, a pair of primers were designed and the homologous upstream counterpart in B. juncea was cloned. In the amphidiploid genome of B. juncea is the pair of primers amplified a single amplicon possibly the STP4 paralogue which was descended from B. rapa and conserved the sequence homology. The upstream sequence (proBjSTP4) was further cloned and sequenced. The cis-regulatory elements on the proBjSTP4 were found to be mostly associated with gene-expression during biotic stresses including pathogen infection, elicitor treatment, treatments by defence hormones, wounding and insect-infestation and growth and development. In functional assays, proBjSTP4 promoter activity was found to be activated by the wound, MJ and SA treatment in a gradual manner from 2-6 h of the treatments and peaked higher compared to the CaMV 35S (Fig. 5.5). However, the basal promoter activity of proBjSTP4 in control plants was significantly lower compared to the CaMV 35S promoter. Histochemical analysis

ICAR-NIPB ANNUAL REPORT 2019 of GUS activity in conjunction with qRT-PCR based transcript analysis suggested that the putative cis-elements viz CAAT-box, Box-W1, 5’UTR Py-rich repeat, ACE motif, Box-4, circadian-regulated elements, LTRE, skn-1 along with some unknown cis-elements present in -1616 to -1377 region of the STP4 were associated with the aphid-responsive promoter activity of proBjSTP4. With much lower basal activity, this promoter can potentially reduce undesirable constitutive expression of the transgene and can be activated by aphid-attack leading to high-level gene-expression, comparable to constitutive gene-expression by CaMV 35S. The promoter shall remain useful for engineering inducible expression of plant immunity genes in reversing host-defence suppression by aphids in susceptible hosts.

Use of insecticidal genes from legumes for developing Indian mustard resistant to aphids (Pawan S Mainkar, Yamini Agarwal, Vinay K Kalia and Rekha Kansal) The genetic transformation techniques make it possible to clone and insert genes viz. delta- endotoxin from Bacillus thuringiensis (Bt), protease inhibitors and lectins into the crop plants to confer resistance to insect pests. This accelerated the work on finding alternate strategies such as protease inhibitors, RNAi, antimicrobial peptides (AMPs), etc. Protease inhibitors which may be small peptides or protein molecules inhibit the activity of proteases, thus disrupting the normal protein digestion and consequent amino acid assimilation vital for insect growth. These are already present in plant storage organs and are induced upon insect feeding. Oryzacystatin-I in transgenic rapeseed is known to protect against aphid infestation with their effect on aphid survival, growth, and reproduction. Thus, the use of PIs in aphid management has a good promise as an alternate control strategy. Table 5.1: Summary of protease inhibitor (PI) Family genes identified from the draft genome of pigeonpea Genome Database Pigeonpea PI Types Cysteine Protease Inhibitor 9 Serine Protease Inhibitor (i) Kunitz Protease Inhibitor 16 (ii) Serpin Protease Inhibitor 1 (iii) Potato Protease Inhibitor-I 3 (iv) Potato Protease Inhibitor-I 0 (v) Bowman-Birk Protease Inhibitor 4 (vi) Kazal Protease Inhibitor 2 (vii) Squash Protease Inhibitor 0 Total 35

ICAR-NIPB ANNUAL REPORT 2019

A total of 35 candidate protease inhibitor (CcaPIs) genes of serine and cysteine-type protease inhibitors were identified from the draft pigeonpea genome (Table 5.1). The size of the identified protease inhibitor genes ranged from 198 to 948nt that encoded peptides ranging from 66 to 316 amino acids. The Phylogenetic analysis of the 35 protease inhibitor genes divided them into two major families; cysteine protease inhibitor (9) genes and serine protease inhibitor (26) genes. Serine protease inhibitors were further divided into five major types based on the conserved domain, signature motif sequences and their target protease specificity, Kunitz PIs (16), BowmanBirk PIs (4), Potato protease inhibitor I (3), Kazal PIs (2) and Serpin (1). Potato protease inhibitor II and Squash type protease inhibitor genes were not found in the pigeonpea genome. In general, the PI genes were devoid of introns but, the gene architecture of the 8 genes of Serine type (CcaKuPI10, CcaKuPI013, CcaKuPI014, CcaKuPI020, CcaKuPI026, CcaPPiI031, CcaPPiI032, CcaSPI035) and 5 genes of Cysteine type (CcaCPI01 and CcaCPI02, CcaCPI03, CcaCPI04 and CcaCPI05) contained the introns. The homology modelled PI structures Ramachandran plot analysis found that sixteen genes have a stable structure (more than 90% of the residues in the allowed region as it had minimum energy). Molecular docking analysis of the two protein structures CcaKuPI025 (Kunitz type) and CcaCPI08 (Cysteine type) were found to have strong interchain hydrogen bonding with the midgut proteases of hemipteran and lepidopteran insects (Fig. 5.6 and Tables 5.2 and 5.3). Based on the in silico data, intron free protease inhibitor genes (nine) from pigeonpea were selected for further studies. One Kunitz type; CcaKuPI025 and one Cysteine type CcaCPI08 were cloned into a pET6XHN-C vector and transformed into the E.coli BL21 pLyseS cells. The transformed PI genes were overexpressed using the IPTG inducer at 1mM concentration for 6 hrs at 37°C (Fig 5.7) and purified proteins were evaluated for their insecticidal activity against Hemipteran pest Myzus persicae (Fig. 5.8) and Lepidopteran pest H. armigera and Spodoptera litura (Fig. 5.9). The PI proteins showed up to 72% mortality of both the types of insects.

Fig. 5.6: Predicted 3D Structure and ligand binding sites of the protease inhibitor (PI). (A) Kunitz type (CcaKuPI025) PI Protein from pigeonpea and the protease receptor of Bengaluru Helicoverpa armigera, and (B) Cysteine type (CcaCPI08) PI protein from pigeonpea and the Cathepsin L receptor of the Aphid Myzus persicae.

ICAR-NIPB ANNUAL REPORT 2019

Fig. 5.7: SDS-PAGE of the expressed protease inhibitor proteins after 6 h induction using 1mM IPTG at 37oC. (A) CcaCPI08 PI protein, and (B) CcaKuPI025 PI protein. Lane- M protein marker, lane-2 BL21 Non-transformed cells, lane-3 BL 21 cells transformed but uninduced, lane 4-6 BL 21 cells transformed and induced protein using IPTG at 0.5mM, 1mM, 1.5mM concentration

Fig. 5.8: Graph showing the mortality percentage of aphid (Myzus persicae) on 4th day fed on an artificial diet supplemented with CcaCPI08 andCcaKuPI025 Protease Inhibitor proteins

Fig. 5.9: Graph showing the mortality percentage of Helicoverpa armigera and Spodoptera litura on an artificial diet supplemented with CcaCPI08 andCcaKuPI025 protease inhibitor proteins at 100 l/g concentration on 8th day of bioassay

ICAR-NIPB ANNUAL REPORT 2019

Table 5.2: Docking Complex study of Kunitz type protease inhibitor (CcaKuPI025) with the Protease receptors of Bengaluru Helicoverpa armigera Docking Complex (Hydrogen Bonds) Distance (Å) Receptor (Protease) CcaKuPI025 (Kunitz type protease inhibitor) ARG 18 GLN 208 2.067 ARG 18 GLN 208 1.903 THR 39 GLU 164 2.065 LYS 104 GLU 164 1.796 ARG 109 TYR 130 2.071 ARG 109 ASN 131 2.101 ARG 109 GLU 3 2.366 ARG 109 GLY 133 2.613 ARG 109 GLU 3 2.042 ASN 131 ARG 109 1.886 GLY 142 ASN 46 1.882 ARG 162 SER 162 1.994 ARG 162 THR 155 1.761 ARG 186 LEU 25 1.757 ARG 186 PHE 26 1.805 GLN 208 HIS 168 1.882 CYS 231 ASP 153 2.451

Table 5.3: Docking Complex study of Cysteine type protease inhibitor (CcaCPI08) with the CathepsinL receptors of Aphid Myzus persicae Docking Complex (Hydrogen Bonds) Distance (Å) Receptor (CaL) (Cysteine type protease inhibitor) ALA 251 ALA 56 2.550 ASN 121 SER 84 1.822 ASN 121 SER 86 1.863 GLU 120 GLN 88 2.037 ASP 121 THR 115 2.018 GLU 112 LYS 132 1.712 GLY 10 LYS 133 1.675 THR 12 LYS 133 1.655 ASP 54 LYS 133 1.714 LEU 181 ARG 163 1.759 TYR 338 ASN 182 2.018 LYS 132 LYS 201 1.994 GLU 129 ASN 233 1.761

ICAR-NIPB ANNUAL REPORT 2019

The introns are likely to play an important role in regulation and gene expression. As some intronic sequences act as enhancers or repressors of transcription by the action of various proteins that bind to these sequences. Also, introns cause an increase in gene length, this increases the likelihood of crossing over and recombination between sister chromosomes. This increases genetic variation and can result in new gene variants through duplications, deletions, and exon shuffling. Intron act as spacers between coding regions of a gene, they facilitate alternative splicing of genes. This allows a single gene to encode multiple proteins as the exons can be assembled in multiple ways.

Biosafety analysis of developed transgenic Brassica (needs an introduction about the transgenic developed) Kanamycin resistance is one of the most frequently used selection markers for obtaining transgenic plants. The introduction of these transgenic plants into agricultural practice will cause the kanamycin resistance gene and the gene product to be present on a large scale. The desirability of this situation is analyzed. Although the GMO Panel of the European Food Safety Authority has reiterated its earlier conclusions that the use of the nptII gene as a selectable marker in GM plants (and derived food or feed) does not pose a risk to human or animal health or the environment. The leaf and flower samples (0.5 gm) from the T5 generation of Brassica juncea grown in the net house at IARI, New Delhi were collected. The total protein was extracted using PBS extraction buffer and estimated using Bradford protein assay with bovine serum albumin (BSA) as the standard and the concentration of protein was expressed in mg ml. The total protein estimated was g 500mg flower sample and was 17 µg/500mg leaf sample (Fig. 5.10 A). The protein was further used for the nptII estimation using nptII ELISA kit (Fig. 5.10 B). The nptII protein was estimated as 4-5ng/g of the total protein content in flowers while it was 5-6ng /g protein in leaves using NPTII Elisa Kit.

Fig. 5.10: Protein estimation (A) Distribution of the blank, BSA protein standards and the total proteins of leaf and flower samples of transgenic B. juncea in triplicates in the ELISA plate using Bradford method, (B) nptII protein estimation in the leaf and flower samples of transgenic B. juncea in the ELISA plate using nptII ELISA kit.

ICAR-NIPB ANNUAL REPORT 2019

Genetic Engineering strategies to develop Alternaria-resistant mustard Alternaria leaf spot, caused by A. brassicae is a widespread and major disease of Brassica juncea. To protect themselves, plants use multiple approaches such as morphological, biochemical and molecular defense responses that allow them to survive after Alternaria infection.

Identification of the genes and pathways introgressed from wild species Diplotaxis erucoides in Brassica juncea for developing Alternaria resistance (Sharani Choudhary, Naresh Vasupalli, Mahesh Rao, R C Bhattacharya) One of our previous studies identified potential resistance against A. brassicae in one of the wild relatives of cultivated Brassica, Diplotaxis erucoides. For introgression of resistance genes from D. erucoides to B. juncea interspecific hybrids were developed which were further backcrossed and advanced to BC2F9 with recurrent screening for Alternaria resistance. This introgression population has been subjected to extensive phenotyping for the Alternaria resistance under natural infection as well as using artificial infection at three different locations viz. NIPB experimental polyhouse, New Delhi, GBPUAandT, Pantnagar and IARI Regional Centre, Pusa, Bihar. Many of the promising introgression lines (ILs) have been identified with a high level of Alternaria resistance. To identify the genes and pathways responsible for the resistance as well as for generating molecular markers associated with the resistance trait, transcriptome and resequencing data were generated from a few of the selected lines. A reference transcriptome of D. erucoides was prepared from the transcriptome of the treated and untreated plants. Contigs from resistant introgressed line (RC and RT) and susceptible introgressed line (SC and ST) were mapped to both Diplotaxis transcriptome reference and Brassica database to categorize them as per their origin (Fig. 5.11).

Fig. 5.11: Distribution of transcripts in B. juncea and Diplotaxis erucoides genomes. ResC: Resistant control; ResT: Resistant treated; SusC: Susceptible control; SusT: Susceptible treated

ICAR-NIPB ANNUAL REPORT 2019

Fig. 5.12: Volcano plot of Diplotaxis-derived differentially expressed genes (DEGs) in resistant introgression line (A) and susceptible lines (B) in segregating introgression plants.

Fig. 5.13: Top 5 KEGG pathway in resistant IL (A) and susceptible IL (B)

Differential expression of D. erucoides derived genes were analyzed both in resistant and susceptible IL to screen out significant DEGs (FC>=2 and P<0.05) shown in green dots in volcano plots (Fig. 5.12). The major affected pathways were identified by KEGG pathway analysis of significant DEGs (Fig. 5.13). RT-qPCR based validation is underway.

Development of transgenics of Arabidopsis and Arabidopsis mutant (for wrky33 gene) with C. sativa wrky33 gene under the control of 35S promoter for resistance to Alternaria infection (Anita Grover, Rekha Kansal, Mahesh Rao, G Prakash, and Sandhya Rawat) The WRKY proteins comprise a major family of transcription factors that are essential in pathogen and hormonal responses (such as JA and SA) of higher plants and many plant- specific reactions. The WRKY33 was shown to be required for resistance toward the necrotrophic pathogens such as A. brassicicola and B. cinerea (Zheng et al., 2006). WRKY33 regulates negatively with the SA pathway and positively with the JA pathway. Designing of the binary vector construct for overexpression and wrky33-mutant complementation Cloning

ICAR-NIPB ANNUAL REPORT 2019 of CsWRKY33 CDS in binary vector pRI101AN. Cloning was confirmed through colony PCR amplification of ~1.5 kb size amplicons using recombinant DH5α colonies as the template (Fig. 5.14).

Fig. 5.14: Designing of the binary vector construct with CsWRKY33 coding sequence for the transformation of Arabidopsis WT Col-0 and wrky33-mutant plants. (A) and (B) Diagrammatic representation of 35Spro::pRI101AN_CsWRKY33_CDS construct employed for Arabidopsis plant transformation. KpnI and EcoRI restriction sites were used in forward and reverse primers, respectively. pRI101AN was used as binary backbone vector. (C) Confirmation of transformed DH5α cells with recombinant CsWRKY33 clones in pRI101AN vector by colony PCR amplification. (D) Confirmation of recombinant pRI101AN_CsWRKY33_CDS construct by restriction digestion with KpnI and EcoRI and release of ~1.5 Kb insert and ~10.4 Kb vector backbone. (E) Confirmation of transformed Agrobacterium Gv3101 cells with CsWRKY33 recombinants by colony PCR amplification.

