Selectin-Mucin Interactions As a Probable Molecular Explanation for the Association of Trousseau Syndrome with Mucinous Adenocarcinomas
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Bioinformatics Approach for Pattern of Myelin-Specific Proteins And
CORE Metadata, citation and similar papers at core.ac.uk Provided by Qazvin University of Medical Sciences Repository Biotech Health Sci. 2016 November; 3(4):e38278. doi: 10.17795/bhs-38278. Published online 2016 August 16. Research Article Bioinformatics Approach for Pattern of Myelin-Specific Proteins and Related Human Disorders Samiie Pouragahi,1,2,3 Mohammad Hossein Sanati,4 Mehdi Sadeghi,2 and Marjan Nassiri-Asl3,* 1Department of Molecular Medicine, School of Medicine, Qazvin university of Medical Sciences, Qazvin, IR Iran 2Department of Bioinformatics, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, IR Iran 3Department of Pharmacology, Cellular and Molecular Research Center, School of Medicine, Qazvin university of Medical Sciences, Qazvin, IR Iran 4Department of Molecular Genetics, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, IR Iran *Corresponding author: Marjan Nassiri-Asl, School of Medicine, Qazvin University of Medical Sciences, Qazvin, IR Iran. Tel: +98-2833336001, Fax: +98-2833324971, E-mail: [email protected] Received 2016 April 06; Revised 2016 May 30; Accepted 2016 June 22. Abstract Background: Recent neuroinformatic studies, on the structure-function interaction of proteins, causative agents basis of human disease have implied that dysfunction or defect of different protein classes could be associated with several related diseases. Objectives: The aim of this study was the use of bioinformatics approaches for understanding the structure, function and relation- ship of myelin protein 2 (PMP2), a myelin-basic protein in the basis of neuronal disorders. Methods: A collection of databases for exploiting classification information systematically, including, protein structure, protein family and classification of human disease, based on a new approach was used. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Oral Absorption of Peptides and Nanoparticles Across the Human Intestine: Opportunities, Limitations and Studies in Human Tissues☆
Advanced Drug Delivery Reviews 106 (2016) 256–276 Contents lists available at ScienceDirect Advanced Drug Delivery Reviews journal homepage: www.elsevier.com/locate/addr Oral absorption of peptides and nanoparticles across the human intestine: Opportunities, limitations and studies in human tissues☆ P. Lundquist, P. Artursson ⁎ Department of Pharmacy, Uppsala University, Box 580, SE-752 37 Uppsala, Sweden article info abstract Article history: In this contribution, we review the molecular and physiological barriers to oral delivery of peptides and nanopar- Received 2 May 2016 ticles. We discuss the opportunities and predictivity of various in vitro systems with special emphasis on human Received in revised form 2 July 2016 intestine in Ussing chambers. First, the molecular constraints to peptide absorption are discussed. Then the phys- Accepted 8 July 2016 iological barriers to peptide delivery are examined. These include the gastric and intestinal environment, the Available online 3 August 2016 mucus barrier, tight junctions between epithelial cells, the enterocytes of the intestinal epithelium, and the Keywords: subepithelial tissue. Recent data from human proteome studies are used to provide information about the protein fi Oral drug delivery expression pro les of the different physiological barriers to peptide and nanoparticle absorption. Strategies that Peptide drugs have been employed to increase peptide absorption across each of the barriers are discussed. Special consider- Nanoparticles ation is given to attempts at utilizing endogenous transcytotic pathways. To reliably translate in vitro data on Ussing chamber peptide or nanoparticle permeability to the in vivo situation in a human subject, the in vitro experimental system Peptide permeability needs to realistically capture the central aspects of the mentioned barriers. -
Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo -
43Rd Annual Scientific and Standardization Committee Meeting
43rd Annual Scientific and Standardization Committee Meeting June 67, 1997 Florence, Italy SCIENTIFIC SUBCOMMITTEE MINUTES 6‐7 June 1997, Florence, Italy Table of Contents Registry of Animal Models of Thrombotic and Hemorrhagic Disorders ....................................................... 2 Biorheology ................................................................................................................................................... 4 Contact Activation ......................................................................................................................................... 7 Control of Anticoagulation ............................................................................................................................ 9 Exogenous Hemostatic Factors Subcommittee: Registry .......................................................................... 15 Factor VIII and Factor IX .............................................................................................................................. 18 Factor XIII .................................................................................................................................................... 22 Fibrinogen and DIC ...................................................................................................................................... 25 Fibrinolysis .................................................................................................................................................. 28 Hemostasis and Malignancy -