After Agrobacterium-mediated transformation of Arabidopsis Col-0 and wrky33-mutant plants following floral dip method, T0 transgenic seeds were harvested separately for WRKY33-OEx and wrky33-complemented lines (Fig. 5.15).

ICAR-NIPB ANNUAL REPORT 2019

Fig. 5.15: Screening and selection of pro35S::pRI101AN-CsWRKY33_CDS transformed Arabidopsis transgenic OEx and wrky33-complemented T0 seeds/T1 plants. Transgenic OE and complemented wrky33 T0 seeds were screened on ½ MS medium supplemented with 30 μg ml kanamycin. Images on the top show the Arabidopsis WT Col-0 non-transformed dead plants on kanamycin selection. Middle and bottom images show the surviving WRKY33-OEx and mutant-complemented plants respectively on kanamycin selection.

T1 transgenic Arabidopsis plants (wild type and wrky33 mutant) carrying C. sativa wrky33 gene will be analysed at the molecular and phenotypic (fungus-resistance) level. If positive results are obtained in Arabidopsis transgenics, C. sativa wrky33 gene will be used for developing B. juncea transgenics.

Interaction of SA, JA and ABA defense signalling pathways in B. juncea upon infection by Alternaria Hormone extraction and quantification of JA was in all three genotypes. JA being volatile was extracted through solid-phase extraction and quantified with GC-MS analysis. The levels of JA were found higher in samples of S. alba and C. sativa as compared to B. juncea under control condition. S. alba and C. sativa JA content range from 15-20 µg/g of JA in frozen samples whereas, B. juncea has 8-10 µg/g JA in the frozen sample (Fig 5.16). From these results we conclude that A. brassicae inoculation induces a much pronounced and early

ICAR-NIPB ANNUAL REPORT 2019 accumulation of JA in resistant genotypes, however, a low and delayed JA accumulation was seen in susceptible genotype.

Fig. 5.16: JA levels recorded in all three genotypes after various treatments at several time points from 3hat to 24hat.

From last three years work on SA, JA and ABA cross-talk in B. juncea, S. alba and C.sativa, we can summarize the work in the model given below (Fig. 5.17).

Fig. 5.17: Prediction of possible cross-talk pathway operating in three host species in response to A. brassicae involving SA, JA and ABA based on the gene expression analysis and hormone quantification.

ICAR-NIPB ANNUAL REPORT 2019

MALDI-TOF analysis of differentially induced proteins in Alternaria infected samples from B. juncea, S. alba, and C. sativa Out of the initial 67 samples, a total of 40 proteins have been identified through MALDI-TOF analysis. The information of these proteins viz organisms with identified protein homologs, protein name, their function, theoretical mass, isoelectric point (pI value) and Mascot sore is presented in (Fig. 5.18).

Fig. 5.18: Fifteen proteins showing marked up or down-regulation

Among these 40 differentially expressed proteins, 7 proteins are related to various stress tolerance (WRKY15, pectin methylesterase, cytokinin oxidase/dehydrogenase, stress-induced protein KIN2, BTR1 protein, chloroplastic chaperonin and phospholipid hydroperoxide glutathione peroxidase), 3 proteins are involved in DNA synthesis (cytosine-specific methyltransferase, primase homolog protein and primase homolog protein isoform), 2 are involved in protein-protein interaction (Small heat-shock protein and bromodomain and WD repeat-containing protein), 2 are involved in protein degradation (F-box/kelch-repeat protein and oligopeptidase A), 3 are involved in cell wall synthesis (xyloglucan endotransglucosylase, mannan synthase and SNARE 12), 3 are involved in gene expression (DNA-directed RNA polymerase III, Ribosomal RNA small subunit methyltransferase and Homeodomain-like containing protein), 4 are involved in cellular metabolisms (Acetyl- coenzyme A carboxylase carboxyl transferase, prephenate dehydratase, sugar/pyridoxal phosphatase and sugar-phosphate isomerase), 1 is involved in signal transduction (wall-

100

ICAR-NIPB ANNUAL REPORT 2019 associated receptor kinase 2) and 15 are unidentified/hypothetical proteins. Fifteen proteins as shown in the picture below show marked up or down-regulation. Three of them have already been shown to be involved in disease resistance proteins which are markedly differentially regulated out of 67 differentially regulated proteins in B. juncea, S. alba and C. sativa after Alternaria infection will be studied at the gene expression level.

Introgression of the gene (s) for Alternaria tolerance from wild species into Brassica juncea (Anamika Kashyap, Pooja Garg, N C Gupta, Ashish Kumar, KK Singh, Usha Pant Naveen Singh, Rohit Chamola, Lakshman Prasad, R C Bhattacharya and Mahesh Rao,)

The introgression line (156 lines in BC2F10) developed in Brassica juncea for Alternaria resistance from wild species Diplotaxis erucoides were subjected for screening at ICAR- NIPB, Delhi under control condition and at GBPUAT, Pantnagar and IARI-RS PUSA Bihar under natural condition. The scoring will be done to identify the resistant lines at a different location with the high pollen viability. The pollen viability was recorded to understand the fertility behaviour of these lines and the rot tip and bud samples were collected for the cytogenetic studies in these lines (Fig. 5.19).

Fig. 5.19: Pollen viability of introgression lines (ERJ lines) and the sample collection for mitosis and meiotic study.

Development of white rust resistance in mustard White rust caused by Albugo candida is a serious disease of Indian mustard (B. juncea) causing 17-60% yield loss in India. A. candida comprises many races that infect distinct host species. Studies indicated that in India significant genetic diversity exist in A. candida populations which may result in the development of strains that possess increased threat to Brassica crops. The disease manifests by white coloured pustules on cotyledons, leaves, shoots and inflorescences, along with typical staghead formation as the result of inflorescence infection. Almost all the released varieties of B. juncea in India are highly susceptible to white rust disease.

101

ICAR-NIPB ANNUAL REPORT 2019

Pathotyping of 10 different isolates of Albugo candida causing white rust disease in rapeseed-mustard (Ashish Kumar, Jameel Akhtar, Mahesh Rao and R C Bhattacharya) Pathotyping of 10 different isolates of A. candida was done and incubation period for resulted infection varies with 8-12 days, 9-15 pinheads/100 mm2 area, 1-5 mm pustule size and 20- 90% disease severity was observed on the inoculated plants. Also, variation in pustules morphology was observed as whitish to light yellow, smooth and rough surface, circular to oval in shape, coalesced and raised or depressed at the center.

Status of white rust resistance in major released cultivars of Brassica species (Ashish Kumar, Mahesh Rao, Jameel Akhtar, Navin C Gupta and RC Bhattacharya) Among 35 released cultivars of B. juncea, only RLC-3 cultivar identified as resistant (PDI = 0) against the Ac-Del, Ac-Bhrtr, Ac-Rnc, Ac-Smstr and Ac-Gwlr isolates whereas, this cultivar showed susceptible reaction (PDI=5-30) against the Ac-Ldh, Ac-Mrt, Ac-Skn, Ac-Pnt and Ac- Mrn isolates. However, none of the B. juncea released cultivars found resistant against the all the ten tested isolates of the pathogen. Among B. napus cultivars, only GSL-1 was found resistant at both the crop stages i.e., cotyledonary as well as true leaf stages against the all the 10 isolates. Besides, one cultivar, GSC-6 was found resistant against 7 isolates namely, Ac-Del, Ac-Bhrtr, Ac-Pnt, Ac-Rnc, Ac- Smstr, Ac-Skn and Ac-Gwlr, whereas, susceptible against remaining 3 isolates, Ac-Ldh, Ac- Mrn and Ac-Mrt. Similarly, another cultivar, GSC-7 found resistant against Ac-Del, Ac-Ldh, Ac-Bhrtpr, Ac-Pnt, Ac-Rnc, Ac-Skn and Ac-Gwlr and susceptible against Ac-Mrn, Ac-Mrt and Ac-Smstr isolates. Amongst B. carinata cultivars, PC-6 showed resistant reaction against Ac- Del, Ac-Ldh, Ac-Bhrtr, Ac-Smstr, Ac-Gwlr and Ac-Pnt isolates, whereas, the susceptible reaction was observed against Ac-Rnc, Ac-Mrn, Ac-Mrt and Ac-Skn isolates.

Screening of wild germplasm of Brassica species under artificial inoculated conditions (Ashish Kumar, Mahesh Rao, Navin C Gupta, Jameel Akhtar and R. C. Bhattacharya) Wild relatives of Brassica, namely B. fruticulosa, Camelina sativa, Diplotaxis assurgens, D. catholica, D. cretacia, D. erucoides, D. muralis, D. siettiana, D. tenuisilique, D. viminea, Erucastrum lyratus, E. abyssinicum, E. canariense, E. cardaminoides and five accessions of Crambe abyssinica viz, EC400058, EC694438, EC694144, EC694145, EC694147 and four accessions of Eruca sativa viz., IC341907, IC57706, IC62597, IC62599 were found completely resistant (Immune, PDI = 0) against Ac-Del, Ac-Pnt, Ac-Ambl, Ac-Rnchi, Ac-Ldh and Ac-Wltn isolates of the pathogen. However, some other Brassica wild species germplasm namely, B. chinensis, B. oxyrrhina, B. tournefortii, Capsella-bursapastoris, Diplotaxis gomez-campoi, Sinapis alba, Erucastrum gallicum, Oxycamp, Lepidium sativum accessions IC572775, 572781, 572787, Eruca sativa accessions IC62597, IC62713-3 were found susceptible (PDI= 5-40) against the Ac-Del, Ac- Pnt, Ac-Ambl, Ac-Rnc, Ac-Ldh and Ac-wltn isolates of the pathogen (Fig. 5.20).

102

ICAR-NIPB ANNUAL REPORT 2019

Fig.5.20: Screening of wild relatives of Brassica species against Albugo candida

Screening and evaluation of Brassica accessions/advanced introgressed lines/ Resynthesized Brassica (RBJ) lines/B. rapa and B. nigra lines under artificial inoculated conditions Evaluation of Brassica and Lepidium spp. accessions obtained from ICAR-NBPGR, New Delhi (Ashish Kumar, Jameel Akhtar, Rashmi Yadav, Mahesh Rao and RC Bhattacharya) A total of 30 accessions of Brassica species were obtained from ICAR-NBPGR, New Delhi and tested for resistance against 10 isolates of A. candida under artificial inoculated conditions. Among them, none of the single accession of B. juncea was found resistant against all the tested ten isolates of the pathogen at both the crop stages. However, one accession of B. juncea viz., IC265495 was found to show resistance against Ac-Del, Ac-Ldh, Ac-Bhrtr, Ac-Mrt, Ac-Skn, Ac-Mrn, Ac-Rnc and Ac-Smstr isolates, whereas, susceptible against Ac-Pnt and Ac-Gwlr isolates. Similarly, another accession, EC766193 found resistant against Ac-Del, Ac-Ldh, Ac-Bhrtpr, Ac-Pnt, Ac-Mrn and Ac-Gwlr, but, susceptible against Ac-Mrt and Smstr isolates. An exotic accession of B. carinata, EC206642 was identified as immune to all the 10 isolates namely, Ac-Del, Ac-Ldh, Ac-Bhrtpr, Ac-Mrt, Ac-Mrn, Ac-Gwlr, Ac-Skn, Ac-Rnchi, Ac-Smstr and Ac-Pnt isolates. Among Lepidium species, two accessions, IC572819 and IC572843 and six accessions of E. sativa, IC508401, IC508402, IC508404, IC310967, IC605221 and IC605225 found completely resistant against Ac-Del isolate at both the crop stages, i.e., cotyledonary and true leaf stages. However, none of the B. tournefortii accessions resulted in a resistant reaction.

Evaluation of Advanced introgressed lines (ILs) (BC2F10) of Brassica juncea (Ashish Kumar, Mahesh Rao, Anamika Kashyap, Navin C Gupta and R C Bhattacharya) A total of 160 advanced introgressed Brassica lines were evaluated against 10 isolates of A. candida under controlled environmental conditions at National Phytotron Facility, ICAR- IARI, New Delhi to identify a common source of resistance against any specific isolate or some isolates of the pathogen (Fig. 5.21). Of these introgressed lines, ERJ 40 was identified

103

ICAR-NIPB ANNUAL REPORT 2019 as immune (PDI=0) against 8 isolates namely, Ac-Del, Ac-Ldh, Ac-Bhrtpr, Ac-Mrt, Ac-Mrn, Ac-Rnc, Ac-Smstr and Ac-Pnt except Gwlr and Skn isolates at both cotyledonary and true leaf growth stages of the crop. Similarly, some other introgressed lines such as ERJ-12, ERJ-14, ERJ-15, ERJ-39, ERJ-109, ERJ-110, ERJ-157, ERJ-159 and ERJ-160 found completely resistant for some (3-5) isolates which could be further utilized for resistance breeding programs. Rest of the introgressed lines showed susceptible reaction with varying level of PDI ranging from 5-100%.

Fig. 5.21: Screening of introgressed lines of Brassica juncea against Albugo candida

Evaluation of Resynthesized Brassica (RBJ) lines (Ashish Kumar, Mahesh Rao, Anamika Kashyap, Navin C Gupta and RC Bhattacharya) A total of 90 RBJ lines were evaluated against ten A. candida isolates. RBJ 40 showing complete resistance reaction for 6 isolates (Ac-Ldh, Ac-Bhrtr, Ac-Mrn, Ac-Gwlr, Ac-Smstr and Ac-Rnc) and RBJ 18 line showing complete resistance for 5 isolates (Ac-Del, Ac-Ldh, Ac-Bhrtr, Ac-Mrn and Ac-Smstr). However, RBJ lines namely; 34, 38, 40, 59, 60, 76, 85 and 87 resulted resistance reaction for 1-4 isolates. Rest of the resynthesized Brassica lines showed tolerant to highly susceptible reaction along with the varying level of disease severity (PDI) ranges from 5-100% (Fig. 5.22).

104

ICAR-NIPB ANNUAL REPORT 2019

Fig. 5.22: Screening of Resynthesized Brassica (RBJ) lines against Albugo candida

Evaluation of Advanced Brassica rapa and Brassica nigra lines (Ashish Kumar, Mahesh Rao, Anamika Kashyap, Navin C Gupta and RC Bhattacharya) B. rapa lines BR 4 (susceptible for Ac-Mrt isolate) and BR 5 (susceptible for Ac-Gwlr isolate) resulted in immune reaction against Ac-Del, Ldh, Bhrtr, Skn, Mrn, Rnc, Smstr and Pnt isolates. BR1 line was showing resistance reaction only for Ac-Pnt isolate; BR 2 for Ac-Ldh, Bhrtr, Skn, Rnchi and Smstr isolate; BR 7 for Ac-Del isolate and BR12 for Ac-Del, Ldh and Rnc isolates. However, B. nigra line BN 4 identified as resistant against Ac-Pnt and Ac-Skn isolates.

Field screening and evaluation of Brassica accessions/germplasm/advanced introgressed lines under Delhi and Bihar conditions (Ashish Kumar, Mahesh Rao, Jameel Akhtar, Navin C Gupta and RC Bhattacharya) Phenotyping of Brassica accessions (30), introgressed lines (160) and resynthesized lines (92) was done under natural field conditions at Research Farms (New Area, IARI) and Issapur of ICAR-NBPGR, New Delhi and IARI-Regional Station, Pusa, Bihar. Among them, only five accessions of B. juncea, 3 of B. carinata, 5 ILs and 4 RBJ lines were found resistant.

Development of Sclerotinia stem rot disease resistance in Indian mustard There are many soil-borne and stubble-borne fungus known to infect Brassica globally and cost millions of losses annually. The incidence of Sclerotinia stem rot disease has been observed on the rise in several major rapeseed-mustard growing states of India including, Rajasthan, Haryana, Uttar Pradesh, Punjab, Madhya Pradesh and others. The broad host range and its ubiquitous presence throughout the world make it difficult to control as the existing control measures are proven not much effective. With no genetically resistant cultivars available to farmers, cultural practices and fungicide applications are the major ways to plaid the severity of this disease. The success of the fungicide largely depends on the timing and dosage of their application. Moreover, the pathogen persists in the soil in the form of its resting bodies composed of compact mycelial aggregate sclerotia that survive for

105

ICAR-NIPB ANNUAL REPORT 2019 decades even in absence of the host in the field and serve as an inoculum to crops in the subsequent years.

Developments of non-injury inoculation technique for assessing Sclerotinia stem rot disease in oilseed Brassica (Navin C Gupta, Pankaj Sharma, Rao M, Pradeep K Rai, and Ashish Kumar) The field assessment technique to evaluate the plants with a fungal phytopathogen for their tolerance to the disease is one of the crucial steps in dissecting their genetic control and in developing the resistant crop varieties. The objective behind this study was to develop and evaluate a field-based non-injury method of inoculation technique for Sclerotinia stem rot in oilseed Brassica, caused by S. sclerotiorum (Lib.) de Bary. The non-injury method of screening technique involves stem inoculation using a five days old mycelial mat on potato dextrose agar (PDA) plug placed on the top of sterile water-soaked cotton pad firmly wrapped over the internodal region with parafilm at the basal portion of the stem (15-20 cm above the ground) in the field. Inoculation without injury substantiates the natural means of infection in the field and the use of moist cotton pad keeps humidity for longer to initiate infection even in case of adverse climatic conditions. Disease development on the inoculated stem was measured by the length and width of the lesion. The symptom appears with water- soaked lesion formation and spreading deeper and wider on the stem in >90% of inoculated susceptible plants. During the experiment, about 800 Brassica germplasms including their wild relatives were screened and evaluated for three consecutive years using near-natural (non-injury) method of disease inoculation (Fig 5.23) in the field.

Fig. 5.23: Non-injury method of Stem inoculation technique (a) Inoculum from the 3 days old mycelial culture of S. sclerotiorum pathogen, (b) wrapping of inoculum with a cotton pad on the Brassica stem, (c) lesion spread over the inoculated B. juncea stem 21 dpi.

The Inoculation severity index (ISI) obtained during these years at Pusa, New Delhi were significantly similar and correlated with the natural infection measured in terms of disease severity index (DSI) on selected germplasm in the sick plot at ICAR-DRMR, Bharatpur. The

106

ICAR-NIPB ANNUAL REPORT 2019 significant correlations obtained among the used Brassica lines that were earlier not subjected for natural screening suggest the potential of this technique in evaluating the breeding material for SSR before confirmation with natural infection in the field.

Development of mapping population for Stem rot resistance by using the identified donor parent (Navin C Gupta, Pankaj Sharma, Mahesh Rao, Ashish Kumar and RC Bhattacharya) The identified resistance source for Sclerotinia stem rot disease (Fig. 5.24) in three different species of Brassica namely B. carinata (Bcar115; BBCC, 2n = 34), B. napus (Bnap 114; AACC, 2n = 38) and B. juncea (RH1222-28/RH-6; AABB, 2n = 36) were used in breeding as a donor parent to transfer the resistance trait into the elite susceptible cultivars of Indian mustard (Table 5.4). From the various crosses made during the 2018-19 crop season, the promising lines were selected based on their genotypic and phenotypic evaluation and planted during the 2019-20 crop season for generation advancement to develop the RILs (recombinant inbred lines) and NILs (near-isogenic lines) mapping populations (Table 5.4).

The F2 lines of A5 and A7 derived from the two different F1 lines from crossing between PJK and RH-6 were selected for generation advancement based on their tolerance to stem rot disease scoring in the field. Similarly, A1, A3 and A8 lines obtained from the crosses between DRMRIJ31, PM25, and Pusa Tarak with tolerant B. juncea lines RH-6, respectively were selfed to develop the F3 generation. The introgression of Sclerotinia stem rot resistance trait from B. carinata and B. napus into susceptible rapeseed-mustard cultivars are in progress through the backcrossing and those reached to BC2F1 generation. To keep the maximum similarity in the background, the back cross populations were also developed in PJK and Varuna by crossing them with B. juncea RH-6 line, tolerant to stem rot disease and those also reached to BC2F1 generation in the current season (Table 5.4).

Fig. 5.24: The stem inoculation assay for Sclerotinia stem rot disease and lesion developed after the 21dpi in the susceptible and resistant source identified in different Brassica species. (a) Susceptible Pusa Jaikisan, (b) tolerant B. juncea line RH-6 (RH1222-28 selection), (c) resistant B. carinata line (Bcar115), and (d) resistant B. napus line (Bnap 114)

107

ICAR-NIPB ANNUAL REPORT 2019

Table 5.4: The list of F2 derived F3 and back cross-population developed from the crosses between the identified tolerant Brassica lines with susceptible cultivars of Indian mustard.

S. Number BC2F1 Population and their F2 Population Parental lines No. of F3 lines parents 1 A5 (NC9026) PJK X RH-6 800 PJK X RH-6 2 A7 (NC9026) PJK X RH-6 400 Varuna X RH-6

3 A1 (NC316) DRMRIJ31 X RH-6 200 BC1F1 (PJK X Bnap114) X PJK

4 A3 (NC256) PM 25 X RH-6 200 BC1F1 (PJK X Bcar115) X PJK

5 A8 (NCTarak6) Pusa Tarak X RH-6 150 BC1F1(RH-6 X Bnap114) X RH-6

Draft genome sequencing of Sclerotinia sclerotiorum pathogen ‘ESR-01’ isolate and secretome analysis (Navin C Gupta, Pankaj Sharma, Dwijesh C Mishra, Kishore Gaikwad, Mahesh Rao, and RC Bhattacharya) The whole-genome sequencing result of an Indian isolate of S. sclerotiorum ‘ESR-01’ phytopathogen depicted the genome size of ~41 Mb with 328 scaffolds and N50 of 447,128, obtained by de novo assembly of the high-quality reads (Fig. 5.25). A total of 9,469 protein- coding genes were predicted from genome assembly (Table 5.5).

Fig. 5.25: CIRCOS plot of the assembled scaffolds of S. sclerotiorum ESR-01 isolate against B. cinerea genome showing the inter-genomic relationship. Outer circle A: S. sclerotiorum scaffolds. Middle circle B: B. cinerea genome, and inner circle C: represent the distribution of the genes annotated in the S. sclerotiorum ESR-01 genome. SSF- Sclerotinia sclerotiorum fungus.

The average gene length and its density in the S. sclerotiorum genome were 1,587 bp and 230.95 genes per Mb, respectively. Additionally, 27,450 single nucleotide polymorphisms (SNPs) were identified from 155 scaffolds against S. sclerotiorum ‘1 80’ isolate, with an average SNP density of ~1.5 per kb of genome. Repetitive elements identified were approximately 667 and comprised of approximately 7% of the total annotated genes. The effector analysis in the whole genome proteomics data revealed a total of 57 effectors

108

ICAR-NIPB ANNUAL REPORT 2019 candidates and 27 of them were having their analogues whereas the remaining 30 were the novel ones (Fig. 5.26).

Table 5.5: De novo whole-genome sequence assembly and gene statistics features of S. sclerotiorum isolate “ESR-01”

Description S. sclerotiorum ‘ESR-01’ Genome size (bp) 40,981,405 Gene prediction Total Number of genes 9469 Average gene length (bp) 1587 Gene annotation No. of genes with blast hits 9412 No. of genes without blast 57 hits GO Term Distribution Biological Process 4514 Molecular functions 4677 Cellular component 4151

Fig. 5.26: Genome-wide secretome prediction and effector identification. (a) From the 554 predicted secreted proteins, 369 were showing the experimental evidence for in planta expression (S. sclerotiorum secreted proteins expressed in planta, SPEPs). The number of proteins filtered out is indicated with dotted arrows, the number of selected proteins is given within boxes, bioinformatics tools and resources used are indicated by the boxes (b) identification of 57 effector candidates (ECs) out of which 27 were having their known analogues whereas 30 ECs were novel ones.

109

ICAR-NIPB ANNUAL REPORT 2019

Comparative transcriptome profiling of the tolerant, RH1222-28 and susceptible NRCHB101 B. juncea lines for Sclerotinia stem rot and data analysis (Navin C Gupta, Pankaj Sharma, Dwijesh C Mishra, Kishore Gaikwad, Mahesh Rao, and RC Bhattacharya) The identified Sclerotinia stem rot disease tolerant line of B. juncea RH122-28 and susceptible line NRCHB 101 were used in comparative RNASeq analysis. For this, three- time points 24 hpi (hour post-inoculation), 48 hpi and 96 hpi were chosen and collected the samples in two biological replicates along with the mock control to mitigate any genetic and environmental effect over the transcripts. For each time point samples were collected from five different individuals and thus a total of 60 individual samples were collected from R line (RH1222-28) and similarly 60 plants from S line (NRCHB-101). The RNA isolated from 120 samples both from R and S line were analysed for quality in bio analyser and with rin, values of >= 8.5 were used for further pooling in equimolar concentration from five different samples to make one for each time point and similarly in case of its biological replicate. In the case of mock samples, the first individual pooled mock sample was made for each time point and later equimolar samples from all the three pooled mock were mixed to make one mixed mock sample. The similar procedure was followed for the samples from the susceptible line. Now all the 16 samples, 8 from each R and S line were used for RNASeq paired-end library preparation and sequencing on Illumina HiSeq 2500 platform for transcript profiling. The sequenced quality reads with average base quality >Q30 which was >94.3% of the base was further processes for de novo assembly (Table 5.6). All the assembled transcripts with length >= 200 bp were considered for transcript expression estimation and downstream annotations (Fig 5.27).

Table 5.6: Summary of the de novo assembled transcript of the B. juncea R and S lines after S. sclerotiorum inoculation.

Description # of Assembled # of Assembled transcripts transcripts Number of assembled transcripts 504778 375819 Longest transcript length (bp) 17306 17306 Mean GC % of transcripts 41.81% 41.51%

110

ICAR-NIPB ANNUAL REPORT 2019

Fig. 5.27: The transcriptome assembly results. (a) The length distribution for all transcripts assembled, and (b) the GC content distribution of the all assembled transcripts in B. juncea challenged with S. sclerotiorum.

The assembled transcripts for all the three-time points and treatment along with their control are under analysis to observe the differentially expressed genes (DEGs) and their correlation with the defense response aggravated in the host after pathogen infection.

Development of genome editing constructs for cytokinin modulation and protoplast transformation (Navin C Gupta, Guy Barker, Mahesh Rao, and RC Bhattacharya) Cloning and characterization of the Cytokinin oxidase/dehydrogenase (CKX) gene from Brassica juncea Cytokinin oxidase/dehydrogenase regulates cytokinin (CK) level in plants and plays an essential role in CK regulatory processes. Evidence showed the knock-out effect of the CKX3 genes in rice and Arabidopsis leads to an increase in yield and abiotic stress tolerance, respectively we have selected this gene to edit through the CRISPR-Cas9 technique. As the quality sequence of the CKX3 gene from B. juncea was not available in the public domain, we made four sets of primers from the conserved reasons of the available sequences and amplified the genes with different combinations of the primers. The obtained PCR amplicon was gel purified (Fig 5.28a) and cloned into the TOPO cloning vector. The recombinant clones were confirmed by restriction digestion with EcoRI endonuclease (Fig 5.28 b, c). The positive clones were sequenced and analyzed (Fig. 5.29) in silico by using the NCBI Blast and alignment tool.

111

ICAR-NIPB ANNUAL REPORT 2019

Fig. 5.28: Gel purification of the PCR amplicons and restriction confirmation of the recombinant clones. (a) Gel purified PCR amplicons of CKX3 (b) EcoRI digested clones of the CKX3 amplicons into TOPO TA cloning vector with F and R2 primers and (c) with F3 and R3 primers.

Fig. 5.29: The cloned BjunCKX3 Sequence information ant its features.

Selection and designing of guide RNA from the cloned CKX3 gene sequence From the in silico predicted guide RNA using CRISPOR tool three guides were selected based on their least or no off-targeting site and kept 200 bp intervals between the two selected guides. All these three selected guides were present on the reverse sequence of the cloned CKX3 gene (Fig. 5.30a). These three guides were used to make three possible combinations (Fig. 5.30b) to clone two guides at a time in a dual guide acceptor vector (Fig. 5.30c) for ascertaining their compatibility and efficacy in targeted gene editing. Two of the guides with BsaI restriction sites at their 5´ namely B85 and B338 were prepared by making the oligo duplex by ligating the forward and reverse oligos of the respective guides following a standard procedure by incubating in a PCR. The developed oligo duplexes were ligated into the BsaI digested vector (Fig. 31a) followed by the transformation of the ligated reaction mix into E. coli competent cells. The vector was carrying the β-galactosidase and red fluorescent

112

ICAR-NIPB ANNUAL REPORT 2019 protein as selectable marker genes between the two BsaI and Esp3I cloning sites, respectively. Therefore, the colour of the recombinant colonies for the BsaI position was observed pink whereas blue for the non-recombinant over the x-Gluc and IPTG supplemented Luria Bertani Agar (LBA) medium (Fig. 31b). The recombinant colonies were confirmed by colony PCR (Fig. 5.31c) by using the guide-specific reverse primer along with the vector- specific forward primer. The putatively positive clones were picked for plasmid DNA isolation (Fig. 5.31d) followed by sequencing (Fig. 5.32).

Fig. 5.30: Selection of the guide RNA and designing of guide combination. (a) Position of the selected guides on the exonic region of the CKX3 gene, (b) Cartoon of the three combinations of the selected guides, and (c) vector map of the dual guide acceptor vector. Cloning of the first guide at BsaI position of the dual guide acceptor vector

Fig. 5.31: Cloning and transformation of B85 and B338 guide at the BsaI position of the CRISPR vector. (a) Plasmid DNA of the vector, (b) Pink (recombinant) and blue (non- recombinant) colonies over selection media, (c) colony PCR of the recombinant colonies, and (d) plasmid DNA of the selected PCR positive clones.

113

ICAR-NIPB ANNUAL REPORT 2019

Fig. 5.32: Sequencing result of the recombinant clones carrying guides B85 and B338 at BsaI position of the dual guide vector. The shaded region showing the guide sequences of the respective clones.

Cloning of the second guide at Esp3I position of the recombinant dual guide vector The recombinant dual guide vectors for BsaI position B85 and B338 were used to clone the second guide at position 2 of the vector i.e., Esp3I site. For this, the Esp3I digested pDNA of the recombinant B85 and B338 vectors (Fig. 5.33a) were ligated with E338, E2051, and E2051 guides, respectively, and transformed into E. coli competent cells (Fig. 5.33b). The recombinants for both the position were selected based on their colour which has expected to be of whitish-yellow. The recombinants for both the positions were confirmed by colony PCR (Fig. 5.33c) using the second guide-specific forward and vector-specific reverse primers. Additionally, these recombinants were doubly confirmed by amplifying with vector- specific primers flanking the BsaI and Esp3I restriction sites. The two putatively positive recombinants were selected for each construct for plasmid isolation (Fig. 5.33d) and sequenced for the confirmation of the insertion of the guides at the desired position (Fig. 5.34).

114

ICAR-NIPB ANNUAL REPORT 2019

Fig. 5.33: Cloning and transformation of E338 and E2051 in the recombinant vector carrying the B85 and B338 at the BsaI site. (a) Esp3I digested B85 and B338 recombinant pDNA, (b) recombinant colonies obtained for the B85 with E338 and E2051 and B338 with E2051 guides, (c) colony PCR of the recombinant clones from the individual constructs, and (d) pDNA from the putatively positive colonies.

Fig. 5.34: Sequencing result of the recombinant clones carrying both the guides in combinations of B85 with E338, E2051 and B338 with E2051 at BsaI and Esp3I positions of the dual guide vector, respectively. The shaded region showing the guide sequences of the respective clones.

All these three CRISPR-Cas9 constructs developed for the BjunCKX3 genes are needed to be checked for their efficacy by protoplast transformation followed by sequencing of the amplicons. The effective guide construct will further be used for stable transformation in B. juncea to get the desired trait of interest.

Standardization of Protoplast isolation and transformation technique in B. juncea (Navin C Gupta, Guy Barker, Mahesh Rao, and RC Bhattacharya) The procedure standardized in B. oleracea for protoplast isolation was used with certain modifications in B. juncea. The younger leaves from the 4-5 week old healthy plant found the best-suited material for protoplast isolation and 0.4 M mannitol balances the osmotic pressure of the isolated protoplasts. About 500-600 osmole was observed sufficient to keep the

115

ICAR-NIPB ANNUAL REPORT 2019 protoplast in a healthy state. The isolated protoplasts were quantified with the hemocytometer under the compound microscope (Fig. 5.35a). Approximately 40,000 protoplasts were used for single vector transformation carrying the mCherry reporter gene. The transformed protoplasts fluoresce red (Fig. 5.35b) after 24 hours under the fluorescent microscope.

Fig. 5.35: Protoplast isolation and transformation (a) Bright-field image of the protoplasts isolated from the leaves of the 4-week old plants of B. juncea. (b) UV filter image of the protoplasts transformed with mCherry.

Enlarging gene pool of Brassica juncea through resynthesis using parental species and development of haploid inducer lines (Pooja Garg, Anamika Kashyap, Navin C Gupta, Rohit Chamola, Naveen Singh, RC Bhattacharya, KK Singh, Rashmi Yadav, Shashibhusan and Mahesh Rao)

The resynthesized Brassica juncea lines (RBJ1 to RBJ-92) in S6 generation was subjected for the stability analysis at the NBPGR, Delhi; NBPGR-RS, Ranchi; IARI-RS, Pusa Bihar and yield contributing trait data were recorded for all the lines in the replicated manner. At ICAR NIPB, the samples for the mitosis (root tips) and meiosis (unopened floral buds) were collected for the cytogenetic analysis of these samples. The pollen viability was done which suggest the good amount of fertility in most of the lines (Fig. 5.36).

Fig.5.36: Pollen viability of advanced resynthesized B. juncea lines (RBJ lines, S6 generations).

116

ICAR-NIPB ANNUAL REPORT 2019

Also, this year the seed from 85 new resynthetic B. juncea lines were harvested (in S1 generation) which will be further subjected for the cytological as well as genetic diversity study (Table 5.7 and Fig.5.37). New crosses were attempted during this year for both resynthetic of Brassica juncea and development of synthetic amphidiploids between Wild species and B. rapa.

Fig. 5.37: Synthetic B. juncea in S1 generation along with parents B. rapa and B. nigra

Table.5.7: Cross details of the 85 new resynthetic B. juncea lines (in S2 generation) S Generation S Generations Sr. 1 1 Crosses Resynthesized Sr. No. Crosses Resynthesized No. B. juncea B. juncea 1 BR2 x BN1 2 17 P.Gold x BN10 1 2 BR2 x BN2 2 18 P.Gold x BN11 4 3 BR2 x BN3 2 19 P.Gold x BN6 6 4 BR2 x BN4 1 20 BR8 x BN1 4 5 BR2 x BN5 3 21 BR8 x BN2 2 6 BR2 x BN6 3 22 BR8 x BN3 3 7 BR2 x BN8 2 23 BR8 x BN4 2 8 BR2 x BN9 1 24 BR8 x BN5 1 9 BR2 x BN10 2 25 BR8 x BN6 2 10 BR2 x BN7 1 26 BR8 x BN7 2 11 P. Gold x BN1 2 27 BR8 x BN8 2 12 P. Gold x BN3 1 28 BR8 x BN9 1 13 P.Gold x BN4 2 29 BR8 x BN10 1 14 P.Gold x BN5 1 30 BR8 x BN11 1 15 P.Gold x BN7 1 31 (Br8xBr2) x BN2 8 16 P. Gold x BN9 1 32 (Br2xBr8) x BN2 18

117

ICAR-NIPB ANNUAL REPORT 2019

Development of synthetic amphidiploids for transfer of gene(s) from wild to cultivated species (Pooja Garg, Anamika Kashyap, Navin C Gupta, Rohit Chamola, Naveen Singh, RC Bhattacharya and Mahesh Rao) In continuation for the program of enlarging gene pool of Brassica juncea, we are making use of different crop wild relatives (CWR) of Brassica and making the crosses of wild species with the bridge species B. rapa cv. yellow sarson (NRCPB rapa8) to develop synthetic amphidiploids by crossing and amphidiplodization. These synthetic amphidiploids will further be crossed and backcrossed with B. juncea genotypes to develop the introgression lines for different yield traits as well as for the stress tolerance. Several events from four cross combinations (NRCPB rapa8 x Diplotaxis muralis, NRCPB rapa8 x Erucastrum gallicum, NRCPB rapa8 x Moricandia arvensis, Crambe abbysinicum (EC694145) x NRCPB rapa8) in the amphidiploid stage were identified and the pollen fertility was analysed (Fig. 5.38). The selfing/bud pollination was attempted to harvest the seeds of the synthetic amphidiploids. These lines will be further used for the development of introgression lines in B. juncea.

Fig. 5.38: Pollen viability of synthetic amphidiploid of B. rapa x wild species (S1 generation).

Genetic Stock management of Rapeseed Mustard (Mahesh Rao, Navin C Gupta, Anshul Watts, Rohit Chamola, Ashish Kumar, RC Bhattacharya) A good number of diverse genetic stocks of Brassicas including the U-triangle species, crop wild species of Brassica, CMS lines, synthetic amphidiploid (forty-six accessions of B. nigra; sixty-eight accessions of B. rapa; twenty-five species of Brassica wild species with around 42 accessions; two synthetic amphidiploids developed using wild species and Brassica rapa; thirteen CMS lines of Brassica spp.) are maintained and used by Brassica group at ICAR- NIPB, Delhi every year (the detailed information is available with ICAR-NIPB, Delhi).

118

ICAR-NIPB ANNUAL REPORT 2019

In-vitro cleavage assay of CENH3 locus of B. juncea and B. oleracea (Anshul Watts, Ritesh Kumar Raipuria and Ramcharan Bhattacharya) Three different sgRNAs targeting a different region of CENH3 gene were designed. Further, to verify that, these three sgRNAs are efficient to guide the Cas9 enzyme to cleave CENH3 gene, an in-vitro cleavage assay was performed. To perform this assay, these sgRNAs were synthesized in-vitro using NEB EnGen® sgRNA synthesis kit. After that, Cas9 mediated cleavage of PCR amplified CENH3 locus was performed using these sgRNAs. The cleavage reaction was performed in an eppendorf tube and kept at 37°C for 15 minutes. After 15 minutes the product was loaded on 1.2% (w/v) agarose gel and it was found that this three sgRNA can cleave CENH3 gene under in-vitro condition (Fig. 5.39).

Fig. 5.39: In-vitro cleavage assay of CENH3 gene using three different sgRNA designed from three different regions of CENH3 gene. A) In-vitro cleavage of CENH3 using sgRNA1 B) SgRNA2 and sgRNA3.

Establishment of regeneration protocol for B. oleracea var. botrytis cultivar Pusa Meghna (Anshul Watts and Ritesh Kumar Raipuria) A high efficient regeneration protocol for B. oleracea var. botrytis Pusa Meghna cultivar using hypocotyls as explant was developed. In this protocol initially, seeds were surface sterilized and sown on ½ MS media. After 5 days of sowing, hypocotyls were cut and these were placed on callus induction medium (MS + 0.75 mg/l, 6-BAP + 0.1 mg/l, α-NAA + 5 mg/l AgNO3). After healthy callus formation, these were placed on shoot regeneration

119

ICAR-NIPB ANNUAL REPORT 2019 medium (MS + 1.5 mg/l, 6-BAP + 0.2 mg/l, α-NAA + 0.01 mg/l, GA3 + 5 mg/l AgNO3). Further, healthy shoot initials were shifted on shoot elongation medium (MS + 0.5 mg/l, 6- BAP). The healthy shoots were shifted to root induction medium (MS + 1 mg/l, IBA). Proper healthy roots were developed within 3-4 weeks. These rooted plantlets were shifted in a test tube containing tap water for 3-5 days for hardening and then these were shifted to the pots in the net house conditions (Fig. 5.40).

Fig. 5.40: Different stages of In-vitro regeneration of Pusa Meghna cultivar of B. oleracea var. botrytis from hypocotyl tissue

Estimation of genome size in wild Brassica species (Anshul Watts and Ramcharan Bhattacharya) At present we are maintaining around 30 different wild Brassica accession including both diploid and tetraploid in the net house of ICAR-NIPB. The sowing of this germplasm was done in October 2019. The leaves from these wild Brassica species were collected for genome size estimation using flow cytometry (Fig. 5.41).

120

ICAR-NIPB ANNUAL REPORT 2019

Fig. 5.41: Estimation of genome size of wild Brassicaceae species using flow cytometry. The genome of B. mourorum, D. assurgens, D. tinisilique, D. vimnea, D. seitiana, D. muralis and D. cretasia were 473, 1269, 511, 1208, 1226, 1253 and 1240 Mbp respectively.

Estimation of genome size of Orobanche aegyptica (Anshul Watts and Ramcharan Bhattacharya) Orobanche ageyptica is a complete root parasite which can attack many important agricultural crop plants. We have estimated the genome size of O. aegyptica samples collected from Charkha Dadri district of Haryana using flow cytometry. The two biological replicates of O. ageyptica were showing genome size around 3966 and 3980 Mbp respectively (Fig. 5.42). We have also initiated work towards its management.

121

ICAR-NIPB ANNUAL REPORT 2019

Fig. 5.42: Estimation of genome size of Orobanche ageyptica using flow cytometry. Arabidopsis thaliana was taken as a control.

122

ICAR-NIPB ANNUAL REPORT 2019

Human Resource Development

 Post-graduate Teaching Programme  Training and Capacity Building

123

ICAR-NIPB ANNUAL REPORT 2019

Post-graduate Teaching Programme National Institute for Plant Biotechnology (NIPB) has been actively engaged in Human Resource Development in the area of plant Molecular Biology and Biotechnology since its inception. Currently 28 Ph.D. and 17 M.Sc. students are registered in the discipline of Molecular Biology and Biotechnology at the Centre. In the previous year, Seven Ph.D and Five M.Sc. Students were awarded with doctoral and master’s degrees, respectively. Students on roll in the discipline of Molecular Biology and Biotechnology during the Academic Session 2019-20.

S.No Name of the student Chairperson Ph.D Students 1. Mr. Manoj M. L. (10495) Prof. Nagendra Singh 2. Ms. Priyanka Singh (10697) Prof. Nagendra Singh 3. Mr. Chetan Kumar Nagar (10720) Dr. Pranab Kumar Mandal 4. Ms. Sharani Choudhury (10836) Dr. R. C. Bhattacharya 5. Ms. Sreeshma N (10839) Prof. Nagendra Singh 6. Mr. Mahendra C. (10844) Dr. Kanika 7. Mr. Soham Choudhury (11068) Dr. Monika Dalal 8. Ms. L. Ashakiran Devi (11070) Dr. R. C. Bhattacharya 9. Ms. Bablee Kumari Singh (11071) Dr. S.V.A.C.R. Mithra 10. Mr. Abinash Biswajit Sethy (11072) Dr. Amolkumar U. Solanke 11. Mr. Sachin (11074) Dr. Pranab Kumar Mandal 12. Mr. Suhas G. Karkute (11288) Dr. Amol Kumar Solanke 13. Mr. Bipratip Dutta (11290) Dr. S. V. A. C. R. Mithra 14. Ms. Sheel Yadav (11291) Dr. Pradeep Kumar Jain 15. Mr. Akash Paul (11293) Dr. Kishor Gaikwad 16. Mr. Saakre Manjesh (11294) Dr. Debasis Pattanayak 17. Ms. Taku Monya (11295) Dr. P. K. Dash 18. Mr. Mawuli Kwamla Azameti (11362) Dr. Jasdeep C. Padaria 19. Ms. Shaziya Sultana (11367) Dr. Sharmistha Barthakur 20. Mr. W. Sandesh Tulsiram (11370) Dr. Anita Grover 21. Mr. Krishnayan Paul (11546) Dr. Debasis Pattanayak 22. Mr. Muhammed Shamnas V. (11547) Dr. Subodh Kumar Sinha 23. Mr. Naresh Kumar Samal (11548) Dr. R. C. Bhattacharya 24. Mr. Zaherul Islam (11549) Dr. Amol Kumar U. Solanke 25. Mr. Deepesh Kumar (11550) Dr. S. V. A. C. R Mithra 26. Mr. Dhivyanandham K. (11551) Dr. Monika Dalal 27. Mr. Gopal (11552) Dr. Pradeep Kumar Jain 28. Mr. Ankur Poudel (11646) Dr. Pranab Kumar Mandal 29. Ms. Mamta Gupta Roll No 10217 Dr. Sarvjeet Kaur 30. Ms.Anupma Roll No 10319 Dr. Sarvjeet Kaur

124

ICAR-NIPB ANNUAL REPORT 2019

M. Sc. Students 31. Mr. Megavath Ravi Naik (20998) Dr. Pranab Kumar Mandal 32. Mr. Somya Gupta (21043) Dr. Sarvjeet Kaur 33. Mr. Ankan Chakraborty (21148) Dr. Monika Dalal 34. Mr. Samar Deb (21149) Dr. Tapan Kumar Mondal 35. Ms. Priyanka Kumari (21150) Dr. Subodh Kr. Sinha 36. Mr. Jeet Roy (21151) Dr. S. V. A. C. R. Mithra 37. Ms. Ashika Debbarma (21152) Dr. Sarvjeet Kaur 38. Ms. Tamilarasi M. (21153) Dr. Kanika 39. Mr. Sovanlal Sahu (21154) Dr. P. K. Dash 40. Mr. Akash Maity (21308) Dr. Monika Dalal 41. Ms. Rekha Mahato (21309) Dr. Tapan Kumar Mondal 42. Mr. Mutawar Ashfaf S. (21310) Dr. Sarvjeet Kaur 43. Mr. Mahamed Ashiq I. (21311) Dr. Sharmistha Barthakur 44. Ms. Shwetha R (21312) Dr. Jasdeep C. Padaria 45. Ms. Ankita Vilasrao Chinche (21313) Dr. Kanika 46. Ms. Anindita Barua (21314) Dr. N. C. Gupta 47. Mr. Gowtham T. P. (21315) Dr. P. K. Dash

125

ICAR-NIPB ANNUAL REPORT 2019

Degrees awarded in the discipline of Molecular Biology and Biotechnology during the convocation held in February, 2019

S No. Name of the Student and Roll No. Chairperson, Advisory Thesis Title Committee Ph. D. 1) Mr. H. H. Kumaraswamy (9864) Prof. N. K. Singh Study of population structure and phylogeny in Indian wheat landraces using DNA markers 2) Mr. Deepak V. Pawar (10153) Prof. N. K. Singh Functional analysis of blast resistance gene Pi56or(t) from Oryza rufipogon 3) Mr. Alim Junaid (10314) Dr. Kishor Gaikwad Understanding the epigenetic regulatory networks in CMS based pigeonpea hybrid.

4) Mr. Rakesh K. Prajapat (10317) Dr. Rekha Kansal Comparative in silico analysis and functional validation of legume lectins for insecticidal activity

M. Sc. Students 1. Mr. Niladri Barman (20837) Dr. Monika Dalal Cloning and characterization of drought inducible PM19 promoter from wheat 2. Mr. Sourav K. Das (20838) Dr. S.V.AmithaC.R. Mithra Marker development for major drought and heat stress tolerance QTLs and their validation in rice (Oryza sativa L.) 3. Mr. Bipratip Dutta (20839) Dr. Amolkumar U. Solanke Characterization of Magnaporthe- responsive WRKY genes in contrasting rice genotypes for panicle blast resistance 4. Ms. Shaziya Sultana (20840) Dr. Sharmistha Barthakur Molecular cloning and gene expression profiling of (GPAT) (Glycerol-3-phosphate acyl transferase) under terminal heat stress in wheat (Triticum aestivum L.) 5. Mr. Akash Paul (20841) Dr. Subodh K. Sinha Co-expression studies of NAR2.1 and NAR 2.2 genes with high affinity nitrate transporter gene (NRT2.1) in root tissues of wheat (Triticum aestivum L.) 6. Mr. Sunil Ningombam (20842) Dr. Jasdeep C. Padaria Development of microsatellite marker associated with heat stress tolerance in Pennesetum glaucum (L.) R.BR 7. Ms. Taku Monya (20843) Dr. Rhitu Rai Isolation, cloning and functional validation of a TAL like effector gene from Xanthomonas oryzae pv. oryzae

126

ICAR-NIPB ANNUAL REPORT 2019

Training and Capacity Building Details of training by ICAR-NIPB staff during 2019

S.No Name Subject Area Duration Host Institute (month of the year) 1. Dr.Mahesh Rao “Advanced cytogenetic April to June Justus Liebig tools and techniques in 2019. University relation to interspecific Giessen, hybridization and Germany polyploidy for Brassica crop improvement” 2. Dr.Nimmy.M.S. IVth National Training 15- 26 July 2019, Repository of Workshop on “TILLING (12 days) Tomato and Genome Editing in Genomics Crop” Resources (RTGR); University of Hyderabad 3. Dr.Nimmy.M.S 4th Management 15-17 May 2019, School of Development Programme (3 days) Management Studies, Cochin University of Science and Technology, Kochi, Kerala. 4. Dr. Ramawatar 3rd International workshop 18 - 22 International Nagar on Genomic Selection November 2019, Crops Research through Advanced R & (5 days) Institute for the Machine Learning Semi-Arid Tropics, Hyderabad 5. Ms. Megha Motivation, positive 4-12 December NIANP, thinking and communication 2019, (9 days) Bengaluru skills 6. Sh. Deepak Motivation, positive 4-12 December NIANP, Kumar Rathod thinking and communication 2019 (9 days) Bengaluru skills 7. Ms. Rita Motivation, positive 4-12 December NIANP, thinking and communication 2019, ( 9 days) Bengaluru skills

HRD Fund allocation and utilization Total HRD fund allocation for Actual expenditure for 2019- % utilization 2019-2020 (Rs. in Lakh) 2020 (Rs. in Lakh)

1.5 1.49478 99.65

127

ICAR-NIPB ANNUAL REPORT 2019

Extension and Outreach Activities

128

ICAR-NIPB ANNUAL REPORT 2019

Extension and Outreach activities ICAR-National Institute for Plant Biotechnology organizes extention and outreach activities through two major initiatives of government of India namely Mera Gaon Mera Gaurav (MGMG) and Scheduled Castes Sub Plan (SCSP). The activities carried out during the year 2019 are as follows Transfer of ICAR-NIPB technologies to the farmers of Western and Eastern part of Uttar Pradesh Under Mera Goav Mera Garv (MGMG) during Kharif and Rabi season 2019 • ICAR-NIPB organized 29 Kisan Ghosthi /Meeting with farmers in adopted villages Narmohampur, Nekpur and Shakalapur district Bulandshar and Dumrao, Kasharia, Arshipur, Bhilashpur, district Mau and Ballia, Uttar Pradesh. About 507 farmers participated in these meetings. • Total 201 demonstrations of rice varieties Pusa Basmati 1637 and DDR Dhan 50 and 129 demonstrations of mustard varieties Pusa Jai Kisan, Pusa Mustard 28 and wheat variety HD 3237 were conducted at these adopted villages at farmer field. • During their visits the institute scientists also created awareness about Soil testing, Pradhan Mantri Fasal Bima Yojna, E-marketing, Drip irrigation, organic farming. Cleanliness drive under Sawach Bharat Abhiyan was also undertaken during the visits. • Institute have organized training program for seed production of Pusa 1637 and Pusa 1460 along with mustard varieties Pusa Jai Kisan, Pusa Mustard 28 and wheat variety HD 3237 at respective villages.

Scientists of ICAR-NIPB interacting with farmers

Demonstration of rice varieties DRR Dhan 50 at farmer’s field in village peeparsat (District Mau) and Tetariya (District Kushinagar)

129

ICAR-NIPB ANNUAL REPORT 2019

Impact analysis on 50 farmers (Small, medium and large) growing Pusa Basmati 1637 in Khurja Block of District Bulandshar

50 farmers (Small, medium and large) were randomly selected from Khurja Block of District Bulandshar. The impact analysis of growing rice variety Pusa Basmati 1637 (PB1637) as compared to Pusa Basmati 1 (PB1) was carried out in terms of their total cost of cultivation, total income and BC ratio. The analysis revealed that irrespective of land holding the cost of cultivation was higher in case of PB1 while total income per hectare and BC ratio was higher with PB1637. This indicates that rice variety PB1637 gives more income to farmers.

Impact analysis on random 50 farmers (small, medium and large) growing DDR Dhan 50 compared with shamba Mahsuri at Pardaha Block, Mau, Uttar Pradesh

50 farmers (Small, medium and large) were randomly selected from at Pardaha Block, Mau, Uttar Pradesh. The impact analysis of growing rice variety DDR Dhan 50 as compared to Shamba Mashuri was carried out in terms of their total cost of cultivation, total income and BC ratio. The analysis revealed that irrespective of land holding the cost of cultivation was higher in case of shamba Mahsuri while total income per hectare and BC ratio was higher DDR Dhan 50.

130

ICAR-NIPB ANNUAL REPORT 2019

Transfer of ICAR-NIPB technologies to the farmers of Western and Eastern part of Uttar Pradesh under SCSP during Kharif and Rabi season 2019

• During Kharif and Rabi season, several training programs were organized by ICAR- NIPB, New Delhi at different villages of Bulandshar, Mau, Azamgarh, Khishinagar, Gorakhpur, Mirzapur, Ballia district of Uttar Pradesh. More than 7000 farmers participated in these trainings.

• In the training programs, seed of rice varieties Pusa Bamati 1637 and DDR Dhan 50 were distributed to 3171 farmers from different villages of Mau, Azamgarh, Gorakhpur, Khishinagar, Ballia and Bulandshar district of Uttar Pradesh.

• Seeds of pigeon pea variety Pusa Arhar 16 were distributed to 229 farmers from different villages of district Gurgram, Haryana.

• For Rabi season, seeds of wheat varietiy HD 3237, pigeon pea variety PM 28 and mustard variety Pusa Jai Kisan were distributed to 3210 farmers of different villages of districts Bulandshar, Mau, Azamgarh, Khishinagar, Ballia, Gorakhapur district of Mizapur Uttar Pradesh.

131

ICAR-NIPB ANNUAL REPORT 2019

Krishi Vigyan Mela

NIPB staff participated in Krishi Vigyan Mela held at IARI, New Delhi during 5 - 7 March 2019. NIPB staff and students actively participated in stall arrangement, poster presentation and distributed newsletter, pamphlets of different crop varieties developed by ICAR-NIPB as one of the collaborators along with crop based institutes or IARI. The NIPB stall was visited by a large number of farmers and school students. Farmers of adapted villages under MGMG also visited Krishi Mela 2019.

132

ICAR-NIPB ANNUAL REPORT 2019

Other Institutional Activities

 Institutional Projects  Externally Funded Projects  Technology Commercialization and IPR  Awards and Honours  Visits Abroad  Recruitments/Promotions/Retirements  Other Activities  Participation in Conferences/Seminars /Symposia  List of Publications  Important Committees

133

ICAR-NIPB ANNUAL REPORT 2019

Institutional Projects

Project Title Date of Date of Principal Name of Associates Start Completion Investigator Dr. T. K. Mandal Dr. Vandna Rai Dr. P. K. Dash Dr. Rhitu Rai Dr. S. V. A. C. R. Search and deployment of 1st April, 31st March, Prof. N. K. Mithra genes for stress tolerance and 2017 2020 Singh Dr. Amolkumar U. grain quality in rice. Solanke Dr. Deepak S. Bisht Dr. Pankaj Kumar Ms. Rita Dr. J. C. Padaria Dr P. K. Mandal Adaptation of wheat to climate 1st April, 31st March, Dr. Sanjay Dr. S. Barthakur change induced stresses. 2017 2020 Singh Dr. Kanika Dr. Monika Dalal Dr. Subodh Sinha Dr. P. K. Jain Improvement of stress Mr. R. A. Nagar 1stApril, 31st March, Dr. Sarvjeet tolerance in chickpea. Dr. M. S. Nimmy 2017 2020 Kaur Mr. Deepak K. Rathore Dr. Kishor Gaikwad Dr.Rohini Sreevathsa Stress tolerance and quality 1st April, 31st March, Dr. Debasis Dr. A. Dinabandhu improvement in pigeonpea. 2017 2020 Pattanayak Dr. Sandhya Dr. R.S. Niranjan Ms. Megha Mr.Anshul Verma Dr. Anita Grover Dr. Rekha Kansal Dr. Ashish Kumar Biotechnological approaches Dr. Navin C. Gupta 1st April, 31st March, Dr. R. C. for Brassica improvement. Dr. Mahesh Rao 2017 2020 Bhattacharya Mr. Anshul Watts Mrs. Seema Dargan Dr. Rohit Chamola Mrs. Sandhya Rawat

134

ICAR-NIPB ANNUAL REPORT 2019

Externally Funded Projects

S.No. Title of the project Funding Sanctioned Principal agency budget (Rs. Investigator Lakhs)

ICAR-NPTC Prof. Nagendra K. 1. Functional genomics of rice, wheat (Since 2005) 500 Lakhs Singh (Plan-linked) Improvement of Pigeon pea for plant type, early maturity, pod borer Prof. Nagendra K. 2. DBT-ISCB 640 Lakhs resistance and moisture stress Singh tolerance (Network programme) From QTL to Variety: breeding for Prof. Nagendra K. 3. DBT 1000 Lakhs abiotic stress tolerance in rice-Phase Singh Referral centre for Genetic Fidelity Dr. Amolkumar U 4. testing of Tissue culture raised plants DBT 71.37 Lakhs Solanke (NCS-TCP) RiceMetaSys: Understanding rice Dr. Amolkumar gene network for biotic and abiotic 5. ICAR-CABin 13.49 Lakhs U. Solanke stress management through system

biology approach CRISPR-Cas9 based genome editing Dr.Amolkumar U. 6. of multiple negative regulators for DST-SERB 31.93 Lakhs Solanke blast resistance in rice Maintenance, Characterization and use of EMS Mutants of upland variety Dr. Amitha 7. Nagina 22 for Functional Genomics in DBT 258.98 Lakhs Mithra Sevanthi Rice- Phase II” (BT//PR10787/AGIII/103/883/2014) Structural and functional genomics 8. study of deepwater adaptation of local DBT 24.47 Lakhs Dr. T. K. Mondal rice landraces of Assam Generation and comparative analysis of salinity responsive miRNAs and miRNA-mediated pathways among 9. halophyte (Oryza coarctata), tolerant DBT 60.60 Lakhs Dr. T. K. Mondal glycophyte (Oryza sativa cv Nona bokra) and susceptible glycophyte (Oryza sativa cv IR-64) genotypes National Tea Decoding tea (Camellia assamica) Research 10. genome for identification of 116 Lakhs Dr. T. K. Mondal Foundation, Tea commercially important genes Board, Kolkata

135

ICAR-NIPB ANNUAL REPORT 2019

Understanding the mechanism of low- Dr. Prasanta K. 11. ICAR-NASF 296.16 Lakhs light tolerance in rice. Dash Genetic improvement of rice for yield, abiotic and biotic stress tolerance Dr. Prasanta K. 12. ICAR-NASF 78.10 Lakhs through RNA guided genome editing Dash (CRISPR-Cas9). ICAR- Dr. Prasanta K. 13. Bast fibre yield in flax 7.0 Lakhs NPGFFM Dash Gene Discovery for Reproductive 14. DBT 89 Lakhs Dr. Vandana Rai Stage salt tolerance in rice Molecular Dissection of mechanism of 36.36 Lakhs Dr. Deepak S. 15. DST resistance to Sheath Blight in Rice Bisht ICAR- Genetic modifications to improve Incentivizing Dr. Pranab Kumar 16. biological nitrogen fixation for 110.85 Lakhs Research in Mandal augmenting nitrogen needs of cereals Agriculture Development of Low Immunogenic ICAR-CRP on Dr. Pranab Kumar 17. 14.475 Lakhs Wheat Biofortification Mandal Indo-UK Centre for the improvement 217.154 Lakhs Dr. Pranab Kumar 18. of Nitrogen use Efficiency in Wheat DBT Mandal (INEW) Identification and functional validation of partner proteins of two- 36.32 Lakhs Dr. Subodh 19. SERB-DST component high affinity nitrate Kumar Sinha transporter of wheat Development of transgenic wheat for ICAR- 35 Lakhs Dr. Sharmistha 20. heat stress tolerance NPFGGM Barthakur Deciphering the transcriptional DST-SERB 21. 40.7 Lakhs regulator(s) of hydrotropism in wheat Dr. Monika Dalal Development of wheat transgenics 22. ICAR-NPTC 14.50 Lakhs with enhanced tolerance to drought Dr. Monika Dalal Characterization, mapping and transcriptome analysis of seed protein, Dr. P.K. Jain 23. NASF 102 Lakhs β-carotene and mineral contents in chickpea (Cicer arietinum L.) Identification and molecular tagging of gene(s) controlling resistance to 39 Lakhs Dr. P.K. Jain 24. NASF chilli leaf curl virus infection in chilli (Capsicum annuum L.) Finishing of pigeonpea genome and Dr. Kishor 25. functional genomics of fertility NPTC 16.00 lakhs Gaikwad restoration. Decoding the genomes of guar and ICAR-CRP on Dr. Kishor 26. black gram for the identification of 145.00 Lakhs Genomics Gaikwad important genes

136

ICAR-NIPB ANNUAL REPORT 2019

Molecular mapping and identification of candidate gene(s) responsible for Dr. Kishor 27. DST-SERB 36.63 lakhs the cleistogamous trait in pigeonpea Gaikwad Cajanus cajan Millsp Genomics-led improvement of biotic and abiotic stress tolerance in mustard 108 Lakhs Dr. R. C. 28. DBT rape for economic and environmental Bhattacharya sustainability Development of haploid inducer line, and enhancement of seed-meal quality Dr. R. C. 29. DBT 50 Lakh in Brassica juncea through Bhattacharya CRISPR/Cas mediated genome editing A way forward to developing aphid- resistance in Indian mustard (Brassica 38 Lakhs Dr. R. C. 30. juncea): Host- and virus-mediated SERB Bhattacharya gene silencing of parthenogenetic genes in mustard aphid Development of Aphid Resistant 31. ICAR-NPTC 70 Lakhs Dr. Rekha Kansal Transgenic Brassica Identification of effector candidates from necrotrophic plant pathogen, 32. Sclerotinia sclerotiorum and its target DBT 38.16 Lakhs Dr Navin C Gupta proteins in Indian mustard (Brassica juncea) Broadening genetic diversity of Indian mustard (Brassica juncea) through 33. DST-SERB Dr. Mahesh Rao resynthesis of amphidiploids genome 33.64 Lakhs by crossing parental diploid species Development of haploid inducer line in Brassica oleracea var. botrytis 34. through CRISPR-Cas mediated DST-SERB 40.20 Lakh Dr. Anshul Watts engineering of centromeric histone H3 gene Development of Alternaria-resistant 35. ICAR 21 Lakhs Dr. Anita Grover mustard

137

ICAR-NIPB ANNUAL REPORT 2019

Technology Commercialization and IPR

The mandate of the Institute Technology Management Unit relates to registration of patents, facilitation of contract research projects and commercialization of IPR enabled technologies of the centre through Public- Private Partnership.

The following activities were undertaken by the ITMU during the year 2019.

I. Patent Granted: Patent Application Granted S. Title of patent Date of Number & date of Patent No. application Grant filling Number

Rice Polynucleotide 241/DEL/2010 Associated with blast 1. 05.03.2019 308533 resistance and uses 04.02.2010 thereof.

II. MoUs signed:

1. A Memorandum of Understanding (MoU) has been signed for R & D promotion in partnership mode between ICAR-NIPB, New Delhi and National Tea Research Foundation (NTRF) Kolkata on 30.08.2019 to carrying out joint research programmes in the areas of “Tea Genome Sequencing” through project funded by NTRF and facilitated by Tea board of India for phase II. 2. A Memorandum of Understanding (MoU) has been signed for R & D promotion in partnership mode between ICAR-NIPB, New Delhi and Shree Guru Gobind Singh Tricentenary University, Gurugram on 28.10.2019.

138

ICAR-NIPB ANNUAL REPORT 2019

Awards and Honours  Dr. Debasis Pattanayak became Fellow of National Academy of Agricultural Sciences in January, 2019  Dr. Mahesh Rao received “Srinivasa Ramanujam Memorial Award” (201 ) by Indian Society of Genetics & Plant Breeding (ISGPB), New Delhi – 110 012  Dr. Sanjay Singh received Team Award for development of Land Mark Variety Swarna Sub -1 awarded by Society of Genetics and Plant Breeding, New Delhi during Brain Storming Season held at IARI Regional Indore on 25 August, 2019  Dr. Sanjay Singh received Team award for development of Wheat Variety 3237 awarded by Indian Institute of Wheat & Barley, Karnal, Haryana during ACRIP workshop held at IARI Regional Indore on 24-26 August, 2019  Dr. Nimmy M. S. received ‘Best Oral Presentation’ award during National Conference on-ICIESTRSP-2019, Sardar Vallabhai Patel University of Agriculture and Technology, Meerut held on 20-21 April, 2019  Dr. Sandhya got ‘Best Oral Presentation’ award in National Seminar on Innovative Approaches for Rural and Agriculture Advancement (IARAA-2019) at JNKVV, COA, MP  Dr T. K. Mondal was nominated as DST, GOI, New Delhi PAC member for 2019-2021  Dr T. K. Mondal was nominated as Member, IBSC, TERI University, New Delhi  Dr T. K. Mondal was Nominated as Member, BOS, Sikkim University  Dr T. K. Mondal was Nominated as an expert for the DPC for scientific staff at Vivekananda Parbayta Anusandhan Sala, Almora, Uttarkhand  Dr. Nimmy M.S. received “Outstanding Biotechnologist Award” in recognition of valuable contributions and achievements in the field of Molecular Biology and Biotechnology during rd National Conference on promoting and reinvigorating agri- horti,technological innovations – PRAGATI-2019, held at Jharkhand  Dr. Mahesh Rao received “Young Scientist Award-201 ” in the field of Genetics & Plant Breeding from National Education Empowerment & Development Foundation (NEEDEF), at ICAR-IISR, Lucknow on 20th June 2019  Dr. Subodh K. Sinha received Best oral presentation award in National Conference on Integrative Plant Biochemistry and Biotechnology, pp 34, held on 8-9 November, 2019 at ICAR-IIRR, Hyderabad  Dr. Jasdeep C. Padaria was nominated as a member of IBSC committee of IIWBR, Karnal as DBT nominee  Dr. Pranab K. Mandal was elected as member editorial board for the Journal of Wheat and Barley Research  Dr. Pranab K. Mandal was elected as Editorial Board member from India for the SAARC Journal of Agriculture

139

ICAR-NIPB ANNUAL REPORT 2019

Visit Abroad

1. Dr. Kishor Gaikwad visited Yezhin Agricultural University, Myanmar from 9th Aug to 2nd Sept, 201 for teaching a full course on “Genomics and Bioinformatics” to PG Students, under the IM ACARE project 2. Dr. N. C. Gupta was deputed for long term (3 months) training on CRISPR/Cas9 technique in Brassica at under Indo-UK PORI project with Prof. Guy Barker from June to Sept 2019, at School of Life Sciences, University of Warwick, UK 3. Dr. T. K. Mondal visited Myanmar to teach the M. Sc and Ph. D students of Molecular Biology and Biotechnology a course entitled as, “Plant gene expression and regulation (MBB-624)” under Indo-Myanmar project at ACARE, Yezin Agricultural University, Myanmar from 21/06/2019 and 15/07/2019 4. Dr. Prasanta Dash visited Yezhin University, Myanmar from from 22nd Feb 2019 to 25th March, 2019 for teaching, and attended Plant and Animal Genome conference-2019 at San Diego, USA 5. Dr. Prasanta Dash was deputed to Myanmar for teaching Principle of Genetic engineering course to Post Graduate Students of Yenzin Agriculture university, Myanmar during June 21, 2019 to July 22, 2019 6. Dr. Mahesh Rao undergone training on “Advanced cytogenetic tools and techniques in relation to interspecific hybridization and polyploidy for Brassica crop improvement” under NAHEP-CAAST (World Bank funded project), IARI Delhi with Dr. Annaliese S Mason at Justus Liebig University Giessen, Germany from April to June 2019 7. Dr. Rohini Sreevathsa was deputed to Yezin Agricultural University, Myanmar from 25th January, 2019 to 18th February 201 for teaching a course on “Introduction to Plant Tissue Culture” to PG Students, under the IM ACARE project 8. Dr. Debasis Pattanayak attended SAARC Regional Expert Consultation Meeting on the Progress and Prospects of Agricultural Biotechnology and Biosafety in South Asia held on June, 18-20, 2019 as ICAR Nominee 9. Dr. P.K. Mandal was awarded a fellowship by BBSRC for Scientific Exchange Visit under INEW project to carry out collaborative research work at John Innes Centre, Norwich, UK. from 29 April to 15 June 2019 10. Dr. P.K. Mandal attended the Monogram 2019 meeting held at the university of Nottingham (http://www.monogram.ac.uk/meetings.php) from 30th April – 2nd May 2019 11. Dr. P.K. Mandal was invited and sponsored by BBSRC to the INEW Project Workshop at London from 3-5 December 2019 and presented the work of the Indian Partners 12. Dr. N.C. Gupta attended the precidential meeting of the British Society of Plant Pathology at the University of WE, Bristol, UK drom 2-3 Sept, 2019

140

ICAR-NIPB ANNUAL REPORT 2019

Recruitments/Promotions/Retirements

Recruitments:

1. Mr. Anshul Kumar Verma joined as Technical Assistant (T-3), ICAR-NIPB on 06th March, 2019.

Promotions: None

Retirement:

1. Sh. B.S. Dagar, Assistant superannuated from 30th June, 2019. 2. Sh. Rajesh Kumar Sharma, Sr. Administrative Officer superannuated from 31st July, 2019.

Transfers: None

141

ICAR-NIPB ANNUAL REPORT 2019

Other Activities 1. Hindi Activities 2019 i. Hindi Chetna Maas

Competitions in Hindi essay writing, technical work writing, declamation, poetry, recitation and noting and drafting were conducted for the staff of NIPB as a part of Hindi Chetna Maas from 1th September, 2019 to 31th September, 2019.

ii. Hindi Workshops: Three hindi workshops were conducted during the Year 2019

S. No. Date Quarter Guest Speaker 1. 24-05-2019 April -June Mr. Keval Krishna

2. 13-09-2019 July -September Ms. Sunita

29-11-2019 Mr. Ashutosh K. Tiwari 3. October- December 23-12-2019 Mr. Anand Vijay Dube

142

ICAR-NIPB ANNUAL REPORT 2019

2. Vigilance Awareness Week

ICAR – NIPB observed vigilance Awareness week from 28th October, 2019 to 2nd November, 2019. Director, ICAR-NIPB administered the pledge to the staff on 30th October, 2019.

3. Swachh Bharat Abhiyan ICAR-NIPB organized Swachchta Abhiyan during 11th September 2019 to 2nd October 2019. During this, different teams of scientists, students, technical and other staff visited residential and market places such as inderpuri and Janak vihar, and carried out cleanliness drive. They also created awareness about the deadly menace of using plastic and to stop using single use plastic. Posters were displayed at various places and pamphlets were distributed. On 2nd October ICAR-NIPB celebrated Swachhta Diwas. Dr P.K.Mandal, coordinator for Swachh Bharat Mission from ICAR-NIPB briefed about the activities undertaken from 11th September to 2nd October 2019. Director ICAR-NIPB delivered a lecture on Swachhta and bad effects of SUP. At the end all staff of ICAR-NIPB took Swachhta Pledge.

143

ICAR-NIPB ANNUAL REPORT 2019

4. Voter Awareness Program

The Election Commission of India under its flagship programme ‘Systematic Voters’ Education & Electoral Participation’ (SVEEP), has instructed all the government organizations and institutions to carry out various interventions for strengthening and enhancing quality electoral participation.

Towards this, Director, ICAR-NIPB constituted an executive committee of voter’s awareness forum (VAF); all employees, including contractual employees are members of the voter’s forum. This year before the general Lok Sabha elections, the first event was organized at NIPB auditorium on 6.5.2019.

The nodal officer of VAF executive committee, Dr Sharmistha Barthakur introduced the members of the executive committee to the forum and gave a brief introduction of activities to be carried out throughout the year. A quiz on election and political system of India was also organized during the event. As a part of this initiative, posters were displayed at different locations throughout the institute building and handouts were distributed amongst the staff to motivate, encourage and inspire them to go out and cast their vote in large numbers.

144

ICAR-NIPB ANNUAL REPORT 2019

Participation in Conference/Seminar/Symposium/Workshop

 Dr. T. K Mondal delivered an invited talk on, “Transcriptomics and its application in plant science” at Genetics Division, ICAR-IARI, New Delhi on. 7th Oct., 2019 NHEP, ICAR-HRC sponsored by on, “Genetic assisted breeding for crop improvement” 30th Sept-12th Oct., 2019.  Dr. T. K. Mondal delivered an invited talk on, “NGS and long non-coding RNA” on 5th Sept, 2021 at CAFT training on, ,” Next Generation Sequencing and its Application in Plant Sciences” sponsored by ICAR-HRD, New Delhi at NIPB, from 3rgd to 23rd sept, 2029.  Dr Sarvjeet Kaur delivered a talk on “Applications of NGS in Metagenomic studies” on 9th September 201 in CAFT training on ‘Next Generation Sequencing and its applications in crop improvement’ at NIPB.  Dr. Vandna Rai delivered talk on “Genes discovery for salt-tolerance in rice” July 26, 2019 – July 27, 2019 at The International Conference on Biotechnology of HCMC Open University 2019: Research & Application in Biotechnology  Dr. Vandana Rai delivered talk on "Connecting Proteomics to Next-Generation Sequencing: Proteogenomics and Its Current Applications in Biology" on 19th Sept., 2019 in CAFT organized at ICAR-NIPB.  Dr. Amitha Mithra Sevanthi delivered an invited lecture on the topic “DNA fingerprinting” to biology school teachers on 30th May 2019 in the Training to Biology teachers organized by XIV Genetics Trust and ICAR-NIPB  Dr. Amitha Mithra Sevanthi delivered an invited lecture on the topic ‘Basics of QTL mapping’ in ICAR-CAFT sponsored training on Next generation sequencing and its applications in crop science ICAR-NIPB Sept 2019 (19th Sept 2019)  Dr. Amitha Mithra Sevanthi delivered an invited lecture on the topic “High throughput genotyping Facility: A visit” in NAHEP-CAAST sponsored Training Programme on “Genomics Assisted Breeding for Crop Improvement” held during 30.0 .201 - 12.10.2019 (3rd Oct 2019) at Division of Genetics, ICAR-Indian Agricultural Research Institute.  Dr. Ashish Kumar Gupta attended Indian Phytopathological Society Annual Meeting (Delhi zone) and National Symposium on “Biointensive approaches for management of crop diseases” held on December 21, 201 at ICAR-IARI, New Delhi, India.  Dr. Kishor Gaikwad delivered a talk in CAFT (Next Generation Sequencing and its Applications in Plant Sciences” from 3rd -23rd September, 2019) held at NIPB, New Delhi  Dr. Sandhya attended an international conference on "Plant Genetics and Genomics: Germplasm to Genome Engineering".17-18 Oct, 2019. NASC Complex, Pusa, New Delhi  Dr. Sandhya attended and presented oral talk in “International conference on “Global Perspective in Agricultural and Applied Sciences for Food and Environmental Security (GAAFES-201 )” 1-2 Dec, 2019 at Uttarakhand Nainital  Dr. Sandhya Deliverd a lecture in international conference on “functional genomics approach for assessing quality traits in pulses” organized by ITI pusa and Krishi Sanskriti  Dr. Sandhya delivered a lecture cum practical on "Bioinformatic software and tools for Next Generation Sequencing (NGS) data analysis" during NAHEP-CAAST training programme on 30 july2019 at the Division of Plant Pathology, ICAR-IARI  Dr. Sandhya delivered a lecture cum practical on NGS platform: Sequencing chemistry and library preparation for Illumina Hiseq in CAFT training program at NIPB.

145

ICAR-NIPB ANNUAL REPORT 2019

 Dr. Kishor Gaikwad delivered a lecture at the ICAR sponsored 21 days Winter School on “Breeding and Genomic tools for Stress resistance in vegetable crops” in the Division of Vegetable Science, ICAR-IARI, New Delhi , October 23 to November 12, 2019  Dr Kishor Gaikwad delivered a lecture in NAHEP CAAST: Training Programme on “Genomics Assisted Breeding for Crop Improvement” from September 30th – October 12th, 2019, Div. of Genetics, IARI, New Delhi  Dr Kishor Gaikwad delivered a lecture in NAHEP CAAST:Training Programme on Genomics of Agriculturally important insects" from 18-28th Sep, 2019, Div. of Entomology  Dr. Ashish Kumar Gupta participated in the International Conference on Recent Trends in Agriculture, Food Science, Forestry, Horticulture, Aquaculture, Animal Sciences, Biodiversity and Climate Change (AFHABC-201 ) Organized by “Krishi Sanskriti” on 21st September 2019 at Jawaharlal Nehru University, New Delhi.  Dr.Nimmy.M.S delivered a lecture cum practical on Plant genomic DNA and Total RNA isolation during CAFT (Next Generation Sequencing and its Applications in Plant Sciences” from 3rd -23rd September, 2019) held at NIPB, New Delhi  Dr. Pranab K Mandal attended the Review meeting of the INEW project held at London from 10-11 September 2018 and presented the progress of the INEW project of our centre and discussed about future plan.  Dr. Pranab K Mandal attended a training course on ‘Agricultural data analysis using R’ at NAARM, Hyderabad from 21-26 February 2019.  Dr. Pranab K Mandal attended International workshop on ‘Wheat Genomic data analysis for improvement of nitrogen use’ on 28- February to 2nd March 2019 at ICAR_NBPGR, New Delhi and also delivered an invited talk.  Dr. Pranab K Mandal attended the Review meeting of the INEW project held at PAU, Ludhiana from 5-6 MArch 2019 and presented the progress of the INEW project of our centre and discussed about future plan.  Dr. Pranab K Mandal attended a workshop on 'Long-Look' & Review Meeting of Indo- UK Virtual Joint Centers on Agricultural N at CRISAT, Hyderabad during Aug 30-31, 2018 and delivered a talk overall progress of INEW project at  Dr. Pranab K Mandal attended 4th International Group Meeting (IGM) 2019 on February 14-16, 2019, CSK HPKV Palampur, HP, and delivered an invited talk.  Dr. Pranab K Mandal delivered Lecture entitled "Wheat Nutrition and Celiac Disease" at Centre for Advanced Faculty Training on Biochemistry of food Crops: from Omics studies to Nutrient analysis on 27th September 2018 at Division of Biochemistry, IARI, New Delhi.  Dr. Jasdeep C. Padaria attended 4th International Group Meeting on ‘Wheat productivity enhancement through climate smart practices’, at CSK HPKV, Palampur 14-16th Feb 2019  Dr. Jasdeep C. Padaria attended National Conference on “Resilience And Resource Management Including ICT for Sustainable Agriculture & Biotechnology” at Dr. MPS Group of Institutions Dr. Bhim Rao Ambedkar University, Agra , 23- 24 February 2019  Dr. Jasdeep C. Padaria attended All India Coordinated Research Project on Pearl Millet, at Genetics Division, IARI, New Delhi 14th March 2019  Dr. Jasdeep C. Padaria attended National conference on Identification, convergence, implementation and extension of Science-tech research for sustainable development, at SVBPUAT, Meerut, U.P., 20-21 April, 2019,

146

ICAR-NIPB ANNUAL REPORT 2019

 Dr. Jasdeep C. Padaria attended Nutri-Cereals Conclave 2019, NutriHub-TBI & ICAR- IIMR, at Hyderabad, 29-30 November 2019  Dr. Monika Dalal attended symposium on “Genomics in Plant Breeding and Varietal Identification” at NIPGR, New Delhi on 4 May 201

147

ICAR-NIPB ANNUAL REPORT 2019

List of Publications Research Articles 1. Aggarwal R, Sharma S, Singh K, Gurjar MS, Saharan MS, Gupta S, Bashyal BM, Gaikwad K. First Draft Genome Sequence of Wheat Spot Blotch Pathogen Bipolaris sorokiniana BS_112 from India, Obtained Using Hybrid Assembly. Microbiology Resource Announcements. 2019 Sep 19;8(38):e00308-19. 2. Ajay J, Vandna R. CRISPR-Cas systems ushered in an era of facile DNA-free genome editing. In Seminars in cell & developmental biology 2019 Dec (Vol. 96, p. 1). 3. Aminedi R, Dhatwalia D, Jain V, Bhattacharya R. High efficiency in planta transformation of Indian mustard (Brassica juncea) based on spraying of floral buds. Plant Cell, Tissue and Organ Culture (PCTOC). 2019 Aug 1;138(2):229-37. 4. Ansari WA, Atri N, Ahmad J, Qureshi MI, Singh B, Kumar R, Rai V, Pandey S. Drought mediated physiological and molecular changes in muskmelon (Cucumis melo L.). PloS one. 2019 Sep 24;14(9):e0222647. 5. Ashley J, Ramawatar N, Anna S, Benjamin S. High-molecular weight DNA extraction from challenging fungi using CTAB and gel purification V, Protocols, 26 2019 Jul 6. Awana M, Yadav K, Rani K, Gaikwad K, Praveen S, Kumar S, Singh A. Insights into Salt Stress-Induced Biochemical, Molecular and Epigenetic Regulation of Spatial Responses in Pigeonpea (Cajanus cajan L.). Journal of Plant Growth Regulation. 2019 Dec 1;38(4):1545-61. 7. Bandeppa S, PC L, Phule AS, Rajani G, Prasad Babu KV, Barbadikar KM, Chandrakala C, Prasad Babu MB, Mandal PK, Sundaram RM. Isolation, identification and characterization of efficient free-living nitrogen-fixing bacteria from rice rhizosphere ecosystem. Journal of Rice Research. 2019;12(2):38. 8. Bashyal BM, Aggarwal R, Rawat K, Sharma S, Gupta AK, Choudhary R, Bhat J, Krishnan SG, Singh AK. Genetic diversity and population structure of Fusarium fujikuroi causing Bakanae, an emerging disease of rice in India.2019 ., 58: 45-52 9. Bashyal BM, Yadav J, Gupta AK, Aggarwal R. Understanding the secondary metabolite production of Gibberella fujikuroi species complex in genomic era. Indian Phytopathology. 2019:1-1. 10. Bharadwaj N, Barthakur S, Biswas AD, Das MK, Kour M, Ramteke A, Gogoi N. Transcript expression profiling in two contrasting cultivars and molecular cloning of a SKP-1 like gene, a component of SCF-ubiquitin proteasome system from mungbean Vigna radiate L. Scientific reports. 2019 May 30;9(1):1-7. 11. Bhat JA, Shivaraj SM, Singh P, Navadagi DB, Tripathi DK, Dash PK, Solanke AU, Sonah H, Deshmukh R. Role of silicon in mitigation of heavy metal stresses in crop plants. Plants. 2019 Mar;8(3):71. 12. Bisht DS, Bhatia V, Bhattacharya R. Improving plant-resistance to insect-pests and pathogens: The new opportunities through targeted genome editing. InSeminars in cell & developmental biology 2019 Dec 1 (Vol. 96, pp. 65-76). Academic Press. 13. Chaudhury A, Kaila T, Gaikwad K. Elucidation of Galactomannan Biosynthesis Pathway Genes through Transcriptome Sequencing of Seeds Collected at Different Developmental

148

ICAR-NIPB ANNUAL REPORT 2019

Stages of Commercially Important Indian Varieties of Cluster Bean (Cyamopsis tetragonoloba L.). Scientific reports. 2019 Aug 8;9(1):1-7. 14. Choudhary DK, Aggarwal R, Bashyal BM, Shanmugam V, Padaria JC. Phenotyping and marker based identification of resistant lines in wheat (Triticum aestivum) against spot blotch pathogen (Cochliobolus sativus). Indian Journal of Agricultural Sciences. 2019 Nov 1;89(11):133-7. 15. Das A, Nigam D, Junaid A, Tribhuvan KU, Kumar K, Durgesh K, Singh NK, Gaikwad K. Expressivity of the key genes associated with seed and pod development is highly regulated via lncRNAs and miRNAs in Pigeonpea. Scientific reports. 2019 Dec 3;9(1):1- 4. 16. Divte P, Yadav P, kumar Jain P, Paul S, Singh B. Ethylene regulation of root growth and phytosiderophore biosynthesis determines iron deficiency tolerance in wheat (Triticum spp). Environmental and Experimental Botany. 2019 Jun 1;162:1-3. 17. Durgesh K, Joshi R, Kumar K, Gaikwad K, Raje RS, Prashat GR. Inheritance pattern of cold tolerance in pigeonpea [Cajanus cajan (L.) Millsp.]. Indian J. Genet. 2019 May 1;79(2):404-10. 18. Farhat S, Jain N, Singh N, Sreevathsa R, Dash PK, Rai R, Yadav S, Kumar P, Sarkar AK, Jain A, Singh NK. CRISPR-Cas9 directed genome engineering for enhancing salt stress tolerance in rice. In Seminars in cell & developmental biology 2019 Dec 1 (Vol. 96, pp. 91-99). Academic Press. 19. Guha PK, Mazumder A, Das A, Pani DR, Mondal TK. In silico identification of long non-coding RNA based simple sequence repeat markers and their application in diversity analysis in rice. Gene Reports. 2019 Sep 1;16:100418. 20. Gupta AK, Choudhary R, Bashyal BM, Rawat K, Singh D, Solanki IS. First Report of Root and Stem Rot Disease on Papaya Caused by Fusarium falciforme in India. Plant Disease. 2019 Oct 17;103(10):2676. 21. Gupta NC, Gupta RK, Rao M, Kumar A. Combining the Sclerotinia stem rot disease resistance trait in interspecific hybrids of Brassica napus and Brassica carinata. Annals of Plant Protection Sciences. 2019;27(1):70-6. 22. Gupta OP, Dahuja A, Sachdev A, Jain PK, Kumari S, Praveen S. Cytosine Methylation of Isoflavone Synthase Gene in the Genic Region Positively Regulates Its Expression and Isoflavone Biosynthesis in Soybean Seeds. DNA and cell biology. 2019 Jun 1;38(6):510- 20. 23. Gupta OP, Dahuja A, Sachdev A, Kumari S, Jain PK, Vinutha T, Praveen S. Conserved miRNAs modulate the expression of potential transcription factors of isoflavonoid biosynthetic pathway in soybean seeds. Molecular biology reports. 2019 Aug 15;46(4):3713-30. 24. Gurjar MS, Aggarwal R, Jogawat A, Kulshreshtha D, Sharma S, Solanke AU, Dubey H, Jain RK. De novo genome sequencing and secretome analysis of Tilletia indica inciting Karnal bunt of wheat provides pathogenesis-related genes. 3 Biotech. 2019 Jun 1;9(6):219. 25. Harshavardhana YS, Hegde V, Tripathi S, Raje RS, Jain PK, Gaikwad K, Bharadwaj C, Kumar R, Singh RK, Sharma MK, Chauhan SK. Genetics of semi-determinacy and

149

ICAR-NIPB ANNUAL REPORT 2019

identification of molecular marker linked to Dt1 locus in chickpea (Cicer arietinum L.). Indian J. Genet. 2019;79(1 Suppl 270):275. 26. Hasegawa D, Kito K, Maeda T, Rai V, Cha-Um S, Tanaka Y, Fukaya M, Takabe T. Functional characterization of aminotransferase involved in serine and aspartate metabolism in a halotolerant cyanobacterium, Aphanothece halophytica. Protoplasma. 2019 Nov 1;256(6):1727-36. 27. Jain P, Dubey H, Singh PK, Solanke AU, Singh AK, Sharma TR. Deciphering signalling network in broad spectrum Near Isogenic Lines of rice resistant to Magnaporthe oryzae. Scientific reports. 2019 Nov 15;9(1):1-3. 28. Jaiswal P and Barthakur S. Optimization of an in vitro regeneration protocol for hexaploid wheat using immature embryo as explants. Ann. Agric. Res.(2019) New Series 40 (4): 1-7 . 29. Jasdeep P, Avijit T, Varsha S, Harinder V, Sanjay S. Cultivar specific response of callus induction and plant regeneration from mature embryos in different elite Indian wheat. Research Journal of Biotechnology. 2019 Feb 1;14(2):1-8. 30. Joshi I, Kumar A, Singh AK, Kohli D, Raman KV, Sirohi A, Chaudhury A, Jain PK. Development of nematode resistance in Arabidopsis by HD-RNAi-mediated silencing of the effector gene Mi-msp2. Scientific reports. 2019 Nov 22;9(1):1-1. 31. Jyoti A, Kaushik S, Srivastava VK, Datta M, Kumar S, Yugandhar P, Kothari SL, Rai V, Jain A. The potential application of genome editing by using CRISPR/Cas9, and its engineered and ortholog variants for studying the transcription factors involved in the maintenance of phosphate homeostasis in model plants. In Seminars in Cell & Developmental Biology 2019 Dec 1 (Vol. 96, pp. 77-90). Academic Press. 32. Kaila T, Saxena S, Ramakrishna G, Tyagi A, Tribhuvan KU, Srivastava H, Chaudhury A, Singh NK, Gaikwad K. Comparative RNA editing profile of mitochondrial transcripts in cytoplasmic male sterile and fertile pigeonpea reveal significant changes at the protein level. Molecular biology reports. 2019 Apr 1;46(2):2067-84. 33. Kalia V, Kaur S. Efficacy of transgenic tobacco carrying synthetic plant-preferred codon- optimized novel VIP3AA44 Gene towards Helicoverpa armigera and Spodoptera litura. Indian Journal of Entomology. 2019;81(2):325-31. 34. Koramutla MK, Ram C, Bhatt D, Annamalai M, Bhattacharya R. Genome-wide identification and expression analysis of sucrose synthase genes in allotetraploid Brassica juncea. Gene. 2019 Jul 30;707:126-35. 35. Lata S, Watts A, Bhat SR. Characterization of Arabidopsis thaliana lines with T-DNA insertions in the mitochondrial ribosomal protein genes Rps14 and Rps19. Indian J. Genet. 2019 May 1;79(2):467-73. 36. Maibam A, Vishwakarma H, Padaria JC. In silico studies predict role of PgUCP1 from Pennisetum glaucum in heat stress tolerance. Indian Journal of Agriculture Science. 2019 Oct 1;89(10):1703-7. 37. Mainkar P S, Manoj ML, Jayaswal D, Agarwal Y, Prajapat R K and Kansal R, Identification and in silico characterization of Serpin genes in legumes genomes, IJAS (Accepted) 2019

150

ICAR-NIPB ANNUAL REPORT 2019

38. Mainkar PS, Agarwal Y,Kansal R, Efficient and Modified CTAB and Trizol protocols improve High Molecular Weight RNA isolation from polyphenol and polysachharides rich pigeonpea (Cajanus cajan (L.) Millsp. IJEB (Accepted) 2019 39. Mandal PK, Rai S, Kaushik M, Sinha SK, Gupta RK, Mahendru A. Transcriptome data of cultivated tetraploid and hexaploid wheat variety during grain development. Data in brief. 2019 Feb 1;22:551-6. 40. Mehraj U, Panwar S, Kanwar PS, Namita RP, Amolkumar US, Mallick N, Kumar S. Assessment of clonal fidelity of doubled haploid line of marigold (Tagetes erecta) using microsatellite markers. Indian Journal of Agricultural Sciences. 2019 Jul 1;89(7):1162-6. 41. Mehraj U, Panwar S, Singh KP, Namita, Pandey R, Solanke AU, Mallick N, Kumar S. In vitro regeneration of double haploid line of African marigold (Tagetes erecta) derived from ovule culture using non-axillary explants. Indian Journal of Agriculture Science. 2019 Jun 1;89(6):969-74. 42. Mondal TK, Rawal HC, Bera B, Kumar PM, Choubey M, Saha G, Das B, Bandyopadhyay T, Ilango RV, Sharma TR, Barua A. Draft genome sequence of a popular Indian tea genotype TV-1 [Camellia assamica L.(O). Kunze]. BioRxiv. 2019 Jan 1:762161. 43. Panwar BS, Kaur S. Structural characterization and heterologous expression of a new cyt gene cloned from Bacillus thuringiensis. Journal of molecular modeling. 2019 May 1;25(5):136. 44. Pradhan SK, Pandit E, Pawar S, Bharati B, Chatopadhyay K, Singh S, Dash P, Reddy JN. Association mapping reveals multiple QTLs for grain protein content in rice useful for biofortification. Molecular Genetics and Genomics. 2019 Aug 1;294(4):963-83. 45. Rafiqi UN, Gul I, Saifi M, Nasrullah N, Ahmad J, Dash P, Abdin MZ. Cloning, identification, and in silico analysis of terpene synthases involved in the competing pathways of artemisinin biosynthesis pathway in Artemisia annua L. Pharmacognosy Magazine. 2019 Apr 1;15(62):38. 46. Ramkumar MK, Senthil Kumar S, Gaikwad K, Pandey R, Chinnusamy V, Singh NK, Singh AK, Mohapatra T, Sevanthi AM. A novel stay-green mutant of rice with delayed leaf senescence and better harvest index confers drought tolerance. Plants. 2019 Oct;8(10):375. 47. Rathinam M, Mishra P, Mahato AK, Singh NK, Rao U, Sreevathsa R. Comparative transcriptome analyses provide novel insights into the differential response of Pigeonpea (Cajanus cajan L.) and its wild relative (Cajanus platycarpus (Benth.) Maesen) to herbivory by Helicoverpa armigera (Hübner). Plant molecular biology. 2019 Sep 1;101(1-2):163-82. 48. Rathinam M, Mishra P, Vasudevan M, Budhwar R, Mahato A, Prabha AL, Singh NK, Rao U, Sreevathsa R. Comparative transcriptome analysis of pigeonpea, Cajanus cajan (L.) and one of its wild relatives Cajanus platycarpus (Benth.) Maesen. PloS one. 2019 Jul 3;14(7):e0218731. 49. Sahashi K, Yamada-Kato N, Maeda T, Kito K, Cha-Um S, Rai V, Tanaka Y, Takabe T. Expression and functional characterization of sugar beet

151

ICAR-NIPB ANNUAL REPORT 2019

phosphoethanolamine/phosphocholine phosphatase under salt stress. Plant Physiology and Biochemistry. 2019 Sep 1;142:211-6. 50. Saini N, Koramutla MK, Singh N, Singh S, Singh R, Yadav S, Bhattacharya R, Vasudev S, Yadava DK. Promoter polymorphism in FAE1. 1 and FAE1. 2 genes associated with erucic acid content in Brassica juncea. Molecular Breeding. 2019 May 1;39(5):75. 51. Saxena S, Kaila T, Chaduvula PK, Singh A, Singh NK, Gaikwad K. Novel chloroplast microsatellite markers in pigeonpea ('Cajanus cajan'L. Millsp.) and their transferability to wild'Cajanus' species. Australian Journal of Crop Science. 2019 Feb;13(2):185. 52. Sharma S, Kaur R, Solanke AK, Dubey H, Tiwari S, Kumar K. Transcriptome sequencing of Himalayan Raspberry (Rubus ellipticus) and development of simple sequence repeat markers. 3 Biotech. 2019 Apr 1;9(4):161. 53. Shingote PR, Mithra SA, Sharma P, Devanna NB, Arora K, Holkar SK, Khan S, Singh J, Kumar S, Sharma TR, Solanke AU. LTR retrotransposons and highly informative ISSRs in combination are potential markers for genetic fidelity testing of tissue culture-raised plants in sugarcane. Molecular Breeding. 2019 Feb 1;39(2):25. 54. Singh D, Singh B, Mishra S, Singh AK, Singh NK. Candidate gene based association analysis of salt tolerance in traditional and improved varieties of rice (Oryza sativa L.). Journal of Plant Biochemistry and Biotechnology. 2019 Mar 11;28(1):76-83. 55. Singh D, Singh CK, Taunk J, Jadon V, Pal M, Gaikwad K. Genome wide transcriptome analysis reveals vital role of heat responsive genes in regulatory mechanisms of lentil (Lens culinaris Medikus). Scientific reports. 2019 Sep 10;9(1):1-9. 56. Singh S, Chopperla R, Khan S, Reddy N, Padaria JC, Solanke AU. Identification and characterization of catalase genes in Eleusine coracana under abiotic stresses. Biologia plantarum. 2019 Jan 1;63:440-7. 57. Sinha SK, Tyagi A, Mandal PK. External nitrogen and carbon source-mediated response on modulation of root system architecture and nitrate uptake in wheat seedlings. Journal of Plant Growth Regulation. 2019 Mar 15;38(1):283-97. 58. Sureshkumar V, Dutta B, Kumar V, Prakash G, Mishra DC, Chaturvedi KK, Rai A, Sevanthi AM, Solanke AU. RiceMetaSysB: a database of blast and bacterial blight responsive genes in rice and its utilization in identifying key blast-resistant WRKY genes. Database. 2019 Jan 1;2019. 59. Tarafdar A, Vishwakarma H, Gothandapani S, Bhati M, Biswas K, Prakash A, Chaturvedi U, Solanke AU, Padaria JC. A quick, easy and cost-effective in planta method to develop direct transformants in wheat. 3 Biotech. 2019 May 1;9(5):180. 60. Tribhuvan KU, SV AM, Sharma P, Das A, Kumar K, Tyagi A, Solanke AU, Sharma R, Jadhav PV, Raveendran M, Fakrudin B. Identification of genomic SSRs in cluster bean (Cyamopsis tetragonoloba) and demonstration of their utility in genetic diversity analysis. Industrial Crops and Products. 2019 Jul 1;133:221-31. 61. Tripathy K, Singh B, Misra G, Singh NK. Identification, distribution and comparative analysis of microsatellites in the chloroplast genome of Oryza species. Indian J. Genet. 2019 Aug 1;79(3):536-44. 62. Tyagi A, Sharma P, Saxena S, Sharma R, Mithra SA, Solanke AU, Singh NK, Sharma TR, Gaikwad K. The genome size of clusterbean (Cyamopsis tetragonoloba) is

152

ICAR-NIPB ANNUAL REPORT 2019

significantly smaller compared to its wild relatives as estimated by flow cytometry. Gene. 2019 Jul 30; 707: 205-11. 63. Vishwakarma H, Sharma J, Solanke AU, Singh GP and Padaria J Isolation and Characterization of Stress Inducible Protein (TaSti/Hop) from Heat-Tolerant Wheat Cultivar C306. Research Journal of Biotechnology, (2019)14 (6): 111-121 (IF 0.21) 64. Zauva L, Dhatwalia D, Subramanian S, Chamola R, Bhattacharya RC Constitutive expression of an endogenous sugar transporter gene SWEET11 in Indian mustard Brassica juncea and its effect thereof on mustard aphids. The Indian Journal of Agricultural Sciences (In press) 2019

Review Articles

1. Bisht DS, Bhatia V, Bhattacharya RC (2019). Improving plant-resistance to insect-pests and pathogens: the new opportunities through targeted genome editing. Sem Cell Dev Biol. 96: 67-76

Book chapters

1. Chellapilla TS, Solanki RK, Kakani RK, Chellapilla B, Singhal T, Jasdeep Padaria, Khandelwal V, Srivastava R, Tomar RS, Iqubal MA. Genomic Assisted Breeding for Abiotic stress Tolerance in Millets. In: Rajpal V., Sehgal D., Kumar A., Raina S. (eds) Genomics Assisted Breeding of Crops for Abiotic Stress Tolerance, Vol. II Sustainable Development and Biodiversity, vol 21.2019: 241-255, (Springer, Cham). 2. Gupta NC, Rao M, Sharma P (2019). The necrotrophic pathogen Sclerotinia sclerotiorum and its management in oilseed Brassica. Adaptive Crop Management Strategies, ISBN: 978-93-88317-08-5, Write and Print Publications, New Delhi, 173-186:173-186. 3. Kaur P, Gaikwad K. Principles and Implications of Various Genome Enrichment Approaches for Targeted Sequencing of Plant Genomes. InPlant Biotechnology: Progress in Genomic Era 2019 (pp. 43-75). Springer, Singapore. 4. P Kaur and K Gaikwad (2019). Principles and Implications of Various Genome Enrichment Approaches for Targeted Sequencing of Plant Genomes. - Plant Biotechnology: Progress in Genomic Era, 2019, 43-75 (Springer, Singapore)