Supplementary Table 1: Adhesion Genes Data Set
Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like, -
Serine Proteases with Altered Sensitivity to Activity-Modulating
(19) & (11) EP 2 045 321 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 08.04.2009 Bulletin 2009/15 C12N 9/00 (2006.01) C12N 15/00 (2006.01) C12Q 1/37 (2006.01) (21) Application number: 09150549.5 (22) Date of filing: 26.05.2006 (84) Designated Contracting States: • Haupts, Ulrich AT BE BG CH CY CZ DE DK EE ES FI FR GB GR 51519 Odenthal (DE) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • Coco, Wayne SK TR 50737 Köln (DE) •Tebbe, Jan (30) Priority: 27.05.2005 EP 05104543 50733 Köln (DE) • Votsmeier, Christian (62) Document number(s) of the earlier application(s) in 50259 Pulheim (DE) accordance with Art. 76 EPC: • Scheidig, Andreas 06763303.2 / 1 883 696 50823 Köln (DE) (71) Applicant: Direvo Biotech AG (74) Representative: von Kreisler Selting Werner 50829 Köln (DE) Patentanwälte P.O. Box 10 22 41 (72) Inventors: 50462 Köln (DE) • Koltermann, André 82057 Icking (DE) Remarks: • Kettling, Ulrich This application was filed on 14-01-2009 as a 81477 München (DE) divisional application to the application mentioned under INID code 62. (54) Serine proteases with altered sensitivity to activity-modulating substances (57) The present invention provides variants of ser- screening of the library in the presence of one or several ine proteases of the S1 class with altered sensitivity to activity-modulating substances, selection of variants with one or more activity-modulating substances. A method altered sensitivity to one or several activity-modulating for the generation of such proteases is disclosed, com- substances and isolation of those polynucleotide se- prising the provision of a protease library encoding poly- quences that encode for the selected variants. -
Clinical Outcomes, Symptoms and Quality of Life in Cancer Patients with Incidental Pulmonary Embolism
A STUDY OF CLINICOPATHOLOGICAL CHARACTERISTICS, SYMPTOMS AND PATIENTS EXPERIENCES RELATED TO OUTCOMES IN PEOPLE WITH CANCER AND I-PE Naima E Benelhaj PhD The University of Hull and The University of York Hull York Medical School July 2019 Abstract Background: The clinical course of incidental pulmonary embolism in cancer population represents an area of controversy. It presents a growing challenge for clinicians because of a lack of prospective data. Aim: This research aims to investigate the impact of an incidentally diagnosed pulmonary embolism on cancer population’ outcomes and to explore their experience of living with cancer and i-PE. The second aim was to explore the role of the key thrombogenic biomarkers as a predictive biomarker of thrombosis. Methods: Mixed method research with critical integrative analysis. A systematic literature review and qualitative analysis to examine patients’ experience of living with cancer-associated thrombosis. A prospective observational case-controlled cohort study with embedded semi-structured interview study to investigate the quality of life and patients’ experience of living with cancer and incidental pulmonary embolism. A retrospective case control-study and scientific analysis of defined biological key factors associated with thrombosis. Results: The diagnosis of cancer-associated thrombosis including incidental pulmonary embolism negatively affect patients’ life, and patients experience this diagnosis in the context of living with cancer. Yet it is a diagnosis that often misattributed, misdiagnosed and associated with lack of information among patients and some of the clinical care professionals. The scientific analysis of the biological biomarkers illustrates the potential role of TF-mRNA as a predictive biomarker for cancer- associated incidental pulmonary embolism and the role of anti-factor ten anticoagulation in reducing the risk of thrombosis. -
Mucin Family Genes Are Downregulated in Colorectal
ooggeenneessii iinn ss && rrcc aa MM CC uu tt ff aa Journal ofJournal of oo gg Aziz et al., J Carcinogene Mutagene 2014, S10 ll ee ee aa aa nn nn nn nn ee ee rr rr ss ss uu uu ii ii ss ss oo oo DOI: 4172/2157-2518.S10-009 JJ JJ ISSN: 2157-2518 CarCarcinogenesiscinogenesis & Mutagenesis Research Article Article OpenOpen Access Access Mucin Family Genes are Downregulated in Colorectal Cancer Patients Mohammad Azhar Aziz*, Majed AlOtaibi, Abdulkareem AlAbdulrahman, Mohammed AlDrees and Ibrahim AlAbdulkarim Department of Medical Genomics, KIng Abdullah Intl. Med. Res. Ctr., King Saud Bin Abdul Aziz University for Health Sciences, Riyadh, Saudi Arabia Abstract Mucins are very well known to be associated with different types of cancer. Their role in colorectal cancer has been extensively studied without direct correlation with their change in expression levels. In the present study we employed the human exon array from Affymetrix to provide evidence that mucin family genes are downregulated in colorectal cancer tumor samples. We analyzed 92 samples taken from normal and tumor tissues. All mucin family genes except MUCL1 were downregulated with the fold change value ranging from -3.53 to 1.78 as calculated using AltAnalyze software. Maximum drop in RNA transcripts were observed for MUC2 with a fold change of -3.53. Further, we carried out Integromics analysis to analyze mucin genes using hierarchical clustering. MUC1 and MUC4 were found to be potential biomarkers for human colorectal cancer. Top upstream regulators were identified for mucin genes. Network analyses were carried out to further our understanding about potential mechanisms by which mucins can be involved in causing colorectal cancer. -
Intrauterine Growth Restriction Alters Postnatal Colonic Barrier Maturation in Rats
0031-3998/09/6601-0047 Vol. 66, No. 1, 2009 PEDIATRIC RESEARCH Printed in U.S.A. Copyright © 2009 International Pediatric Research Foundation, Inc. Intrauterine Growth Restriction Alters Postnatal Colonic Barrier Maturation in Rats PASCALE FANC¸ A-BERTHON, CATHERINE MICHEL, ANTHONY PAGNIEZ, MARTINE RIVAL, ISABELLE VAN SEUNINGEN, DOMINIQUE DARMAUN, AND CHRISTINE HOEBLER UMR 1280, Physiologie des Adaptations Nutritionnelles [P.F.-B., C.M., A.P., M.R., D.D., C.H.], INRA, Universite´ de Nantes, Nantes F-44093, France; Inserm, U837 [I.V.S.], Jean-Pierre Aubert Research Center, Lille F-59045, France ABSTRACT: Intrauterine growth restriction (IUGR) is a leading secreted mucins (MUC2) and membrane-bound mucins cause of perinatal mortality and morbidity and increases the risk for (MUC1 and 3) have recently been shown to be involved in necrotizing enterocolitis. We hypothesized that colonic barrier colonic protection (8–10). Trefoil factor family 3 (TFF3) is a disruption could be responsible for intestinal frailty in infants and small peptide exerting multiple biologic effects including the adults born with IUGR. Mucins and trefoil factor family 3 (TFF3) actively contribute to epithelium protection and healing. Our aim modulation of healing, inflammation, and differentiation (11). was to determine whether IUGR affects colonic mucosa matura- TFF3 is, thus, considered essential for epithelial restitution tion. IUGR was induced by dietary protein restriction in pregnant (12). dams. Mucins and Tff3 expression and morphologic maturation of Barrier disruption, involving some of the latter mucosal the colonic mucosa were followed during postnatal development constituents, has been reported in various diseases. Mucin of the offspring. Before weaning, mucin 2 and Tff3 protein levels expression is dramatically altered in inflammatory bowel dis- were reduced in colonic mucosa of rats with IUGR compared with eases and colorectal cancer (13). -
Digitalcommons@UNMC Regulation of the Transmembrane Mucin MUC4
University of Nebraska Medical Center DigitalCommons@UNMC Theses & Dissertations Graduate Studies Fall 12-18-2015 Regulation of the transmembrane mucin MUC4 by Wnt/β-catenin in gastrointestinal cancers Priya Pai University of Nebraska Medical Center Follow this and additional works at: https://digitalcommons.unmc.edu/etd Part of the Biochemistry Commons, and the Molecular Biology Commons Recommended Citation Pai, Priya, "Regulation of the transmembrane mucin MUC4 by Wnt/β-catenin in gastrointestinal cancers" (2015). Theses & Dissertations. 58. https://digitalcommons.unmc.edu/etd/58 This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@UNMC. It has been accepted for inclusion in Theses & Dissertations by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected]. i Regulation of the transmembrane mucin MUC4 by Wnt/β- catenin in gastrointestinal cancers By PRIYA PAI A DISSERTATION Presented to the Faculty of The University of Nebraska Graduate College In Partial Fulfillment of the Requirements For the Degree of Doctor of Philosophy Department of Biochemistry and Molecular Biology Graduate Program Under the Supervision of Professor Surinder K. Batra University of Nebraska Medical Center Omaha, Nebraska November, 2015 ii Regulation of the transmembrane mucin MUC4 by Wnt/β-catenin in gastrointestinal cancers Priya Pai, PhD. University of Nebraska Medical Center, 2015 Supervisor: Surinder K. Batra, PhD. The transmembrane mucin MUC4 is a high molecular weight glycoprotein that is expressed de novo in pancreatic ductal adenocarcinoma (PDAC). MUC4 has been shown to play a tumor-promoting role in malignancies such as PDAC, ovarian cancer and breast cancer. -
Platelet-Associated Hypercoagulability in Patients with Essential Thrombocythemia and Polycythemia Vera
Platelet-associated hypercoagulability in patients with Essential Thrombocythemia and Polycythemia Vera Citation for published version (APA): Panova-Noeva, M. (2012). Platelet-associated hypercoagulability in patients with Essential Thrombocythemia and Polycythemia Vera. Maastricht University. https://doi.org/10.26481/dis.20121129mp Document status and date: Published: 01/01/2012 DOI: 10.26481/dis.20121129mp Document Version: Publisher's PDF, also known as Version of record Please check the document version of this publication: • A submitted manuscript is the version of the article upon submission and before peer-review. There can be important differences between the submitted version and the official published version of record. People interested in the research are advised to contact the author for the final version of the publication, or visit the DOI to the publisher's website. • The final author version and the galley proof are versions of the publication after peer review. • The final published version features the final layout of the paper including the volume, issue and page numbers. Link to publication General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal.