US00934,577OB2

(12) United States Patent (10) Patent No.: US 9,345,770 B2 Storkus et al. (45) Date of Patent: May 24, 2016

(54) MMUNOGENIC TUMIOR ASSOCATED (2013.01); G0IN33/57438 (2013.01); G0IN STROMAL CELLANTIGEN PEPTIDES AND 33/57446 (2013.01); A61 K 2039/5154 METHODS OF THEIR USE (2013.01); A61 K 2039/5 158 (2013.01); A61 K 2039/5256 (2013.01); A61 K 2039/53 (2013.01); (71) Applicant: University of Pittsburgh-Of the A61 K 2039/55538 (2013.01) Commonwealth System of Higher (58) Field of Classification Search Education, Pittsburgh, PA (US) None (72) Inventors: Walter J. Storkus, Pittsburgh, PA (US); See application file for complete search history. Anamika Bose, Kolkata (IN); Jennifer Lynn Taylor, McDonald, PA (US); Xi (56) References Cited Zhao, Pittsburgh, PA (US); Devin B. U.S. PATENT DOCUMENTS Lowe, Pittsburgh, PA (US) 7,981,424 B2 7/2011 Malli et al. (73) Assignee: University of Pittsburgh-Of the 2009,0299038 A1 12/2009 Nakamura et al. Commonwealth System of Higher Education, Pittsburgh, PA (US) FOREIGN PATENT DOCUMENTS AU 2003218603 B2 10, 2003 (*) Notice: Subject to any disclaimer, the term of this AU 2007318483 A1 5, 2008 patent is extended or adjusted under 35 WO WO995.5865 * 11/1999 U.S.C. 154(b) by 0 days. WO WOO3,O75921 A2 9, 2003 WO WOO3O86450 * 10/2003 Appl. No.: 14/358,705 (21) OTHER PUBLICATIONS (22) PCT Fled: Nov. 15, 2012 Zhao et al. Molecular therapy 19:805-814, Apr. 2011.* PCT NO.: PCT/US2012/065.327 Gonzalez et al., Eur J. Immunol 45:2615-27, 2015.* (86) International Search Report from parent PCT Application No. PCT/ S371 (c)(1), US2012/065327, 7 pages (mailed Dec. 19, 2012). (2) Date: May 15, 2014 Written Opinion from parent PCT Application No. PCT/US2012/ 065327, 6 pages. (mailed Dec. 19, 2012). (87) PCT Pub. No.: WO2O13/07482O Yan et al., “RAGE and amyloid-beta peptide neurotoxicity in Alzheimer's disease.” Nature 22:382(6593):685-691 (1996) PCT Pub. Date: May 23, 2013 (Abstract only). Zhao et al., “Intratumoral IL-12 Gene Therapy Results in the (65) Prior Publication Data Crosspriming of Tcl Cells Reactive Against Tumor-associated US 2014/0314758A1 Oct. 23, 2014 Stromal Antigens.” Mol Ther: 19(4):805-814 (2011). Related U.S. Application Data * cited by examiner (60) Provisional application No. 61/560,597, filed on Nov. Primary Examiner — Lei Yao 16, 2011. (74) Attorney, Agent, or Firm — Klarduist Sparkman, LLP (51) Int. C. (57) ABSTRACT A6 IK 45/06 (2006.01) A6 IK38/08 (2006.01) Immunogenic peptides from tumor associated Stromal cell A6 IK38/17 (2006.01) antigens, including combinations of Such peptides, are dis GOIN33/574 (2006.01) closed herein. In some examples the peptides are useful for A6 IK39/00 (2006.01) methods of eliciting an immune response. In additional A6 IK3I/506 (2006.01) examples the peptides are useful for methods of treating (52) U.S. C. cancer. Methods for decreasing vascularization of a tumor CPC ...... A61K 45/06 (2013.01); A61 K3I/506 using a Protein Delta Homolog 1 (DLK1) protein or a nucleic (2013.01); A61 K38/08 (2013.01); A61 K acid encoding the protein are also disclosed. 38/1709 (2013.01); A61K39/00II (2013.01); G0IN33/574 (2013.01); G0IN33/5743 17 Claims, 27 Drawing Sheets U.S. Patent May 24, 2016 Sheet 1 of 27 US 9,345,770 B2

FIG . 1A

U.S. Patent May 24, 2016 Sheet 2 of 27 US 9,345,770 B2

FIG. 1B

-- yf Sri s gp OO 3-Actin U.S. Patent May 24, 2016 Sheet 3 of 27 US 9,345,770 B2

FIG. 2A

FIG 2B

KC U.S. Patent May 24, 2016 Sheet 4 of 27 US 9,345,770 B2

see wwii-, 8.8 X, (8S is (&x. exist So M \s: $ (Odd & is). A S. ..i. s S sS. SSS)Kas w d

w w Sei (168) qu-bold (9ev) adhn $ Š S&SN. Y.xxxi \s W. w.x. 8:8- &- x -S. (888 i &isiN &.

(88w ex ( & & ex Š

88 &Y is (sae ixi to St. Xix (9a) >ic

{{ { a \si

U.S. Patent May 24, 2016 Sheet 6 of 27 US 9,345,770 B2

FIG. 4

U.S. Patent May 24, 2016 Sheet 7 Of 27 US 9,345,770 B2

FIG. 5

·luww+z?l 21|oo!d6+

w & tes stiniated wit: U.S. Patent US 9,345,770 B2

U.S. Patent May 24, 2016 Sheet 9 Of 27 US 9,345,770 B2

FIG. 7

600 prior. Control Ni (k 500 & g-A-A2 Š -C 400 380 200 it? ( 600 p.mmm, D.C. 5-Treated St

-

3 -

it

t g g : s Se a e o Pericytes WEC Target Cells Analyzed: U.S. Patent May 24, 2016 Sheet 10 of 27 US 9,345,770 B2

áæta?Y

88" 8GIO U.S. Patent May 24, 2016 Sheet 11 of 27 US 9,345,770 B2

FIG. 9A

FIG. 9B

?!--~~~~~~~~

****

av's est-user ineculation U.S. Patent May 24, 2016 Sheet 12 of 27 US 9,345,770 B2

FIG. 10A FIG. 10B p

8.

3 - 3 &tive *egitie: FIG. 10C FIG. 10D

+****???Å

E is Y-se: Peptide: U.S. Patent May 24, 2016 Sheet 13 Of 27 US 9,345,770 B2

FIG. 11A

soooooooo- sex sex weexs Control Vaccine XS steeise Vareiaei ww

{{s- acD8 g"

s w rf

Days Post-Tunner Inoculation

F.G. 11B

8.

r

arrassarass- SSSSSS &n. Naas S. Sassarasara-arss i it : ) it : Pays Post-funer inoculation F.G. 11C

-- c. 388: - - E38: {}ay

s trar $8; Se ER3 ... '8: Si:SS is

-x-- $8: SE&SS * k -- Ss. VES: ----&- A&; ERS 83 8: S: S8 is SS s: says east-Tirner are ulation U.S. Patent May 24, 2016 Sheet 14 of 27 US 9,345,770 B2

FIG. 12

a 20 1000

80 38

8 .ssori:****P****,ano?ovAxridi?a?wpoova

Hae??z?***3: K K ?vi.xså Hae?.******** serieyte W ************ ±(+-******** T2 - TBVA-Berived Peptides: U.S. Patent May 24, 2016 Sheet 15 Of 27 US 9,345,770 B2

200 too a Sa. W . 4ee p.m. 300 288 it}} a

: 400 300 288 100 : Nome faaaaaaaaaaaaaaa- 3 S S. ( S) { Si S ( S) bays Past- unior acetiation U.S. Patent May 24, 2016 Sheet 16 of 27 US 9,345,770 B2

FIG. 14

R8. U.S. Patent May 24, 2016 Sheet 17 Of 27 US 9,345,770 B2

FIG. 15

K Eph A2 HBB

NR PDGFRB SY RESS EY YER YEGFR. (3. -Actin U.S. Patent May 24, 2016 Sheet 18 of 27 US 9,345,770 B2

5 w Xa Y. N. NoN. s $ N N. N &s 8 isssssssssssssssssssssssssssssssss CDs TIL 8 & 38(YS SS: 38 S8 & Sis

88 R

Sax w ar. 0.56 & is $$$. ii & 8& is 38 & & Si: 888 C)S. (8

8 : S8 3 & Trai Size is: U.S. Patent Sheet 19 Of 27 US 9,345,770 B2

F.G. 17A

FIG 17B

34% ;--

st -- 'etirie U.S. Patent May 24, 2016 Sheet 20 Of 27 US 9,345,770 B2

FIG. 18

DC + Peptide w U.S. Patent May 24, 2016 Sheet 21 of 27 US 9,345,770 B2

U.S. Patent May 24, 2016 Sheet 22 of 27 US 9,345,770 B2

*OCI |001 |08 |09 |ow

83u83S8ion pee ifieu

U.S. Patent May 24, 2016 Sheet 23 of 27 US 9,345,770 B2

------a mama arrananar exaaaaaa. wa My S > xx is so a key v. t N w s s w- N w w c as 80x) a2ueoSa ionid to e2e30 L (six eauss&ion six 83u83 saion p3e333 -oo auaouad pee ifieu 8do p33e389 it yid

N AWOACO 2

i

e ce s N w (guiu) aziS WON U.S. Patent May 24, 2016 Sheet 24 of 27 US 9,345,770 B2

;

ei SS. 38'N, (x) aguaose ionid fii (Ofgh fiti pae fest SN

wn Na w C U.S. Patent May 24, 2016 Sheet 25 Of 27 US 9,345,770 B2

FIG. 23A

. S

, IvNEG IvDLK1 U.S. Patent May 24, 2016 Sheet 26 of 27 US 9,345,770 B2

U.S. Patent May 24 9 2016 Sheet 27 Of 27 US 9,345,770 B2

US 9,345,770 B2 1. 2 IMMUNOGENIC TUMIOR ASSOCATED In further embodiments, the immunogenic TASA peptides, STROMAL CELLANTIGEN PEPTIDES AND polynucleotides, vectors and host cells can be used, for METHODS OF THEIR USE example, for inducing an immune response to one or more TASA or to treat or inhibit cancer. This is the U.S. National Stage of International Application In additional embodiments, methods are disclosed for No. PCT/US2012/065327, filed Nov. 15, 2012, which was treating a tumor, such as by decreasing vascularization of a published in English under PCT Article 21(2), which in turn tumor. The methods include administering to a subject having claims the benefit of U.S. Provisional Application No. a tumor an effective amount of a Protein Delta Homolog 1 61/560,597, filed on Nov. 16, 2011, which is incorporated by (DLK1) protein, a nucleic acid encoding the DLK1 protein, reference herein in its entirety. 10 or a dendritic cell transformed with the nucleic acid. In some non-limiting examples, the methods also include administer ACKNOWLEDGMENT OF GOVERNMENT ing to the subject a therapeutically effective amount of beva SUPPORT cizumab, Sunitinib, axitinib, an HSP90 inhibitor, or gencitab ine/fludarabine. In additional non-limiting examples, the This invention was made with government Support under 15 tumor is a melanoma, hepatocellular carcinoma or colorectal Grant Nos. R01 NIH CA114071, R01 NIH CA140375 and CaCC. P50 NIH CA121973 awarded by the National Institutes of Health. The government has certain rights in the invention. BRIEF DESCRIPTION OF THE FIGURES FIELD FIGS. 1A-1B show a series of digital images illustrating that expression of TASA in the established B16 tumor This application relates to the field of cancer therapeutics, microenvironment (TME). In FIG. 1A, B16 melanoma cells specifically to molecules Such as immunogenic peptides, pro were injected Subcutaneously (s.c.) in the right flank of teins, and inhibitory nucleic acids for the treatment of cancer. female HHD mice and allowed to establish/progress for 14 25 days. Animals were then euthanized, with tumors resected, BACKGROUND fixed, sectioned and analyzed for expression of the indicated antigens using specific Abs and fluorescence microscopy. T cell-mediated anti-tumor immunity plays a role in regu Specific antibody against NG2 (green), the indicated antigen lating tumor growth, placing selective pressure on the anti of interest (red), and CD31 (blue) were used to distinguish genically-heterogeneous cancer cell population throughout 30 preferential antigen expression in tumor-associated Stromal disease progression (Ostrand-Rosenberg, Curr: Opin. Genet. pericytes, vascular endothelial cells (VEC), alternate stromal Dev., 18: 11-18. 2008; Reiman et al., Semin. Cancer Biol., 17: cells and/or tumor cells. In FIG. 1B, B16 melanoma cells, as 275-287, 2007: Bui and Schreiber, Curr. Opin. Immunol., 19: well as, flow-sorted (PDGFRB", CD31's) pericytes and 203-208, 2007). Most tumor-associated antigens (TAAS) rec (PDGFRB's, CD31') VEC isolated from day 19 established ognized by T cells are “self antigens that may be quantita 35 B16 tumors and tumor-uninvolved kidneys were analyzed for tively over-expressed by tumor cells of one or more histologic expression of target gene product mRNAs using RT-PCR. All types (Slingluff et al., Adv. Immunol., 90: 243-2952006). data are reflective of three independent experiments per Clinical trials implementing vaccines and immunotherapies formed for each tumor type. targeting such antigens have exhibited Success in promoting FIGS. 2A-2C show a series of graphs illustrating that increased numbers of specific CD4 and/or CD8" T cell 40 induction of CD8" T cells reactive against TASA after intra populations in the peripheral blood of patients. There is a need tumoral delivery of DCIL12. In FIG. 2A, HLA-A2's B16 to identify additional tumor associated antigens or combina melanoma cells were injected Subcutaneously in the right tions of antigens that can be used for cancer immunotherapy. flank of female HLA-A2 Tg (HHD) mice and allowed to establish for seven days. On day seven, mice were random SUMMARY 45 ized into three groups (n=5 mice each) receiving no treat ment, intratumoral (i.t.) injection of Syngenic dendritic cells Immunogenic tumor associated Stromal cell antigen (DC) that were previously infected with recombinant aden (TASA) peptides are disclosed herein. In some embodiments ovirus encoding mIL-12p70, or DC infected with control a plurality of immunogenic TASA peptides is included in a (empty) adenovirus (i.e. DC. p5). Animals were retreated composition. In some embodiments, the immunogenic TASA 50 using the same therapy on day 14 post-tumor inoculation. In peptides include at most twelve amino acids from a TASA, replicate cohorts of animals receiving DC.IL12 therapy, such as Protein Delta Homolog 1 (DLK1), Hemoglobin Sub depleting antibodies against CD4 or CD8 were provided unit Beta (HBB), Neuropilin 1 (NRP1), Tumor Endothelial beginning on day 6 post-tumorinoculation. Tumor sizes were Marker 1 (TEM1), EphrinType A Receptor 2 (EphA2), Regu assessed every 3-4 days and are reported as mean+/-SD in lator of G-Protein Signaling 5 (RGS5), or Platelet Derived 55 mm. *p-0.05 versus control or DC. p5-treated mice on Growth Factor Receptor B (PDGFRB). In some embodi days >14. In FIG. 2B., on day 19 post-tumor inoculation, the ments, compositions are provided including combinations of mice were euthanized and CD8 splenocytes isolated by mag these polypeptides. In one non-limiting example, a composi netic bead cell sorting (MACS) and cultured with PDGFRB" tion is disclosed including DLK1, HBB, NRP1, and TEM1 CD31*SH-2K8 pericytes or PDGFRB-3CD31“H- peptides. In another non-limiting example, a composition is 60 2K" VEC sorted by flow cytometry. After co-culture in disclosed including DLK1, HBB, NRP1, TEM1, EphA1 and the absence or presence of anti-HLA-A2 mAb BB7.2 or RGS5 peptides. anti-MHC class II mAb L243 (10 ug?well) for 48 hat 37° C., In additional embodiments, polynucleotides encoding the cell-free supernatants were analyzed for mIFN-Y content by immunogenic TASA peptides, vectors including these poly specific ELISA. Data are mean+/-SD for triplicate determi nucleotides, host cells transformed with these vectors, and 65 nations, and are representative of 2 independent experiments methods of using these peptides, polynucleotides, vectors, performed. *p-0.05 versus kidney cells (pericytes or VEC) and host cells are provided. and tumor pericytes/VEC in the presence of anti-HLA-A2 US 9,345,770 B2 3 4 mAb BB7.2. In FIG. 2C, on day 19 post-tumor inoculation, was used as a positive HLA-A2 binding control peptide (Tat the mice were euthanized and splenocytes and stimulated for sumi et al., Cancer Res., 63: 4481-4489, 2003). Overlays of five days with stromal peptides. On day five, MACS-isolated fluorescence histograms are provided for each peptide over a CD8 splenocytes were cocultured with HLA-A2' T2 cells 1-10000 nM dose range, as indicated. Evidence for produc loaded with the indicated TASA-derived peptides or HLA tive stabilization of HLA-A2 complexes is supported by a A2" B16 tumor cells. After a 48 h culture period, cell-free shift in staining intensity to the right vs. the no peptide con Supernatants were analyzed formIFN-Y concentration by spe trol. Negative control (HLA-A3/A11-binding) HIV-nef, s, cific ELISA. Data are mean+/-SD for triplicate ELISA deter peptide (Tatsumi et al., Cancer Res., 63: 4481-4489, 2003) minations. *p-0.05 versus FluM1 control peptide responses. failed to promote enhanced HLA-A2 stabilization on T2 All presented data are representative of 3 independent experi 10 cells. Data are from one representative experiment of three ments performed. independent assays performed. FIGS. 3A-3B show a series of scatter plot graphs illustrat FIG. 7 shows a set of graphs illustrating that CD8" T cells ing that CD8"TIL from DC.IL12-treated mice are enriched in isolated from B16-bearing HHD mice left untreated or treated effector cells reactive against tumor pericytes and/or VEC, as with DC. p5 fail to recognize tumor-associated pericytes/ well as TASA peptides. B16 tumor-bearing mice were treated 15 VEC. CD8" T cells were MACS-isolated from the spleens of as described in FIG. 2. On day 17 post-tumor inoculation, tumor-bearing animals that were left untreated (Control) or CD8" TIL were isolated from all cohorts of mice, and peri that were treated with intratumoral delivered DC. p5, as out cytes and VEC were isolated from the tumors and kidneys of lined in FIG. 2B. These T cells were then cultured with untreated mice. Freshly-sorted CD8" TIL were then co-cul flow-sorted tumor- or kidney-derived pericytes or VEC+/- tured with pericytes, VEC or T2 cells--/-TASA peptides (1 blocking anti-HLA-A2 (BB7.2) or class II (L243) antibodies. uM each of all peptides in Table 4 with the exception of Cell-free supernatant was harvested after 24 hours incubation NRP2- or PSMA-derived peptides) for 4-5 hours, before at 37°C. and analyzed using a specific IFN-Y ELISA. Repre responder CD8" T cells were analyzed for intracellular sentative data is presented from one of two independent expression of IFN-Y (FIG. 3A) or cell surface expression of experiments performed. CD107a/b (FIG.3B) by flow cytometry. Inset numbers reflect 25 FIGS. 8A-8C shows a series of graphs illustrating that the percentage of CD8" T cells expressing intracellular IFN-y CD8"TIL isolated from B16-bearing HHD mice treated with or cell surface CD107a/b. Data are from one representative DC.IL 12 recognize tumor-associated pericytes in an HLA experiment of two performed. A2-restricted manner, and fail to recognize HLA-A2's B16 FIG. 4 shows a series of graphs illustrating the in vitro tumor cells. TIL were isolated from the day 17 melanomas of immunogenicity of TASA-derived peptides in HLA-A2" nor 30 mice (treated as indicated) and analyzed for reactivity against mal donors and patients with melanoma. The indicated pep flow-sorted tumor pericytes as described in FIG. 3 for intra tides were pulsed onto autologous DC and used to prime and cellular IFN-y or cell surface expression of translocated boost CD8" T cells isolated from the peripheral blood of eight CD107 using flow cytometry. To assess MHC-restriction in T normal HLA-A2" donors or ten HLA-A2" patients with cell recognition of tumor pericytes, 10 ug of anti-HLA-A2 melanoma. Seven days after the primary in vitro sensitization 35 mAb BB7.2 or anti-pan class II mAb L243 were added to (IVS) (melanoma patients) or a secondary IVS boost (normal cultures during the 4-5 hours co-incubation period prior to donors), T cells were analyzed for their reactivity against flow cytometry-based analysis. Inset numbers reflect the per HLA-A2" T2 cells pulsed with the relevant peptide vs. the centage of CD8" T cells exhibiting positive response to tumor negative control HIV-nefoods peptide. After 24 hours of pericytes or B16 melanoma cells. Data derive from one rep co-culture, cell-free supernatants were analyzed for levels of 40 resentative experiment of two independent experiments per secreted IFN-y using a commercial ELISA. Data are reported formed. in Bar and Whisker plots, with p-values provided for paired FIGS. 9A-9B show a series of graphs illustrating induction pre-versus post-IVS data from normal donors and patients. In of specific/protective CD8" T cells reactive against TASA as addition, p<0.05 was detected for MEL-Post versus ND-Post a consequence of DC/peptide-based vaccination. In FIG.9A, for the following peptides: DLK1 (309), NG2 (770), NG2 45 HHD mice (five animals/cohort) were vaccinated twice (2238), PDGFRB (891) and RGS5 (5). (d-14, d-7) subcutaneously with PBS or with isologous FIG. 5 shows a graph illustrating that splenic CD8" T cells DC.IL12 pulsed with PBS or synthetic peptides (Table 6) from HHD mice effectively treated with DC.IL12 gene derived from the indicated TASA. In cases where more than 1 therapy develop HLA-A2-restricted responses against mela peptide was identified for a given target antigen, an equimolar noma-associated antigens. HHD mice bearing day 7 HLA 50 pool of the indicated peptides (each 10 uM) was pulsed onto A2" (MART-1, gp100") B16 melanomas were left DC.IL12 and used for vaccination in the relevant cohort. One untreated or they were treated with intratumoral injection of week after the second immunization, spleens were harvested control DC (DC. p5) or DC.IL12 as described in FIG. 2. On and splenic CD8" T cells isolated using MACS-beads (Milte day 19 post tumor inoculation (i.e. 5 days after receiving the nyi). T cells were stimulated in vitro for 48 h using the second injection of DC), CD8 spleen cells were isolated and 55 HLA-A2" T2 cell line pulsed with relevant TASA vs. irrel analyzed for reactivity against the hMART-1 is and evant HIV-nefos (AFHHVAREL: ref. 24) peptides. Cell h/mgp1009-27 peptide epitopes presented by the HLA-A2" free supernatants were then recovered and IFN-Y levels by T2 cell line. After 48 h co-culture of T cells and Ag-loaded T2 ELISA. Data are reported as mean+/-SD for triplicate ELISA cells, cell-free Supernatants were harvested and analyzed for determinations, and are representative of 3 independent IFN-y content by specific ELISA. *p-0.05 versus T2 only 60 experiments performed. *p-0.05 vs. HIV-nef control peptide control. responses. In FIG. 9B, HHD mice were vaccinated twice FIG. 6 shows a series of graphs illustrating that TASA (days-14 and -7; right flank) subcutaneously with PBS or with derived peptides bind to HLA-A2 to a variable degree based isologous DC.IL12pulsed with PBS or synthetic TASA pep on the T2 class I stabilization assay. Peptide stabilization of tides as indicated in FIG. 1A. In cases where more than 1 HLA-A2 complexes on the T2 cell line by synthetic peptides 65 peptide is identified for a given target antigen, an equimolar was assessed as previously described (Stuber et al., Eur: J. pool of the indicated peptides (each 10 uM) was pulsed onto Immunol., 24: 765-768, 1994. FluM1ss (GILGFVFTL) DC.IL12 and used for vaccination in the relevant cohort. One US 9,345,770 B2 5 6 week after the booster vaccine (i.e. day Zero), animals were refined p-values for differences between treatment cohorts challenged subcutaneously on their left flank with 2x10° reported in Table 6). Data are cumulative for three indepen MC38 colon carcinoma cells. Tumor growth was then moni dent experiments performed. tored every 3-4 days through day 24. All data represent mean FIG. 12 shows a series of graphs illustrating that HHD mice tumor area (in mm)+/-SD determined from 5 mice/cohort, treated for B16 melanoma by treatment with DC.IL12/pep and are representative of three independent experiments per tide vaccination exhibit poly-specific anti-TASA Type-1 formed. *p-0.05 versus DC only on the indicated days. CD8" T (Tc1) responses. HHD mice bearing established day FIGS. 10A-10D show a series of digital images and graphs seven B16 melanomas were therapeutically vaccinated with illustrating that MC38 tumors in mice pre-vaccinated with peptides derived from the TASA DLK1 or RGS5as described 10 in FIG. 11B. Tumors regressed to a non-detectable level over TASA-derived peptides exhibit differential infiltration by the next two weeks. Sixty days after tumor inoculation, CD8" CD8" T cells and alterations in vascular density. Day 14 T cells were MACS-isolated from the spleens of these ani MC38 tumors were harvested from HHD mice that had been mals and evaluated for IFN-Y production (by ELISA) in vaccinated as outlined in FIG.9B with the indicated peptides response to pericytes and VEC (flow-sorted from day 19 (or control PBS or DC.IL12 alone=No peptide). In FIG. 10A., 15 untreated B16 tumors or tumor-uninvolved kidneys of B16 six-micron tissue sections were co-stained with anti-CD8 bearing HHD mice), as well as, HLA-A2"T2 cells (control or (green) and anti-NG2 (red) antibodies and imaged by fluo pulsed with the indicated peptides). p-0.05 versus anti-class rescence microscopy. Blue signal nuclear counterstain using I mab blockade (when evaluating responses against peri 4,6-diamidino-2-phenylindole (DAPI). FIG. 10B provides a cytes, VEC or B16 tumor cells) or T2 cells only (when evalu summary of the mean+/-SD number of CD8 cells per high ating anti-peptide responses). Data are reflective of responses power field (HPF) in MC38 tumors isolated from control or observed in three independent experiments. vaccinated mice as depicted in FIG. 10A. In FIG. 10C, tissue FIG. 13 shows a series of graphs illustrating that in vivo sections were co-stained with anti-CD31 (green) and anti depletion of CD8", but not CD4", T cells from a cohort of NG2 (red) antibodies and imaged by fluorescence micros HHD mice effectively treated with TASA peptide-based vac copy. Blue signal-nuclear counterstain using DAPI. In FIG. 25 cines results in recurrence of disease at the site of primary 10D, the mean+/-SD number of CD31" vessels per HPF of tumor inoculation. HHD mice harboring established subcu MC38 tumors in control or vaccinated mice are summarized. taneous B16 melanomas received vaccines consisting of syn Representative data is depicted from 1 of 3 independent genic DC.IL12 pulsed with a mixture of TASA peptides on experiments performed. *p-0.05 versus DC only or untreated days 7 and 14 (post-tumor inoculation) as outlined in FIG. control mice. 30 11A, resulting in tumor regression in 100% of treated ani mals. On days 60 and 67 or days 180 and 187 (post-tumor FIGS. 11A-11C show a series of graphs illustrating that inoculation) mice were depleted of CD4" or CD8" T cells by DC.IL 12 vaccines containing TASA-derived peptides are intraperitoneal injection with specific antibodies. Control therapeutic against MC38 colon carcinomas and B16 mela animals received i.p. injections of isotype control antibodies. nomas in HHD mice. In FIG. 11A, HHD mice bearing estab 35 Specific T cell subset depletions were confirmed by flow lished day seven subcutaneous MC38 tumors (right flank) cytometry analyses performed on peripheral blood obtained were left untreated, or they were vaccinated in the left flank by tail. Animals were then monitored for the reappearance with control DC.IL12 or DC.IL12 pulsed with an equimolar and size of melanomas every 4-7 days. The number of ani pool (10 uM each) of the following TASA-derived peptides: mals evaluated per cohort is indicated within a given panel, DLK1326-334, EphA2sss-soi, HBB-39, NRP1869-877, FDG 40 with each line representing longitudinal data from a given FR3soo-sos. RGS55-1s and TEM191-7oo. Identical booster animal. Data are cumulative from three experiments per vaccines were provided on day 14 post-tumor inoculation. As formed. indicated, two vaccine cohorts were treated with depleting FIG. 14. Shows a series of digital images illustrating anti-CD4 or anti-CD8 monoclonal antibodies to evaluate the expression of TASA in the established MC38 TME. MC38 impact of these T cell subsets on therapy outcome. Tumor 45 colon carcinoma cells were injected Subcutaneous in the right growth was monitored every 3-4 days through d28. In FIG. flank of female HHD mice and allowed to establish/progress 11B, Female HHD or C57BL/6 (B6) mice were inoculated for 14 days. Animals were then euthanized, with tumors subcutaneously in the right flank with 1x10 B16 (HLA resected, fixed, sectioned and analyzed for expression of the A2") tumor cells. After 7 days, animals were randomized indicated antigens using specific antibodies and fluorescence into groups of 5 mice exhibiting tumor lesions with a mean 50 microscopy. Specific antibody against NG2 (green), the indi surface area of 60-75 mm. The mice then received vaccines cated antigen of interest (red), and CD31 (blue) were used to consisting of isologous control or peptide-pulsed DC.IL12 distinguish preferential antigen expression in tumor-associ cells subcutaneously in the left flank on days 10 and 17 ated stromal pericytes, VEC, alternate stromal cells and/or (post-tumor inoculation). In cases where more than one pep tumor cells. Images are reflective of those obtained in three tide was identified for a given target antigen, an equimolar 55 independent experiments performed. pool of the indicated peptides (each 10 uM) was pulsed onto FIG. 15. shows a series of digital images illustrating RT DC.IL12 and used for vaccination. Tumor size (mean+/-SD) PCR analysis of “stromal' antigen expression by pericytes, was monitored every 3-4 days through day 34. In FIG. 11A VEC and tumor cells in MC38 tumor-bearing mice. MC38 and FIG. 11B, mean tumor area--/-SD is reported for 5 ani colon carcinoma cell lines, as well as, flow-sorted tumor- and mals/cohort. Data are the representative of those obtained in 60 tumor-uninvolved kidney-associated pericytes and VEC (iso two independent experiments in each case. p-0.05 versus lated from HHD mice bearing untreated day 14 tumors) were DC only on the indicated days. In FIG. 11C, HHD mice analyzed for expression of the indicated mRNAs using RT bearing Subcutaneous B16 melanomas were treated as PCR. described in FIG. 11B and followed through day 60 post FIG. 16. shows a series of graphs illustrating correlation of tumor inoculation. Data are reported in a Kaplan-Meier plot 65 biologic parameters assessed in the MC38 tumor model sys depicting overall percentage of Surviving animals over time. tem. Data harvested from FIG. 1 and FIG. 2 were analyzed for *p-0.02 versus DC only: ** p-0.002 versus DC only (with the correlation of indicated markers in a pair-wise manner. US 9,345,770 B2 7 8 Individual data included: CD8+ TIL (day 7 post tumor-inocu (n=5), mice were injected s.c. on their left flank on days 7 and lation (in mean numbers per HPF). CD31+ vessels in these 14 (post-tumor inoculation) PBS, 10 DC.IL12 or 10 same lesions (reported a mean number/10 HPF), tumor size DC.IL 12 pre-pulsed with equimolar mix (10 uM each) of the (in mm2) on day 24 post-tumor inoculation, and specific 3 synthetic DLK1 peptides. Tumor growth (meaniSD) was production of IFN-Y from splenic CD8+ T cells harvested 5 then followed over time. In FIG. 20B, on day 20 post-tumor from control and vaccinated mice on day 14 post-tumor inoculation, splenic CD8" T cells were isolated from each inoculation. Each dot represents a control (DC only) or vac cohort and co-cultured with syngenic DC pre-pulsed with cine cohort evaluated (n=10). For panels including in vitro T individual DLK1 peptides for 24 h, at which time, IFN-y cell response data, each symbol reflects cumulative response ELISA were performed on the harvested cell-free superna against a given target antigen (i.e. for DLK1, this represents 10 tants. In FIGS. 20O and 20D, day 20 tumors were fixed, the Summation of responses against each of three peptides, sectioned and analyzed by immunofluorescence microscopy; while for RGS5, this reflects response against a single pep CD31 (brightgrey in FIGS. 20O, 20D), VCAM1 (medium tide). Note that in all instances, except for the IFN-yxTumor grey in FIG.20C), CXCL10 (medium grey in FIG. 20D). The Size comparison (n=13), the cohorts vaccinated using percentage of VCAM1 co-localization with CD31 is depicted DLK1-, NRP1- or PDGFRB-derived peptides are not 15 as a yellow signal in FIG. 20O. Histograms to the right of included in the indicated analysis, as these mice failed to images reflect mean quantitation (+/-SD) of color pixels from develop lesions capable of being resected for analyses. Linear 3 independent fields per slide. Data are representative of 3 regression lines are inserted in each panel, with the associated independent experiments performed. *p-0.05 versus control r’ values reported in each instance. Lines indicating 95% treatments (ANOVA). confidence intervals are also provided in each panel. FIGS. 21A-21E show that Recombinant lentiviral (lv) FIGS. 17A-17B show a series of digital images and a graph DLK1-based vaccines are therapeutic and promote a Type-1- illustrating the lack of vaccine-induced impact on CD4+ T polarized TME. (FIGS. 21A-D) BALB/c mice were inocu cell infiltration into MC38 tumor lesions. In FIG. 17A, tumor lated s.c. with RENCA tumor cells in the right flank on day 0. sections prepared as described in FIG. 10 were stained using (FIG. 21A) After cohort (n=5) randomization for similar antibodies against CD4 (green) and NG2 (red), then counter 25 meantumor size on day 10 post-tumorinoculation, mice were stained using DAPI (blue). The mean number of CD4+ TIL treated i.d. in the left flank with 40 TU or 200 TU of lvDLK1 per HPF (+/-SD) was determined over a total often fields or lv.NEG. Tumor size was then monitored longitudinally. In (FIG. 17B). FIGS. 21B, 21C and 21D, on day 27 post-tumor inoculation, FIG. 18 shows a graph illustrating that prior vaccination mice were euthanized and tumors resected, fixed, sectioned against TASA does not inhibit wound-healing in HHD mice. 30 and analyzed by immunofluorescence microscopy for expres Female HHD mice (5 animals/cohort) were vaccinated in the sion of (FIG. 21B) CD31 (brigh) and DLK1 (medium grey) right flank on d-14 and d-7 with saline, 106 DC.IL12 alone or with arrows indicating DLK1" cells, (FIG. 21C) CXCL10 106 DC.IL12pulsed with peptides derived from the indicated and (FIG. 21D) co-localization of VCAM1 with CD31. In TASA. In cases where more than one peptide is identified for FIG. 21E, CD8" TIL quantitation is provided. The presented a given TASA, an equimolar pool of the indicated peptides 35 histograms reflect mean quantitation (+/-SD) of color pixels (each 10 uM) was pulsed onto DC.IL12 and used for vacci from 3 independent fields per slide. Data are representative of nation in the relevant cohort. On d0, mice were anesthetized, 3 independent experiments performed. *p-0.05 versus con with skin on the upper back shaved and sterilized topically, trol treatments (ANOVA). before placement of two 3-mm diameter wounds using a FIGS. 22A-22D show that recombinant lv.DLK1-based sterilized punch biopsy instrument. Wounds were not treated 40 vaccines promote normalization of the tumor vasculature. consequently and no infections were observed in any animals. Mice bearing day 10 RENCA tumors were treated with The time to closure for the 10 wounds/cohort (2 sites/ani lvDLK1 or lv.NEG as outlined in FIG. 21. On day 27 post malx5 mice/group) were assessed daily and is reported as the tumor inoculation, mice were euthanized and resected and mean number of days+/-SD for complete wound closure. evaluated macroscopically and for hemoglobin content (FIG. FIGS. 19A-19C show that DLK1 is differentially 45 21A). In FIGS. 21B and 21C, tumor sections were analyzed expressed on RENCA tumor-associated pericytes. RENCA by immunofluorescence microscopy for expression of CD31 tumor cells were injected Subcutaneously (s.c.) into female (brightgrey) and NG2 (darkgrey). In FIG.21B, 6 um sections BALB/c mice and allowed to progress for 21 days after which were imaged by wide-field microscopy, while in FIG. 21C, 30 animals were euthanized and tumors and normal kidneys um sections were imaged by confocal microscopy to generate were removed. In FIG. 19A, tissues were processed into 50 3D reconstructions. For FIG. 21B, mean data+SD of three single-cell Suspension and sorted by flow cytometry based on independent fields per slide is reported for each group from 1 forward scatter and side scatter, DAPI exclusion (to exclude representative experiment of 3 performed. In repeated experi dead cells), a CD45" phenotype, and then selectively into ments (FIG. 21D), treated mice received intravenous injec CD146"CD34's pericytes and CD146"CD34* VEC popula tions of tomato lectin-FITC to label endothelium (bightgrey) tions. In FIG. 19B, mRNA was isolated from sorted pericytes 55 and 20 nm FLUORSPHEREs(R) to assess vascular permeabil and VEC from normal kidney and RENCA tumor and ana ity (dark grey) on day 24 post-tumor inoculation. Whole lyzed for DLK1 expression by real-time PCR. Relative tumor tissue was then imaged immediately by confocal mRNA expression was normalized to housekeeping HPRT1 microscopy at a depth of 17 lum. *p-0.05 for lv.DLK1 versus expression. In FIG. 19C, day 21 RENCA tumor tissue sec lvNEG (t-test). tions were analyzed for expression of CD31, NG2, and DLK1 60 FIGS. 23 A-23E show recombinant lvDLK1-based vac by fluorescence microsopy. Data are representative of 3 cines promote normoxia in the TME in association with the experiments performed. loss of cells bearing stem cell-like phenotypes. Mice bearing FIGS. 20A-20D show that DC/DLK1 peptide vaccines are day 10 RENCA tumors were treated with lvDLK1 or lv.NEG immunogenic and therapeutic in the RENCA model. (FIGS. as outlined in FIG. 21. In FIG. 23A, on day 21, mice were 20A-20C) BALB/c mice were inoculated with RENCA 65 injected i.p. with the hypoxia probe pimonidazole hydrochlo tumor cells s.c. on the right flank on day 0. In FIG. 20A, After ride and euthanized, with tumors resected, sectioned, and randomizing for similar meantumor size per treatment cohort analyzed by HRP-immunohistochemistry. In FIGS. 21 B US 9,345,770 B2 9 10 21E, day 21 tumor-bearing mice that did not receive SEQID NO: 16 is an exemplary amino acid sequence of an pimonidazole hydrochloride were euthanized, with tumors immunogenic NRP2 polypeptide. resected, fixed, sectioned and analyzed by immunofluores SEQID NO: 17 is an exemplary amino acid sequence of an cence microscopy for expression of CD31 and RGS5 (FIG. immunogenic NRP2 polypeptide. 21B), Jarid1b (FIG. 21C), CD133 (FIG. 21D) and CD44 SEQID NO: 18 is an exemplary amino acid sequence of an (FIG. 21E). The presented histograms reflect mean quantita immunogenic PSMA polypeptide. tion (+/-SD) of color pixels from 3 independent fields per SEQID NO: 19 is an exemplary amino acid sequence of an slide. Data are representative of 3 independent experiments immunogenic VEGFR1 polypeptide. performed. *p-0.05 for lvDLK1 versus lv.NEG (t-test). SEQID NO:20 is an exemplary amino acid sequence of an 10 immunogenic VEGFR2 polypeptide. FIG. 24 shows vascular remodeling after recombinant SEQ ID NO: 21 is an exemplary amino acid sequence of lvDLK1-based vaccination results in the development of apo DLK1. ptotic “dead Zones' in the TME distal to residual blood ves SEQ ID NO: 22 is an exemplary amino acid sequence of sels. Mice bearing day 10 RENCA tumors were treated with HBB. lvDLK1 or lv.NEG as outlined in FIG. 21. On day 24 post 15 SEQ ID NO: 23 is an exemplary amino acid sequence of tumor inoculation, mice were euthanized, with tumors NRP1. resected, fixed, sectioned and analyzed for expression of SEQ ID NO: 24 is an exemplary amino acid sequence of CD31 (bright grey) and apoptotic nuclear staining with TEM1. TUNEL reagent (darkgrey). The presented histograms reflect SEQ ID NO: 25 is an exemplary amino acid sequence of mean quantitation (+/-SD) of color pixels from 3 indepen EphA2. dent fields per slide. Data are representative of 3 independent SEQ ID NO: 26 is an exemplary amino acid sequence of experiments performed. *p-0.05 for lvDLK1 versus lv.NEG RGS5. (t-test). SEQ ID NO: 27 is an exemplary amino acid sequence of PDGFRB. SEQUENCE LISTING 25 SEQ ID NO: 28 is an exemplary amino acid sequence of NG2. The nucleic and amino acid sequences listed in the accom SEQ ID NO: 29 is an exemplary amino acid sequence of panying sequence listing are shown using standard letter NRP2. abbreviations for nucleotide bases, and three letter code for SEQ ID NO:30 is an exemplary amino acid sequence of amino acids, as defined in 37 C.F.R. 1.822. Only one strand of 30 PSMA. each nucleic acid sequence is shown, but the complementary SEQ ID NO: 31 is an exemplary amino acid sequence of strand is understood as included by any reference to the VEGFR1. displayed Strand. The Sequence Listing is submitted as an SEQ ID NO: 32 is an exemplary amino acid sequence of ASCII text file in the form of the file named “Sequence.txt VEGFR2. (106 kb), which was created on Oct. 30, 2015, which is 35 SEQID NO:33-64 are the nucleic acid sequences of prim incorporated by reference herein. CS. In the accompanying sequence listing: SEQ ID NO: 65 is the amino acid sequence of SEQID NO: 1 is an exemplary amino acid sequence of an DLK1 iss-66. immunogenic DLK1 polypeptide. SEQ ID NO: 66 is the amino acid sequence of SEQID NO: 2 is an exemplary amino acid sequence of an 40 DLK1 161-169. immunogenic DLK1 polypeptide. SEQID NO: 67 is the amino acid sequence of DLK1 solo SEQID NO:3 is an exemplary amino acid sequence of an and DLK1262-27o. immunogenic DLK1 polypeptide. SEQID NOs: 68-83 are peptide sequences. SEQID NO. 4 is an exemplary amino acid sequence of an SEQID NO: 84 is the amino acid sequence of a linker. immunogenic HBB polypeptide. 45 SEQID NO: 5 is an exemplary amino acid sequence of an DETAILED DESCRIPTION immunogenic HBB polypeptide. SEQID NO: 6 is an exemplary amino acid sequence of an Terms immunogenic NRP1 polypeptide. SEQID NO: 7 is an exemplary amino acid sequence of an 50 Unless otherwise noted, technical terms are used according immunogenic NRP1 polypeptide. to conventional usage. Definitions of common terms in SEQID NO: 8 is an exemplary amino acid sequence of an molecular biology may be found in Benjamin Lewin, Genes immunogenic NRP1 polypeptide. V, published by Oxford University Press, 1994 (ISBN 0-19 SEQID NO: 9 is an exemplary amino acid sequence of an 854287-9); Kendrew et al. (eds.), The Encyclopedia of immunogenic TEM1 polypeptide. 55 Molecular Biology, published by Blackwell Science Ltd., SEQID NO: 10 is an exemplary amino acid sequence of an 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), immunogenic EphA2 polypeptide. Molecular Biology and Biotechnology: a Comprehensive SEQID NO: 11 is an exemplary amino acid sequence of an Desk Reference, published by VCH Publishers, Inc., 1995 immunogenic RGS5 polypeptide. (ISBN 1-56081-569-8). SEQID NO: 12 is an exemplary amino acid sequence of an 60 In order to facilitate review of the various embodiments of immunogenic PDGFRB polypeptide. this disclosure, the following explanations of specific terms SEQID NO: 13 is an exemplary amino acid sequence of an are provided, along with particular examples: immunogenic NG2 polypeptide. Adjuvant: A Vehicle used to enhance antigenicity. Adju SEQID NO: 14 is an exemplary amino acid sequence of an vants include a Suspension of minerals (alum, aluminum immunogenic NG2 polypeptide. 65 hydroxide, or phosphate) on which antigen is adsorbed; or SEQID NO: 15 is an exemplary amino acid sequence of an water-in-oil emulsion in which antigen solution is emulsified immunogenic NRP2 polypeptide. in mineral oil (Freund incomplete adjuvant). Sometimes with US 9,345,770 B2 11 12 the inclusion of killed mycobacteria (Freund's complete specific antigen can also be a disease specific antigen. A adjuvant) to further enhance antigenicity (inhibits degrada tissue-specific antigen is expressed in a limited number of tion of antigen and/or causes influx of macrophages) Immun tissues, such as a single tissue. Specific, non-limiting stimulatory oligonucleotides (such as those including a CpG examples of a tissue specific antigen are a prostate specific motif) can also be used as adjuvants (for example see U.S. Pat. antigen, a uterine specific antigen, and/or a testes specific No. 6,194,388: U.S. Pat. No. 6,207,646; U.S. Pat. No. 6,214, antigen. A tissue specific antigen may be expressed by more 806; U.S. Pat. No. 6,218,371; U.S. Pat. No. 6,239,116; U.S. than one tissue, such as, but not limited to, an antigen that is Pat. No. 6,339,068; U.S. Pat. No. 6,406,705; and U.S. Pat. expressed in more than one reproductive tissue. Such as in No. 6,429, 199). Adjuvants include biological molecules (a both prostate and uterine tissue. A disease-specific antigen is “biological adjuvant”). Such as costimulatory molecules. 10 expressed coincidentally with a disease process. Specific Administration: To provide or give a subject an agent, for non-limiting examples of a disease-specific antigen are an example, a composition that includes a immunogenic TASA antigen whose expression correlates with, or is predictive of peptide, by any effective route. Exemplary routes of admin tumor formation, such as prostate cancer and/or uterine can istration include, but are not limited to, oral, injection (such as cer and/or testicular cancer. A disease-specific antigen can be Subcutaneous, intramuscular, intradermal, intraperitoneal, 15 an antigen recognized by T cells or B cells. and intravenous) and transdermal (e.g., topical). Cancer, Tumor or Neoplasia: A neoplasm is an abnormal Agent: Any Substance or any combination of Substances growth of tissue or cells that results from excessive cell divi that is useful for achieving an end or result; for example, a Sion. Neoplastic growth can produce a tumor. The amount of Substance or combination of Substances useful for decreasing a tumor in an individual is the “tumor burden' which can be or reducing a tumor in a subject. In some embodiments, the measured as the number, Volume, or weight of the tumor. A agent is a chemotherapeutic agent, toxin or anti-angiogenic tumor that does not metastasize is referred to as “benign. A agent. The skilled artisan will understand that particular tumor that invades the Surrounding tissue and/or can metas agents may be useful to achieve more than one result. tasize is referred to as “malignant.” Angiogenesis: A biological process leading to the genera Tumors of the same tissue type are primary tumors origi tion of new blood vessels through sprouting or growth from 25 nating in a particular organ (such as colon or skin). Tumors of pre-existing blood vessels. The process involves the migra the same tissue type may be divided into tumors of different tion and proliferation of endothelial cells from preexisting Sub-types. vessels. Angiogenesis occurs during pre- and post-natal Examples of Solid tumors, such as sarcomas (connective development, and in the adult. Angiogenesis occurs during tissue cancer) and carcinomas (epithelial cell cancer), include the normal cycle of the female reproductive system, wound 30 fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, healing, and during pathological processes such as cancer, osteogenic sarcoma, and other sarcomas, synovioma, where it is essential for the growth of solid tumors (for review, mesothelioma, Ewings tumor, leiomyosarcoma, rhab see Battegay, J. Molec. Med., 73(7): 333-346, 1995; Shchors domyosarcoma, colorectal carcinoma, lymphoid malignancy, and Evan, Cancer Res., 67: 1630-1633. 2007). pancreatic cancer, breast cancer, lung cancers, ovarian cancer, Anti-angiogenic agent: A molecule that decreases or 35 prostate cancer, hepatocellular carcinoma, squamous cell car reduces angiogenesis, for example, a molecule that decreases cinoma, basal cell carcinoma, adenocarcinoma, Sweat gland pathological angiogenesis. Additional anti-angiogenic agents carcinoma, medullary thyroid carcinoma, papillary thyroid include, but are not limited to, vascular endothelial growth carcinoma, pheochromocytomas sebaceous gland carci factor receptor 2 (VEGFR2)antibodies such as bevacizumab, noma, papillary carcinoma, papillary adenocarcinomas, med as well as Small molecule tyrosine kinase inhibitors, such as 40 ullary carcinoma, bronchogenic carcinoma, renal cell carci Sunitinib. See also, Liu et al., Seminars in Oncology, 29(11): noma, hepatoma, bile duct carcinoma, choriocarcinoma, 96-103, 2002; Shepherd et al., Lung Cancer 34:S81-S89, Wilms tumor, cervical cancer, testicular tumor, seminoma, 2001). bladder carcinoma, and CNS tumors (such as a glioma, astro Antigen: A compound, composition, or Substance that can cytoma, medulloblastoma, craniopharyoglioma, ependy stimulate the production of antibodies or a T cell response in 45 moma, pinealoma, hemangioblastoma, acoustic neuroma, an animal, including compositions that are injected or oligodendroglioma, menangioma, melanoma, neuroblas absorbed into an animal. An antigen reacts with the products toma and retinoblastoma). of specific humoral or cellular immunity, including those cDNA (complementary DNA): A piece of DNA lacking induced by heterologous immunogens. The term “antigen” internal, non-coding segments (introns) and regulatory includes all related antigenic epitopes. “Epitope' or “anti 50 sequences that determine transcription. cDNA is synthesized genic determinant refers to a site on an antigen to which B in the laboratory by reverse transcription from messenger and/or T cells respond. In one embodiment, T cells respond to RNA extracted from cells. the epitope, when the epitope is presented in conjunction with CD4: Cluster of differentiation factor 4, a T cell surface an MHC molecule. Epitopes can be formed both from con protein that mediates interaction with the MHC Class II mol tiguous amino acids or noncontiguous amino acids juxta 55 ecule. CD4 also serves as the primary receptor site for HIV on posed by tertiary folding of a protein. Epitopes formed from T cells during HIV infection. Cells that express CD4 are often contiguous amino acids are typically retained on exposure to helper T cells. denaturing solvents whereas epitopes formed by tertiary fold CD8: Cluster of differentiation factor 8, a T cell surface ing are typically lost on treatment with denaturing solvents. protein that mediates interaction with the MHC Class I mol An epitope typically includes at least 3, at least 5, at least 9, at 60 ecule. Cells that express CD8 are often cytotoxic T cells. least 10, at least 11, at least 12, or about 9-12 amino acids in Chemotherapeutic agent: Any chemical agent with thera a unique spatial conformation. Methods of determining spa peutic usefulness in the treatment of diseases characterized tial conformation of epitopes include, for example, X-ray by abnormal cell growth. For example, chemotherapeutic crystallography and 2-dimensional nuclear magnetic reso agents are useful for the treatment of cancer, including col aCC. 65 orectal and skin cancer. In one embodiment, a chemothera An antigen can be a tissue-specific antigen, or a disease peutic agent is a radioactive compound. In particular specific antigen. These terms are not exclusive, as a tissue examples, such chemotherapeutic agents are administered in US 9,345,770 B2 13 14 combination with a treatment that decreases or reduces a Contacting: Placement in direct physical association, for tumor or angiogenesis (for example before, during or after example solid, liquid or gaseous forms. Contacting includes, administration of a therapeutically effective amount of one or for example, direct physical association of fully- and par more immunogenic TASA peptides or a composition includ tially-solvated molecules. ing a plurality of immunogenic polypeptides). One of skill in Costimulatory molecule: Although engagement of the the art can readily identify a chemotherapeutic agent of use T-cell receptor with peptide-MHC delivers one signal to the T (see for example, Slapak and Kufe, Principles of Cancer cell, this signal alone can be insufficient to activate the T cell. Therapy, Chapter 86 in Harrison's Principles of Internal Costimulatory molecules are molecules that, when bound to Medicine, 14th edition: Perry et al., Chemotherapy, Ch. 17 in their ligand, deliver a second signal enhancing activation of 10 the T cell. The most well-known costimulatory molecule on Abeloff, Clinical Oncology 2" ed., (C) 2000 Churchill Living the T cell is CD28, which binds to either B7-1 (also called stone, Inc.; Baltzer, L., Berkery, R. (eds): Oncology Pocket CD80) or B7-2 (also known as CD86). An additional Guide to Chemotherapy, 2nd ed. St. Louis, Mosby-Year costimulatory molecule is B7-3. Accessory molecules that Book, 1995: Fischer, D. S. Knobf, M. F. Durivage, H. J. also provide a second signal for the activation of T cells (eds): The Cancer Chemotherapy Handbook, 4th ed. St. 15 include intracellular adhesion molecule (ICAM-1 and Louis, Mosby-Year Book, 1993; Chabner and Longo, Cancer ICAM-2), leukocyte function associated antigen (LFA-1, Chemotherapy and Biotherapy. Principles and Practice (4th LFA-2 and LFA-3). Integrins and tumor necrosis factor ed.). Philadelphia: Lippincott Willians & Wilkins, 2005; (TNF) superfamily members can also serve as co-stimulatory Skeel, Handbook of Cancer Chemotherapy (6th ed.). Lippin molecules. cott Williams & Wilkins, 2003). Combination chemotherapy Decrease or Reduce: To reduce the quality, amount, or is the administration of more than one agent to treat cancer. strength of something; for example a reduction in tumor Colorectal cancer: A neoplastic tumor of colon, rectum or burden. In one example, a therapy reduces a tumor (such as anus tissue that is or has the potential to be malignant. The the size of a tumor, the number of tumors, the metastasis of a main types of colorectal cancer include colorectal carcinomas tumor, or combinations thereof), or one or more symptoms Such as adenocarcinoma and squamous cell carcinoma. Infil 25 associated with a tumor, for example as compared to the trating (malignant) carcinoma of the colon can be divided into response in the absence of the therapy. In a particular stages (I, II, III and IV). See, e.g., Blake et al. (eds.), Gas example, a therapy decreases the size of a tumor, the number trointestinal Oncology. A practical Guide, Berlin: Springer of tumors, the metastasis of a tumor, or combinations thereof, Verlag, 2011. Subsequent to the therapy, such as a decrease of at least 10%, Consists Of With regard to a polypeptide, a polypeptide 30 at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. Such that consists of a specified amino acid sequence does not decreases can be measured using the methods disclosed include any additional amino acid residues, nor does it herein. include additional non-peptide components, such as lipids, Degenerate variant: A polynucleotide encoding a immuno Sugars or labels. 35 genic TASA peptide that includes a sequence that is degen Conservative variants: “Conservative' amino acid substi erate as a result of the genetic code. There are 20 natural tutions are those substitutions that do not substantially affect amino acids, most of which are specified by more than one or decrease an activity or antigenicity of an antigenic epitope codon. Therefore, all degenerate nucleotide sequences are of DLK1. Specific, non-limiting examples of a conservative included in this disclosure as long as the amino acid sequence Substitution include the following examples: 40 of the immunogenic TASA peptide encoded by the nucleotide sequence is unchanged. Dendritic cell (DC): Dendritic cells are the principle anti Original Residue Conservative Substitutions gen presenting cells (APCs) involved in primary immune Al Ser responses. Dendritic cells include plasmacytoid dendritic Arg Lys 45 cells and myeloid dendritic cells. Their major function is to ASn Gln, His Asp Glu obtain antigen in tissues, migrate to lymphoid organs and Cys Ser present the antigen in order to activate T cells. Immature Gln ASn dendritic cells originate in the bone marrow and reside in the Glu Asp periphery as immature cells. His ASn; Glin Ile Leu, Val 50 Effective amount: The amount of an agent (Such as a immu Leu Ile: Val nogenic TASA peptide or a composition comprising a plural Lys Arg: Gln: Glu ity of immunogenic polypeptides) that alone, or together with Met Leu: Ile one or more additional agents, induces the desired response, Phe Met; Leu: Tyr Ser Thr Such as, for example induction of an immune response to a Thr Ser 55 TASA. Trp Tyr Epitope: An antigenic determinant. These are particular Tyr Trp; Phe chemical groups or peptide sequences on a molecule that are Wal Ile: Leu antigenic (that elicit a specific immune response). An anti body specifically binds a particular antigenic epitope on a The term conservative variant also includes the use of a sub 60 polypeptide. Epitopes can be formed both from contiguous stituted amino acid in place of an unsubstituted parent amino amino acids or noncontiguous amino acids juxtaposed by acid, provided that antibodies raised to the substituted tertiary folding of a protein. Epitopes formed from contigu polypeptide also immunoreact with the unsubstituted ous amino acids are typically retained on exposure to dena polypeptide, and/or that the Substituted polypeptide retains turing solvents whereas epitopes formed by tertiary folding the function of the unsubstituted polypeptide. Non-conserva 65 are typically lost on treatment with denaturing solvents. An tive substitutions are those that reduce an activity or antige epitope typically includes at least 3, and more usually, at least nicity. 5, about 9, or 8 to 10 amino acids in a unique spatial confor US 9,345,770 B2 15 16 mation. Methods of determining spatial conformation of lymphocyte ("CTL) response against the antigen from epitopes include, for example, X-ray crystallography and which the immunogenic peptide is derived. 2-dimensional nuclear magnetic resonance. See, e.g., Isolated: A biological component (Such as a nucleic acid, "Epitope Mapping Protocols' in Methods in Molecular Biol peptide, protein or protein complex) that has been Substan ogy, Vol. 66, Glenn E. Morris, Ed (1996). In one embodiment, 5 tially separated, produced apart from, or purified away from an epitope binds an MHC molecule, such an HLA molecule other biological components in the cell of the organism in or a DR molecule. These molecules bind polypeptides having which the component naturally occurs, i.e., other chromo the correct anchor amino acids separated by about eight to somal and extrachromosomal DNA and RNA, and proteins. about ten amino acids, such as nine amino acids. Thus, isolated nucleic acids, peptides and proteins include Host cells: Cells in which a vector can be propagated and 10 nucleic acids and proteins purified by Standard purification its DNA expressed. The cell may be prokaryotic or eukary methods. The term also embraces nucleic acids, peptides and otic. The cell can be mammalian, Such as a human cell. The proteins prepared by recombinant expression in a host cell, as term also includes any progeny of the Subject host cell. It is well as, chemically synthesized nucleic acids. A isolated understood that all progeny may not be identical to the paren 15 nucleic acid, peptide or protein, for example a polypeptide, tal cell since there may be mutations that occur during repli can be at least 50%, at least 60%, at least 70%, at least 80%, cation. However, such progeny are included when the term at least 90%, at least 95%, at least 96%, at least 97%, at least "host cell' is used. 98%, or at least 99% pure. The epitopes of TASA disclosed Immune response: A response of a cell of the immune herein can be isolated (and/or synthesized) by any means system, Such as a B cell, T cell, or monocyte, to a stimulus. In known in the art (see, e.g., Guide to Protein Purification, ed. one embodiment, the response is specific for a particular Deutscher, Meth. Enzymol. 185, Academic Press, San Diego, antigen (an 'antigen-specific response'). In one embodiment, 1990; and Scopes, Protein Purification. Principles and Prac an immune response is a T cell response, such as a CD4+ tice, Springer Verlag, New York, 1982). response or a CD8+ response. In another embodiment, the Linker: The terms "conjugating.” “joining.” “bonding.” response is a B cell response, and results in the production of 25 “labeling' or “linking refer to making two molecules into specific antibodies. one contiguous molecule; for example, linking two polypep Immunogenic composition: A composition comprising an tides into one contiguous polypeptide, or covalently attaching immunogenic TASA peptide or a plurality of immunogenic an effector molecule or detectable marker radionuclide or TASA peptides, or one or more polynucleotides encoding the other molecule to a polypeptide. The linkage can be either by immunogenic TASA peptide or plurality of immunogenic 30 chemical or recombinant means. "Chemical means’ refers to TASA peptides that induces a measurable CTL response a reaction between the antibody moiety and the effector mol against cells expressing the corresponding TASA, or induces ecule Such that there is a covalent bond formed between the a measurable B cell response (such as production of antibod two molecules to form one molecule. ies that specifically bind the corresponding TASA) against a In some embodiments, a linker is an amino acid sequence TASA peptide. For in vitro use, the immunogenic composi 35 that covalently links two polypeptide domains. For example, tion can consist of the isolated nucleic acid, vector including Such linkers can be included in the between the immunogenic the nucleic acid/or immunogenic peptide. For in vivo use, the TASA epitopes disclosed herein to provide rotational free immunogenic composition will typically comprise the dom to the linked polypeptide domains and thereby to pro nucleic acid, vector including the nucleic acid, and or immu mote proper domain folding and presentation to a MHC. By nogenic polypeptide, in pharmaceutically acceptable carri 40 way of example, in a recombinant polypeptide comprising ers, and/or other agents. An immunogenic composition can two immunogenic TASA peptide domains, linker sequences optionally include an adjuvant. can be provided between them, Such as a polypeptide com Immunogenic TASA peptide: A peptide which comprises prising immunogenic TASA peptide-linker-immunogenic an allele-specific motif or other sequence of a tumor associ TASA peptide. Linker sequences, which are generally ated Stromal cell antigen, such that the peptide will bind an 45 between 2 and 25 amino acids in length, are well known in the MHC molecule and induce a cytotoxic T lymphocyte art and include, but are not limited to, the glycine(4)-serine (“CTL) response, or a B cell response (e.g. antibody produc spacer (GGGGS (SEQ ID NO: 84)x3) described by tion) against the antigen from which the immunogenic pep Chaudhary et al., Nature 339:394–397, 1989. tide is derived. Lymphocytes: A type of white blood cell that is involved in In one example, an immunogenic TASA peptide is a series 50 the immune defenses of the body. There are two main types of of contiguous amino acid residues from a TASA generally lymphocytes: B cells and T cells. between 7 and 20 amino acids in length, such as about 8 to 11 Major Histocompatibility Complex (MHC): A generic des residues in length. Specific immunogenic TASA peptides are ignation meant to encompass the histocompatability antigen disclosed herein that are 9 or 10 amino acid residues in length, systems described in different species, including the human or at most 12 amino acids in length, such as 8-15 amino acids 55 leukocyte antigens (“HLA). in length. Generally, immunogenic TASA peptides can be Open reading frame (ORF): A series of nucleotide triplets used to induce an immune response in a subject, Such as a B (codons) coding for amino acids without any internal termi cell response or a T cell response. In one example, an immu nation codons. These sequences are usually translatable into nogenic TASA peptide, when bound to a Major Histocom a peptide. patibility Complex Class I molecule, activates cytotoxic T 60 Operably linked: A first nucleic acid sequence is operably lymphocytes (CTLs) against cells expressing the correspond linked with a second nucleic acid sequence when the first ing wild-type TASA protein. Induction of CTLS using Syn nucleic acid sequence is placed in a functional relationship thetic peptides and CTL cytotoxicity assays known in the art, with the second nucleic acid sequence. For instance, a pro see U.S. Pat. No. 5,662.907, which is incorporated herein by moter is operably linked to a coding sequence if the promoter reference. In one example, an immunogenic peptide includes 65 affects the transcription or expression of the coding sequence, an allele-specific motif or other sequence Such that the pep Such as a sequence that encodes an immunogenic TASA tide will bind an MHC molecule and induce a cytotoxic T peptide. Generally, operably linked DNA sequences are con US 9,345,770 B2 17 18 tiguous and, where necessary to join two protein-coding Pharmaceutically acceptable carriers: The pharmaceuti regions, in the same reading frame. cally acceptable carriers provided herein are conventional. Pathological angiogenesis: Angiogenesis that is medically Remington's Pharmaceutical Sciences, by E. W. Martin, undesired or harmful to a subject, such as angiogenesis asso Mack Publishing Co., Easton, Pa., 15th Edition (1975), ciated with a tumor or the generation of blood vessels in or 5 describes compositions and formulations Suitable for phar Surrounding a tumor. Other examples of pathological angio maceutical delivery of the fusion proteins herein disclosed. genesis include corneal or retinal angiogenesis (as in a cor In general, the nature of the carrier will depend on the neal transplant or the retina of a Subject with macular degen particular mode of administration being employed. For eration or diabetes). instance, parenteral formulations usually include injectable Peptide Modifications: Immunogenic TASA peptides 10 fluids that include pharmaceutically and physiologically include synthetic embodiments of peptides described herein. acceptable fluids Such as water, physiological saline, bal In addition, analogs (non-peptide organic molecules), deriva anced salt Solutions, aqueous dextrose, glycerol or the like as tives (chemically functionalized peptide molecules obtained a vehicle. For Solid compositions (e.g., powder, pill, tablet, or starting with the disclosed peptide sequences) and variants capsule forms), conventional non-toxic solid carriers can (homologs) of these peptides can be utilized in the methods 15 include, for example, pharmaceutical grades of mannitol, described herein. Each peptide of this disclosure is comprised lactose, starch, or magnesium Stearate. In addition to biologi of a sequence of amino acids, which may be either L- and/or cally-neutral carriers, pharmaceutical compositions to be D-amino acids, naturally occurring and otherwise. administered can contain minor amounts of non-toxic auxil Peptides can be modified by a variety of chemical tech iary Substances, such as wetting or emulsifying agents, pre niques to produce derivatives having essentially the same servatives, and pH buffering agents and the like, for example activity as the unmodified peptides, and optionally having Sodium acetate or Sorbitan monolaurate. other desirable properties. For example, carboxylic acid Polynucleotide: The term polynucleotide or nucleic acid groups of the protein, whether carboxyl-terminal or side sequence refers to a polymeric form of nucleotide at least 10 chain, can be provided in the form of a salt of a pharmaceu bases in length. A recombinant polynucleotide includes a tically-acceptable cation or esterified to form a C-C ester, 25 polynucleotide that is not immediately contiguous with both or converted to an amide of formula NRR, wherein R and of the coding sequences with which it is immediately con R2 are each independently H or C-C alkyl, or combined to tiguous (one on the 5' end and one on the 3' end) in the form a heterocyclic ring, Such as a 5- or 6-membered ring naturally occurring genome of the organism from which it is Amino groups of the peptide, whetheramino-terminal or side derived. The term therefore includes, for example, a recom chain, can be in the form of a pharmaceutically-acceptable 30 binant DNA which is incorporated into a vector; into an acid addition salt, such as the HCl, HBr, acetic, benzoic, autonomously replicating plasmid or virus; or into the toluene sulfonic, maleic, tartaric and other organic salts, or genomic DNA of a prokaryote or eukaryote, or which exists can be modified to C-C alkyl or dialkyl amino or further as a separate molecule (e.g., a cDNA) independent of other converted to an amide. sequences. The nucleotides can be ribonucleotides, deoxyri Hydroxyl groups of the peptide side chains may be con 35 bonucleotides, or modified forms of either nucleotide. The Verted to C-C alkoxy or to a C-C ester using well term includes single- and double-stranded forms of DNA. recognized techniques. Phenyl and phenolic rings of the pep Polypeptide or Peptide: A polymer in which the monomers tide side chains may be substituted with one or more halogen are amino acid residues that are joined together through atoms, such as fluorine, chlorine, bromine or iodine, or with amide bonds. The amino acids included in a polypeptide may C-C alkyl, C-C alkoxy, carboxylic acids and esters 40 be subject to post-translational modification (e.g., glycosyla thereof, or amides of such carboxylic acids. Methylene tion or phosphorylation). A polypeptide or peptide can be groups of the peptide side chains can be extended to homolo between 3 and 30 amino acids in length. In one embodiment, gous C-C alkylenes. Thiols can be protected with any one of a polypeptide or peptide is from 8 to 12 amino acids in length. a number of well-recognized protecting groups, such as In several embodiments, a polypeptide or peptide is at most acetamide groups. Those skilled in the art will also recognize 45 12 amino acids in length, for example, 9, 10, 11 or 12 amino methods for introducing cyclic structures into the peptides of acids in length. In some embodiments, a protein is at least 100 this invention to select and provide conformational con amino acids in length, for example, at least 150, at least 200, straints to the structure that result in enhanced stability. at least 250, at least 300, at least 350, at least 400, at least 450, Peptidomimetic and organomimetic embodiments are or at least 500 amino acids in length. envisioned, whereby the three-dimensional arrangement of 50 Plurality: Two or more of a molecule, such as 2, 3, 4, 5, 6, the chemical constituents of Such peptido- and organomimet 7, 8, 9, 10, 11, 12 or more of a molecule. ics mimic the three-dimensional arrangement of the peptide Promoter: An array of nucleic acid control sequences backbone and componentamino acid side chains, resulting in which direct transcription of a nucleic acid. A promoter Such peptido- and organomimetics of an immunogenic TASA includes necessary nucleic acid sequences near the start site peptide having measurable or enhanced ability to generate an 55 of transcription, Such as, in the case of a polymerase II type immune response. For computer modeling applications, a promoter, a TATA element. In one embodiment, a promoter pharmacophore is an idealized three-dimensional definition includes an enhancer. In another embodiment, a promoter of the structural requirements for biological activity. Peptido includes a repressor element. In these embodiments, a chi and organomimetics can be designed to fit each pharmacoph meric promoter is created (a promoter/enhancer chimera or a ore with current computer modeling Software (using com- 60 promoter/repressor chimera, respectively). Enhancer and puter assisted drug design or CADD). See Walters, “Com repressor elements can be located adjacent to, or distal to the puter-Assisted Modeling of Drugs, in Klegerman & Groves, promoter, and can be located as much as several thousand eds., 1993, Pharmaceutical Biotechnology, Interpharm base pairs from the start site of transcription. Examples of Press: Buffalo Grove, Ill., pp. 165-174 and Principles of promoters include, but are not limited to the SV40 promoter, Pharmacology, Munson (ed.) 1995, Ch. 102, for descriptions 65 the CMV enhancer-promoter, and the CMV enhancer/B-actin of techniques used in CADD. Also included are mimetics promoter. Both constitutive and inducible promoters are prepared using Such techniques. included (see e.g., Bitter et al., Methods in Enzymology 153: US 9,345,770 B2 19 20 516-544, 1987). Also included are those promoter elements NCBI website on the internet. One of skill in the art will which are Sufficient to render promoter-dependent gene appreciate that these sequence identity ranges are provided expression controllable for cell-type specific, tissue-specific, for guidance only; it is entirely possible that strongly signifi or inducible by external signals or agents; such elements may cant homologs could be obtained that fall outside of the be located in the 5' or 3' regions of the gene. Promoters ranges provided. produced by recombinant DNA or synthetic techniques can Skin cancer: A neoplastic tumor of skin tissue that is or has also be used to provide for transcription of the nucleic acid the potential to be malignant. Melanoma is a skin cancer of Sequences. transformed melanocytes (cells that make the pigment mela Recombinant: A recombinant nucleic acid is one that has a nin). Melanocytes are found primary in the skin, but are also sequence that is not naturally occurring or has a sequence that 10 present in the bowel and eye. Melanoma in the skin includes is made by an artificial combination of two otherwise sepa Superficial spreading melanoma, nodular melanoma, acral rated segments of sequence. This artificial combination is lentiginous melanoma, and lentigo maligna (melanoma). Any often accomplished by chemical synthesis or, more com of the above types may produce melaninor can be amelanotic. monly, by the artificial manipulation of isolated segments of Similarly, any Subtype may show desmoplasia (dense fibrous nucleic acids, e.g., by genetic engineering techniques. 15 reaction with neurotropism), which is a marker of aggressive Sequence identity: The similarity between amino acid behavior and a tendency for local recurrence. Other melano sequences is expressed in terms of the similarity between the mas include clear cell sarcoma, mucosal melanoma and uveal sequences, otherwise referred to as sequence identity. melanoma. Melanoma is staged from I to IV. See, e.g., Sequence identity is frequently measured interms of percent Thompson et al. (eds), Textbook of Melanoma. Pathology, age identity (or similarity or homology); the higher the per Diagnosis and Management, London: Taylor & Francis, centage, the more similar the two sequences are. Homologs or 2004. variants of an immunogenic TASA peptide or DLK1 will Stromal cells: Cells forming the connective tissue of any possess a relatively high degree of sequence identity when organ. Examples of stromal cells include fibroblasts (such as aligned using standard methods. myofibroblasts), leukocytes, pericytes (such as vascular peri Methods of alignment of sequences for comparison are 25 cytes) and endothelial cells (such as vascular endothelial well known in the art. Various programs and alignment algo cells). rithms are described in: Smith and Waterman, Adv. Appl. Subject: Any mammal. Such as humans, non-human pri Math. 2:482, 1981; Needleman and Wunsch, J. Mol. Biol. mates, pigs, sheep, cows, rodents and the like. In two non 48:443, 1970; Higgins and Sharp, Gene 73:237, 1988: Hig limiting examples, a Subject is a human Subject or a murine gins and Sharp, CABIOS 5:151, 1989; Corpet et al., Nucleic 30 subject. Thus, the term “subject' includes both human and Acids Research 16:10881, 1988; and Pearson and Lipman, Veterinary Subjects. Proc. Natl. Acad. Sci. USA 85:2444, 1988. Altschul et al., T Cell: A white blood cell critical to the immune response. Nature Genet. 6: 119, 1994, presents a detailed consideration T cells include, but are not limited to, CD4 T cells and CD8" of sequence alignment methods and homology calculations. T cells. A CD4 T lymphocyte is an immune cell that carries The NCBI Basic Local Alignment Search Tool (BLAST) 35 a marker on its surface known as “cluster of differentiation 4 (Altschulet al., J. Mol. Biol. 215:403, 1990) is available from (CD4). These cells, also known as helper T cells, help orches several sources, including the National Center for Biotech trate the immune response, including antibody responses as nology Information (NCBI, Bethesda, Md.) and on the inter well as killer T cell responses. CD8" T cells carry the “cluster net, for use in connection with the sequence analysis pro of differentiation 8” (CD8) marker. In one embodiment, a grams blastp, blastin, blastX, thlastin and thlastX. A description 40 CD8 T cell is a cytotoxic T lymphocyte. In another embodi of how to determine sequence identity using this program is ment, a CD8 cell is a suppressor T cell. available on the NCBI website on the internet. Tumor Associated Microenvironment (TME): A tumor and Homologs and variants of an immunogenic TASA peptide the area immediately surrounding a tumor, including, for or DLK1 are typically characterized by possession of at least example, blood vessels intersecting or contacting the tumor. 75%, for example at least 80%, sequence identity counted 45 Tumor Associated Stromal Cell: A stromal cell included in over the full length alignment with the amino acid sequence a tumor or the tumor microenvironment. For example, vascu of the immunogenic TASA peptide using the NCBI Blast 2.0, lar endothelial cells (VECs) and pericytes included in blood gapped blastp set to default parameters. For comparisons of vessels intersecting or contacting tumor. amino acid sequences of greater than about 30 amino acids, Tumor Associated Stromal Cell Antigen (TASA): An anti the Blast 2 sequences function is employed using the default 50 genic molecule expressed by a tumor associated Stromal cell. BLOSUM62 matrix set to default parameters, (gap existence Examples of TASA include Protein Delta Homolog 1 (DLK1; cost of 11, and a per residue gap cost of 1). When aligning SEQ ID NO: 21), Hemoglobin Subunit Beta (HBB: SEQID short peptides (fewer than around 30 amino acids), the align NO: 22), Neuropilin 1 (NRP1; SEQ ID NO. 23), Tumor ment should be performed using the Blast 2 sequences func Endothelial Marker 1 (TEM1; SEQID NO:24), EphrinType tion, employing the PAM30 matrix set to default parameters 55 A Receptor 2 (EphA2: SEQID NO:25), Regulator of G-Pro (open gap 9. extension gap 1 penalties). Proteins with even tein Signaling 5 (RGS5; SEQ ID NO: 26), Platelet Derived greater similarity to the reference sequences will show Growth Factor Receptor B (PDGFRB: SEQID NO:27), mela increasing percentage identities when assessed by this noma chondroitin sulfate proteoglycan (NG2: SEQ ID NO: method, such as at least 80%, at least 85%, at least 90%, at 28), Neuropilin 2 (NRP2: SEQID NO: 29), Glutamate Car least 95%, at least 98%, or at least 99% sequence identity. 60 boxypeptidase 2, (PSMA; SEQID NO:30), Vascular Endot When less than the entire sequence is being compared for helial Growth Factor 1 (VEGFR1; SEQID NO:31), Vascular sequence identity, homologs and variants will typically pos Endothelial Growth Factor Receptor 2 (VEGFR2: SEQ ID sess at least 80% sequence identity over short windows of NO:32). (See, e.g., Komita et al., Cancer Res., 68: 8076 10-20 amino acids, and can possess sequence identities of at 8084, 2008; Hatano et al., J. Transl. Med., 2: 40, 2004; least 85% or at least 90% or 95% depending on their similar 65 Maciaget al., Cancer Res., 68: 8066-8075, 2008: Ishizaki et ity to the reference sequence. Methods for determining al., Clin. Cancer Res., 12: 5841-5849, 2006; Wada et al., sequence identity over Such short windows are available at the Cancer Res., 65: 4939-4946, 2005; Kaplanet al., Vaccine, 24: US 9,345,770 B2 21 22 6994-7002, 2006; Liu et al., Cytokine, 32: 206-212, 2005; reduction in severity of some or all clinical symptoms of the Silver et al., Clin. Cancer Res., 3: 81-85, 1997: Harada et al., disease, a slower progression of the disease (for example by Oncol. Rep., 12: 601-607, 2004; Bonders et al., Am. J. prolonging the life of a subject having tumor), a reduction in Pathol., 162: 721-729, 2003; Boss et al., Clin. Cancer Res., the number of relapses of the disease, an improvement in the 13: 3347-3355, 2007: Christian et al., Am. J. Pathol., 172: overall health or well-being of the subject, or by other param 486-494, 2008. Several embodiments include an immuno eters well known in the art that are specific to the particular genic peptide from a TASA. In some embodiments, a plural tumor. ity of immunogenic peptides from one or more TASA is Vector: A nucleic acid molecule as introduced into a host provided in a composition. cell, thereby producing a transformed host cell. A vector may Tumor burden: The total volume, number, metastasis, or 10 include nucleic acid sequences that permit it to replicate in a combinations thereof of tumor or tumors in a Subject. host cell. Such as an origin of replication. A vector may also Therapeutically effective amount: The amount of an agent include one or more selectable marker gene and other genetic (such as immunogenic TASA peptide, a DLK1 protein, a elements known in the art. Vectors include plasmid vectors, nucleic acid encoding the TASA peptide, a nucleic acid including plasmids for expression in gram negative and gram encoding DLK1 protein, or a composition including a plural 15 positive bacterial cell. Exemplary vectors include those for ity of immunogenic TASA peptides) that alone, or together expression in E. coli. Vectors also include viral vectors. Such with one or more additional agents, induces the desired as, but are not limited to, retroviral, pox, adenoviral, herpes response, Such as, for example, induction of an immune virus, alpha virus, baculovirus, Sindbis virus, vaccinia virus response and/or treatment of a tumor in a Subject. Ideally, a and poliovirus vectors. therapeutically effective amount provides atherapeutic effect Under conditions sufficient for: A phrase that is used to without causing a substantial cytotoxic effect in the Subject. describe any environment that permits a desired activity. In In one example, a desired response is to decrease the size, one example the desired activity is formation of an immune Volume, or number (such as metastases) of a tumor in a complex. In particular examples the desired activity is treat Subject. For example, the agent or agents can decrease the ment of a tumor. size, Volume, or number of tumors by a desired amount, for 25 Vascularization: The amount and type of blood vessels in a example by at least 5%, at least 10%, at least 15%, at least tissue or a cancer. Vascularization can be measured by a 20%, at least 25%, at least 30%, at least 50%, at least 75%, at variety of methods, including histological methods. Tumor least 90%, or at least 95% as compared to a response in the blood vessels have perivascular detachment, vessel dilation, absence of the agent. and irregular shape. It is believed tumor blood vessels are not Several preparations disclosed herein are administered in 30 Smooth like normal tissues, and are not ordered sufficiently to therapeutically effective amounts. A therapeutically effective give oxygen to all of the tissues. If vascularization is “nor amount of an immunogenic TASA peptide, a DLK1 protein, malized it is returned to a form in a normal (wildtype, not a nucleic acid encoding the TASA peptide, a nucleic acid affected by disease), so that it is more ordered and reduced. encoding DLK1 protein, or composition including a plurality Unless otherwise explained, all technical and scientific of immunogenic TASA peptides that is administered to a 35 terms used herein have the same meaning as commonly human or veterinary Subject will vary depending upon a num understood by one of ordinary skill in the art to which this ber of factors associated with that subject, for example the disclosure belongs. The singular terms “a,” “an and “the overall health of the subject. A therapeutically effective include plural referents unless context clearly indicates oth amount of the immunogenic TASA peptide, a DLK1 protein, erwise. Similarly, the word 'or' is intended to include “and” a nucleic acid encoding the TASA peptide, a nucleic acid 40 unless the context clearly indicates otherwise. It is further to encoding DLK1 protein, or composition including a plurality be understood that all base sizes or amino acid sizes, and all of immunogenic polypeptides can be determined by varying molecular weight or molecular mass values, given for nucleic the dosage and measuring the resulting therapeutic response, acids or polypeptides are approximate, and are provided for Such as the regression of a tumor. Therapeutically effective description. Although methods and materials similar or amounts also can be determined through various in vitro, in 45 equivalent to those described herein can be used in the prac Vivo or in situ immunoassays. The disclosed agents can be tice or testing of this disclosure, Suitable methods and mate administered in a single dose, or in several doses, as needed to rials are described below. The term “comprises' means obtain the desired response. However, the therapeutically “includes. All publications, patent applications, patents, and effective amount can be dependent on the Source applied, the other references mentioned herein are incorporated by refer Subject being treated, the severity and type of the condition 50 ence in their entirety. In case of conflict, the present specifi being treated, and the manner of administration. cation, including explanations of terms, will control. In addi Treating or Treatment: A therapeutic intervention (e.g., tion, the materials, methods, and examples are illustrative administration of a therapeutically effective amount of an only and not intended to be limiting. immunogenic TASA peptide or composition including a plu rality of immunogenic polypeptides) that ameliorates a sign 55 Immunogenic TASA Peptides or symptom of a disease or pathological condition related to a disease (such as a tumor). Treatment can also induce remis Isolated polypeptides disclosed herein that include at most sion or cure of a condition, Such as a tumor. In particular twelve amino acids from a tumor associated Stromal cell examples, treatment includes preventing a tumor, for example antigen, such as Protein Delta Homolog 1 (DLK1, SEQ ID by inhibiting the full development of a tumor, such as pre 60 NO: 21), Hemoglobin Subunit Beta (HBB: SEQID NO: 22), venting development of a metastasis or the development of a Neuropilin 1 (NRP1; SEQ ID NO. 23), Tumor Endothelial primary tumor. Prevention does not require a total absence of Marker 1 (TEM1; SEQID NO: 24), EphrinType A Receptor a tumor. 2 (EphA2: SEQID NO: 25), Regulator of G-Protein Signal Reducing a sign or symptom associated with a tumor can ing 5 (RGS5: SEQ ID NO: 26), Platelet Derived Growth be evidenced, for example, by a delayed onset of clinical 65 Factor Receptor B (PDGFRB: SEQ ID NO: 27), melanoma symptoms of the disease in a susceptible Subject (such as a chondroitin sulfate proteoglycan (NG2: SEQ ID NO: 28), Subject having a tumor which has not yet metastasized), a Neuropilin 2 (NRP2; SEQ ID NO: 29), Glutamate Carbox US 9,345,770 B2 23 24 ypeptidase 2, (PSMA; SEQID NO:30), Vascular Endothelial amino acids, at most eleven amino acids, at most ten amino Growth Factor 1 (VEGFR1; SEQ ID NO: 31), Vascular acids or at most nine amino acids, wherein the polypeptide Endothelial Growth Factor Receptor 2 (VEGFR2: SEQ ID includes an amino acid sequence as shown in Table 1. In other NO:32). These polypeptides include an antigenic determi embodiments, an immunogenic TASA peptide comprises or consists of DLK1ss (CPPGFSGNF, SEQ ID NO: 65), nant from a TASA and are immunogenic, and thus can be used DLK1 (GFSGNFCEI, SEQID NO: 66), or at least 9, to induce an immune response in a subject. 10, 11 or 12 amino acids of DLK12so-27o and/or DLK1262-27o The isolated TASA peptides, can be chemically synthe (TILGVLTSLVVL, SEQ ID NO: 67 includes both of these sized by standard methods. If desired, polypeptides can also epitopes). These immunogenic DLK1 peptides can be used be chemically synthesized by emerging technologies. One 10 individually. However, a combination of two or more of these such process is described in W. Lu et al., Federation of Euro DLK1 peptides can be utilized. In additional embodiments, pean Biochemical Societies Letters. 429:31-35, 1998. the immunogenic TASA peptides includes at most twelve Polypeptides can also be produced using molecular genetic amino acids, at most eleven amino acids, at most ten amino techniques, such as by inserting a nucleic acid encoding a acids or at most nine amino acids of an amino acid sequence TASA peptide oran epitope thereof into an expression vector, 15 as shown in Table 1. These TASA peptides can be used indi introducing the expression vector into a host cell, and isolat vidually or in combination. ing the polypeptide (see below). In several embodiments, the amino acid at position 2 of the The immunogenic TASA peptides include at most twelve immunogenic TASA peptide is substituted for a valine resi amino acids, such as nine, ten, eleven or twelve consecutive due. In additional embodiments, the amino acid at position 9 amino acids of a TASA. For example, in some embodiments, of the immunogenic TASA peptide is substituted for a leucine the immunogenic TASA peptides includes at most twelve residue. TABLE 1.

Immunogenic TASA Peptides.

TASA Accession AA SEO ID Protein No. * TASA Peptide Positions NO.

DLK1. NP_003827.3 RLTPGVHEX, wherein X is a leucine or a valine 269-277 1. ILGWLTSLW 31O-318 2 FLNKCETWV 326-334 3

HBB CAG4 671.1.1 RLLVVYPWX wherein X is a threonine or a valine 31-39 4. RLLGNVLVXV wherein X is a cysteine or a valine 105-114 5

NRP1 CAI16997.1 GLLRFWTAW 331-339 6 GXLGMVSGL wherein X is a leucine or a 433 - 441 methionine WLLGAWCGW 869-877 8

TEM1 AAGOO867.1 LLVPTCVFXV wherein Xs is a leucine or a valine 691 - 7 OO 9

Eph A2 NP_004422.2 TLADFDPRW 883-891 O

RGS5 AAB84 OO1.1 LXALPHSCL wherein X is a leucine or an alanine 5-13 1.

PDGFRB AAA60049. 1 ILLWEIFTX, wherein X, is L or V 890-898 2

NG2 AAQ62842 XLSNLSFPV wherein X is I or T 77O-778 LILPLLFYL 2238-2246

NRP2 NP 957718. 1 DIWDGIPHV 214-222 5 YLOWDLRFL 328-336 NMLGMLSGL 436 - 444 7

PSMA NP_004467.1 LLOERGWAYI 441 - 450 8

VEGFR1 NP 002010. 2 TLFWLLLTL 77O-778 9

VEGFR2 NP_002244.1 VIAMFFWLL 773-781 2O

* Accession No. NP OO3827.3 incorporated by reference here in as of Sep. 11, 2011; Accession No. CAG4671.1.1 incorporated by reference herein as of Oct. 16, 2008; Accession No. CAI16997. 1 incorporated by reference herein as of Jan. 13, 2009; Accession No. AAGOO867. 1 incorporated by reference herein as of Aug. 23, 2000; Accession No. NP OO4422. 2 incorporated by reference herein as of Aug. 13, 2011; Accession No. AAB84001. 1 incorporated by reference herein as of Nov. 8, 1997; Accession No. AAA60049. 1 incorporated by reference here in as of Jan. 7, 1995; Accession No. NP 957718. 1 incorporated by reference here in as of Aug. 21, 2011; Accession No. NP OO4467. 1 incorporated by reference herein as of Sep. 24, 2011; Accession No. NP OO 2010. 2 incorporated by reference herein as of Sep. 25, 2011; Accession No. NP 00 2244. 1 incorporated by reference herein as of Sep. 25, 2011. US 9,345,770 B2 25 26 Without being bound by theory, it is believed that the a threonine (T). In other embodiments, amino acid X is a presentation of peptides by MHC Class I molecules involves valine (V). In one example the polypeptide consists of the binding to the cleft in an MHC Class I molecule through the amino acid sequence set forth as SEQID NO: 4. Thus, in one anchor residues of the peptide and ultimate presentation on example, the polypeptide consists of SEQID NO: 4, wherein the cell Surface. Depending upon the particular anchor resi 5 amino acid X is a valine (V), and in another example the dues, among other things, certain peptides can bind more polypeptide consists of SEQID NO: 4, wherein amino acid tightly to particular HLA molecules than others. Peptides that X is a threonine (T). bind well are usually "dominant' epitopes, while those that In still other examples, an isolated polypeptide includes at bind less well are often “subdominant’ or "cryptic' epitopes. most 9, 10, 11 or 12 amino acids from HBB, wherein the Dominant epitopes of either self proteins or foreign proteins 10 polypeptide includes an amino acid sequence set forth as evoke strong tolerance or immune responses. Subdominant or RLLGNVLVXV (SEQID NO: 5) wherein X is a cysteine cryptic epitopes generate weak responses or no responses at (C) or a valine (V). In additional embodiments amino acid X. all. Without being bound by theory, tighter binding by domi is a cysteine (C). In other embodiments, amino acid X is a nant epitopes to HLA molecules results in their denser pre valine (V). In one example the polypeptide consists of the sentation on the cell Surface, greater opportunity to react with 15 amino acid sequence set forth as SEQID NO: 5. Thus, in one immune cells and greater likelihood of eliciting an immune example, the polypeptide consists of SEQID NO: 5, wherein response or tolerance. MHC Class I molecules present amino acid X is a valine (V), and in another example the epitopes from endogenous proteins for presentation to CTL polypeptide consists of SEQID NO: 5, wherein amino acid cells. HLAA, HLAB and HLAC molecules bind peptides of X is a cysteine (C). about eight to ten amino acids in length (Such as nine amino In some examples, an isolated polypeptide includes at most acids in length) that have particular anchoring residues. The 9, 10, 11 or 12 amino acids from NRP1, wherein the polypep anchoring residues recognized by an HLA Class I molecule tide includes an amino acid sequence set forth as GLLR depend upon the particular allelic form of the HLA molecule. FVTAV (SEQ ID NO: 6). In one example the polypeptide A CD8+ T cell bears T cell receptors that recognize a specific consists of the amino acid sequence set forth as SEQID NO: epitope when presented by a particular HLA molecule on a 25 6. cell. When a CTL precursor that has been stimulated by an In additional examples, an isolated polypeptide includes at antigen presenting cell to become a cytotoxic T lymphocyte 9, 10, 11 or 12 twelve amino acids from NRP1, wherein the contacts a cell that bears such an HLA-peptide complex, the polypeptide includes an amino acid sequence set forth as CTL forms a conjugate with the cell and destroys it. In several GXLGMVSGL (SEQID NO: 7) wherein X is a leucine (L) examples presented herein, the immunogenic TASA peptides 30 or a methionine (M). In still other embodiments, amino acid that are disclosed bind and are presented by HLA-A2. X is a leucine (L). In other embodiments, amino acid X is a Thus, in some examples, an isolated polypeptide includes methionine (M). In one example the polypeptide consists of at most 9, 10, 11 or 12 amino acids from DLK1, wherein the the amino acid sequence set forth as SEQID NO: 7. Thus, in polypeptide includes an amino acid sequence set forth as one example, the polypeptide consists of SEQ ID NO: 7. RLTPGVHEX (SEQID NO: 1) wherein X is a leucine (L) 35 wherein amino acid X is a methionine (M), and in another or a valine (V). In some embodiments amino acid X is a example the polypeptide consists of SEQID NO: 7, wherein leucine (L). In other embodiments, amino acid X is a valine amino acid X is a leucine (L). (V). In one example the polypeptide consists of the amino In further examples, an isolated polypeptide includes at acid sequence set forth as SEQ ID NO: 1. Thus, in one most 9, 10, 11 or 12 amino acids from NRP1, wherein the example, the polypeptide consists of SEQID NO: 1, wherein 40 polypeptide includes an amino acid sequence set forth as amino acid X is a valine (V). In another example the VLLGAVCGV (SEQID NO:8). In one example the polypep polypeptide consists of SEQID NO: 1, wherein amino acid tide consists essentially of the amino acid sequence set forth X is a leucine (L). as SEQID NO: 8. In additional examples, the polypeptide is In other examples, an isolated polypeptide includes at most eleven amino acids in length, ten amino acids in length or nine 9, 10, 11 or 12 amino acids from DLK1, wherein the polypep 45 amino acids in length. In further examples, the isolated tide includes an amino acid sequence set forth as ILGV polypeptide consists of the amino acid sequence set forth as LTSLV (SEQ ID NO: 2). In one example the polypeptide SEQID NO: 8. consists of the amino acid sequence set forth as SEQID NO: In other examples, an isolated polypeptide includes at most 2. 9, 10, 11 or 12 amino acids from TEM1, wherein the polypep In additional examples, an isolated polypeptide includes at 50 tide includes an amino acid sequence set forth as most 9, 10, 11 or 12 amino acids from DLK1, wherein the LLVPTCVFXV (SEQID NO:9) wherein X is a leucine (L) polypeptide includes an amino acid sequence set forth as or a valine (V). In some embodiments, amino acid Xs is a FLNKCETWV (SEQ ID NO: 3). In one example the leucine (L). In other embodiments, amino acid X is a valine polypeptide consists of the amino acid sequence set forth as (V). In one example the polypeptide consists of the amino SEQID NO:3. 55 acid sequence set forth as SEQ ID NO: 9. Thus, in one In yet other examples, an isolated polypeptide that includes example, the polypeptide consists of SEQID NO:9, wherein an isolated polypeptide includes at most 9, 10, 11 or 12 amino amino acid Xs is a valine (V), and in another example the acids from DLK1, wherein the polypeptide includes one of polypeptide consists of SEQID NO: 9, wherein amino acid SEQ DI NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67. In Xs is a leucine (L). several examples, the polypeptide consists of the amino acid 60 In additional examples, an isolated polypeptide includes at sequence set forth as one of SEQID NO: 65, SEQID NO: 66 most 9, 10, 11 or 12 amino acids from EphA2, wherein the or SEQ ID NO: 67. polypeptide includes an amino acid sequence set forth as In further examples, an isolated polypeptide includes at TLADFDPRV (SEQ ID NO: 10). In one example the most 9, 10, 11 or 12 amino acids from HBB, wherein the polypeptide consists of the amino acid sequence set forth as polypeptide includes an amino acid sequence set forth as 65 SEQID NO: 10. RLLVVYPWX (SEQ ID NO: 4) wherein X is a threonine In some examples, an isolated polypeptide includes at most (T) or a valine (V). In further embodiments amino acid X is 9, 10, 11 or 12 amino acids from RGS5, wherein the polypep US 9,345,770 B2 27 28 tide includes an amino acid sequence set forth as protein can include an immunogenic TASA peptide and a LXALPHSCL (SEQID NO: 11) wherein X is a leucine (L) second heterologous moiety, Such as a myc protein, an or analanine (A). In further embodiments, amino acid X is a enzyme or a carrier (Such as a hepatitis carrier protein or leucine (L). In other embodiments, amino acid X is an ala bovine serum albumin) covalently linked to the immunogenic nine (A). In one example the polypeptide consists of the TASA peptide. A second heterologous moiety can be amino acid sequence set forth as SEQID NO: 11. Thus, in one covalently or non-covalently linked to the immunogenic example, the polypeptide consists of SEQ ID NO: 11, TASA peptide. wherein amino acid X is an alanine (A), and in another In additional embodiments, the immunogenic TASA pep example the polypeptide consists of SEQID NO: 11, wherein tides can be included in a fusion protein and can also include 10 heterologous sequences. Thus, in several specific non-limit amino acid X is a leucine (L). ing examples, one or more of the immunogenic TASA pep In other examples, an isolated polypeptide includes at most tides are included in a fusion polypeptide, for example a 9, 10, 11 or 12 amino acids from PDGFRB, wherein the fusion of an immunogenic TASA peptide with six sequential polypeptide includes an amino acid sequence set forth as histidine residues, a B-galactosidase amino acid sequence, or ILLWEIFTX, (SEQIDNO: 12) wherein X, is a leucine(L) or 15 an immunoglobulin amino acid sequence. The immunogenic a valine (V). In some embodiments, amino acid X, is a leucine TASA peptides can also be covalently linked to a carrier. (L). In other embodiments, amino acid X, is a valine (V). In Suitable carriers include, but are not limited to, a hepatitis B one example the polypeptide consists of the amino acid Small envelope protein HBSA.g. This protein has the capacity sequence set forth as SEQID NO: 12. Thus, in one example, to self assemble into aggregates and can form viral-like par the polypeptide consists of SEQID NO: 12, wherein amino ticles. The preparation of HBS Agis well documented, see for acid X, is a valine (V), and in another example the polypep example European Patent Application Publication No. EP tide consists of SEQID NO: 12, wherein amino acid X, is a A-0 226 846, European Patent Application Publication No. leucine (L). EP-A-0 299 108 and PCT Publication No. WO 01/117554, and the amino acid sequence disclosed, for example, in Tiol TABL E A 25 lais et al., Nature, 317:489, 1985, and European Patent Pub The followind lists certain TASA peptides : lication No. EP-A-0 278 940, and PCT Publication No. WO 91/14703, all of which are incorporated herein by reference. TASA The fusion polypeptide can optionally include repetitions Protein TASA Peptide SEO ID NO of one or more of any of the immunogenic TASA peptides DLK1. RLTPGWHEL 68 30 disclosed herein. In one specific, non-limiting example, the RLTPGWHEW 69 fusion polypeptide includes two, three, four, five, or up to ten ILGWLTSLW 2 repetitions of an immunogenic TASA peptide. In another FLNKCETWV 3 example, the fusion polypeptide can optionally include two or HBB RLLWWYPWT 70 more different immunogenic TASA peptides disclosed RLLWWYPWW 71. 35 herein, for example an immunogenic DLK1 peptide and an RLLGNWLWCW 72 immunogenic TEM1 peptide. In one specific, non-limiting RLLGNWLWWW 73 example, the fusion polypeptide includes two, three, four, NRP1 GLLRFWTAW 6 five, or up to ten different immunogenic TASA peptides. A GLLGMWSGL 74 linker sequence can optionally be included between the GMLGMWSGL 7s 40 immunogenic TASA peptides. In all of these examples, the WLLGAWCGW 8 polypeptide does not include the full-length TASA amino TEM1 LLWPTCWFLW 76 acid sequence. LLWPTCVVV 77 In Some embodiments, two or more different immunogenic EphA2 TLADFDPRW 10 TASA peptides can be included on a polypeptide. Such as an 45 immunogenic molecule. For example, 2-20 or more different RGSS LLALPHSCL 78 immunogenic TASA peptides can be included in the polypep LAALPHSCL 79 tide, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more different immunogenic TASA peptides. PDGFRB ILLWEIFTW 8O ILLWEIFTL 81 The different immunogenic TASA peptides can be separated 50 by peptide linkers. In some examples, several copies of the NG2 ILSNLSFPW 82 same immunogenic TASA peptide can be included in a TLSNLSFPW 83 polypeptide. Such as an immunogenic molecule. For example LILPLLFYL 14 a repeat of a immunogenic TASA peptide in series. In some NRP2 DIWDGIPHW 15 examples, two, three, four, five or more copies of the same YLOVDLRFL 16 55 immunogenic TASA peptide are included in an polypeptide. NMLGMLSGL 17 In examples wherein two or more immunogenic TASA pep tide are included on a polypeptide, the immunogenic TASA PSMA LLOERGWAYI 18 peptides can be separated by peptide linkers. WEGFR1 TIFWLLLTL 19 In additional embodiments, a plurality of the immunogenic 60 TASA peptides described above is included in a composition. WEGFR2 WIAMFFWLL 2O In one embodiment, the composition includes a plurality of immunogenic TASA peptides, wherein each immunogenic In several embodiments, an immunogenic TASA peptide is TASA peptide in the plurality is at most twelve amino acids in included in a fusion protein. For example, each of the immu length, wherein the plurality of peptides includes at least two nogenic TASA peptides included in a composition including 65 different immunogenic TASA peptides. Thus the composi a plurality of immunogenic TASA peptides (described tion can include 2, 3, 4, 5, 6, 7, 8, 9, 10 or more of the herein) can be in the form of a fusion protein. Thus, the fusion immunogenic TASA peptides disclosed in Table 1. In some US 9,345,770 B2 29 30 embodiments, the composition includes 2, 3, 4, 5, 6 or 7 Table 1, and a polypeptide consisting of an amino acid immunogenic peptides each from a different TASA. In other sequence as shown for one of the PDGFRB polypeptides embodiments, the composition includes 2, 3, 4, 5, 6, 7, 8, 9 or listed in Table 1. In some Such embodiments, each polypep 10 immunogenic peptides from 2, 3, 4, 5 or 6 different tide in the plurality of polypeptides is nine, ten, eleven or TASAS. twelve amino acids in length. Compositions including a plurality of immunogenic TASA In some embodiments, a composition is provided includ peptides described herein can include varying concentrations ing a plurality of immunogenic TASA peptides including a of different concentrations of each immunogenic TASA pep peptide comprising an amino acid sequence set forth as SEQ tide in the plurality of immunogenic TASA peptides. For ID NO: 1, a peptide comprising an amino acid sequence set example, in some embodiments, the composition includes 10 forth as SEQ ID NO: 2 and a peptide comprising an amino two, three, for, five, six, or seven different types of immuno acid sequence set forth as SEQ ID NO:3. In other embodi genic TASA peptide in an equimolar ratio. In other examples, ments, a composition is provided including a plurality of the composition includes two, three, for, five, six, or seven immunogenic TASA peptides including a peptide comprising different types of immunogenic TASA peptide in a non an amino acid sequence set forth as SEQ ID NO. 4 and a equimolar ratio. 15 peptide comprising an amino acid sequence set forth as SEQ In some embodiments, the composition includes immuno ID NO: 5. In still other embodiments, a composition is pro genic peptides from DLK1, HBB, NRP1 and TEM1. In other vided including a plurality of immunogenic TASA peptides embodiments, the composition includes immunogenic pep including a peptide comprising an amino acid sequence set tides from DLK1, HBB, NRP1,TEM1, EphA2 and RGS5. In forth as SEQID NO: 6, a peptide comprising an amino acid still other embodiments, the composition includes immuno sequence set forth as SEQID NO: 7 and a peptide comprising genic peptides from DLK1, HBB, NRP1, TEM1, EphA2, an amino acid sequence set forth as SEQID NO: 8. In some RGS5 and PDGFRB. Such embodiments, each polypeptide in the plurality of In some embodiments, a composition is provided includ polypeptides is nine, ten, eleven or twelve amino acids in ing a plurality of immunogenic TASA peptides, wherein each length. immunogenic TASA peptide in the plurality is at most twelve 25 In some embodiments, a composition is provided includ amino acids in length, wherein the plurality of immunogenic ing a plurality of immunogenic TASA peptides including a TASA peptides includes at least one polypeptide including an DLK1 polypeptide comprising an amino acid sequence set amino acid sequence as shown for one of the DLK1 peptides forth as FLNKCETWV (SEQID NO:3), a HBB polypeptide listed in Table 1, at least one polypeptide including an amino comprising an amino acid sequence set forth as RLLV acid sequence as shown for one of the HBB peptides listed in 30 VYPWX (SEQID NO: 4) wherein X is a threonine (T), a Table 1, at least one polypeptide including an amino acid NRP1 polypeptide comprising an amino acid sequence set sequence as shown for one of the NRP1 peptides listed in forth as VLLGAVCGV (SEQIDNO:8), a TEM1 polypeptide Table 1, and at least one polypeptide including an amino acid comprising an amino acid sequence set forth as sequence as shown for one of the TEM1 peptides listed in LLVPTCVFXV (SEQID NO:9) whereinX is a leucine(L), Table 1. In some such embodiments, the plurality of polypep 35 an EphA2 polypeptide comprising an amino acid sequence tides further includes at least one polypeptide including an set forth as TLADFDPRV (SEQ ID NO: 10), a RGS5 amino acid sequence as shown for the EphA2 peptide listed in polypeptide comprising an amino acid sequence set forth as Table 1, and at least one polypeptide including an amino acid LXALPHSCL (SEQ ID NO: 11) wherein X is an alanine sequence as shown for one of the RGS5 peptides listed in (A), a PDGFRB polypeptide comprising an amino acid Table 1. In still more embodiments, the plurality of polypep 40 sequence set forth as ILLWEIFTX, (SEQ ID NO: 12) tides further includes at least one polypeptide including an wherein X7 is a leucine (L). In some Such embodiments, each amino acid sequence as shown for the EphA2 peptide listed in polypeptide in the plurality of polypeptides is at least nine, at Table 1, at least one polypeptide including an amino acid least ten, at least eleven or at least twelve amino acids in sequence as shown for one of the RGS5 peptides listed in length. Table 1, and at least one polypeptide including an amino acid 45 In some embodiments, a composition is provided includ sequence as shown for one of the PDGFRB peptides listed in ing a plurality of immunogenic TASA peptides, wherein the Table 1. In some such embodiments, each polypeptide in the plurality of immunogenic TASA peptides includes a DLK1 plurality of polypeptides is nine, ten, eleven or twelve amino polypeptide consisting of an amino acid sequence set forth as acids in length. FLNKCETWV (SEQID NO:3), a HBB polypeptide consist In some embodiments, a composition is provided includ 50 ing of an amino acid sequence set forth as RLLVVYPWX ing a plurality of immunogenic TASA peptides including a (SEQ ID NO: 4) wherein X is a threonine (T), a NRP1 polypeptide consisting of an amino acid sequence as shown polypeptide consisting of an amino acid sequence set forth as for one of the DLK1 peptides listed in Table 1, a polypeptide VLLGAVCGV (SEQ ID NO: 8) and a TEM1 polypeptide consisting of an amino acid sequence as shown for one of the consisting of an amino acid sequence set forth as HBB peptides listed in Table 1, a polypeptide consisting of an 55 LLVPTCVFXV (SEQID NO:9) whereinX is a leucine(L). amino acid sequence as shown for one of the NRP1 peptides In some embodiments, the composition further includes an listed in Table 1, and a polypeptide consisting of an amino EphA2 polypeptide consisting of an amino acid sequence set acid sequence as shown for one of the TEM1 peptides listed forth as TLADFDPRV (SEQ ID NO: 10) and a RGS5 in Table 1. In some embodiments, the composition further polypeptide consisting of an amino acid sequence set forth as includes a polypeptide consisting of an amino acid sequence 60 LXALPHSCL (SEQ ID NO: 11) wherein X is an alanine as shown for the EphA2 peptide listed in Table 1, and a (A). In some embodiments, the composition further includes polypeptide consisting of an amino acid sequence as shown an EphA2 polypeptide consisting of an amino acid sequence for one of the RGS5 peptides listed in Table 1. In still more set forth as TLADFDPRV (SEQ ID NO: 10), a RGS5 embodiments, the composition further includes a polypeptide polypeptide consisting of an amino acid sequence set forth as consisting of an amino acid sequence as shown for the Eph A2 65 LXALPHSCL (SEQ ID NO: 11) wherein X is an alanine peptide listed in Table 1, a polypeptide consisting of an amino (A) and a PDGFRB polypeptide consisting of an amino acid acid sequence as shown for one of the RGS5 peptides listed in sequence set forth as ILLWEIFTX (SEQ ID NO: 12) US 9,345,770 B2 31 32 wherein X7 is a leucine (L). In some such embodiments, each DLK1 proteins or polypeptides that are linked to a carrier polypeptide in the plurality of polypeptides is at least nine, at are also of use in the disclosed methods. Generally, a carrier least ten, at least eleven or at least twelve amino acids in is an immunogenic macromolecule to which an antigenic length. molecule can be bound. When bound to a carrier, the bound The immunogenic TASA peptides can be covalently linked 5 DLK1 protein or DLK1 polypeptide becomes more immuno to a carrier, which is an immunogenic macromolecule to genic. Carriers are chosen to increase the immunogenicity of which an antigenic molecule can be bound. When bound to a the bound molecule and/or to elicit higher titers of antibodies carrier, the bound polypeptide becomes more immunogenic. against the carrier which are diagnostically, analytically, and/ Carriers are chosen to increase the immunogenicity of the or therapeutically beneficial. Covalent linking of a molecule bound molecule and/or to elicit higher titers of antibodies 10 to a carrier can confer enhanced immunogenicity and T cell against the carrier which are diagnostically, analytically, and/ dependence (see Pozsgay et al., PNAS96:5194-97, 1999; Lee or therapeutically beneficial. Covalent linking of a molecule et al., J. Immunol. 116:1711-18, 1976; Dintzis et al., PNAS to a carrier can confer enhanced immunogenicity and T cell 73:3671-75, 1976). Useful carriers include polymeric carri dependence (see Pozsgay et al., PNAS96:5194-97, 1999; Lee ers, which can be natural (for example, polysaccharides, et al., J. Immunol. 116:1711-18, 1976; Dintzis et al., PNAS 15 polypeptides or proteins from bacteria or viruses), semi-syn 73:3671-75, 1976). Useful carriers include polymeric carri thetic or synthetic materials containing one or more func ers, which can be natural (for example, polysaccharides, tional groups to which a reactant moiety can be attached. polypeptides or proteins from bacteria or viruses), semi-syn Bacterial products and viral proteins (such as hepatitis B thetic or synthetic materials containing one or more func Surface antigen and core antigen) can also be used as carriers, tional groups to which a reactant moiety can be attached. as well as proteins from higher organisms such as keyhole Bacterial products and viral proteins (such as hepatitis B limpet hemocyanin, horseshoe crab hemocyanin, edestin, Surface antigen and core antigen) can also be used as carriers, mammalian serum albumins, and mammalian immunoglobu as well as proteins from higher organisms such as keyhole lins. Suitable carriers include, but are not limited to, a hepa limpet hemocyanin, horseshoe crab hemocyanin, edestin, titis B small envelope protein HBs.Ag. This protein has the mammalian serum albumins, and mammalian immunoglobu 25 capacity to self-assemble into aggregates and can form viral lins. Additional bacterial products for use as carriers include like particles. The preparation of HBS Agis well documented, bacterial wall proteins and other products (for example, Strep see for example European Patent Application Publication No. tococcal or staphylococcal cell walls and lipopolysaccharide EP-A-0 226 846, European Patent Application Publication (LPS)). No. EP-A-0 299 108 and PCT Publication No. WO 30 01/117554, and the amino acid sequence disclosed, for Protein Delta Homolog 1 (DLK1) example, in Tiolais et al., Nature, 317: 489, 1985, and Euro pean Patent Publication No. EP-A-0 278 940, and PCT Pub In some embodiments, the methods disclosed herein utilize lication No. WO 91/14703, all of which are incorporated DLK1 protein, or a nucleic acid encoding DLK1 protein. An herein by reference. exemplary DLK1 protein is set forth as SEQID NO: 21, see 35 In other embodiments, only the DLK1 protein or polypep also GENBANKR Accession No. NP 003827.3, incorpo tide is utilized. Thus, a second heterologous moiety is non rated herein by reference, and GENBANKR Accession No. covalently linked to the DLK1 protein or polypeptide. NM_003836.5 (Sep. 23, 2012), incorporated herein by refer ence. In some embodiments, the DLK1 protein is at least Nucleotides, Expression Vectors and Host Cells about 80%, at least about 85%, at least about 90%, at least 40 about 91%, at least about 92%, at least about 93%, at least Nucleic acids encoding one or more of the immunogenic about 94%, at least about 95%, at least about 96%, at least TASA peptides, or encoding DLK1 protein, are provided. about 97%, at least about 98%, at least about 99% identical to These polynucleotides include DNA, cDNA and RNA SEQID NO: 21. Human DLK1 has very high homology with sequences which encode the polypeptide(s) of interest. DLK1 from other animal species and therefore, the sequences 45 Nucleic acid molecules encoding these peptides can readily of DLK1 from other organisms can be utilized, particularly be produced by one of skill in the art, using the amino acid where these sequences are identical, Substantially homolo sequences provided herein, and the genetic code. In addition, gous, and elicit an effective immune response against the one of skill can readily construct a variety of clones contain target antigen (e.g., native DLK1 expressed by a cell). Addi ing functionally equivalent nucleic acids, such as nucleic tional exemplary DLK1 proteins include at most 10, at most 50 acids which differ in sequence but which encode the same 9, at most 8, at most 7, at most 6, at most 5, at most 4, at most effector molecule, detectable marker or antibody sequence. 3, at most 2 or at most 1 conservative amino acid Substitutions An exemplary nucleic acid sequence encoding a DLK1 pro in SEQID NO: 21. The methods disclosed herein can utilize tein is provided in GENBANKR Accession No. protein fragments of DLK1 protein, such as 100, 150, 200, NM_003836.5 (Sep. 23, 2012, incorporated herein by refer 250, 300, 350 or 380 amino acids of a DLK1 protein. 55 ence). In several embodiments, the isolated DLK1 protein or Nucleic acid sequences encoding one or more of the immu polypeptide is included in a fusion protein. Thus, the fusion nogenic TASA peptides can be prepared by any Suitable protein can include the DLK1 protein or DLK1 polypeptide method including, for example, cloning of appropriate (see above) and a second heterologous moiety, such as a myc sequences or by direct chemical synthesis by methods such as protein, an enzyme or a carrier (Such as a hepatitis carrier 60 the phosphotriester method of Narang et al., Meth. Enzymol. protein or bovine serum albumin) covalently linked to the 68:90-99, 1979; the phosphodiester method of Brown et al., DLK1 protein or polypeptide. Thus, in several specific non Meth. Enzymol. 68:109-151, 1979; the diethylphosphoramid limiting examples, the fusion protein includes a DLK1 pro ite method of Beaucage et al., Tetra. Lett. 22:1859-1862, tein and six sequential histidine residues, a B-galactosidase 1981; the solid phase phosphoramidite triester method amino acid sequence, and/or an immunoglobulin amino acid 65 described by Beaucage & Caruthers, Tetra. Letts. 22(20): sequence. However, in other embodiments, the DLK1 is not 1859-1862, 1981, for example, using an automated synthe fused to a heterologous moiety. sizer as described in, for example, Needham-VanDevanter et US 9,345,770 B2 33 34 al., Nucl. Acids Res. 12:6159-6168, 1984; and, the solid Sup viral and plasmid DNA vectors capable of expression and port method of U.S. Pat. No. 4.458,066. Chemical synthesis replication in a host are known in the art. produces a single stranded oligonucleotide. This can be con Transformation of a host cell with recombinant DNA may verted into double stranded DNA by hybridization with a be carried out by conventional techniques as are well known complementary sequence, or by polymerization with a DNA to those skilled in the art. Where the host is prokaryotic, such polymerase using the single Strand as a template. as E. coli, competent cells which are capable of DNA uptake Exemplary nucleic acids including sequences encoding can be prepared from cells harvested after exponential growth one or more of the immunogenic TASA peptides can be phase and Subsequently treated by the CaCl2 method using prepared by cloning techniques. Examples of appropriate procedures well known in the art. Alternatively, MgCl, or 10 RbCl can be used. Transformation can also be performed after cloning and sequencing techniques, and instructions suffi forming a protoplast of the host cell if desired, or by elec cient to direct persons of skill through cloning are found in troporation. Sambrook et al., Supra, Berger and Kimmel (eds.), Supra, and When the host is a eukaryote, such methods of transfection Ausubel, supra. Product information from manufacturers of of DNA as calcium phosphate coprecipitates, conventional biological reagents and experimental equipment also provide 15 mechanical procedures Such as microinjection, electropora useful information. Such manufacturers include the SIGMA tion, insertion of a plasmid encased in liposomes, or virus Chemical Company (Saint Louis, Mo.), R&D Systems (Min vectors may be used. Eukaryotic cells can also be cotrans neapolis, Minn.), Pharmacia Amersham (Piscataway, N.J.), formed with polynucleotide sequences encoding one or more CLONTECH Laboratories, Inc. (Palo Alto, Calif.), Chem of the immunogenic TASA peptides, and a second foreign Genes Corp., Aldrich Chemical Company (Milwaukee, DNA molecule encoding a selectable phenotype. Such as the Wis.), Glen Research, Inc., GIBCO BRL Life Technologies, herpes simplex thymidine kinase gene. Another method is to Inc. (Gaithersburg, Md.), Fluka Chemica-Biochemika Ana use a eukaryotic viral vector, such as simian virus 40 (SV40) lytika (Fluka Chemie AG, Buchs, Switzerland), Invitrogen or bovine papilloma virus, to transiently infect or transform (San Diego, Calif.), and Applied Biosystems (Foster City, eukaryotic cells and express the one or more of the immuno Calif.), as well as many other commercial Sources known to 25 genic TASA peptides (see for example, Eukaryotic Viral Vec one of skill. tors, Cold Spring Harbor Laboratory, Gluzman ed., 1982). Nucleic acids can also be prepared by amplification meth One of skill in the art can readily use expression systems such ods. Amplification methods include polymerase chain reac as plasmids and vectors of use in producing proteins in cells tion (PCR), the ligase chain reaction (LCR), the transcription including higher eukaryotic cells such as the COS, CHO, based amplification system (TAS), the self-sustained 30 HeLa and myeloma cell lines. sequence replication system (3SR). A wide variety of cloning In some embodiments, one or more polynucleotides methods, host cells, and invitro amplification methodologies encoding one or more immunogenic TASA peptides are are well known to persons of skill. included in one or more viral vectors. Examples of suitable Once the nucleic acids encoding one or more of the immu viral vectors include retrovirus vectors, pox vectors, adenovi nogenic TASA peptides are isolated and cloned, the protein 35 ral vectors, herpes virus vectors, alpha virus vectors, bacu can be expressed in a recombinantly engineered cell Such as lovirus vectors, Sindbis virus vectors, vaccinia virus vectors bacteria, plant, yeast, insect and mammalian cells using a and poliovirus vectors. Basic techniques for preparing recom suitable expression vector. One or more DNA sequences binant DNA viruses containing a heterologous DNA encoding one or more immunogenic TASA peptide can be sequence are known in the art. Such techniques involve, for expressed in vitro by DNA transfer into a suitable host cell. 40 example, homologous recombination between the viral DNA The cell may be prokaryotic or eukaryotic. The term also sequences flanking the DNA sequence in a donor plasmid and includes any progeny of the Subject host cell. It is understood homologous sequences present in the parental virus (Mackett that all progeny may not be identical to the parental cell since et al., 1982, Proc. Natl. Acad. Sci. USA 79:7415-7419). there may be mutations that occur during replication. Meth Viral vectors can be prepared encoding one or more of the ods of stable transfer, meaning that the foreign DNA is con 45 immunogenic TASA peptides. A number of viral vectors have tinuously maintained in the host, are known in the art. been constructed, including polyoma, SV40 (Madzak et al., J. Polynucleotide sequences encoding one or more of the Gen. Virol.., 73:15331536, 1992), adenovirus (Berkner, Cur. immunogenic TASA peptides, can be operatively linked to Top. Microbiol. Immunol., 158:39-6, 1992; Berlineret al., Bio expression control sequences (e.g., a promoter). An expres Techniques, 6:616-629, 1988: Gorziglia et al., J. Virol., sion control sequence operatively linked to a coding sequence 50 66:4407-4412, 1992: Quantin et al., Proc. Nad. Acad. Sci. is ligated Such that expression of the coding sequence is USA, 89:2581-2584, 1992: Rosenfeld et al., Cell, 68:143-155 achieved under conditions compatible with the expression 1992; Wilkinson et al., Nucl. Acids Res., 20:2233-2239, 1992: control sequences. The expression control sequences include, Stratford-Perricaudet et al., Hum. Gene Ther:, 1:241-256, but are not limited to appropriate promoters, enhancers, tran 1990), vaccinia virus (Mackett et al., Biotechnology, 24:495 Scription terminators, a start codon (i.e., ATG) in front of a 55 499, 1991), adeno-associated virus (Muzyczka, Curr. Top. protein-encoding gene, splicing signal for introns, mainte Microbiol. Immunol., 158:91-123, 1992: On et al., Gene, nance of the correct reading frame of that gene to permit 89:279-282, 1990), herpes viruses including HSV and EBV proper translation of mRNA, and stop codons. (Margolskee, Curr: Top. Microbiol. Immunol., 158:67-90, The polynucleotide sequences encoding one or more of the 1992; Johnson et al., J. Virol. 66:29522965, 1992: Finket al., immunogenic TASA peptides can be inserted into an expres 60 Hum. Gene Ther, 3:11-19, 1992: Breakfield et al., Mol. Neu sion vector including, but not limited to a plasmid, virus or robiol. 1:337-371, 1987; Fresse et al., Biochem. Pharmacol., other vehicle that can be manipulated to allow insertion or 40:2189-2199, 1990), Sindbis viruses (Herweijer et al., incorporation of sequences and can be expressed in either Human Gene Therapy, 6:1161-1167, 1995: U.S. Pat. Nos. prokaryotes or eukaryotes. Hosts can include microbial, 5,091,309 and 5.2217.879), alphaviruses (Schlesinger, yeast, insect and mammalian organisms. Methods of express 65 Trends Biotechnol., 11:18-22, 1993; Frolov et al., Proc. Natl. ing DNA sequences having eukaryotic or viral sequences in Acad. Sci. USA, 93:11371-11377, 1996) and retroviruses of prokaryotes are well known in the art. Biologically functional avian (Brandyopadhyay et al., Mol. Cell Biol., 4:749-754, US 9,345,770 B2 35 36 1984; Petropouplos et al., J. Virol., 66:3391-3397, 1992), plurality of nucleic acids), polynucleotides encoding Such murine (Miller, Curr: Top. Microbiol. Immunol., 158:1-24, peptides and vectors comprising the polynucleotides, can be 1992; Milleret al., Mol. Cell Biol., 5:431-437, 1985; Sorge et used in methods of generating an immune response, treating al., Mol. Cell Biol. 4:1730-1737, 1984; Mann et al., J. Virol., a Subject with cancer and decreasing the growth of a tumor 54:401–407, 1985), and human origin (Page et al., J. Virol., associated stromal cell, as described below. In several 64:5370-5276, 1990; Buchschalcher et al., J. Virol. 66:2731 examples, the Subject has a tumor or tumor microenvironment 2739, 1992). Baculovirus (Autographa Californica multi (TME) that expresses one or more TASAs. nuclear polyhedrosis virus; AcMNPV) vectors are also In several embodiments, the methods include administer known in the art, and may be obtained from commercial ing to a subject with a tumor a therapeutically effective sources (such as PharMingen, San Diego, Calif.; Protein Sci 10 amount of one or more of the immunogenic TASA peptides ences Corp., Meriden, Conn.; Stratagene, La Jolla, Calif.). (for example, a plurality of immunogenic TASA peptides as Viral vectors that encode one or more immunogenic TASA described herein or one or more polynucleotides encoding peptides typically include at least expression control element these peptides), in order to generate an immune response. (e.g., a promoter) operationally linked to the nucleic acid The methods can include selecting a Subject in need of sequence encoding the one or more immunogenic TASA 15 treatment, such as a subject with a tumor, for example a tumor peptides. The at least on expression control element is that expresses a TASA, or a TME that expresses a TASA. In inserted in the poxviral vector to control and regulate the several examples, the methods include selecting a subject expression of the nucleic acid sequence. Examples of expres with colorectal cancer or melanoma. sion control elements of use in these vectors include, but are It is also disclosed herein that DLK1 protein, or a nucleic not limited to, lac system, operator and promoter regions of acid encoding DLK1 protein, can be used to treat a tumor phage lambda, yeast promoters and promoters derived from and/or pathogenic angiogenesis. In several embodiments, the polyoma, adenovirus, retrovirus or SV40. Additional opera methods include administering to a subject with a tumor a tional elements include, but are not limited to, leader therapeutically effective amount of one or more of the immu sequence, termination codons, polyadenylation signals and nogenic DLK1 peptides (for example, a plurality of DLK1 any other sequences necessary for the appropriate transcrip 25 peptides as described herein), one or more polynucleotides tion and Subsequent translation of the nucleic acid sequence encoding these peptides, DLK1 protein, or a nucleic acid encoding the one or more immunogenic TASA peptides in the encoding DLK1, in order to generate an immune response. In host system. The expression vector can contain additional Some examples, the methods disclosed herein decrease patho elements necessary for the transfer and Subsequent replica logical angiogenesis in the Subject, to slow or inhibit the tion of the expression vector containing the nucleic acid 30 growth or metastasis of a tumor. In these applications, a sequence in the host system. Examples of Such elements therapeutically effective amount of a composition including include, but are not limited to, origins of replication and the polypeptide, plurality of polypeptides, or polynucleotide selectable markers. It will further be understood by one is administered to a Subject, thereby slowing or inhibiting the skilled in the art that such vectors are easily constructed using growth or the metastasis of a tumor, or other pathological conventional methods (Ausubel et al., (1987) in “Current 35 angiogenesis, or to inhibit a sign or a symptom. Examples of Protocols in Molecular Biology. John Wiley and Sons, New Suitable Subjects include those diagnosed with or Suspecting York, N.Y.) and are commercially available. of having cancer (for example, a subject having a tumor), for In one embodiment, a composition is provided that example Subjects having a carcinoma, Such as a breast carci includes a recombinant virus comprising a vaccinia virus noma, lung carcinoma, colorectal carcinoma, renal carci genome or portions thereof and a nucleic acid sequence 40 noma, or melanoma. In additional examples, Subject has a encoding one or more immunogenic TASA peptides, and a hematologic tumor, Such as a hemangioma, lymphangioma, recombinant virus comprising a nucleic acid sequence encod Kaposi sarcoma, or hemangioblastoma. In some examples, ing an immunostimulatory molecule (for example, B 7-1 or the tumor cells express DLK1. However, in some embodi B7-2). In Such embodiments, any combination of encoding ments, the tumor cells do not express DLK1, but the pericytes one or more immunogenic TASA peptides can be used. Such 45 in the blood vessels within the tumor express DLK1. In yet as 2, 3, 4, 5, 6, 7 or more polynucleotides. other examples, both the tumor cells and the pericytes in the Isolation and purification of recombinantly expressed blood vessels in the tumor express DLK1. polypeptide can be carried out by conventional means includ In some embodiments, compositions are administered to a ing preparative chromatography and immunological separa Subject having a disease such as cancer (for example, renal tions. Once expressed, the one or more of the immunogenic 50 cell cancer), in an amount Sufficient to reduce vascularization. TASA peptides can be purified according to standard proce Administration inhibits blood vessel growth, and/or normal dures of the art, including ammonium Sulfate precipitation, izes the vasculature. Amounts effective for this use will affinity columns, column chromatography, and the like (see, depend upon the vascularization of the cancer, the general generally, R. Scopes, Protein Purification, Springer-Verlag, state of the patients health, and the robustness of the patients N.Y., 1982). Substantially pure compositions of at least about 55 immune system. In one example, a therapeutically effective 90 to 95% homogeneity are disclosed herein, and 98 to 99% amount of the composition is that which provides either sub or more homogeneity can be used for pharmaceutical pur jective relief of a symptom(s) or an objectively identifiable poses. Once purified, partially or to homogeneity as desired, improvement, such as a decrease in vascularization, as noted if to be used therapeutically, the polypeptides should be sub by the clinician or other qualified observer. In some embodi stantially free of endotoxin. 60 ments, these methods include administering to the Subject one or more DLK polypeptides or DLK1 protein as disclosed Therapeutic Methods and Pharmaceutical herein. Compositions In exemplary applications, compositions are administered to a subject having a disease, such as cancer (for example, The immunogenic TASA peptides disclosed herein (in 65 colorectal cancer or melanoma), in an amount Sufficient to cluding a plurality of immunogenic peptides), or nucleic raise an immune response to TASA-expressing cells. Admin acids encoding the immunogenic TASA peptides (including a istration induces a sufficient immune response to slow the US 9,345,770 B2 37 38 proliferation of such cells or to inhibit their growth, or to tralizing antibodies can also be primed with the same mol reduce a sign or a symptom of the tumor. Amounts effective ecule conjugated to a peptide which displays an appropriate for this use will depend upon the severity of the disease, the epitope, two compositions can be combined to elicit both general state of the patients health, and the robustness of the humoral and cell-mediated responses where that is deemed patient’s immune system. In one example, a therapeutically desirable. effective amount of the compound is that which provides In yet another embodiment, to induce a CTL response to either subjective relief of a symptom(s) or an objectively one or more immunogenic TASA peptides, a MHC Class identifiable improvement as noted by the clinician or other II-restricted T-helper epitope is added to the one or more qualified observer. immunogenic TASA peptides to induce T-helper cells to One or more immunogenic TASA peptides or one or more 10 secrete cytokines in the microenvironment to activate CTL polynucleotides encoding these peptides, DLK1 protein, or a precursor cells. The technique further involves adding short polynucleotide encoding DLK1 protein can be administered lipid molecules to retain the construct at the site of the injec by any means known to one of skill in the art (see Banga, A., tion for several days to localize the antigen at the site of the “Parenteral Controlled Delivery of Therapeutic Peptides and injection and enhance its proximity to dendritic cells or other Proteins, in Therapeutic Peptides and Proteins, Technomic 15 “professional antigen presenting cells over a period of time Publishing Co., Inc., Lancaster, Pa., 1995) either locally or (see Chesnut et al., “Design and Testing of Peptide-Based systemically, such as by intramuscular, Subcutaneous, intra Cytotoxic T-Cell-Mediated Immunotherapeutics to Treat peritoneal or intravenous injection, but even oral, nasal, trans Infectious Diseases and Cancer, in Powell et al., eds., Vac dermal or anal administration is contemplated. In one cine Design, the Subunit and Adjuvant Approach, Plenum embodiment, administration is by Subcutaneous or intramus Press, New York, 1995). cular injection. To extend the time during which the peptide, A pharmaceutical composition including one or more protein or polynucleotide is available to stimulate a response, immunogenic TASA peptides or DLK1 protein is provided. the peptide, protein or polynucleotide can be provided as an In some examples, the composition includes a plurality of implant, an oily injection, or as a particulate system. The immunogenic TASA peptides as described herein. These particulate system can be a microparticle, a microcapsule, a 25 compositions are used to generate an immune response. Such microsphere, a nanocapsule, or similar particle. (see, e.g., as for immunotherapy. In one embodiment, one or more Banga, Supra). A particulate carrier based on a synthetic poly immunogenic TASA peptides are mixed with an adjuvant mer has been shown to act as an adjuvant to enhance the containing two or more of a stabilizing detergent, a micelle immune response, in addition to providing a controlled forming agent, and an oil. Suitable stabilizing detergents, release. Aluminum salts can also be used as adjuvants to 30 micelle-forming agents, and oils are detailed in U.S. Pat. No. produce an immune response. 5,585,103: U.S. Pat. No. 5,709,860; U.S. Pat. No. 5,270,202; Optionally, one or more cytokines, such as IL-2, IL-6, and U.S. Pat. No. 5,695,770, all of which are incorporated by IL-12, RANTES, GM-CSF, TNF-C., or IFN-y, one or more reference. A stabilizing detergent is any detergent that allows growth factors, such as GM-CSF or G-CSF, one or more the components of the emulsion to remain as a stable emul costimulatory molecules, such as ICAM-1, LFA-3, CD72, 35 sion. Such detergents include polysorbate, 80 (TWEEN) B7-1, B7-2, or other B7 related molecules; one or more mol (Sorbitan-mono-9-octadecenoate-poly(oxy-1,2-ethanediyl; ecules such as OX-40L or 41 BBL, or combinations of these manufactured by ICI Americas, Wilmington, Del.), TWEEN molecules, can be used as biological adjuvants (see, for 40TM, TWEEN 20TM, TWEEN 60TM, ZwittergentTM 3-12, example, Salgaller et al., 1998, J. Surg. Oncol. 68(2): 122-38: TEEPOL HB7TM, and SPAN 85TM. These detergents are usu Lotzeet al., 2000, Cancer J Sci. Am. 6(Suppl 1):S61-6: Cao et 40 ally provided in an amount of approximately 0.05 to 0.5%, al., 1998, StemCells 16(Suppl 1):251-60; Kuiperet al., 2000, Such as at about 0.2%. A micelle forming agent is an agent Adv. Exp. Med. Biol. 465:381-90). These molecules can be which is able to stabilize the emulsion formed with the other administered systemically (or locally) to the host. In several components such that a micelle-like structure is formed. Such examples, IL-2, RANTES, GM-CSF, TNF-C, IFN-Y, G-CSF, agents generally cause Some irritation at the site of injection LFA-3, CD72, B7-1, B7-2, B7-1 B7-2, OX-40L, 41 BBL and 45 in order to recruit macrophages to enhance the cellular ICAM-1 are administered. response. Examples of Such agents include polymer Surfac In one specific, non-limiting example, one or more immu tants described by BASF Wyandotte publications, e.g., nogenic TASA peptides (for example, a plurality of Such Schmolka, J. Am. Oil. Chem. Soc. 54:110, 1977, and Hunter peptides as described herein), or DLK1 protein, is adminis et al., J. Immunol 129:1244, 1981, PLURONICTM L62LF, tered in a manner to direct the immune response to a cellular 50 L101, and L64, PEG1000, and TETRONICTM 1501, 150R1, response (that is, a cytotoxic T lymphocyte (CTL) response), 701, 901, 1301, and 130R1. The chemical structures of such rather than a humoral (antibody) response. agents are well known in the art. In one embodiment, the A number of means for inducing cellular responses, both in agent is chosen to have a hydrophile-lipophile balance (HLB) vitro and in vivo, are known. Lipids have been identified as of between 0 and 2, as defined by Hunter and Bennett, J. agents capable of assisting in priming CTL in vivo against 55 Immun. 133:3167, 1984. The agent can be provided in an various antigens. For example, as described in U.S. Pat. No. effective amount, for example between 0.5 and 10%, or in an 5,662.907, palmitic acid residues can be attached to the alpha amount between 1.25 and 5%. and epsilon amino groups of a lysine residue and then linked The oil included in the composition is chosen to promote (for example, via one or more linking residues, such as gly the retention of the antigen in oil-in-water emulsion, Such as cine, glycine-glycine, serine, serine-serine, or the like) to an 60 to provide a vehicle for the desired antigen, and preferably has immunogenic peptide. The lipidated peptide can then be a melting temperature of less than 65° C. Such that emulsion injected directly in a micellar form, incorporated in a lipo is formed either at room temperature (about 20°C. to 25°C.), Some, or emulsified in an adjuvant. As another example, E. or once the temperature of the emulsion is brought down to coli lipoproteins, such as tripalmitoyl-S-glycerylcysteinly room temperature. Examples of Such oils include squalene, seryl-serine can be used to prime tumor specific CTL when 65 Squalane, EICOSANETM, tetratetracontane, glycerol, and covalently attached to an appropriate peptide (see, Deres et peanut oil or other vegetable oils. In one specific, non-limit al., Nature 342:561, 1989). Further, as the induction of neu ing example, the oil is provided in an amount between 1 and US 9,345,770 B2 39 40 10%, or between 2.5 and 5%. The oil should be both biode Optionally, one or more cytokines, such as IL-2, IL-6, gradable and biocompatible so that the body can break down IL-12, RANTES, GM-CSF, TNF-ct, or IFN-y, one or more the oil over time, and so that no adverse effects, such as growth factors, such as GM-CSF or G-CSF, one or more granulomas, are evident upon use of the oil. costimulatory molecules, such as ICAM-1, LFA-3, CD72, In one embodiment, the adjuvant is a mixture of stabilizing 5 B7-1, B7-2, or other B7 related molecules; one or more mol detergents, micelle-forming agent, and oil available under the ecules such as OX-40L or 41 BBL, or combinations of these name PROVAX(R) (IDEC Pharmaceuticals, San Diego, molecules, can be used as biological adjuvants (see, for Calif.). An adjuvant can also be an immunostimulatory example, Salgaller et al., 1998, J. Surg. Oncol. 68(2): 122-38: nucleic acid, Such as a nucleic acid including a CpG motif, or Lotzeet al., 2000, Cancer J Sci. Am. 6(Suppl 1):561-6: Cao et a biological adjuvant (see above). 10 al., 1998, StemCells 16(Suppl 1):251-60; Kuiperet al., 2000, Controlled release parenteral formulations can be made as Adv. Exp. Med. Biol. 465:381-90). These molecules can be implants, oily injections, or as particulate systems. For a administered systemically to the host. It should be noted that broad overview of protein delivery systems, see Banga, these molecules can be co-administered via insertion of a Therapeutic Peptides and Proteins. Formulation, Processing, nucleic acid encoding the molecules into a vector, for and Delivery Systems, Technomic Publishing Company, Inc., 15 example, a viral vector. In various embodiments, the nucleic Lancaster, Pa., 1995. Particulate systems include micro acid encoding the biological adjuvant can be cloned into same spheres, microparticles, microcapsules, nanocapsules, nano vector as an immunogenic TASA peptide coding sequence, or spheres, and nanoparticles. Microcapsules contain the thera the nucleic acid can be cloned into one or more separate peutic protein as a central core. In microspheres, the vectors for co-administration. In addition, nonspecific immu therapeutic agent is dispersed throughout the particle. Par nomodulating factors such as Bacillus Cahnette-Guerin ticles, microspheres, and microcapsules Smaller than about 1 (BCG) and levamisole can be co-administered. um are generally referred to as nanoparticles, nanospheres, One approach to administration of nucleic acids is direct and nanocapsules, respectively. Capillaries have a diameter immunization with plasmid DNA, such as with a mammalian of approximately 5 um So that only nanoparticles are admin expression plasmid. As described above, nucleotide sequence istered intravenously. Microparticles are typically around 100 25 encoding immunogenic TASA peptides, or encoding DLK1 um in diameter and are administered Subcutaneously or intra protein, can be placed under the control of a promoter to muscularly (see Kreuter, Colloidal Drug Delivery Systems, J. increase expression of the molecule. Kreuter, ed., Marcel Dekker, Inc., New York, N.Y., pp. 219 Immunization by nucleic acid constructs is well known in 342, 1994; Tice & Tabibi, Treatise on Controlled Drug Deliv the art and taught, for example, in U.S. Pat. No. 5,643,578 ery, A. Kydonieus, ed., Marcel Dekker, Inc. New York, N.Y., 30 (which describes methods of immunizing vertebrates by pp. 315-339, 1992). introducing DNA encoding a desired antigen to elicit a cell Polymers can be used for ion-controlled release. Various mediated or a humoral response), and U.S. Pat. No. 5,593.972 degradable and nondegradable polymeric matrices for use in and U.S. Pat. No. 5,817,637 (which describe operably linking controlled drug delivery are known in the art (Langer, a nucleic acid sequence encoding an antigen to regulatory Accounts Chem. Res. 26:537, 1993). For example, the block 35 sequences enabling expression). U.S. Pat. No. 5,880,103 copolymer, polaxamer 407 exists as a viscous yet mobile describes several methods of delivery of nucleic acids encod liquid at low temperatures but forms a semisolid gel at body ing immunogenic peptides or other antigens to an organism. temperature. It has shown to be an effective vehicle for for The methods include liposomal delivery of the nucleic acids mulation and Sustained delivery of recombinant interleukin-2 (or of the synthetic peptides themselves), and immune-stimu and urease (Johnston et al., Pharm. Res. 9:425, 1992; and Pec, 40 lating constructs, or ISCOMSTM, negatively charged cage J. Parent. Sci. Tech. 44(2):58, 1990). Alternatively, hydroxya like structures of 30-40 nm in size formed spontaneously on patite has been used as a microcarrier for controlled release of mixing cholesterol and Quil ATM (saponin). Protective immu proteins (Intema et al., Int. J. Pharm. 112:215, 1994). In yet nity has been generated in a variety of experimental models of another aspect, liposomes are used for controlled release as infection, including toxoplasmosis and Epstein-Barr virus well as drug targeting of the lipid-capsulated drug (Betageriet 45 induced tumors, using ISCOMSTM as the delivery vehicle for al., Liposome Drug Delivery Systems, Technomic Publishing antigens (Mowat and Donachie, Immunol. Today 12:383, Co., Inc., Lancaster, Pa., 1993). Numerous additional systems 1991). Doses of antigen as low as 1 Lig encapsulated in for controlled delivery of therapeutic proteins are known ISCOMSTM have been found to produce Class I mediated (e.g., U.S. Pat. No. 5,055.303; U.S. Pat. No. 5,188,837; U.S. CTL responses (Takahashi et al., Nature 344:873, 1990). Pat. No. 4,235,871; U.S. Pat. No. 4,501,728; U.S. Pat. No. 50 In another approach to using nucleic acids for immuniza 4,837,028: U.S. Pat. No. 4,957,735; and U.S. Pat. No. 5,019, tion, one or more immunogenic TASA peptides, or DLK1 369; U.S. Pat. No. 5,055.303; U.S. Pat. No. 5,514,670; U.S. protein, can also be expressed by attenuated viral hosts or Pat. No. 5,413,797; U.S. Pat. No. 5,268, 164; U.S. Pat. No. vectors or bacterial vectors. Recombinant vaccinia virus, 5,004,697; U.S. Pat. No. 4,902,505; U.S. Pat. No. 5,506,206; poxvirus, adeno-associated virus (AAV), herpes virus, retro U.S. Pat. No. 5,271,961; U.S. Pat. No. 5,254,342; and U.S. 55 virus, or other viral vectors can be used to express one or more Pat. No. 5,534496). TASA peptides, thereby eliciting a CTL response. For In another embodiment, a pharmaceutical composition example, vaccinia Vectors and methods useful in immuniza including one or more polynucleotides encoding one or more tion protocols are described in U.S. Pat. No. 4,722,848. BCG immunogenic TASA peptides, or encoding DLK1 protein, is (Bacillus Calmette Guerin) provides another vector for provided. For example the composition can include one or 60 expression of the peptides (see Stover, Nature 351:456-460, more polynucleotides encoding a plurality of immunogenic 1991). TASA peptides as described herein. A therapeutically effec A first recombinant virus, such as a poxvirus (for example, tive amount of polynucleotide can be administered to a Sub vaccinia virus) encoding one or more TASA immunogenic ject in order to generate an immune response. In one specific, polypeptides can be used in conjunction with a second recom non-limiting example, a therapeutically effective amount of 65 binant virus which has incorporated into a viral genome or the polynucleotide is administered to a subject to treat col infectable portion thereof one or more genes or DNA orectal cancer, hepatocellular carcinoma or melanoma. sequences encoding B7-1, B7-2, or B7-1 and B7-2, wherein US 9,345,770 B2 41 42 the composition is able to coinfect a host cell resulting in 0.1 up to about 100 mg per patient per day can be used, coexpression of the polypeptide and the B7-1, B7-2, or B7-1 particularly if the agent is administered to a secluded site and and B7-2 encoding genes or DNA sequences (see U.S. Pat. not into the circulatory or lymph system, such as into a body No. 6,893,869, and U.S. Pat. No. 6,045,908, which are incor cavity or into a lumen of an organ. Actual methods for pre porated by reference herein). paring administrable compositions are known or apparent to When a viral vector is utilized, it is desirable to provide the those skilled in the art and are described in more detail in such recipient with a dosage of each recombinant virus in the publications as Remingtons Pharmaceutical Sciences, 19" composition in the range of from about 10 to about 10" Ed., Mack Publishing Company, Easton, Pa., 1995. plaque forming units/mg mammal, although a lower or higher Single or multiple administrations of the compositions are dose can be administered. The composition of recombinant 10 administered depending on the dosage and frequency as viral vectors can be introduced into a mammal either prior to any evidence of a cancer, or to mediate regression of the required and tolerated by the subject. In one embodiment, the disease in a mammal afflicted with the cancer. Examples of dosage is administered once as a bolus, but in another methods for administering the composition into mammals embodiment can be applied periodically until a therapeutic include, but are not limited to, exposure of cells to the recom 15 result is achieved. Generally, the dose is sufficient to treat or binant virus ex vivo, or injection of the composition into the ameliorate symptoms or signs of disease without producing affected tissue or intravenous, Subcutaneous, intradermal or unacceptable toxicity to the Subject. Systemic or local admin intramuscular administration of the virus. Alternatively the istration can be utilized. recombinant viral vector or combination of recombinant viral In another method, antigen presenting cells (APCs). Such vectors may be administered locally by direct injection into as dendritic cells, are pulsed or co-incubated with peptides the cancerous lesion in a pharmaceutically acceptable carrier. comprising one or more immunogenic TASA peptides, or Generally, the quantity of recombinant viral vector, carrying with DLK1 protein, or a nucleic acid encoding the peptide(s) the nucleic acid sequence of one or more immunogenic TASA or protein, in vitro. In one specific, non-limiting example, the peptides (or DLK1 protein) to be administered is based on the antigen presenting cells can be autologous cells. A therapeu titer of virus particles. An exemplary range of the immunogen 25 tically effective amount of the antigen presenting cells can to be administered is 10 to 10' virus particles per mammal, then be administered to a subject. Such as a human. One or more immunogenic TASA peptides or DLK1 pro In one embodiment the recombinant viruses have been tein, or a nucleic acid encoding the peptide(s) or protein, can constructed to express cytokines (such as TNF-C. IL-6, GM be delivered to the dendritic cells or to dendritic cell precur CSF, and IL-2), and co-stimulatory and accessory molecules 30 sors via any method known in the art, including, but not (B7-1, B7-2) alone and in a variety of combinations. Simul limited to, pulsing dendritic cells directly with antigen, or taneous production of an immunostimulatory molecule and utilizing abroad variety of antigen delivery vehicles, such as, one or more immunogenic TASA peptides (or DLK1 protein) for example, liposomes, or other vectors known to deliver enhances the immune response. Without being bound by antigen to cells. In one specific, non-limiting example an theory, dependent upon the specific immunostimulatory mol 35 antigenic formulation includes about 0.1 ug to about 1,000 ecules, different mechanisms might be responsible for the ug, or about 1 to about 100 ug of one or more immunogenic enhanced immunogenicity: augmentation of help signal (IL TASA peptides. One or more immunogenic TASA peptides 2), recruitment of professional APC (GM-CSF), increase in (or DLK1 protein), or a nucleic acid encoding the peptide(s) CTL frequency (IL-2), effect on antigen processing pathway or protein, can also be administered with agents that promote and MHC expression (IFNY and TNFC) and the like. For 40 dendritic cell maturation. Specific, non-limiting examples of example, IL-2, IL-6, interferon, tumor necrosis factor, or a agents of use are interleukin-4 (IL-4) and granulocyte/mac nucleic acid encoding these molecules, can be administered rophage colony stimulating factor (GM-CSF), or filt-3 ligand in conjunction with one or more TASA immunogenic (filt-3L). The preparation can also contain buffers, excipients, polypeptides, a nucleic acid encoding one or more immuno and preservatives, amongst other ingredients. genic TASA peptides, DLK1 protein or a nucleic acid encod 45 In one embodiment, mature antigen presenting cells are ing DLK1 protein. The co-expression of one or more immu generated to present one or more immunogenic TASA pep nogenic TASA peptides, DLK1 protein or a nucleic acid tides, such as DLK1 peptides. These dendritic cells are then encoding DLK1 protein, together with at least one immuno administered alone (or in combination with another agent) to stimulatory molecule can be effective in an animal model to a subject with a tumor, for example a tumor that expresses the show anti-tumor effects. 50 corresponding TASA. Such as a colorectal tumor or mela In one embodiment, a nucleic acid encoding one or more Oa. immunogenic TASA peptides (or DLK1 protein) is intro Alternatively, the APCs are used to sensitize CD8 cells, duced directly into cells. For example, the nucleic acid can be Such as tumor infiltrating lymphocytes (TILS) from tumors or loaded onto gold microspheres by standard methods and peripheral blood lymphocytes (PBLs). The TILs or PBLs can introduced into the skin by a device such as Bio-Rads 55 be from the same Subject (autologous) that is to be treated. HELIOSTM Gene Gun. The nucleic acids can be “naked, Alternatively, the TILs or PBLs can be heterologous. How consisting of plasmids under control of a strong promoter. ever, they should at least be MHC Class-I restricted to the Typically, the DNA is injected into muscle, although it can HLA types the subject possesses. An effective amount of the also be injected directly into other sites, including tissues in sensitized cells are then administered to the subject. proximity to metastases. Dosages for injection are usually 60 Peripheral blood mononuclear cells (PBMCs) can be used around 0.5 g/kg to about 50 mg/kg, and typically are about as the responder cell source of CTL precursors. The appro 0.005 mg/kg to about 5 mg/kg (see, for example, U.S. Pat. No. priate antigen-presenting cells are incubated with peptide, 5,589.466). after which the peptide-loaded antigen-presenting cells are In one specific, non-limiting example, a pharmaceutical then incubated with the responder cell population under opti composition for intravenous administration would include 65 mized culture conditions. Positive CTL activation can be about 0.1 g to 10 mg of one or more immunogenic TASA determined by assaying the culture for the presence of CTLs peptides (or DLK1 protein) per patient per day. Dosages from that kill radio-labeled target cells, both specific peptide US 9,345,770 B2 43 44 pulsed targets as well as target cells expressing endogenously etaxel, as well as the analogs of paclitaxel taught by U.S. Pat. processed forms of the antigen from which the peptide Nos. 6,610,860: 5,530,020; and 5,912,264 can be used. sequence was derived. Suitable DNA and/or RNA transcription regulators, The cells can be administered to a subject to inhibit the including, without limitation, actinomycin D, daunorubicin, growth of TASA expressing cells in a tumor or TME. In these doxorubicin and derivatives and analogs thereofalso are Suit applications, a therapeutically effective amount of activated able for use in combination with the disclosed therapies. DNA antigen presenting cells, or activated lymphocytes, are intercalators and cross-linking agents that can be adminis administered to a subject Suffering from a disease, in an tered to a subject include, without limitation, cisplatin, car amount Sufficient to raise an immune response to TASA boplatin, oxaliplatin, mitomycins, such as mitomycin C, expressing cells. The resulting immune response is sufficient 10 bleomycin, chlorambucil, cyclophosphamide and derivatives to slow the proliferation of such cells or to inhibit their and analogs thereof. DNA synthesis inhibitors suitable for growth, or to reduce a sign or a symptom of the tumor. use as therapeutic agents include, without limitation, meth In a Supplemental method, any of these immunotherapies is otrexate, 5-fluoro-5'-deoxyuridine, 5-fluorouracil and ana augmented by administering a cytokine, such as interleukin 15 logs thereof. Examples of suitable enzyme inhibitors include, (IL)-2, IL-3, IL-6, IL-10, IL-12, IL-15, GM-CSF, or interfer without limitation, camptothecin, etoposide, formestane, tri OS. chostatin and derivatives and analogs thereof. Suitable com The methods of treating a subject with a tumor described pounds that affect gene regulation include agents that result in herein can be accompanied by administration of anti-cancer increased or decreased expression of one or more genes. Such oranti-angiogenesis agents ortherapeutic treatments (such as as raloxifene, 5-azacytidine, 5-aza-2'-deoxycytidine, tamox Surgical resection of a tumor or radiation therapy). For ifen, 4-hydroxytamoxifen, mifepristone and derivatives and example, the Subject can receive additional therapies (a) prior analogs thereof. to, during, or following administration of a therapeutic Examples of the commonly used chemotherapy drugs amount of one or more immunogenic TASA peptides, or (b) include Adriamycin, Alkeran, Ara-C, BiCNU, Busulfan, prior to, during, or following administration of a therapeutic 25 CCNU, Carboplatinum, Cisplatinum, Cytoxan, Daunorubi amount of DLK1 protein or a nucleic acid encoding DLK1 cin, DTIC, 5-FU, Fludarabine, Hydrea, Idarubicin, Ifosfa protein. In one example, the Subject receives one or more mide, Methotrexate, Mithramycin, Mitomycin, Mitox treatments to remove or reduce the tumor prior to adminis antrone, Nitrogen Mustard, Taxol (or other taxanes, such as tration of a therapeutic amount of one or more agents for docetaxel), Velban, Vincristine, VP-16, while some more treatment of the tumor. For example, the additional agent may 30 newer drugs include Gemcitabine (Gemzar), Herceptin, include, but is not limited to, a chemotherapeutic agent, an Irinotecan (Camptosar, CPT-11), Leustatin, Navelbine, Rit anti-angiogenic agent, or a combination thereof. In another uxan STI-571, Taxotere, Topotecan (Hycamtin), Xeloda example, at least part of the tumor is Surgically or otherwise (Capecitabine), Zevelin and calcitriol. excised or reduced in size or Volume prior to administering Non-limiting examples of immunomodulators that can be the therapeutically effective amount of the antibody or con 35 used include AS-101 (Wyeth-Ayerst Labs.), bropirimine (Up jugate. In some embodiments, the chemotherapeutic agent john), gamma interferon (Genentech), GM-CSF (granulocyte reduces Suppressor cells in the tumor microenvironment or macrophage colony stimulating factor, Genetics Institute), fosters the recruitment of vaccine-induced T cells into the IL-2 (Cetus or Hoffman-LaRoche), human immune globulin tumor site. In some examples, the agent is bevacizumab, (Cutter Biological), IMREG (from Imreg of New Orleans, Sunitinib, axitinib, HSP90 inhibitors, or gencitabine/fludara 40 La.), SK&F 106528, and TNF (tumor necrosis factor; Genen bine. tech). Particular examples of additional therapeutic agents that Non-limiting examples of anti-angiogenic agents include can be used include microtubule binding agents, DNA inter molecules, such as proteins, enzymes, polysaccharides, oli calators or cross-linkers, DNA synthesis inhibitors, DNA gonucleotides, DNA, RNA, and recombinant vectors, and and/or RNA transcription inhibitors, antibodies, enzymes, 45 small molecules that function to reduce or even inhibit blood enzyme inhibitors, gene regulators, angiogenesis inhibitors. vessel growth. Examples of Suitable angiogenesis inhibitors These agents (which are administered at a therapeutically include, without limitation, angiostatin K1-3, staurosporine, effective amount) and treatments can be used alone or in genistein, fumagillin, medroxyprogesterone, Suramin, inter combination. For example, any suitable anti-cancer or anti feron-alpha, metalloproteinase inhibitors, platelet factor 4. angiogenic agent can be administered in combination with 50 Somatostatin, thromobospondin, endostatin, thalidomide, the immunogenic TASA peptides or DLK1 protein disclosed and derivatives and analogs thereof. For example, in some herein, or polynucleotides encoding Such peptides or protein embodiments the anti-angiogenesis agent is an antibody that and viral vectors include these polynucleotides. Methods and specifically binds to VEGF (e.g., Avastin, Roche) or a VEGF therapeutic dosages of such agents are known to those skilled receptor (e.g., a VEGFR2 antibody). In one example the in the art, and can be determined by a skilled clinician. 55 anti-angiogenic agent includes a VEGFR2 antibody, or Microtubule binding agent refers to an agent that interacts DMXAA (also known as Vadimezan or ASA404; available with tubulinto stabilize or destabilize microtubule formation commercially, e.g., from Sigma Corp., St. Louis, Mo.) or thereby inhibiting cell division. Examples of microtubule both. The anti-angiogenic agent can be bevacizumab, Suni binding agents that can be used in conjunction with the dis tinib, an anti-angiogenic tyrosine kinase inhibitors (TKI), closed therapy include, without limitation, paclitaxel, doc 60 Such as Sunitinib, Xitinib and dasatinib. These can be used etaxel, vinblastine, vindesine, vinorelbine (navelbine), the individually or in any combination. epothilones, colchicine, dolastatin 15, nocodazole, podo Exemplary kinase inhibitors include Gleevac, Iressa, and phyllotoxin and rhizoxin. Analogs and derivatives of Such Tarceva, Sunitinib, Sorafenib, anitinib, and dasatinib that pre compounds also can be used and are known to those of ordi vent phosphorylation and activation of growth factors. Anti nary skill in the art. For example, suitable epothilones and 65 bodies that can be used include Herceptin and Avastin that epothilone analogs are described in International Publication block growth factors and the angiogenic pathway. These can No. WO 2004/018478. Taxoids, such as paclitaxel and doc be used individually or in combination. US 9,345,770 B2 45 46 In some examples, the additional agent is a monoclonal chain is modified by deletion of the trans-membrane and antibody, for example, 3F8, Abagovomab, Adecatumumab, cytosolic tail and COOH-terminal addition of a sequence AfutuZumab, Alacizumab, Alemtuzumab. Altumomab pen containing the biotin protein ligase (Bir-A) enzymatic bioti tetate, Anatumomab mafenatox. Apolizumab, Arcitumomab, nylation site. Heavy chain, 32m, and peptide are then Bavituximab, Bectumomab, Belimumab, Besilesomab, refolded. The refolded product can be isolated by any means Bevacizumab, Bivatuzumab mertansine, Blinatumomab, known in the art, and then biotinylated by Bir-A. A tetramer is Brentuximab vedotin, Cantuzumab mertansine, Capromab then produced by contacting the biotinylated product with pendetide, Catumaxomab, CC49, Cetuximab, Citatuzumab streptavidin. bogatox, Cixutumumab, ClivatuZumab tetraxetan, Conatu In one embodiment, the streptavidin is labeled. Suitable mumab, DacetuZumab, Detumomab, Ecromeximab, Eculi 10 labels include, but are not limited to, enzymes, magnetic Zumab, Edrecolomab, EpratuZumab, ErtumaXomab, Etaraci beads, colloidal magnetic beads, haptens, fluorochromes, Zumab, Farletuzumab, Figitumumab, Galiximab, metal compounds, radioactive compounds or drugs. The Gemtuzumab ozogamicin, Girentuximab, Glembatumumab enzymes that can be conjugated to Streptavidin include, but Vedotin, Ibritumomab tiuxetan, Igovomab, Imciromab, Inte are not limited to, alkaline phosphatase, peroxidase, urease tumumab, Inotuzumab ozogamicin, Ipilimumab, Iratu 15 and 3-galactosidase. The fluorochromes that can be conju mumab, LabetuZumab, Lexatumumab, LintuZumab, Lorvo gated to the streptavidin include, but are not limited to, fluo tuZumab mertansine, Lucatumumab, Lumiliximab, rescein isothiocyanate, tetramethylrhodamine isothiocyan Mapatumumab, Matuzumab, Mepolizumab, Metelimumab, ate, phycoerythrin, allophycocyanins and Texas Red. For Milatuzumab, Mitumomab, Morolimumab, Nacolomab taf additional fluorochromes that can be conjugated to streptavi enatox. Naptumomab estafenatox, Necitumumab, Nimotu din, see Haugland, R. P. Molecular Probes. Handbook of Zumab, Nofetumomab merpentan, Ofatumumab, Olara Fluorescent Probes and Research Chemicals (1992-1994). tumab, OportuZumab monatox, Oregovomab, Panitumumab, The metal compounds that can be conjugated to the Strepta Pemtumomab, Pertuzumab, Pintumomab, Pritumumab, vidin include, but are not limited to, ferritin, colloidal gold, Ramucirumab, Rilotumumab, Rituximab, Robatumumab, and particularly, colloidal Superparamagnetic beads. The Satumomab pendetide, Sibrotuzumab, Sonepcizumab, Taca 25 haptens that can be conjugated to the Streptavidin include, but tuZumab tetraxetan, Taplitumomab paptoX, Tenatumomab, are not limited to, biotin, digoxigenin, oxazalone, and nitro TGN1412, Ticilimumab (tremelimumab), Tigatuzumab, phenol. The radioactive compounds that can be conjugated to TNX-650, Trastuzumab, Tremelimumab, Tucotuzumab cel streptavidin are known to the art, and include but are not moleukin, Veltuzumab, Volocliximab, Votumumab, Zalutu limited to technetium 99m (Tc), 'I and amino acids com mumab. 30 prising any radionuclides, including, but not limited to, ''C, Another common treatment for some types of cancer is H and S. Generally, streptavidin labeled with a fluoro Surgical treatment, for example surgical resection of the can chrome is utilized in the methods disclosed herein. cer or a portion of it. Another example of a treatment is In one embodiment, Suspension of cells including T cells radiotherapy, for example administration of radioactive mate that specifically recognize one or more TASAS is produced, rial or energy (such as external beam therapy) to the tumor site 35 and the cells are reacted with the tetramer in Suspension. In to help eradicate the tumor or shrink it prior to Surgical resec one embodiment, these reagents are used to label cells, which tion. are then analyzed by fluorescence activated cell sorting Other therapeutic agents, for example anti-tumor agents, (FACS). A machine for FACS employs a plurality of color that may or may not fall under one or more of the classifica channels, low angle and obtuse light-scattering detection tions above, also are suitable for administration in combina 40 channels, and impedance channels, among other more tion with the disclosed therapies. By way of example, such Sophisticated levels of detection, to separate or sort cells. Any agents include adriamycin, apigenin, rapamycin, Zebularine, FACS technique can be employed as long as it is not detri cimetidine, and derivatives and analogs thereof. Further mental to the detection of the desired cells. (For exemplary examples include one or more additional vaccines targeting methods of FACS see U.S. Pat. No. 5,061,620.) tumor antigens or tumor stem cells (such as a tumor initiating 45 cell). The skilled artisan is familiar with such vaccines. EXAMPLES Reagents for the Detection of CD8+ cells that The following examples are provided to illustrate certain Specifically Bind TASAs particular features and/or embodiments and should not be 50 construed as limiting. Reagents are provided herein for the detection of CD8 expressing cells that specifically bind the TASAs described Example 1 herein. These reagents are tetrameric MHC Class I/immuno genic TASA peptide complexes. These tetrameric complexes Intratumoral Gene Therapy Induces Cross-Priming include an immunogenic TASA peptide that includes at most 55 of T Cells Reactive Against Tumor-Associated twelve consecutive amino acids, wherein the isolated Stromal Antigens polypeptide comprises the amino acid sequence as shown in Table 1. Specific examples of immunogenic TASA peptides This example illustrates that cross-priming of CD8T cells that are nine or ten amino acids in length are disclosed above. reactive against TASA is a general paradigm for effective Tetrameric MHC Class I/peptide complexes can be synthe 60 immunotherapy. The results show that protective CD8" T sized using methods well known in the art (Altmann et al., cells induced as a consequence of effective intratumoral Science 274:94, 1996, which is herein incorporated by refer DC.IL 12 therapy recognize both tumor-associated stromal ence). In one specific non-limiting example, purified HLA cells (i.e. flow-sorted pericytes and VEC) and naturally-pro heavy chain and B2-microglobulin (B2m) can be synthesized cessed and HLA-A2–presented peptides derived from TASA. by means of a prokaryotic expression system. One specific, 65 These data illustrate the therapeutic targeting of TASA (via non-limiting example of an expression system of use is the intratumoral cytokine genetherapy or specific vaccination) as pET system (R&D Systems, Minneapolis, Minn.). The heavy a means to treat vascularized solid tumors. US 9,345,770 B2 47 48 Materials and Methods B-cell hybridoma (Tatsumi et al., Cancer Res., 63:4481 Mice. 4489, 2003). Cell lines were free of mycoplasma contamina HHD mice fail to express H-2” class Imolecules, with their tion and were maintained in CM (RPMI 1640 supplemented cells instead expressing an HLA-A*0201-h2 microglobulin with 10% heat-inactivated fetal bovine serum, 100U/ml peni single-chain (HHD) gene product (Firat et al., Int Immunol., cillin, 100 ug/ml streptomycin, and 10 mM L-glutamine (all 14:925-934, 2002). Ag-specific CD8" T cell responses in reagents from Life Technologies, Inc., Grand Island, N.Y.)) in HHD mice recapitulate those observed in HLA-A2" human a humidified incubator at 5% CO, and 37° C. donors (Firat et al., Int Immunol., 14:925-934, 2002). Female RT-PCR. 6-8 week old mice were used in all experiments and were Reverse transcriptase-PCR (RT-PCR) was performed handled in accordance with an Institutional Animal Care and 10 using the primer pairs shown in Table 2. Cycling times and Use Committee (IACUC)-approved protocol. HLA-A2 temperatures were as follows: initial denaturation at 94° C. expression on peripheral blood cells isolated from HHD mice for 2 min (1 cycle), denaturation at 94°C. for 30 sec, anneal via tail Venipuncture was confirmed by coordinate positive ing at 60° C. for 30 sec and elongation at 72°C. for 1 min (30 staining as assessed by flow cytometry using two monoclonal cycles), final extension at 72° C. for 5 min (1 cycle). PCR antibodies (mAbs) MA2.1 (reactive against HLA-A2 and 15 products were identified by image analysis Software for gel HLA-B17) and BB7.2 (reactive against HLA-A2 and HLA documentation (LabWorks 4.6 Software; UVP. Upland, Aw69) (both monoclonal antibodies from the AmericanType Calif.) following electrophoresis on 1.2% agarose gels and Culture collection; ATCC, Manassas, Va.). staining with ethidium bromide (Sigma-Aldrich). TABLE 2 RT-PCR primers.

Product Target RT-PCR primers (bp) CD31 Forward 5'-3" : AGCCCACCAGAGACATGGAA (SEQ ID NO: 33) 337 Reverse 5'-3' : CTGGCTCTGTTGGAGGCTGT (SEO ID NO. 34) DLK1. Forward 5'-3' : CTGCACACCTGGGTTCTCTG (SEO ID NO: 35) 2O2 Reverse 5'-3" : GCATGGGTTAGGGGTACAGC (SEQ ID NO: 36 EphA2 Forward 5'-3" : GGGGATGCCAACAGCTATAA (SEQ ID NO: 37) 232 Reverse 5'-3' : CTCCTGCCAGTACCAGAAGC (SEO ID NO: 38) gp1.OO Forward 5'-3' : CATCAATGGGAGCCAGGTGT (SEO ID NO: 39) 296 Reverse 5'-3" : TGAAGGTTGAACTGGCGTGA (SEQ ID NO: 40) HBB Forward 5'-3" : TCAGAAACAGACATCATGGTGC (SEQ ID NO: 41) 48O Reverse 5'-3" ; TAGACAATAGCAGAAAAGGGGC (SEQ ID NO: 42) NG2 Forward 5'-3' : ACAGACGCCTTTGTTCTGCT (SEO ID NO : 43) 399 Reverse 5'-3" : TCGGAAGAAATGTCCAGGAG (SEQ ID NO: 44) NRP1 Forward 5'-3' : TCCAAGTGGACCTGGGAGAT (SEO ID NO: 45) 299 Reverse 5'-3' : TTCACAGCCCAGTAGCTCCA (SEO ID NO: 46) NRP2 Forward 5'-3' : CCGGAAGAGACCTGTGGTTG (SEO ID NO: 47) 394 Reverse 5'-3' : CCGATCGTCCCTTCCCTATC (SEO ID NO : 48) PDGFRB Forward 5'-3' : TGCTCCTGGAGAGGCTTCTG (SEO ID NO: 49) 3O1 Reverse 5'-3' : GGAGGAAGTGTTGACTTCATTC (SEO ID NO: 5O) PSMA Forward 5'-3' : CCTGCGGTGAAGTCCTATCC (SEO ID NO. 51) 3OO Reverse 5'-3' : GTTTCCAGCAAAGCCAGGTC (SEO ID NO : 52) RGSS Forward 5'-3' : AAGTTGGGAATTCTCCTCCAG (SEO ID NO : 53) 2O3 Reverse 5'-3' : TTCCTCACTGAATTCAGACTTC (SEO ID NO. 54) TEM1 Forward 5'-3' : TTCACCAACTGGGCCCAGC (SEO ID NO : 55) 645 Reverse 5'-3' : GTTGACACACATCTGCTGGC (SEO ID NO: 56) WEGFR1 Forward 5'-3' : CCAACTACCTCAAGAGCAAAC (SEO ID NO : 57) 3.18 Reverse 5'-3' : CCAGGTCCCGATGAATGCAC (SEO ID NO: 58) WEGFR2 Forward 5'-3' : ACAGACAGTGGGATGGTCC (SEO ID NO. 59) 271 Reverse 5'-3" : AAACAGGAGGTGAGCGCAG (SEQ ID NO: 6O) B-actin Forward 5'-3' : GGCATCGTGATGGACTCCG (SEQ ID NO : 61) 615 Reverse 5'-3" : GCTGGAAGGTGGACAGCGA (SEQ ID NO: 62)

Cell Lines and Culture. Fluorescence Imaging of Tumor Sections. B16 is an HLA-A2's, mMART-1", mgp100" melanoma Tumor tissue samples were prepared and sectioned as pre cell line (syngenic to the H-2' background of HHD mice) 65 viously described (Komita et al., Cancer Res., 68: 8076-8084, known in the art (Hatano et al., J Transl Med., 2:40, 2004). 2008). For analysis of T cell subsets, sections were incubated The T2 cell line is an HLA-A2, TAP-deficient human T-cell/ with rabbit anti-mouse NG2 (Millipore, Bedford, Mass.) US 9,345,770 B2 49 50 along with alexa488-conjugated anti-CD4 or -CD8 Bantibod total volume of 50 uL PBS. Tumor size was then assessed ies or matching isotype controls (all from BD BioSciences, every 3 to 4 days and recorded in mm, determined as the San Jose, Calif.) for 1 h. After washing with 0.5% BSA in product of orthogonal measurements taken using Vernier cali PBS, sections were stained with donkey anti-rabbit Ig cy5 pers. In some experiments, as indicated, in vivo antibody (Jackson ImmunoResearch, West Grove, Pa.) secondary anti depletions (on days 6, 13 and 20 post-tumor injection) of body for one hour at room temperature. For analysis of CD31 CD4" T cells or CD8" T cells were performed as previously vs. NG2, sections were first incubated with rat anti-mouse described (13). Data were reported as mean tumor area +SD. CD31 (BD Biosciences) and rabbit anti-mouse NG2 (Milli On day 17-19 post-tumor inoculation, CD8 splenocytes and pore) antibodies for one hour at room temperature and then TIL were MACS-isolated from 3 mice/cohort, with cells washed. Sections were then treated with donkey anti-rat Ig 10 pooled and assessed for reactivity against peptide epitopes or cy3 and donkey anti-rabbit Ig cy5 (both from Jackson Immu cell targets (pericytes, VEC, tumor cells). noResearch) antibodies for 1 hr and washed. For the analysis Evaluation of Murine CD8" T Cell Responses In Vitro. of target antigens in B16 tumor lesions, all sections received To analyze Ag-specific responses, spleens and TIL were dilutions of rat anti-mouse CD31 (BD Biosciences) and harvested (from 2 mice/group) 3-5 days after the second guinea pig anti-mouse NG2 (Burg et al. Cancer Res., 15 intratumoral injection of control DC or DC.IL12 (i.e. day 59:2869-2874, 1999) antibodies. In addition, each slide 17-19 after tumor inoculation). Splenic lymphocytes were received an antibody reactive against a given TASA: rabbit restimulated in vitro for 5 days with irradiated (2.5Gy) naive anti-mouse antibody for DLK1 (R&D Systems, Minneapolis, peptide-pulsed HHD splenocytes at a stimulator:responder Minn.), EphA2 (Santa Cruz, Biotech., San Diego, Calif.), cell ratio of 1:1. Responder CD8" T cells were then isolated PSMA (Thermo Fisher Scientific, Rockford, Ill.), RGS5 using magnetic bead cell sorting (MACS; Miltenyi Biotec) (Sigma-Aldrich), VEGFR1 (Thermo Fisher Scientific) or and analyzed for reactivity against unpulsed or peptide goat anti-mouse antibody for HBB (Santa Cruz), NRP1 pulsed T2 cells, as indicated. To analyze T cell response to (R&D Systems), NRP2 (R&D Systems), PDGFRB (R&D stromal cell targets and tumor cells, untreated HHD mice Systems), VEGFR2 (Abcam, Cambridge, Mass.). Sections bearing established day 17-19 B16 tumors were sacrificed were then again washed five times with 0.5% BSA (in PBS), 25 and tumors and kidneys removed. Tissues were then minced before a one hour incubation with dilutions of a mixture of manually and enzymatically digested as described by Crisan secondary antibodies: i.) donkey anti-rat cy5 antibody, ii.) et al. (Crisan et al., Cell Stem Cell., 3:301-313, 2008) using donkey anti-guinea pig DyLight 488 antibody, and iii.) either collagenases IA, II, and IV (Sigma-Aldrich) and DNAse I donkey anti-rabbit cy3 antibody or donkey anti-goat cy3 anti (Sigma-Aldrich) for 30 min at 37° C., with gentle shaking. body depending on the species of antibody directed against 30 Cells were then being passed through a 70 micron cell strainer the TASA target (all secondary antibodies were purchased (BD-Biosciences), washed with PBS, and single cell suspen from Jackson ImmunoResearch). After secondary Ab stain sions stained with anti-mouse CD31 FITC (BD-Biosciences), ing, sections were then washed with 3 washes of PBS, cov anti-mouse CD140b (PDGFRB) PE (eBioscience), and anti erslipped with gelvatol mounting media (made in-house) and mouse H2-K APC (BD-Biosciences). After washing with stored at 4°C. until imaging using an Olympus FluoView 500 35 PBS, cells were sorted into enriched populations containing Confocal microscope (Olympus America, CenterValley, Pa.). pericytes (PDGFRB"CD31'SH-2K8) or VEC (PDG Synthetic Peptides. FRB"-CD31H-2K") using a multicolor fluorescence The peptides shown in Table 4 were synthesized by 9-fluo activated cell sorter (FACSAria, BD-Biosciences). In all renylmethoxycarbonyl (Fmoc) chemistry. Peptides were cases, cells were >95% pure for the stated phenotype. CD8" >96% pure based on high performance liquid chromatogra 40 T cells (10) were then co-cultured with 10 pericytes or VEC phy profile and mass spectrometric analysis. in U-bottom 96-well plates (Sigma-Aldrich). To verify HLA Generation of HHD Bone Marrow (BM)-Derived DCs and A2 restricted recognition of target cells by CD8" T cells, 10 DCIL12. ug of anti-HLA-A2 mAb BB7.2 or control anti-HLA-class II DC were generated from BM precursors isolated from the mAb L243 (both from ATCC) were added to replicate co tibias/femurs of mice using in vitro cultures containing 1000 45 culture wells. Forty-eight hours after initiating splenic CD8" U/ml recombinant murine granulocyte/macrophage colony T cell co-cultures, cell-free supernatants were collected and stimulating factor (rmcjM-CSF) and 1000U/ml rmIL-4 (both analyzed for mIFN-Y content using a commercial ELISA from Peprotech, Rocky Hill, N.J.), as previously described (BD-Biosciences) with a lower limit of detection of 31.3 (Komita et al., Cancer Res, 68: 8076-8084, 2008). The pg/ml. Data were reported as the meaniSD of triplicate deter AdmIL-12p70 and Adup5 (empty) recombinant adenoviral 50 minations. Alternatively, freshly-sorted CD8" TIL were co vectors were produced as reported previously (Komita et al., cultured with pericytes, VEC, T2 cells (+/-peptides) or B16 Cancer Res, 68: 8076-8084, 2008; Tatsumi et al., Cancer tumor cells at a T cell-to-target cell ratio of 3:2 for 4-5 hat 37° Res., 63: 6378-6386, 2003). Five million (day 5 cultured) C. and analyzed for intracellular levels of IFN-y or cell DCs were infected at an MOI =50 with Adm1L-12p70 or the surface expression of CD107a/b using specific monoclonal control, empty vector Ad. p5. While control DC produced 55 antibodies (APC-labeled anti-mouse CD8C. from eBio <62.5 pg. IL-12p70/ml/48 h/10 cells, DC.IL12 cells pro science; PE-labeled rat anti-mouse IFN-Y and FITC-labeled duced 1-10 ng IL-12p70/ml/48 h/10° cells (Komita et al., rat anti-mouse CD107a/b from BD Biosciences) and flow Cancer Res. 68:8076-8084, 2008: Tatsumi et al., Cancer cytometry using the manufacturer's suggested protocol and Res., 63:6378-6386, 2003). ref. (Mittendorf et al., Breast Cancer Res Treat., 92:85-93, Intratumoral (Lt.) DC.IL12 Therapy. 60 2005), respectively. B16 melanoma cells (1x10) were injected subcutaneously In Vitro Assessment of Human CD8 T Cell Responses in the right flank of HHD mice and allowed to establish for 7 Against TASA- or TAA-Derived Peptides. days. Mice were then randomized into cohorts of 5 animals, Peripheral blood mononuclear cells (PBMC) were with each cohort exhibiting an approximate mean tumor size obtained by Venipuncture or leukapheresis from HLA-A2" of 30-50 mm. On days 7 and 14, tumor-bearing mice were 65 normal donors or HLA-A2" melanoma patients with written untreated or treated with intratumoral injections of 1x10 consent under IRB-approved protocols (Table 3). CD8" T adenovirus-infected dendritic cells (DC. p5 or DC.IL12) in a cells were then isolated by MACS (Miltenyi Biotec, Auburn, US 9,345,770 B2 51 52 Calif.) and either not stimulated or stimulated with autolo recipient HHD mice. To gauge potential overexpression of gous, TASA peptide-pulsed DC as previously described (Tat TASA in tumor versus normal tissues, pericytes and VEC sumi et al., Cancer Res., 63:4481-4489, 2003). Normal donor were also flow-sorted from single cell digests of tumor-unin T cells were stimulated with TASA peptide-pulsed DC twice volved kidneys harvested from these same animals. RT-PCR on a weekly schedule, with responder T cells harvested for 5 analyses were then performed on cDNA isolated from each of analysis of their specificity 5 days after the booster stimula these sorted cell populations. Quality control analyses Sup tion (i.e. day 12 of T cell-DC co-culture). Melanoma patient ported the expression of NG2 transcripts only in pericytes, CD8" T cells were analyzed after a single round of stimula CD31 transcripts only in VEC and gp100 transcripts only in tion with TASA peptide-pulsed, autologous DC (i.e. day 5 of B16 cells (FIG. 1B). These analyses also support: i.) tumor T cell-DC co-culture) as indicated. For DC-based stimula 10 tions, DC were pulsed with an equimolar (1 uMeach) pool of pericyte expression of all TASA transcripts with the excep the TASA peptides (Table 4) for 4 h at 37° C. at 5% CO, tions of EphA2 and PSMA; ii.) tumor VEC expression of tension. These antigen-loaded DC were then used to stimulate transcripts for DLK1, EphA2, HBB, PSMA, TEM1, autologous CD8" T cells at a T cell-to-DC ratio of 10:1 to VEGFR1 and VEGFR2; iii.)B16 expression of transcripts for generate a bulk population of responder T cells. T cells were 15 NRP1, PDGFRB, VEGFR1 and VEGFR2; iv.) higher levels maintained in IMDM media supplemented with 10% human of DLK1, EphA2, HBB, NRP1, NRP2, PDGFRB, RGS5, AB serum, 100 U/ml penicillin, 100 mg/ml streptomycin, 10 TEM1, VEGFR1 and VEGFR2 transcript expression in mM L-glutamine and MEM non-essential amino acids (all tumor- versus normal kidney-derived stromal cells; and V.) reagents from Invitrogen, except human AB serum that was comparable or greater levels of NG2. PSMA and CD31 tran purchased from Sigma-Aldrich, St. Louis, Mo.). Responder Script expression in normal kidney- versus tumor-derived CD8" T cells were analyzed for reactivity against control stromal cells (FIG. 1B). (HLA-A2") T2 cells or T2 cells pulsed with individual TASA or TAA peptides (1 M for 4 h at 37° C.) at a CD8" T TABLE 3 cell-to-T2 cell ratio of 5:1 for 24 h. Harvested cell-free super Cells expressing TASA in the B16 TME. natants were consequently assessed for hiFN-Y content using 25 a specific ELISA (BD Biosciences, San Diego, Calif.) with a Cells Expressing TASA Cells Expressing TASA lower detection limit of 4.7 pg/ml. TASA Protein (IHC) mRNA (RT-PCR) Statistical Analysis. DLK1 C P (Hi) > VEC (2.1) Student’s two-sided t-test and one-way ANOVA were used Eph A2 VEC VEC (3.3) 30 HBB C P (Hi) > VEC (Hi) to test for overall differences between groups (StatMate III, NG2 C P ATMS Co., Tokyo, Japan), with a p value <0.05 taken as NRP1 P, VEC, TIS P (2.0), T > VEC significant. (Pericyte/VEC interface) Results NRP2 P, VEC P (1.6) Analysis of TASA Expression in the TME. (Intracellular) PDGFRB P - TS P (2.3), T TASA are expressed by pericytes and/or activated VEC 35 PSMA VEC, P (Vesiculated, punctuate) VEC (Komita et al., Cancer Res., 68:8076-8084, 2008; Hatano et RGSS P - TS P (1.7) al., J Transl Med., 2:40, 2004; Maciag et al., Cancer Res., (Cytoplasmic) 68:8066-8075, 2008: Ishizaki et al., Clin Cancer Res., TEM1 T/S, VEC, P P (1.5), VEC (1.6) VEGFR1 VEC, P. T.S (Intracellular/Nuclear) VEC (1.8) > P (2.6), T 12:5841-5849, 2006; Wada et al., Cancer Res., 65.4939 VEGFR2 P > VEC, TIS P (1.6) > VEC (4.5), T 4946, 2005; Kaplanet al., Vaccine, 24: 6994-7002, 2006; Liu 40 *Progressor B16 tumors (day 14) in untreated HHD mice were surgically-resected, then et al., Cytokine, 32:206-212, 2005: Silver et al., Clin Cancer fixed, sectioned and stained using TASA-specific Abs, as described in FIG. 1A and the Res., 3:81–85, 1997: Harada et al., Oncol Rep., 12:601-607, Materials and Methods. Based on co-localization of TASA with the NG2 and for CD31 markers in fluorescence microscopy analyses, a pericyte (P)- and or VEC- association was 2004; Bondjerset al., Am J Pathol., 162:721-729, 2003: Boss assigned with a given marker, respectively. In some cases, TASA were also expressed by NG23, CD313 cells (designated as TS = tumorfstromal) in the TME, which could reflect et al., Clin Cancer Res., 13:3347-3355, 2007: Christian et al., either tumor cells or alternate stromal cell populations. RT-PCR analyses were performed on Am J Pathol., 172:486-494, 2008). An initial panel of 12 45 flow-sorted tumor-derived pericytes and VEC and tumor cells as described in FIG, 1B and the Materials and Methods. Numbers in parentheses reflect the fold increase in expression of antigens was selected for evaluation in the current studies transcripts in tumor versus normal kidneypericytes or WEC, as indicated, after first normal (Table 4). To show that the chosen TASA were indeed izing densitometry signals against B-actin in each case. (Hi) indicates the TASA transcript is expressed in situ by stromal cells in the TME, immunohis expressed by tumor pericytes, VEC, but not normal kidney pericytes VEC. tochemistry analyses were performed using specific antibod Selection of TASA Peptides for Immunologic Analyses. ies on tissue sections isolated from day 14 (HLA-A2") B16 50 Of the selected TASA, HLA-A2–presented epitopes recog melanomas growing progressively in untreated HLA-A2 Tg nized by CD8" T cells have been previously reported for (HHD) mice. Using immunofluorescence microscopy, co human EphA2, NG2, PSMA, RGS5, VEGFR1 and VEGFR2 expression patterns of specific stromal target antigens were (Table 4). Notably, these defined human epitopes share 100% determined with NG2" pericytes and/or CD31* VEC within sequence identity with their murine homologues. To identify the TME. The resulting images are depicted in FIG. 1A, with 55 novel HLA-A2–presented epitopes in the alternate 6 selected a Summary of cellular protein expression profiles provided in TASA, a prediction algorithm (see, e.g., bimas.cit.nih.gov/ Table 3. Based on these imaging analyses, the DLK1, HBB, molbio/hla bind?) was applied to each protein, and non NG2, PDGFRB, RGS5 and VEGFR2 antigens were assigned americ (9-mer) and/or decameric (10-mer) peptides were as predominantly tumor pericyte-associated, and the Eph A2 preferentially chosen for synthesis and corollary analyses and TEM1 antigens as predominantly tumor VEC-associated. 60 based on 2 priority criteria: i.) a high algorithm predicted The NRP1, NRP2, PSMA and VEGFR1 antigens appeared to binding score to the HLA-A2.1 class I molecule, and ii.) be expressed by multiple cell types including pericytes, VEC identity in the human versus murine peptide sequences. This and alternate stromal cells and/or tumor cells within the pro latter restriction was adopted for translational purposes; i.e. to gressive B16 TME. To further corroborate TASA expression insure that specific therapy-induced T cell responses would by NG2" pericytes, CD31" VEC or H-2K" tumor cells 65 need to break operational tolerance in HLA-A2 Tg (HHD) within the TME, these cell populations were flow-sorted from recipient mice in order to provide anti-tumor protection (i.e. enzymatically digested B16 tumors resected from untreated as would also need to occur for protection in HLA-A2" US 9,345,770 B2 53 54 patients with solid cancers). After selection, each of the cho DC.up5)-treated cohort of animals directly recognized HLA Sen synthetic peptides was shown to be competent (to a vary A2 pericytes and VEC flow sorted from single-cell digests of ing degree) to bind and stabilize HLA-A2 complexes B16 tumors (but not kidneys isolated from these same tumor expressed by T2 cells (FIG. 6), a prerequisite to their ability to bearing animals) or HLA-A2's B16 tumor cells (FIG.2B, 2C be presented to specific, HLA-A2-restricted CD8" T cells. and FIG. 7). Tcl recognition of tumor-derived pericytes and TABLE 4. Summary of in vitro results regarding TASA peptides. Specific CDs. T Cell Response

HHD Mice Treated HLA-A2- HLA-A2 HLA-A2 With Normal Melanoma AA Immunogenic SEQ ID Binding it. Donors Patients TASA Positions Peptide Sequence NO: Score DC. IL12 (of 8) (of 10)

DLK1. 269-277 RLTPGWHEL 68 49 -- 1. 4. 31O-318 ILGWLTSLW 2 118 -- 2 6 326-334 FLNKCETWV 3 1760 -- 2 4.

EphA2 883-891 TLADFDPRW 1O 1084 -- 2 6

HBB 31 - 39 RLLWWYPWT 70 227 -- 2 6 105-114 RLLGNWLWCW 72 592 -- 1. 1.

NG2° 77O-778 TLSNLSFPW 83 4 O3 O 4. 2238-2246 LILPLLFYL 14 1356 O 4.

NRP1 331-339 GLLRFWTAW 6 2249 -- 2 7 433 - 441 GMLGMWSGL 7s 131 -- 2 7 869-877 WLLGAWCGW 8 1 OO6 -- 2 1.

NRP2 214-222 DIWDGIPHW 15 56 -- O 4. 328-336 YLOVDLRFL 16 249 -- O 4. 436 - 444 NMLGMLSGL 17 131 O O

PDGFRB 890-898 ILLWEIFTL 81 1792 -- 2 1.

PSMA 441 - 450 LLOERGWAYI 18 92O -- O 2

RGS5/ 5-13 LAALPHSCL 79 1. -- O 5

TEM1 691-700 LLWPTCWFLW 76 1577 -- 4. 4.

WEGFR13 ff O-778 TIFWLLLTL 19 182 -- 1. 3

VEGFR2 773-781 WIAMFFWLL 2O 27 O -- O O **CD8 T cell response data is summarized for i.) HHD mice treated with DC. IL-12 gene therapy (as in FIG. 2C) or ii.) HLA-A2" normal human donors and HLA-A2" patients with melanoma as displayed pictorially in FIG. 4. Human (ELISA) responses were designated as + if CD8" T cell reactivity against T2 cells presenting the indicated peptide (IFN-Y) was >30 pg/ml and more than 2 fold higher than reactivity versus T2 cells pulsed With the negative Control HIV-nef190-198 peptide (p < 0.05). Peptide sequences were submitted to an algorithm predicting binding to HLA-A2, with the deduced scores provided. A higher number reflects the prediction of a more stable HLA-A2-peptide Complex. (see Tatsumi et al., Cancer Res; 63: 4481 – 4489, 2003). (see Maciag et al., Cancer Res., 68: 80.66-8075, 2008). (see Harada et al., Oncol. Rep. , 12: 601-607, 2004). (see Boss et al., Clin. Cancer Res., 13 : 33 47-3355, 2007). 8 (see Ishizaki et al., Clin. Cancer Res., 12: 5841-5849, 2006). (see Wada et al., Cancer Res. , 65 : 4939 - 494 6, 2005).

Delivery of DC.IL12 into HLA-A2's B16 Tumors Pro VEC was completely blocked in the presence of the anti motes the Cross-Priming of CD8 T Cells Reactive Against HLA-A2 mAb BB7.2 (but not an anti-MHC II mAb L243), Tumor Pericytes, VEC and an Array of TASA-Derived Pep supporting the HLA-A2-restricted nature of T cell reactivity. tide Epitopes in HHD Mice. 55 Splenic CD8" T cells from DC.IL12- (but not control DC-) DC.IL12 were prepared and injected directly into subcu treated animals also responded against an array of TASA taneous (HLA-A2") B16 melanomas growing progres derived peptides when presented by HLA-A2 T2 cells in sively in HLA-A2 Tg HHD mice on days 7 and 14 post-tumor vitro (FIG. 2C). A non-limiting explanation for ability of inoculation. On day 19 post-tumorinoculation, the mice were 60 these murine (HHD) CD8" T cells to recognize TASA-de euthanized and CD8" splenic T cells were analyzed for their rived peptides in the context of the human T2 cell line is that ability to secrete IFN-Y in response to stimulation with TASA these Tcl effector cells exhibit moderate-to-high avidity for derived peptides presented by the HLA-A2 T2 cell line. specific epitopes, since the murine CD8 co-receptor interacts Intratumoral delivery of DC.IL 12 resulted in dramatically inefficiently with the human HLA class I C3 domain (Kuball reduced tumor growth (FIG. 2A; p<0.05 versus vs. DC. p5 65 et al., Immunity, 22:117-129, 2005) expressed by T2 cells. treated or untreated controls after day 11). Furthermore, The impact of therapy on the ability of CD8" tumor-infil splenic CD8" T cells isolated from the DC.IL12 (but not trating lymphocytes (TIL) freshly-isolated from day 17 US 9,345,770 B2 55 56 tumors to recognize flow-sorted pericytes and VEC, as well effect occurs via cross-presentation mediated by HLA-A2" as, TASA peptides presented by T2 cells was assayed. Using APCs emigrating from the TME (Zhang et al., J Exp Med., both intracellular IFN-Y staining (FIG.3A) and CD107 trans 204:49-55, 2007). location (FIG. 3B; i.e. a measure of effector T cell degranu lation associated with perforin/granzyme-dependent lysis; TABLE 5A (Mittendorf et al., Breast Cancer Res Treat., 92:85-93, 2005) assays, it was observed that 3-12% of CD8"TIL isolated from Normal donor and melanoma patient demographics animals treated with DC.IL 12 mediated effector Tcl responses against tumor (but not kidney)-derived pericytes and responsiveness to TASA.* and VEC. Similar frequencies of CD8" TIL from the 10 DC.IL12-treated cohort of mice recognized TASA peptides Donor Age Sex Stage Prior Therapy presented by T2 cells (FIG.3A, FIG.3B). The ability of target cells to elicit effector responses from CD8"TIL isolated from ND1 51 M NA NA DC.IL12-treated mice was blocked by anti-HLA-A2 (but not ND2 62 NA NA anti-class II) mab and these T cells display only background 15 ND3 37 M NA NA reactivity against HLA-A2's B16 tumor cells (FIG. 8). In contrast, the frequency of TASA-specific CD8" TIL isolated ND4 28 M NA NA from untreated or DC. p5-treated melanoma was lower (ver ND5 50 NA NA sus DC.IL12 treatment) in all functional analyses performed ND6 32 NA NA (FIGS. 2C, 3A, 3B, 8). ND7 26 M NA NA CD8 T Cells from HLA-A2 Normal Donors or HLA ND8 38 NA NA A2" Melanoma Patients Recognize TASA-Derived Peptides Mel1 62 IIA S In Vitro. Mel2 69 M IV Anti-CTLA4 To assess whether the TASA-derived peptides identified in Mel3 55 IIC C the HHD tumor model were also capable of being recognized 25 by human CD8" T cells, IVS was performed using T cells Mel4 87 IIC MAA- VAC, IL-2 isolated from the peripheral blood of HLA-A2" donors or Mel5 65 M IV C, R HLA-A2" patients with melanoma. DC were pulsed with Mel6 71 M IV GM2-KLH peptides derived from a given TASA for 4 h at 37°C., then Me7 56 IV C washed and used as stimulator cells for autologous CD8" T 30 Mel8 64 IV C, IFN cells. In cases where more than one peptide existed for a given protein, DC were pulsed with an equimolar (10 LM) mixture Mel9 62 IV C, IFN of each peptide. Two rounds of IVS using TASA for normal Mel10 56 M IV C, IFN, IL-2 donors and a single-round of IVS using TASA for melanoma *Abbreviations used in Table 5A: AD, Active disease; C, Chemotherapy; CTLA-4, Cyto patients was applied. HLA-A2" normal donors (FIG. 4; 35 totoxic T lymphocyte antigen-4; DC, dendritic cell, F. Female; IFN, Interferon-O, DL-2, Interleukin-2; GM2, Ganglioside M2; KLH, Keyhole limpet hemocyanin; M, Male; NED, Tables 4, 5A and 5B) and melanoma patients (FIG. 4: Tables No evidence of disease;R,Radiotherapy; S, Surgery;MAA, Melanoma-associated antigen; 4, 5A and 5B) were each capable of recognizing many of the WAC, Vaccine, TASA-derived peptides. TABLE 5B Normal donor and melanoma patient demographics and responsiveness to TASA: Specific CD8 T cell Production of IFN-Y in Response to TASA. Donor DLK1 EphA2 HBB NG2 NRP1 NRP2 PFGFRB PSMA RGS5 TEM1 VEGFR1 VEGFR2

ND1 -- ND2 -- -- ND3 -- ND4 -- ND5 -- -- ND6 ND7 ND8 Mel1 ------Mel2 -- -- Mel3 Mel4 ------Mel5 -- Mel6 ------Me7 -- Mel8 -- Mel9 Mel10

As shown in FIG. 5, in the HHD recipient mouse model Human responses were designated as + if T cell reactivity system, protective HLA-A2-restricted Tcl cells failed to rec against T2 cells presenting the indicated peptide (IFN-y ognize HLA-A2" B16 tumor cells, even though CD8" T ELISA) was >30 pg/ml and more than 2 fold higher than cells appeared to be cross-primed against HLA-A2–presented 65 reactivity versus T2 cells pulsed with the negative B16 melanoma-associated antigens such as MART-1 and control HIV-nefos peptide (with p-0.05 versus T2+HIV gp100. A non-limiting explanation for this result is that the nefigo-19s). US 9,345,770 B2 57 58 Without being bound by theory, this data suggests the lation and prepared for fluorescence imaging, as described translational utility of TASA peptides in the context of active below. For therapeutic experiments, MC38 (2x10) or B16 vaccination protocols and/or clinical trials implementing melanoma cells (1x10) were injected subcutaneously in the immunotherapeutic/anti-angiogenic approaches (including right flank and allowed to establish/progress for 7 days, at IL-12p70 gene therapy, tyrosine kinase inhibitors (TKI) or which time, the mice were randomized into cohorts of 5 mice VEGFR antagonists) for the treatment of solid cancers, such each, with each group exhibiting an approximate mean tumor as melanoma. size of 50-75 mm. Mice were then untreated or treated with control, syngenic DC.IL12 or DC.IL12 (10° cells injected Example 2 subcutaneously in the left flank on days 7 and 14) pulsed with 10 synthetic TBVA peptides. In some assays, as indicated, in Vaccines Targeting Tumor Blood Vessel Antigens vivo antibody depletions (on days 6, 13 and 20 post-tumor Promote CD8" T Cell-Dependent Tumor Eradication inoculation to assess early involvement or on days 60 and 67 or Dormancy in HLA-A2 Transgenic Mice or 180 and 187 to assess late involvement) of protective CD4" T cells or CD8" T cells were performed and monitored as This example illustrates that therapeutic vaccination of 15 previously described (Zhao et al., Mol Ther:, 19:805-814, HHD mice with TBVA-peptides results in CD8" T cell-de 2011). In all cases, tumor size (area) was monitored every 3-4 pendent regression of colon carcinoma and melanoma and days and is reported as mean+/-SD in mm. long-term protection against disease relapse. Evaluation of Specific CD8" T Cell Responses in HHD Materials and Methods Mice. Mice. MACS (Miltenyi Biotec) CD8" splenocytes were har HHD mice are D'x3-microglobulin (BM) null, trans vested (from 3 mice/group) 7 days after the second round of genic for the modified HLA-A*0201-h2-microglobulin DC-based vaccination (i.e. day 21 after tumor inoculation) single chain (HHD gene; Firat et al., 1999, Eur: J. Immunol. and analyzed for reactivity against unpulsed T2 cells, 29: 3112-3121) and exhibit CD8" T cell responses that reca TBVA peptide-pulsed T2 cells, or day 19 (flow-sorted) B16 pitulate those observed in HLA-A2" human donors (28-30). 25 derived PDGFRB"CD31*H-2K's pericytes or PDG C57BL/6 wild-type mice were purchased from The Jackson FRB's CD31H-2K's VEC isolated as previously Laboratory (Bar Harbor, Me...). Female 6-8 week old mice described (Zhao et al., Mol Ther., 19:805-814, 2011). Where were used in all experiments and were handled in accordance indicated, 10 ug of anti-HLA-A2 mAb BB7.2 or control with an Institutional Animal Care and Use Committee anti-class II mAb L243 (both from ATCC, Manassas, Va.) (IACUC)-approved protocol. 30 were added to replicate co-culture wells. After 48 h, superna Cell Lines. tants were analyzed for mIFN-Y content by specific ELISA MC38, a methylcholanthrene-induced (HLA-A2") (BD-Biosciences; lower detection limit 31.3 pg/ml). Data murine colon carcinoma cell line and B16 an HLA-A2's are reported as the meant-SD of triplicate determinations. melanoma cell line (syngenic to the H-2' background of HHD RT-PCR. mice) have been described previously (Yamaguchi et al., 35 Reverse transcriptase-PCR (RT-PCR) was performed 2007, Cancer 110: 1469-1477, Hatano et al., 2004, J. Transl. using primer pairs as described in Example 1. Med. 2: 40). The T2 cell line is a TAP-deficient T-cell/B-cell Fluorescence Imaging of Tumor Sections. hybridoma that constitutively expresses HLA-A2 (Stuber et Tumor tissue samples were prepared and 6 micron sections al., 1994, Eur: J. Immunol. 24: 765-768). All cell lines were prepared as previously reported (Komita et al., Cancer Res., free of mycoplasma contamination. 40 68:8076-8084, 2008). The following Abs were used: (for T Peptides. cell analyses), rabbit anti-mouse NG2 (Millipore, Bedford, All peptides were synthesized using 9-fluorenylmethoxy Mass.) and alexa488-conjugated anti-CD4 or -CD8f3 anti carbonyl (Fmoc) chemistry. Peptides were >96% pure based bodies or matching isotype controls (all from BD-Bio on high performance liquid chromatography profile and mass sciences): (for vascular analyses), ratanti-mouse CD31 (BD spectrometric analysis. 45 Biosciences) and rabbit anti-mouse NG2 (Millipore) Abs: Production of Murine Bone Marrow (BM)-Derived DCs (for TBVA), rat anti-mouse CD31 (BD-Biosciences) and and DC.IL12. guinea pig anti-mouse NG2. Abs, along with anti-TBVA as DC were generated from BM precursors isolated from the described in Example 1. Imaging was performed using an tibias/femurs of HHD mice, as previously described (28). The Olympus FluoView 500 Confocal microscope (Olympus AdmIL-12p70 and Adup5 (empty) recombinant adenoviral 50 America, Center Valley, Pa.). vectors were produced as reported previously (34). Five mil Cutaneous Wound Healing Assays. lion (day 5 cultured) DCs were infected at MOI =50 with Ad Wound healing analyses were performed in HHD mice as mIL-12p70 or the control, empty vector Adup5. While control described by Maciag et al. (Maciag et al., Cancer Res., DC produced <62.5 pg. IL-12p70/ml/48 h/10 cells, DC.IL12 68:8066-8075, 2008). cells produced 1-10ng IL-12p70/ml/48 h/10° cells (Komita et 55 Statistical Analysis. al., Cancer Res., 68:8076-8084, 2008). Two-tailed Student's t-test or two-way ANOVA were used Vaccine Experiments. to test overall differences between groups (StatMate III, For prophylactic experiments, HHD mice were immunized ATMS Co., Tokyo, Japan), with p-values <0.05 considered subcutaneously on the right flank with 100 ul PBS or PBS significant. containing 10° syngenic DC.IL12 cells that had been 60 Results untreated or pre-pulsed for 4 hat 37°C. with 10 uM synthetic Vaccines Incorporating Peptide Epitopes Derived from peptide(s). Immunizations occurred on dayS-14 and -7, with TBVA are Immunogenic and Protect HHD Mice Against mice subsequently receiving injections of MC38 (2x10) HLA-A2's MC38 Tumor Challenge. tumor cells in the left flank on d0. In all cases, treatment To assess the immunogenicity of TBVA-derived peptides, groups contained 5 mice per cohort. For analysis of tumor 65 female HLA-A2Tg (HHD; lacking murine H-2” class I mol cellular composition in repeat experiments, MC38 tumors ecules) mice were vaccinated twice on a weekly schedule were isolated by Surgical resection 10 days after tumorinocu with 10° peptide-pulsed, (HHD) DC.IL12 cells. One week US 9,345,770 B2 59 60 after the booster immunization, CD8 splenocytes were iso Given the robust anti-tumor activity noted for vaccines lated and analyzed for their ability to secrete IFN-Y in based on a subset of TBVA in the prophylactic model, the response to peptide-pulsed HLA-A2" T2 cells in vitro. As efficacy of these vaccines as immunotherapies in mice bear shown in FIG.9A, the majority (17/20, p<0.05 versus T cells ing established day 7 subcutaneous MC38 or B16 tumors was stimulated with DC only) of TBVA-derived peptides ana assayed. In the MC38 model, HHD mice were treated with lyzed primed Tcl responses in vivo that could be detected in DC.IL12 cells pulsed with (an equimolar mixture of) peptides derived from TBVA shown most capable of regulating tumor vitro. growth under prophylactic conditions (FIG. 9B) and exhibit The DLK1, EphA2, HBB, NG2, NRP1, NRP2, PDGFRB, 10 ing the highest degree of immunogenicity based on data pro PSMA, RGS5, TEM1, VEGFR1 and VEGFR2 antigens were Vided in FIG.9A (i.e. DLK1, EphA2ss so, HBB-9. expressed in situ by blood vessel cells in the MC38 colon NRP1869-877, PDGFRBsoo-sos, RGS55-1s and TEM1691-7oo). carcinoma TME (FIG. 14). Protection of HHD mice againsta As shown in FIG. 11A, the combination peptide vaccine challenge with HLA-A2" MC38 tumor cells injected sub effectively promoted the regression of established MC38 cutaneously on day Zero was assayed with immunization with 15 tumors. Furthermore, based on Ab-depletion analyses, thera TBVA-derived peptides on days-14 and -7. As depicted in peutic benefit was largely due to the action of CD8", but not FIG. 9B, vaccines incorporating peptides from the TBVA CD4", T cells (FIG. 11A). DLK1, EphA2, HBB, NRP1, PDGFRB, RGS5 or TEM1 were Therapeutic vaccines applied to mice bearing B16 mela effective in preventing HLA-A2" MC38 tumor establish nomas were also effective in Suppressing tumor growth if i) ment or they resulted in the regression of tumors (after a the vaccine-incorporated peptides derived from the stromal transient period of establishment) in HHD mice. In contrast, antigens DLK1, EphA2, HBB, NRP1, RGS5 (and to a lesser extent TEM1) and ii) recipient mice were competent to vaccines based the TBVANG2, NRP2, PSMA, VEGFR1 or respond to these peptides in an HLA-A2-restricted manner VEGFR2 yielded minimal protection (FIG.9B). Based on the 25 (FIG. 11B). Hence, none of the vaccines evaluated perturbed data provided in FIG.9, vaccine immunogenicity and efficacy B16 tumor growth in syngenic B6 mice, which fail to express were not always correlated with one another in the MC38 the relevant HLA-A2 class I restriction element required for prophylaxis model (FIG. 16), a finding in accordance with CD8" T cell recognition of the immunizing peptides. reports for peptide-based vaccines in human clinical trials 30 HHD Mice Cured of B16 Tumors by TBVA Peptide-Based (Jandus et al., Pigment Cell Melanoma Res., 22:711-723, Therapeutic Vaccines Exhibit Extended Survival and Durable 2009; Vujanovic and Butterfield, J. Cell. Biochem., 102:301 Tcl Responses Against Tumor-Associated Pericytes and/or 310, 2007: Yu and Restifo, J. Clin. Invest., 110:289-294, VEC, and Spreading in Anti-TBVA CD8" T Cell Repertoire. 2001). 35 Mice treated as in FIG. 11B were followed through 60 days Protective Vaccines Incorporating TBVA Peptides Pro post-tumorinoculation and observed significant Survival ben mote Enhanced Infiltration of the TME by CD8" T Cells in efits if the animals had been treated with vaccines containing Association with an Inhibition of Tumor Vascularity. peptides derived from the TBVA DLK-1, EphA2, HBB, MC38 tumor lesions from all cohorts of animals with evi NRP1, RGS5 or TEM1 (FIG. 11C, Table 6). To analyze the dence of disease on day 14 (post-tumor inoculation) were 40 status and specificity of Tcl cells, HHD mice rendered free of isolated and immunofluorescence microscopy on tumor sec B16 melanoma after therapeutic vaccination with DLK or tions was performed. Although control (untreated or vacci RGS5 peptide-based vaccines were sacrificed 60 days after nated with DC.IL12/no peptide) mice contained few CD8"T tumorinoculation. Fresh MACS-isolated spleen CD8" T cells cells in the TME, the majority of the peptide vaccinated 45 were then analyzed for reactivity against HLA-A2"PDG cohorts exhibited a variable, but significantly elevated num FR3"CD318 pericytes, HLA-A2"PDGFRB-3CD31* VEC ber of CD8" TILs (FIG. 10A, FIG. 10B). In marked contrast, or HLA-A2" tumor cells flow-sorted from day 19 B16 CD4 T cell infiltration in the TME was sparse and the data tumors growing progressively in untreated HHD mice. As were indistinguishable when comparing control vs. Vacci 50 shown in FIG. 12, splenic Tcl cells isolated from mice cured nated mice (FIG. 17). An analysis of vascular structures in after vaccination with DLK1 peptides recognized tumor-as these tumors revealed that mice pre-vaccinated with peptides sociated pericytes and VEC in an MHC class I-restricted derived from the TBVA EphA2, RGS5 or TEM1 had the manner. They failed to recognize pericytes or VEC isolated greatest degree of suppression in CD31 vessel counts in the from the tumor-uninvolved kidneys of these same donorani MC38 TME, with somewhat less pronounced effects also 55 mals. These Type-1 CD8" T cells strongly recognized the noted for groups vaccinated against HBB or VEGFR2 (FIG. DLK1 peptides used in the protective vaccine formulation, 10C, 10D; p<0.05 vs. untreated mice or mice vaccinated with but also (to a variable degree), a number of additional TBVA DC.IL12/no peptide). Correlative analyses indicated an asso derived peptides that were not included in the therapeutic ciation between the anti-tumor efficacy of vaccines and their 60 vaccine. Similarly, B16-bearing HHD mice cured using a ability to promote CD8 T cell infiltration and reduced vas vaccine based on the RGS5s. peptide, demonstrated clear cularity in the TME (FIG. 16). Tcl recognition of tumor (but not tumor-uninvolved kidney) Therapeutic Vaccines Incorporating TBVA-Derived Pep pericytes, as well as, statistically-significant response against tide Epitopes are Effective Against Established HLA-A2's 65 HLA-A2" T2 cells pulsed with peptides derived from the MC38 Colon Carcinomas and HLA-A2' B16 Melanomas TBVA DLK1, EphA2, NG2, NRP1, PSMA, RGS5 or TEM1 in HHD Mice. (FIG. 12). US 9,345,770 B2 61 62 TABLE 6 In vivo immunocenicity and anti-tumor efficacy of TBVA-based vaccines in HHD models.

Tc1 Response Anti-tumor Anti-tumor to efficacy in efficacy in Peptide MC38 B16 therapy AA Waccine protection model TASA Positions Peptide Sequence SEQ ID NO (HHD) model (survival: pvalue)

DLK1. 269-277 RLTPGWHEL 68 -- -- OO13 31O-318 ILGWLTSLW 2 -- 326-334 FLNKCETWW 3 --

Epha2 883-891 TLADFDPRW 1O -- -- . OO12

HBB 31 - 39 RLLWWYPWT 70 -- -- . OO12 105-114 RLLGNWLWCW 72 --

NG2 77 O-778 TLSNLSFPW 83 -- NS 2238-224 6 LILPLLFYI 14

NRP1 331-339 GLLRFWTAW 6 -- -- OO13 433 - 441 GMLGMWSGL 7s -- 869-877 WLLGAWCGW 8 --

NRP2 214 - 222 DIWDGIPHW 15 -- NT 328-336 YLOVDLRFL 16 436 - 444 NMLGMLSGL 17

PDGFRB 890-898 ILLWEIFTL 81 -- -- NS

PSMA 441 - 450 LLOERGWAYI 18 -- NT

RGS5 5-13 LAALPHSCL 79 -- -- . OO12

TEM1 691 - 7 OO LLWPTCWFLW 76 -- -- . O1 O2

WEGFR1 770- 778 TLFWLLLTL 19 -- +/- NS

WEGFR2 773 - 781 WIAMFFWLL 2O -- +/- NS

Data are summarized from FIG. 9 and FIG. 11. 2 +, p < 0.05 versus DC only. vaccines consisted of DC. IL12 pulsed with a pool of 1 or more peptides derived from the indicated TEVA. +/-, p < 0.05 versus DC Only for 2 Consecutive time points; +, p < 0.05 versus DC only for >2 Consecutive time points; - not significant at any time point analyzed. p-value versus mice treated with DC only vaccine (from FIG. 11C). NS, not significant; NT, not tested. 40 HHD Mice Cured of B16 Tumors by TBVA Peptide-Based where more than one peptide is identified for a given TASA, Therapeutic Vaccines Either Exhibit True “Molecular Cures” an equimolar pool of the indicated peptides (each 10LM) was or a State of CD8" T Cell-Mediated Tumor Dormancy. pulsed onto DC.IL12 and used for vaccination in the relevant Effectively-treated HHD mice with no evidence of (mac cohort. On d0, mice were anesthetized, with skin on the upper roscopic) disease were depleted of CD8 or CD4 T cells on 45 back shaved and sterilized topically, before placement of two days 60 and 67, or 180 and 187 by injection of specific 3-mm diameter wounds using a sterilized punch biopsy antibodies in vivo. As shown in FIG. 13, depletion of CD8"T instrument. Wounds were not treated consequently and no cells, but not CD4 T cells, resulted in the re-establishment of infections were observed in any animals. The time to closure melanoma growth at sites of the primary tumor placement in 50 for the 10 wounds/cohort (2 sites/animalx5 mice/group) was 7/9 (i.e. 78% for depletions on days 60/67) and 3/8 (i.e. 38% assessed daily and is reported as the mean number of days+/- for depletions on days 180/187) cases, respectively. Interest SD for complete wound closure (FIG. 18). ingly, 2/9 (22%) mice in the day 60/67 CD8" T cell-depleted To determine expression of selected TASA in tissue, RT group exhibited transient tumor expansion and then “sponta PCR analysis of “stromal' antigen expression by pericytes, neous” regression over a period of weeks-to-months (FIG. 55 VEC and tumor cells in MC38 tumor-bearing mice was 13); a non-limiting explanation for this finding is that TBVA/ examined (FIG. 15). MC38 colon carcinoma cell lines, as tumor-specific CD8" T effector cells recovered in these ani well as, flow-sorted tumor- and tumor-uninvolved kidney mals. Additionally, at the time of primary disease recurrence associated pericytes and VEC (isolated from HHD mice bear in CD8" T cell-depleted animals, melanomas did not present ing untreated day 14 tumors) were analyzed for expression of in distal cutaneous sites and that metastases were not detected 60 the indicated mRNAs using RT-PCR. As shown in FIG. 15, in the lung, liver or brain based on a histopathology exami several of the selected TASA were expressed in the examined nation of resected tissues. tissue. To show that that prior vaccination against TASA does not Thus, a subset of TBVA-derived peptides elicit protective/ inhibit wound-healing in HHD mice, female HHD mice (5 therapeutic immunity against HLA-A2' (MC38 or B16) animals/cohort) were vaccinated in the rightflank on d-14 and 65 transplantable tumors in HHD mice due to the apparent CD8" d-7 with saline, 106 DC.IL12 alone or 106 DC.IL12 pulsed T cell targeting of HLA-A2" pericytes or VEC in the TME. with peptides derived from the indicated TASA. In cases Without being bound by theory, because similar peptide US 9,345,770 B2 63 64 based vaccines applied to CD8-depleted HHD mice or HLA Success, vaccines promoting specific Tcl recognition of A2's recipient (C57BL/6) mice failed to yield treatment tumor vascular cell (i.e. pericytes, VEC) populations can be benefit, indicating involvement of CD8" T cells and the need used (see, for example, Komita et al., 2008, Cancer Res. for these effector cells to target HLA-A2" stromal cells in 2008; 68:8076-8084). vivo. Additionally, many responders in the therapeutic vac As disclosed below, pericytes isolated from RCC, but not cine models retained occult disease, since CD8", but not normal kidney tissue, express the DLK1 antigen in vivo. CD4. T cell depletion of such animals resulted in the rapid Using immunofluorescence microscopy and real-time PCR recurrence of tumors selectively at the site of the original the NOTCH antagonist delta-like kinase-1 (DLK1) was iden primary lesion in many cases. While in most instances, recur tified as an antigen differentially expressed by blood vessel rent tumors grew quickly and proved lethal, in Some cases 10 pericytes in highly-vascularized renal cell carcinoma (RCC) (i.e. 2/10), tumors grew slowly and Subsequently underwent tumors, but not in normal kidney tissue. DLK1 peptide- and spontaneous regression presumably after the Ab-depleted gene-based vaccines applied to mice bearing established CD8" T cell repertoire had recovered. Without being bound RCC tumors provided therapeutic benefits in association with by theory, these data indicate that TBVA peptide-based vac tumor blood vessel normalization (based on decreased vas cines can promote either complete eradication of tumors or 15 cular permeability and intratumoral hypoxia) and the activa the establishment of a state of (occult) tumor dormancy over tion and recruitment of CD8" T cells into the tumor microen extended periods of time which is regulated by vaccine-insti vironment (TME). Post DLK1-based vaccination, the TME gated CD8" T cells. was characterized by increased expression of VCAM1" CD31" vascular endothelial cells and the CXCL10 (IP-10) Example 3 chemokine associated with Superior recruitment of Type-1 (IFN-Y producing) proinflammatory T effector cells and a Therapeutic Vaccination Against Tumor dramatic reduction in Jarid 1B", CD133 and CD44 stem cell Pericyte-Associated Antigen DLK1 populations. DLK1 peptide- or gene-based vaccines are both immuno This example provides evidence that the NOTCH antago 25 genic and therapeutic in the RENCA model of RCC. Effec nist delta-like kinase-1 (DLK1) peptides can be used thera tively treated RCC tumors displayed vascular normalization peutically, Such as, but not limited to, in treatments for renal based on reduced vascular leak and tissue hypoxia, and were cell carcinoma. highly-infiltrated by CD8" TIL in the perivascular space. Renal cell carcinoma is highly-vascularized and refractory Residual pericytes in the TME were tightly-approximated to to conventional chemo-/radio-therapy (Motzer and 30 CD31* VEC and were deficient in expression of DLK1, Sup Bukowski, J. Clin Oncol. 2006:24:5601-5608). Current first portive of vaccine-induced immunoselection of mature mural line therapeutic agents for RCC patients include anti-angio cell populations in vivo. The results support that vaccines genic drugs (such as tyrosine kinase inhibitors (TKI) or anti targeting tumor-associated vascular antigens can be used for VEGF antibodies) have yielded high rates of objective RCC therapy, and for the treatment of other vascularized solid clinical response (Escudier et al., J. Clin Oncol. 2009: 35 cancers. Vaccines promoting immune targeting of tumor-as 27:4068-4075; Naijar and Rini. Ther Adv. Med Oncol. 2012: Sociated vascular cells are a therapeutic modality permitting 4:183-194). However, responder patients typically relapse durable normalization of blood vessels in solid cancers, quickly based on the evolution of treatment-refractory dis including RCC ease (Helfrich et al., J Exp Med. 2010; 207:491-503). Given Material and Methods such limitations in durable clinical benefits associated with 40 Mice. existing treatment options, there remains a great need to Female 6-8 week old BALB/c mice were purchased from develop alternative and/or improved therapies for patients The Jackson Laboratory (Bar Harbor, Me.) and maintained in with RCC. In this regard, RCC is considered an immunogenic a pathogen-free animal facility. cancer as patients may exhibit immune-associated spontane Tumor Cells. ous or therapeutic tumor regression (Finke et al., Ann NY 45 The mouse renal cell carcinoma cell line RENCA was AcadSci, 1988: 532:387-394; Muul et al., J Immunol. 1987: purchased from the American Type Culture Collection 138:989-995; Lokich, Am J Clin Oncol. 1997: 20:416-418). (ATCC, Manassas, Va.) and cultured in complete media as Hence, novel therapies capable of improving the magnitude previously reported (Komita et al. Cancer Res. 2008: and recruitment of protective immunity into the TME could 68:8076-8084). The cell line was negative for known mouse expand and prolong clinical benefits, and their development 50 pathogens, including mycoplasma. remains a mandate. Stromal Cell Isolation. High-dose cytokine therapy promotes durable complete Human RCC tumor and adjacent (patient-matched) normal responses in a minority of treated RCC patients, however, kidney specimens were analyzed. Murine RCC tumors and off-target toxicities have limited general use of this approach tumor uninvolved kidneys were harvested surgically after (Biswas and Eisen, Nat Rev Clin Oncol. 2009; 6:478-487), 55 euthanasia, 21 days after s.c. injection of 10° RENCA cells and more specific/focused immunotherapy approaches are into Syngenic BALB/c recipient animals. Human and murine warranted. Vaccines targeting cancer cell-associated antigens tissues were then minced manually, enzymatically digested, are safe and immunogenic in the clinical setting, but they have and pericytes and VEC isolated by flow sorting, as previously limited curative value (Vijuanovic and Butterfield, J Cell Bio described (Crisan et al., Cell Stem Cell. 2008: 3:301-313). chem. 2007: 102:301-310). While many factors could limit 60 Murine cells were labeled with anti-mouse CD34-FITC the effectiveness of current cancer Vaccines, major obstacles (eBioscience, San Diego, Calif.), anti-mouseCD146-PE to success include poor delivery and/or functional stability of (BD-Biosciences, San Diego, Calif.), and anti-mouse CD45 vaccine-induced tumor infiltrating lymphocytes (TIL) and APC (BD-Biosciences) prior to sorting into pericyte phenotypic heterogeneity of tumor cell populations permit (CD146"CD34*SCD458) and VEC (CD146"CD34" ting immune evasion in Vivo (Ahmed et al., Curr Cancer 65 CD45') populations using a multi-color fluorescence-acti Drug Targets. 2008; 8:447-453, Zhao et al., JImmunol. 2012: vated cell sorter (FACSAria; BD Biosciences). In all cases, 188: 1782-1788). To circumvent such limitations to treatment cells were >95% pure for the stated phenotype. US 9,345,770 B2 65 66 Real-Time PCR. mice bearing established (day 10; right flank) s.c. RENCA Messenger RNA was isolated from pericytes and VEC tumors received a single left flank intradermal injection of using the RNeasyR Plus Micro kit (Qiagen, Valencia, Calif.) lvDLK1 or negative control lv.NEG at a dose of 40 TU or 200 according to manufacturer's instructions. cDNA was then TU in a total volume of 50 ul PBS. For all animal experiments, generated using High Capacity RNA-to-clNA kit (Applied tumor size was assessed every 3 to 4 days and recorded in Biosystems, Carlsbad, Calif.) according to manufacturers mm, as determined by the product of orthogonal measure instructions. Real-time PCR was performed using Fast ments taken using Vernier calipers. Data are reported as mean SYBR(R) Green Master Mix (Applied Biosystems) with tumor area SD. primer pairs for human or mouse HPRT1 (Qiagen), human Evaluation of Specific CD8" T Cell Responses In Vitro. DLK1 (Applied Biosystems) or mouse DLK1 (forward 10 Spleens were harvested from 3 mice per group 7 days after primer: TGTGACCCCCAGTATGGATT, SEQ ID NO: 63, the second DC injection. Splenocytes were then stimulated in reverse primer: CCAGGGGCAGTTACACACTT, SEQ ID vitro for 5 days with syngenic DC pulsed with an equimolar NO: 64). Reactions were performed in duplicate in a 96-well (10 uM) mix of the 3 DLK1 peptides applied in the vaccine. reaction plate on a StepOnePlus real-time PCR thermocycler Responder CD8" T cells were then isolated using magnetic (Applied Biosystems). Cycling conditions were 95°C. for 20 15 bead cell sorting (Miltenyi Biotec) and co-cultured with DC min., then 35 cycles of 95°C. for 3 min. and 60°C. for 30 min. pulsed with individual DLK1 peptides for 72 h,37°C. and 5% In Vitro Generation of Bone Marrow-Derived Dendritic CO, at which time cell-free supernatants were analyzed for Cells (DC) and DC.IL12. IFN-Y content using a cytokine-specific ELISA (BD-Bio DC were generated in 5-day rIL-4+rGM-CSF-supple Sciences). mented cultures from bone marrow precursors isolated from Fluorescent Imaging of Tumors. the tibias/femurs of BALB/c mice infected with recombinant Tumor tissue samples were prepared and sectioned as pre adenovirus encoding mouse IL-12p70 (yielding DC.IL12), as viously reported (Komita et al., Cancer Res. 2008; 68:8076 previously described (Zhao et al., Mol Ther: 2012; 19:805 8084). Six-micron tissue sections were analyzed for expres 814). sion of CD31 (BD-Biosciences), VCAM1 (R& D Systems, Synthetic Peptides. 25 Minneapolis, Minn.), CXCL10 (R&D Systems), NG2 (Mil The H-2 class I-presented DLK1ss (CPPGFSGNF: lipore, Billerica, Mass.), DLK1 (Santa Cruz), RGS5, Jarid1b presented by H-2L), DLK1-go (GFSGNFCEI; presented (all from Abcam: Cambridge, Mass.), CD133 (BD-Bio by H-2K), DLK1.so (TILGVLTSLVVL; containing Sciences), CD44 (Abcam) by immunofluorescence micros Overlapping DLK1259-267 and DLK1262-27o sequences pre copy. For analysis of cellular apoptosis, tissue sections were sented by H-2K) peptide were synthesized as previously 30 labeled using TUNEL kit (Roche: Indianapolis, Ind.) as per described (Zhao et al., J Immunol. 2012; 188: 1782-1788). manufacturers instructions, followed by incubation with sec Recombinant Lentiviral Vector Production. ondary anti-streptavidin Cy3 antibody (Jackson Immunore Genes encoding mDLK1 and the reverse sequence of search, West Grove, Pa.). Some sections were analyzed by mRGSS (as a negative control) were cloned into the plentiG/ confocal microscopy to generate 30 um3-dimensional recon V5D-TOPO vector downstream of the CMV promoter using 35 structions of images. For the vascular permeability imaging, the Lentiviral Directional TOPOR Expression Kit (Invitro animals received retro-orbital intravenous injections of gen, Grand Island, N.Y.). To determine insert presence in the FITC-labeled tomato lectin (Sigma) and red 20 nm FLUO plasmid, expression of the V5 tag was detected by immunof SPHERES(R) (Invitrogen), followed by cardiac perfusion of luorescence using an anti-V5 FITC antibody (Invitrogen) and PBS and 4% paraformaldehyde. Tumors were then immedi by Western blot using an anti-V5 HRP antibody (Invitrogen). 40 ately resected and imaged by confocal microscopy to gener In the initial production of the lentiviruses, 293FT cells (Invit ate 17 um 3-dimensional reconstructions. rogen) were transfected with plasmid DNA plenti-DLK1 (or Hemoglobin Quantitation. pLenti-NEG) using VIRAPOWERTM Packaging Mix (Invit The amount of hemoglobin contained in tissues was quan rogen) combined with Lipofectamine 2000 (Invitrogen) titated using the Drabkin method (Klungsoyr et al., Scand J according to the manufacturer's instructions. After 48 hours, 45 Clin Lab Invest. 1954; 6:270-276). Hemoglobin content is lentivirus was collected and concentrated using a Fast-Trap reported as Jug Hb per mg wet weight of tissue. Virus Purification and Concentration kit (Millipore). Lentivi Measurement of Tumor Hypoxia Using Pimonidazole. ral (lvDLK1 and lv.NEG) titers, reported in transduction units BALB/c mice bearing established (treated or untreated) (TU), were determined by quantitating blasticidin (Invitro day 21 s.c. RENCA tumors were injected intraperitoneally gen)-resistance in HT-1080 cells according to the manufac 50 (i.p.) with 60 mg/kg pimonidazole hydrochloride (HYPDX turers instructions. Expanded lentiviral production was per YPROBETM; HPI Inc., Burlington, Mass.) 30 min prior to formed by the University of Pittsburgh Cancer Institute euthanasia and tumor harvest and 6 um tissue sections pre Lentiviral Vector Core Facility. Lentivirus quality was pared and analyzed by immunohistochemistry as previously assessed by infecting HT-1080 cells for 24 h and monitoring reported (Komita et al., Cancer Res. 2008; 68:8076-8084). cells for coordinate V5 protein expression (Western blot) and 55 Statistical Analysis. cell-surface expression of DLK1 (flow cytometry using an Comparisons between groups were performed using a two anti-DLK1-PE antibody; Adipogen, San Diego, Calif.). tailed Student's t test or one-way Analysis of Variance Animal Therapy Experiments. (ANOVA) with Tukey post-hoc analysis, as indicated. All BALB/c mice received s.c. injection of 10 RENCA tumor data were analyzed using SigmaStat software, version 3.5 cells (right flank) on day 0. Six days later, the animals were 60 (Systat Software, Chicago, Ill.). Differences between groups randomized into cohorts of 5 mice with comparable mean with a p-value <0.05 were considered significant. tumor sizes. On days 7 and 14 after tumor implantation, mice Results were treated with 100 uls.c. injections (left flank) of PBS, 10 RCC-Associated Pericytes Differentially Express the DC.IL12 or 10 DC.IL12 that had been pre-pulsed for 2 hat DLK1 Antigen. 37° C. with an equimolar (10 uM) mixture of the 65 In the previous analysis of the therapeutic vaccines incor DLK1 iss66, DLK1161-69 and DLK12so-27o peptides. For porating peptides derived from each of twelve individual lentivirus vaccination experiments, randomized BALB/c tumor blood vessel-associated antigens, it was noted that US 9,345,770 B2 67 68 vaccines targeting delta-like kinase-1 (DLK1) were most single administration in vivo (He et al. Immunity. 2006; effective in HLA-A2 transgenic recipient mice. To apply 24:643-656). Thus, a recombinant lentivirus encoding full DLK1 peptide and gene-based vaccines to the only available length murine DLK1 (lvDLK1) and a negative control virus transplantable murine model of RCC, RENCA, the pattern of (lvNEG) was engineered. DLK1 expression by cells within the TME was first investi 5 To assess the therapeutic efficacy of specific genetic vac gated. RENCA tumors and tumor-uninvolved normal kidneys cination against the DLK1 antigen, RENCA-bearing mice were removed from Syngenic BALB/c mice and processed were injected s.c. at a distal site with 40 TU or 200 TU of into single cell suspensions. Pericytes and VEC were then lvDLK1 or lv.NEG in PBS Animals injected with lvDLK1 at isolated via flow sorting (FIG. 19A) and their extracted either dose exhibited significant reductions in tumor growth mRNA (along with mRNA from the cultured RENCA cell 10 line) analyzed by real-time PCR for DLK1 and housekeeping compared to animals treated with lv.NEG (FIG.21A). As was control, HPRT1, transcript content (FIG. 19B). It was the case for the DLK1 peptide-based vaccine, immunofluo observed that pericytes derived from RCC tumors were rescence microscopy analysis of tumor sections Supported uniquely enriched for DLK1 transcripts versus pericytes iso decreased vascularity and loss of (DLK1") vascular pericytes lated from the animal-matched, tumor-uninvolved kidneys or 15 (FIG.21B), and increased presence of VCAM1"CD31“VEC VEC or RENCA cells (FIG. 19B). Immunofluorescence and CXCL10 chemokine in the TME of mice treated with microscopy performed on day 21 RENCA tumor sections lvDLK1 versus lv.NEG (FIG. 21C, 21D). Since VCAM1 and confirmed that DLK1 protein expression was associated with CXCL10 play important roles in the extravasation of NG2" pericytes but not CD31 “VEC in the tumor vasculature recruited VLA-4"CXCR3" Tc1 from blood into the TME in situ (FIG. 19C). (Bose et al., Int J Cancer. 2011; 129:2158-2170), levels of Therapeutic Treatment of RENCA Tumor-Bearing Mice infiltrating CD8" T cells in RENCA tumors were evaluated. with a DLK1 Peptide-Based Vaccine is Effective and Asso As depicted in FIG. 21E, tumors isolated from mice treated ciated with Specific Tcl Activation and Recruitment into the with lv.DLK1 contained greater numbers of CD8" TIL. TME. Vaccination with a lvl)LK1 Normalizes the RENCA Vas The Superior immunogenicity of a vaccine formulation 25 culature. composed of DC.IL 12 pulsed with MHC class I-presented It has been Suggested that in the absence of pericytes, the peptides to promote Thelper-independent priming of specific tumor vasculature appears “normalized with lower densities CD8" T cells (see above and Zhao et al., J Immunol. 2012: of blood vessels and reduced vascular permeability in the 188: 1782-1788, Zhao et al., Mol Ther: 2012; 19:805-814). TME (24), Supporting therapeutic strategies designed to Using H-2 class I-presented peptide epitopes derived from 30 selectively reduce or eradicate vascular pericytes within sites the murine DLK1 protein (i.e. DLK1 iss-co. DLK1 go and of tumor. Given the ability of the lv.DLK1-based genetic DLK1 so-zo), the impact of treating BALB/c mice bearing vaccine to reduce the content of DLK1" cells in the tumor established RENCA tumors with a DLK1 peptide-based vac stroma, further evidence was sought Supporting therapeutic cine was analyzed. As depicted in FIG. 20A, mice treated vascular "normalization” as a consequence of treatment with with the DLK1 peptide-based vaccines, but not the control 35 the lv.DLK1 genetic vaccine. It was initially noted that vaccine (DC.IL12, no peptide) or PBS, exhibited a significant RENCA tumors harvested from mice treated with lv.DLK1 reduction in RENCA tumor growth (FIG. 20 A; p<0.05 appeared anemic when compared to control tumors (FIG. (ANOVA) on days >13). On day 21 (i.e. 7 days after the 22A). This subjective index was confirmed based on analysis booster immunization), CD8 splenocytes were isolated and of hemoglobin content in tumor lysates (FIG.22A). analyzed for their ability to produce IFN-Y in response to 40 Tumors were analyzed for expression of NG2 (a general stimulation with specific DLK1 peptides in vitro. A superior pericyte marker in both normal and tumor tissues; Stallcup, J level of IFN-y secretion was observed from CD8" T cells Neurocytol. 2002; 31:423-435) using immunofluorescence isolated from mice treated with the DC.IL12+DLK1 peptide microscopy, it was observed that animals receiving injections vaccines (versus mice treated with DC.IL12 only or PBS) of lv.DLK1 displayed tumors with significant reductions in after stimulation with the individual DLK1 peptides (FIG. 45 NG2" pericytes versus tumors from animals vaccinated with 20B). lvNEG (FIG. 22B, 22C). Residual tumor pericytes in A coordinate fluorescence microscopy analysis if tumor lvDLK1-treated animals were tightly associated with CD31' sections revealed that RENCA-bearing mice treated with the VEC, unlike the randomly-distributed pattern of pericytes DLK1 peptide-based vaccine had fewer CD31 blood vessels detected in the stroma of tumors isolated from control mice in the TME than control treatment cohorts, and these vessels 50 (FIG. 22B, 22C). To investigate changes in vascular perme contained VEC with an activated, VCAMV phenotype (FIG. ability, animals were labeled with two different dyes, lectin 20C). RENCA tumors from DC.IL12+DLK1 peptide-treated FITC to bind the vascular endothelium and red 20 nm FLUO mice contained abundant locoregional expression of the Tcl SPHERES(R) to determine vessel leakiness into tissue. When recruiting chemokine CXCL10/IP-10 when compared to compared to controls, the tumor blood vessels in mice vacci control tumors (FIG. 20D). 55 nated with lv.DLK1 displayed a simple tubular architecture Vaccination with a Recombinant Lentivirus Encoding devoid of extensive branching (FIG. 22D). Furthermore, Murine DLK1 cDNA is Therapeutic in the RENCA Model. while the perivascular stroma of tumors in control treated Clinical trials implementing synthetic peptide-based vac animals was littered with the red FLUOSPHERES(R), these cines are only applicable to Subsets of cancer patients given probes were virtually undetected in tumors harvested from the need to restrict accrual to individuals expressing relevant 60 lvDLK1 vaccinated mice, consistent with diminished vascu HLA class I (peptide-presenting) allotypes. The anti-tumor lar permeability in the TME of these latter animals (FIG. efficacy of a genetic vaccine was evaluated that would allow 22D). These data Suggest that selective immunization against host antigen-presenting cells to process and present DLK1 DLK1 allows for the immunotherapeutic “normalization of peptides in a manner conducive to activate abroad anti-DLK1 tumor blood vessels in vivo. (CD8 and CD4") T cell repertoire in any individual, regard 65 Therapeutic Vaccination with lv.DLK1 Results in Reduced less of their HLA type. Lentiviral-based vaccines promote Hypoxia and a Lower Incidence of Hypoxia-Responsive Cell prolonged antigen-specific CD8" T cell responses after a Populations in the TME. US 9,345,770 B2 69 70 Hypoxia frequently occurs in Solid tumors as a conse tor T cells may serve as regulators of the “angiogenic Switch' quence of their “aberrant' blood vessels inefficiently perfus by monitoring and controlling the status of DLK1 pericytes ing oxygen into the TME (Matsumoto et al., Proc Natl Acad within the TME. Sci USA. 2009; 106:17898-17903; Jain, Semin Oncol. 2002: Conditional activation of the Wnt/B-catenin/NOTCH sig 29:3-9), resulting in reduced effector T cell (i.e. TIL) func naling pathway leads to vascular normalization (Reis et al. J tion, increased production of immunosuppressive modula Exp Med. 2012: 209:1611-1627), as indicated by reduced tors, dysregulated angiogenesis, and an accumulation of can vascular density and improved mural cell attachment, in cer stem cells (Wilson and Hay, Nat Rev Cancer. 2012: intracranial murine gliomas. Without being bound by theory, 11:393-410). To investigate changes in hypoxia within since DLK1 serves as a functional antagonist to NOTCH tumors after vaccination with lv.DK1 versus lvNEG, mice 10 were injected i.p. with pimonidazole, which detects low signaling (Falix et al., Biochim Biophys Acta. 2012; 1822: <1.3% O tension (Levesque et al., Stem Cells. 2007: 988-995), its therapeutic removal from the TME as a conse 25:1954-1965), and performed immunohistochemical analy quence of DLK1-based vaccination in the present studies sis. Tumors isolated from mice receiving lv.DLK1 vaccines would be expected to lead to the de-repression of NOTCH had a very low hypoxic index when compared to tumors 15 signaling in RENCA tumors. As such, immune-mediated culled from control animals (FIG. 23A). Given this large inhibition of DLK1 expression in the TME may represent a difference in TME hypoxia post-vaccination with lv.DLK1, protector of NOTCH signaling, thereby maintaining the the treatment impact on expression of molecules associated tumor angiogenic-Switch in the “off position (Leslie et al., with vascular stromal cells (RGS5) and/or cancer stem cells Development. 2007: 134:839-844, Siekmann and Lawson, was investigated (Jarid 1B aka histone demethylase lysine Cell Adh Migr. 2007: 1:104-106). demethylase 5b, CD133, CD44), all hypoxia-responsive gene The therapeutically “normalized TME post-vaccination products (Roesch et al., Cell. 2010; 141:583-594, Liang et al., with lv.DLK1 was largely devoid of cell populations harbor BMC Cancer. 2012; 12:201, Mathieu et al., Cancer Res. ing stem-like phenotypes, regardless of whether Such cells 2011; 71:4640-4652). Immuno-fluorescence microscopy represented bonafide cancer Stem cells or mesenchymal stem analysis of day 27 tumors revealed that all of these markers 25 cells or alternate stem cell populations recruited into the were reduced in their abundance in the TME after vaccination TME. Without being bound by theory, the treatment-associ with lvlDLK1 (FIG. 23B-23E). ated difference in tumor-associated stem cells could reflect Therapeutic Vaccination with lv.DLK1 Results in the ability of vaccine-induced T cells to: i.) alter the support Increased Apoptosis of Tumor Cells Distal to Residual Blood ive TME thereby limiting the recruitment, accumulation or Vessels in the Treated TME. 30 expansion of such stem cell populations in the TME: ii.) Given the trimming of vascular branches in the RENCA TME and reduction invascular permeability after vaccination promote the loss of hypoxia in the TME, leading to transcrip with lv.DLK1 (but not lv.NEG), it was hypothesized that tional silencing of stem cell markers, many of which have plasma nutrients required for Sustaining tumor cell viability hypoxia-responsive elements (HRE) in their promoter would be limited to regions proximal to the residual, normal 35 regions (Liang et al., BMC Cancer: 2012; 12:201; Mathieu et ized blood vessel network. TUNEL analyses revealed that al., Cancer Res. 2011; 71:4640-4652); iii.) promote the cor indeed, the level of cellular apoptosis in the TME of lv.DLK1 ollary cross-priming (Mathieu et al., Supra) of specific treated mice was Substantially increased when compared with immune responses againstalternate tumor-associated Stromal tumors isolated from control treated animals (FIG. 24). Fur antigens (including stem cell antigens like Jarid 1B, CD133 thermore, virtually all apoptotic events in RENCA tumors 40 and CD44 among others) leading to specific stem cell regu isolated fromlvDLK1-vaccinated mice were located in tissue lation/eradication in vivo. Additionally, without being bound regions distal (>60 microns) to residual CD31 blood vessels by theory, it is possible that stem cells are directly targeted by (FIG. 24). anti-DLK1 Tcl, since cells expressing DLK1 may also co Thus, it has been documented that DLK1 is a tumor peri express stem cell markers, including CD133, c-kit, and SOX2 cyte-associated antigen that can be immunologically targeted 45 (Metsyanim et al., PLoS One. 2009; 4:e6709). Cancer stem via specific peptide- or gene-based vaccination in vivo, lead cells employ many of the same signaling pathways as normal ing to the effective “normalization of the tumor vasculature stem cells, including NOTCH (Takebe et al., Nat Rev Clin and the TME. Effective therapeutic vaccination resulted in Oncol. 2011; 8:97-106); therefore, it is also feasible that the activation of Type-1 (IFN-Y producing) DLK1-specific effective silencing of DLK1 leads to a maturation event (and CD8" T cells in the periphery (spleen) and the improved 50 altered phenotypes) in stem cell populations within the TME. recruitment of CD8" T cells into the TME with a focused These mechanisms are clearly not mutually-exclusive and a localization around residual tumor blood vessels. After treat combination of these may be involved in the biologic out ment with DLK1-based vaccines, the therapeutically-nor comes disclosed herein. malized blood vessels in RENCA tumors exhibited a simple The anti-angiogenic action mediated by the DLK1 vac conduit design with tightly-approximated (abluminal) 55 cine-induced CD8" T cell repertoire would differ, and likely DLK1-deficient pericyte populations and activated VCAM1" complement, that of alternative anti-angiogenic treatment VEC that appeared improved in their structural integrity modalities such as anti-VEGF antibodies (i.e. bevacizumab) based on reductions in vascular leakiness/permeability. As a and Small molecule tyrosine kinase inhibitors (i.e. Sunitinib) consequence, progressively-growing RENCA tumors (Helfrich et al., J Exp Med. 2010; 207:491-503: Rini and became normoxic after treatment with DLK1-based vaccines, 60 Atkins, Lancet Oncol. 2009; 10:992-1000; Faivre et al., Nat with regions of the tumor mass that were distal to the residual Rev Drug Discov. 2007; 6:734–745). DLK1-based vaccines normalized blood vessel network undergoing apoptotic could represent a logical second-line approach in the many death. Concomitantly, the CXCL10 chemokine responsible cases of developed resistance to bevacizumab or Sunitinib. for recruiting Type 1 proinflammatory effector cells was dra Pericytes freshly-isolated from human RCC (but not patient matically upregulated only in DLK1-vaccinated mice, which 65 matched normal adjacent kidney tissue) display differential coincided with improved accumulation of CD8" TIL. These DLK1 expression. DLK1-based vaccines can be used as treat findings Support a paradigm in which specific immune effec ment of patients with vascularized forms of cancer. US 9,345,770 B2 71 72 Example 4 the delivery of approximately 5x10 (vaccine) DC are needed to promote clinically-meaningful levels of antigen-specific T Clinical Trial cells (Verdijk et al., op.cit.). By extrapolation, these figures indicate that intradermal injection of a vaccine containing This example provides a clinical trial to study intradermal approximately 107 mature antigen-loaded CDC1 would be administration of CDC1s loaded with a mixture of six TBVA anticipated to provide a quasi-optimal degree of immune derived peptides at the time of, or a cycle prior to, starting stimulation that may be associated with clinical benefit. Pre study treatment with the TKI dasatinib. Current therapeutic clinical, clinical, and mathematical modeling all Suggest that approaches available for patients with advanced-stage mela optimal vaccine-induced immunity and benefit to the tumor noma remain inadequate, and existing approaches including 10 bearing host can be best achieved through repeated immuni those involving immunotherapy with cytokines and/or tar Zation (3-5 Vaccines) provided over a regular-interval Sched geted Strategies have resulted in disappointingly low rates of ule. Since there is no consensus in the literature for an optimal durable and complete responses. Correcting immune dys time interval between the individual vaccinations, a protocol function in advanced-stage melanoma patients using TKI was adopted involving 4 intradermal vaccines every 2 weeks, Such as dasatinib is proposed to relicense the patients 15 immune system to respond optimally to specific immuniza which is a commonly employed schedule for DC-based vac tion. The integration of antigens expressed by tumor-associ cines (Lesterhus et al., op.cit.). ated blood vessel cells provides a means to selectively target A single-center, prospective randomized, pilot, Phase 2 the genetically-fantigenically-heterogeneous population of trial is conducted evaluating the activity, safety and immune tumor cells in the advanced-stage melanoma patient. effects of dasatinib given in combination with an autologous CD8" T cell responses are analyzed against the TBVA type-1 polarized DC vaccine. Dasatinib is administered at the DLK1, EphA2, HBB, NRP1, RGS5, and TEM1 in peripheral standard dose and schedule recommended by the FDA (70 mg blood of HLA-A2" melanoma patients prior to, during the BID). The autologous type-I DC vaccine is administered course of, and one month after the last dose of dasatinib. either prior to, or concomitant with, the initiation of dasatinib Based on the strong Type-1 polarizing potential of CDC1 in 25 administration. Patients are vaccinated intradermally with the vitro, these vaccines enhance Type-1 CD8" T cell responses CDC1/peptide mixture on days 1 and 15 of every cycle on an against at least 3 of the 6 peptides included in the vaccine outpatient basis. For those patients starting therapy with vac (particularly when patients receive concurrent dasatinib administration, as this removes the regulatory action of cine alone, dasatinib is initiated on day 29 after receiving the MDSC/Treg suppressor cells). 30 first immunization. Unless patients are removed from study, A mixture of six TBVA-derived epitopes is evaluated to be they are treated for at least 6 cycles or disease progression. In applied to CDC1s as an intradermal vaccine injection into 28 cases where there is continued clinical benefit and no addi HLA-A2" patients with advanced-stage melanoma. This tional vaccine product is available, patients can continue to be choice is based on the finding of Superior anti-tumor efficacy treated on single agent dasatinib. in HLA-A2 transgenic tumor models for the pooled peptide 35 Leukapheresis vaccine approach and the relevance of the TBVA-derived Leukapheresis (90 minutes) is a minimal risk procedure. peptides (which share sequence identity in both human and Prior to the procedure each subjects venous access is evalu mouse TBVA) in the HLA-A2" human patient setting. The ated. If a subject does not have acceptable venous access a combinational vaccine--dasatinib modeling Suggest that opti pheresis catheter is put in place. All selected patients undergo mal therapeutic benefit against established M05 melanoma 40 occurred when Sunitinib administration was initiated at the a single 90 minute-long limited leukapheresis once they have time of initial vaccination or at the time of boosting. been deemed eligible and prior to the first course of vaccina Systemic review and meta-analysis of previous DC-based tion. One time of the subject’s blood volume is processed per vaccine trials in cancer patients Suggests that: i.) vaccine procedure. induced T cell responses are associated with beneficial clini 45 Leukapheresed product is immediately, and a part of it is cal outcome; ii.) mature DC (such as CDC1) were superior used for the first vaccination course (Week 1). The remainder activators of specific immunity and a better clinical prognosis of the product is cryopreserved as described. If cytopenia when compared to immature DC; iii.) while a threshold dose (WBC<2000/mm or platelets <40,000/mm) develops dur of DC is required in the vaccine in order to promote specific ing, or as a result of leukapheresis, the procedure is post immunity, a vast increase in DC number over that threshold 50 did not generally yield Superior efficacy (Eggertet al., Cancer poned until recovery. This will not be considered an adverse Res. 1999: 59: 3340-3345; Linette et al., Clin Cancer Res. event. Samples from each cell product are obtained for hemo 2005; 11: 7692-7699; Verdijk et al., Clin Cancer Res. 2009: globin, hematocrit, total WBC, and differential and platelet 15:2531-2540; Lesterhuis et al., Clin Cancer Res. 2011; July COunt. 19 Epub ahead of print; Castiglione and Piccoli, J Theor 55 Vaccine Biol. 2007: 247: 723-732: Draube et al., PLoS One. 2011; 6: Formulation e18801). A recent study by Verdijk et al. suggests that intra Dendritic cells (DC) are derived from autologous (the sub dermal delivery of DC-based vaccines in patients with jects own) adherent mononuclear cells (monocytes) in the advanced stage melanoma was clinically equitable to the peripheral blood obtained from leukapheresis. In this case, delivery of these cells directly into lymph nodes (Verdijketal, 60 “biologic product' and “biologic substance are the same. op.cit.), while a report from Lesterhuis and colleagues argues Storage and Preparation that intradermal delivered DC-based vaccines were superior to intranodal delivered vaccines in promoting melanoma The final product is placed in vials with labels identifying specific T cell activation in vivo (Lesterhuis et al., op cit.). In each unique vaccine lot and cryopreserved. DCs used in the Vivo tracking of intradermal injected DC in melanoma 65 vaccine are suspended in 5% human serum albumin (HSA) patients suggests that approximately 4% of the administered and delivered to the clinic for administration. For preparation DC actually migrate to tissue-draining lymph nodes and that of the vaccines, the labeled vials of cryopreserved CDC1 are US 9,345,770 B2 73 74 removed from storage in liquid nitrogen and quickly thawed in a 37° C. water bath. After 3 washes in sterile medium, REGIMENDESCRIPTION thawed CDC1 are suspended in saline with 5% human serum Premedi albumin (HSA), placed in sterile Syringes for administration cations Cycle to the subject and delivered to the clinic for administration. Agent Precautions Dose Route Schedule Length Each syringe is labeled with a custom-designed label, iden CDC1 None 10" cells Intra- Arms A and B: 28 days tifying the subject and the vaccine. Both saline and HSA are Vaccine dermal every 2 weeks (4 weeks) injection starting on clinical grade. Cycle 1, day 1 Administration 10 Dasatinib Take with or 70 mg Orally, ArmA: Daily without food twice a starting on The autologous type-I DC vaccine are administered intra day Cycle 2, day 1 Arm B: daily dermally either prior to, or concomitant with, the initiation of starting on Cycle dasatinib administration. The injections are performed on an 1, day 1 outpatient basis. 15 Dendritic cell-based vaccines have been extensively evalu Vaccine Administration ated in thousands of cancer patients over the past 15 years) The DC vaccine is administered by a single intradermal and found to be safe and extremely well-tolerated. injection of approximately 107 cells (a minimum of 5x10' cells is allowable due to manufacturing limitations), with all Study Treatment Plan the DCs being administered on days 1 and 15 of each cycle. No investigational or commercial agents ortherapies other The intradermal administration is in the vicinity of the four than those described below are administered with the intent to nodal drainage groups of the four extremities and performed treat the patient's malignancy. on an outpatient basis. Study treatment will continue for at least 6 cycles or disease progression. Dasatinib Administration 25 Duration of Study Treatment All patients receive dasatinib at a starting dose of 70 mg In the absence of treatment delays due to adverse events, twice daily by mouth in the outpatient setting. Dasatinib is treatment continues for at least 6 cycles until one of the following criteria applies: Disease progression, Intercurrent supplied as 50 mg and 20 mg tablets. Patients take 1 of the 50 illness that prevents further administration of treatment, mg tablets and 1 of the 20 mg tablets twice daily, approxi Unacceptable adverse event(s), Patient decides to withdraw mately every 12 hours, at the same time each day. Dasatinib 30 from the study, or General or specific changes in the patients may be taken with or without food. Patients swallow the condition render the patient unacceptable for further treat tablets whole. ment in the judgment of the investigator/Sub-investigator, Study is terminated, or Loss of ability to freely provide con Patients on ArmA start dasatinib administration on cycle 2, Sent day 1 (week 5), while those patients in Arm B start dasatinib 35 Duration of Follow Up administration on cycle 1, day 1 (week 1). Study treatment Patients are followed for 1 year after removal from study or continues for at least 6 cycles or disease progression. In case until death, whichever occurs first. of vaccine depletion patients may continue on dasatinib alone Study Calendar and there is evidence of clinical benefit. Schedules Shown in the Study Calendar Below are Provided 40 as an Example and should be Modified as Appropriate. The dosing time is adjusted as required for Subject conve Baseline evaluations are conducted within 1 week prior to nience. If doses are missed for toxicity, they are not replaced. start of protocol therapy. Scans and X-rays are dones4 weeks If a dose is not taken due to an error, it may be taken up to 12 prior to the start of therapy. In the event that the patients hours later. If vomiting occurs within 30 minutes of intake, condition is deteriorating, laboratory evaluations are repeated that dose is repeated. within 48 hours prior to initiation of the next cycle of therapy.

Week Off Study Up to -4 1 2 3 4 5 6 7 8 Treatment?

informed consent HLA-A2 Screening BRAF, c-KIT mutation Demographics Medical history Physical exam X X X X Vital signs X X X X Height Weight X X X X Performance status X X X X CBC widiff, platelets X X X X X X X X X Serum chemistry X X X X X X X X X B-HCG EKG (as indicated) Leukapheresis US 9,345,770 B2

-continued

Week Off Study Up to -4 1 2 3 4 5 6 7 8 Treatment? Dasatinib

Arm A X X X X Arm B X X X X X X X X DC Vaccine X X X X Immune monitoring- X X X X X X PBMC Tumor Biopsy X X AE evaluation e- X-> X Tumor X Tumor measurements are repeated every 8 weeks. X measurements Documentation (radiologic) must be provided for patients removed from study for progressive disease. Radiologic evaluation X Radiologic measurements should be performed every 8 weeks. Xg Not necessary if already known; Albumin, alkaline phosphatase, total bilirubin, bicarbonate, BUN, calcium, chloride, creatinine, glucose, LDH, phosphorus, potassium, total protein, SGOT AST, SGPTALT, sodium, magnesium; Serum pregnancy test (women of childbearing potential); Screening is to be performed in the UPCI-CTRC; e: Treatment with DC vaccine and dasatinib will continue for at least 6 cycles (or until disease progression), the weeks of those cycles will follow the tests and procedures listed for weeks 5 through 8 above for each subsequent cycle; JFour weeks after the last dasatinib administration; 3If removed from the study for reasons other than DP 25 Dose-Limiting Toxicities Prior chemotherapy, immunotherapy, or targeted therapy is Definition of Dose-Limiting Toxicity allowed as long as it did not include dasatinib. Toxicities are scored according to the NCI Common Ter Ages 18 years. Because no dosing or adverse event data are minology Criteria for Adverse Events (NCICTCAE) v4.0. currently available on the use of dasatinib in patients <18 Dose-limiting toxicity (DLT) is defined as the following 30 years of age, children are excluded. study drug-related events experienced during Cycle 1: ECOG performance status s2 (Karnofsky 60%) Grade 4 neutropenia or thrombocytopenia which lasts Life expectancy of greater than 12 weeks. more than 7 days; Patients have normal organ and marrow function as defined Grade 3 or 4 febrile neutropenia; or below: Grade 3 or greater non-hematological toxicities; this 35 Leukocytes >3,000/LL includes grade 3 or greater diarrhea, nausea or vomiting absolute neutrophil count >1.500/LL which last more than 7 days despite adequate treatment absolute lymphocyte count >500/LL (with loperamide for diarrhea, 5HT3 antagonists, ste platelets >100,000/uL roids and dopamine antagonist for NN). 40 total bilirubin within normal institutional limits Dasatinib Dosing Delays/Modifications AST(SGOT)/ALT(SGPT)<2.5x institutional upper limit of normal Creatinine s2.0x institutional upper limit of normal Dose Level Dasatinib Dose Serum magnesium, potassium and adjusted (or ionized) O 70 mg BID 45 calcium athe institutional lower limit of normal. -1 50 mg BID (Supplementation of electrolytes prior to Screening is -2 100 mg QD allowed). Sexually active women and men of childbearing potential The study uses the CTCAE (Common Terminology Crite agree to use an effective method of birth control during 50 the course of the study and for up to 3 months following ria for Adverse Events) version 4.0 for toxicity and serious the last dose of the study drug, in a manner Such that risk adverse event reporting. of pregnancy is minimized Surgical sterilization, intrau Patient Selection terine device or barrier method (e.g. condom and/or Inclusion Criteria diaphragm with spermicidal agents) are acceptable Patients are HLA-A2" and have histologically confirmed 55 forms of birth control. Women of childbearing potential melanoma that is metastatic (Stage IV) or unresectable have a negative pregnancy test (serum) within 7 days Stage IIIB/C and for which standard curative or pallia prior to treatment. A pregnancy test is not required for tive measures do not exist or are no longer effective. registration. Women who have not menstruated for more Patients have measurable disease by RECIST 1.1, defined than 2 years are considered postmenopausal, thus not of as at least one lesion that can be accurately measured in 60 childbearing potential. at least one dimension (longest diameter to be recorded Exclusion Criteria for non-nodal lesions and short axis for nodal lesions) as Patients who have had chemotherapy or radiotherapy >20 mm with conventional techniques or as a 10 mm within 4 weeks (6 weeks for nitrosoureas or mitomycin with spiral CT scan, MRI, or calipers by clinical exam. C) prior to entering the study or those who have not Patients have at least 2 subcutaneous, intracutaneous, and 65 recovered from adverse events due to agents adminis accessible tumor deposits, lymph node or other site tered more than 4 weeks earlier. available for biopsy purposes. Patients with documented c-KIT mutations. US 9,345,770 B2 77 78 Patients who are receiving any other investigational agents. patients during randomization to ensure a balanced propor Patients with known brain metastases should be excluded tion of patients with the mutation on both arms. from this clinical trial because of their poor prognosis Biopsy Tissue. and because they often develop progressive neurologic Melanoma biopsies are obtained prior to the first vaccina dysfunction that would confound the evaluation of neu tion (baseline) and week 5 (date of the third vaccination). rologic and other adverse events. Patients should have at least 2 subcutaneous, intracutaneous, History of allergic reactions attributed to compounds of and accessible tumor deposits, lymph node or other site avail similar chemical or biologic composition to dasatinib or able for biopsy purposes. any of the components of the vaccine being administered Blood Samples 10 At least 3 weeks prior to study treatment, peripheral blood as part of this study. is obtained for the screening of patient HLA-A2 expression Women who are pregnant or nursing/breastfeeding. status and for baseline testing. Peripheral blood is obtained History of significant bleeding disorder unrelated to can every 2 weeks on trial beginning week 2. cer, including: Correlative Studies Diagnosed congenital bleeding disorders (e.g., von Will 15 HLA-A2/TBVA peptide dextramer" CD8" T cells (i.e. ebrand’s disease) CD8" T cells imaged by flow cytometry using a fluorescently Diagnosed acquired bleeding disorder within one year labeled, antigen-specific probe) exhibits higher frequencies (e.g., acquired anti-factor VIII antibodies) in the peripheral blood and a greater propensity to produce Patients currently taking medications that inhibit platelet IFN-Y after the initiation of CDC1-based vaccines. Since function (i.e., aspirin, dipyridamole, epoprostenol, epti dasatinib alters the recruiting capacity of the tumor microen fibatide, clopidogrel, cilostaZol, abciximab, ticlopidine, vironment based on activation of VCAM-1 expression on the and any non-steroidal anti-inflammatory drug) because tumor-associated vascular endothelial cells and locoregional of a potential increased risk of bleeding from dasatinib. production of CXCR3 ligand chemokines, the frequency of Patients currently taking anticoagulants (warfarin, hep TBVA-specific CD8" T cells selectively declines in the arin/low molecular weight heparin e.g., danaparoid, 25 patients peripheral blood if the combined therapy performs as dalteparin, tinzaparin, enoxaparin) because of a poten expected. Circulating levels of the CXCR3 ligand CXCL10 tial increased risk of bleeding from dasatinib. (aka IP-10), become elevated under treatment conditions in Diagnosis of unstable angina or myocardial infarction patients that are more prone to exhibit objective clinical within 6 months of study entry. response to effective immunotherapy. As a consequence, lev Patients currently taking one or more of the following 30 els of serum CXCL10 are analyzed before, during and after drugs that are generally accepted to have a risk of caus combined vaccine--dasatinib therapy to determine correlation ing Torsades de Pointes: with TBVA-specific CD8" T cells in the blood versus tumor quinidine, procainamide, disopyramide over time post-treatment. amiodarone, Sotalol, ibutilide, dolfetilide Immune Monitoring Analysis of TBVA-Specific CD8T Cell erythromycins, clarithromycin 35 Responses (Primary Endpoint). chlorpromazine, haloperidol, mesoridazine, thior Rationale and Hypothesis: idazine, pimozide Translation and clinical vaccine trials have demonstrated cisapride, bepridil, droperidol, methadone, arsenic, that DC/peptide-based vaccines effectively activate specific chloroquine, domperidone, halofantrine, CD8" T cells in tumor-bearing hosts that may be detected in levomethadyl, pentamidine, sparfloxacin, lidoflazine. 40 peripheral blood, and that individuals that exhibit objective Diagnosed or Suspected congenital long QT syndrome. clinical response to Such vaccine therapies tend to derive from Prolonged QTc interval on pre-entry electrocardiogram the cohort of patients that display detectable increases in T (>450 msec) within 30 days prior to study registration. cell responses post-vaccination (see, for example, Keilholz, Any history of clinically significant ventricular arrhyth Recent Results Cancer Res. 2007: 176: 213–218). The effec mias (such as Ventricular tachycardia, Ventricular fibril 45 tiveness of DC1/peptide vaccination to elicit protective/thera lation, or Torsades de pointes) peutic T cell-mediated immunity in melanoma models in vivo Uncontrolled intercurrent illness including, but not limited (see above), support the hypothesis that CDC1/peptide vac to, ongoing or active infection, symptomatic congestive cination of advanced stage melanoma patients results in heart failure, unstable angina pectoris, cardiac arrhyth increased quantities of specific CD8" T cells in patient mia, or psychiatric illness/social situations that would 50 peripheral blood and that those individuals in which limit compliance with study requirements. improved response to many peptides can be observed are HIV-positive patients on combination antiretroviral those that are more likely to demonstrate clinical benefit. therapy are ineligible because of the potential for phar Method: macokinetic interactions with dasatinib. In addition, Using fluorescently-labeled HLA-A2/peptide dextramer these patients are at increased risk of lethal infections 55 probes and intracellular staining for the Type-1 cytokine IFN when treated with marrow-suppressive therapy. Appro Y, how the frequency of CD8" T cells specific for TBVA priate studies are undertaken in patients receiving com peptides changes over time post-vaccination and how many bination antiretroviral therapy when indicated. of these T cells are Type-1 effector T cells is determined. Research Samples Quantitation of CD8" T cells, Treg, MDSC and Blood Vessels Patient peripheral blood and tumor biopsies are obtained at 60 in Melanoma Biopsy Tissue various time points prior to, and after, the initiation of therapy. Rationale and Hypothesis: If the patient is determined to express the HLA-A2 antigen on Without being bond by theory, tumor progression is their peripheral blood cells, to express a wild-type phenotype, believed to be linked to the accumulation of suppressor cell and they pass all additional inclusion/exclusion criteria, after populations (both MDSC and Treg) and strong pro-angio written consent, they are entered on trial. Those patients 65 genic signals, as well as, “prevention of Type-1 T cell determined to express c-KIT mutations are excluded from recruitment within the tumor microenvironment (see, for study, while BRAF mutational status is used to stratify example, Wolfetal., Clin Cancer Res. 2005; 11: 8326-8331). US 9,345,770 B2 79 80 The data in murine melanoma models Support the ability of in the tumor microenvironment to EphA2-specific CD8" T dasatinib (particularly when combined with DC1/peptide cells that have been activated as a consequence of CDC1/ vaccines) to counteract these biologic endpoints in vivo. peptide-based vaccination. These changes may also be evidenced in effectively treated Method: melanoma patients by analyzing melanoma biopsies taken 5 Western blotting and immunofluorescence microscopy are post- versus pre-treatment and that the greatest “normaliza used to quantitate EphA2 protein expression in melanoma tion' of the tumor microenvironment is observed after treat biopsies pre- versus post-vaccination. ment with combined dasatinib+Vaccine therapy. CXCL10 Levels in Patient Serum Method: Rationale and Hypothesis: Immunofluorescence microscopy is used to analyze tumor 10 sections of melanoma biopsies for expression of the markers Therapeutic CD8" T cells require the production of CD8O. (T effector cells), CD11b+CD33+lack of HLA-DR CXCR3 ligand chemokines within the tumor microenviron (lineage-negative MDSC), CD11b+CD15+lack of CD14 ment in order to effectively home to these disease sites. Two (neutrophilic MDSC), CD11b+CD14+lack of CD15 (my recent clinical trials, including a CDC1/glioma peptide vac eloid MDSC), CD4+Foxp3 (Treg cells) and CD31+NG2 15 cination trial in patients with brain tumors strongly Support (blood vessels). After staining and washing, sections are cov CXCL10 (aka IP-10) as a chemokine associated with superior ered in Gelvatol (Monsanto, St. Louis, Mo.) and a coverslip clinical outcome to immune-based therapy (see, for example, applied. Positively-stained cells are quantitated by analyzing Schwaab et al., Clin Cancer Res. 2009; 15: 4986-4992). This the images at a final magnification of x20 using Metamorph will also be the case in the CDC1/TBVA peptide vaccinated Imaging software (Molecular Devices, Sunnyvale, Calif.). patients with melanoma where Type-1 CXCR3 responder T Treg Analysis in PBMC cells require a gradient of CXCL10/IP-10 (as detected in Rationale and Hypothesis: serum) in order to traffick to tumor sites in vivo. Cancer patients have commonly also been shown to have Method: Patient serum levels of CXCL10 are monitored elevated populational frequencies of Treg (based on the CD4" using Luminex fluorescent bead technology according to Foxp3" phenotype) circulating in theor peripheral blood. 25 manufacturer's protocol. Alternate TKI, such as Sunitinib, have been shown capable of Measurement of Effect reducing peripheral blood Treg levels within the first 4 week Patients with measurable disease are assessed by standard cycle of drug administration, in concert with a rebound in criteria. Patients are re-evaluated every 8 weeks. In addition Type-1 T cell numbers and function in PBMC (Finke et al., to a baseline Scan, confirmatory scans are obtained 24 weeks Clin Cancer Res. 2008; 14: 6674-6682). Dasatinib provides a 30 following initial documentation of an objective response. similar effect in melanoma patients and that those patients exhibiting the greatest degree of Treg reduction post-therapy Antitumor Effect respond favorably against the peptide epitopes contained in Patients are re-evaluated for response every 8 weeks. In the vaccine formulation. addition to a baseline Scan, confirmatory scans are obtained Method: 35 no less than 4 weeks following initial documentation of Peripheral blood cells are analyzed by flow cytometry objective response. using specific antibodies against CD3 (all T cells), CD4+ Response and progression are evaluated using the new Foxp3 (Treg), CD4+CD25"(Treg) Results are expressed as international criteria proposed by the revised Response percentage of CD25"/Foxp3" cells out of total CD3"/CD4" Evaluation Criteria in Solid Tumors (RECIST) guideline viable cells. 40 (version 1.1; ref. 104). Changes in the largest diameter (uni MDSC Analysis in PBMC dimensional measurement) of the tumorlesions and the short Rationale and Hypothesis: est diameter in the case of malignantlymph nodes are used in Similar to Treg, levels of cells expressing an MDSC phe the RECIST criteria. notype have been reported to be elevated in the peripheral Definitions blood of cancer patients, including patients with advanced 45 Evaluable for toxicity. All patients are evaluable for toxic stage melanoma (see, for example, Ko et al., Clin Cancer Res. ity from the time of their first treatment. 2009; 15: 2148-2157). TKI, such as sunitinib and dasatinib Evaluable for objective response. Only those patients who can reduce the frequency of such suppressor cells to a variable have measurable disease present at baseline, have received at degree when used as a therapy, Melanoma patients treated least one cycle of therapy, and have had their disease re with dasatinib exhibit reduction in MDSC frequencies in 50 evaluated are considered evaluable for response. These PBMC, with the degree of loss correlating with the patients patients have their response classified according to the defi ability to respond favorably against the peptide epitopes con nitions stated below. (Note: Patients who exhibit objective tained in the vaccine formulation. disease progression prior to the end of cycle 1 will also be Method: considered evaluable.) Analysis of MDSC percentages in patient PBMC is per 55 Evaluable Non-Target Disease Response. Patients who formed using flow cytometry and anti-human antibodies have lesions present at baseline that are evaluable but do not against CD11b, CD11c, CD14, CD15, CD33 and HLA-DR. meet the definitions of measurable disease, have received at EphA2 Protein Levels in Tumor Biopsies least one cycle of therapy, and have had their disease re Rationale and Hypothesis: evaluated are considered evaluable for non-target disease. Drug treatments (including dasatinib in vitro) that promote 60 The response assessment is based on the presence, absence, the proteasome-dependent degradation of the tumor (and or unequivocal progression of the lesions. tumor vascular endothelial) cell-associated protein Eph A2 Disease Parameters lead to improved recognition by specific CD8" T cells (see, Measurable disease. Measurable lesions are defined as for example, Kawabe et al., Cancer Res. 2009; 69: 6995 those that can be accurately measured in at least one dimen 7003). Administration of dasatinib to melanoma patients pro 65 sion (longest diameter to be recorded) as 220 mm by chest motes the loss of EphA2 protein within the tumor lesion, X-ray or as a 10 mm with CT scan, MRI, or calipers by clinical leading to an enhancement in the sensitivity of EphA2" cells exam. All tumor measurements must be recorded in millime US 9,345,770 B2 81 82 ters (or decimal fractions of centimeters). Tumor lesions that Chest X-ray. Lesions on chest X-ray are measurable lesions are situated in a previously irradiated area might or might not when they are clearly defined and Surrounded by aeratedlung, be considered measurable. but CT is preferable. Malignant lymph nodes. To be considered pathologically Conventional CT and MRI. This guideline has defined enlarged and measurable, a lymph node must be a 15 mm in measurability of lesions on CT scan based on the assumption short axis when assessed by CT scan (CT scan slice thickness that CT slice thickness is 5 mm or less. If CT scans have slice recommended to be no greater than 5 mm) At baseline and in thickness greater than 5 mm, the minimum size for a measur follow-up, only the short axis is measured and followed. able lesion should be twice the slice thickness. MRI is also Non-measurable disease. All other lesions (or sites of dis acceptable in certain situations (e.g. for body scans). MRI has 10 excellent contrast, spatial, and temporal resolution. As with ease), including Small lesions (longest diameter <10 mm or CT, if an MRI is performed, the technical specifications of the pathological lymph nodes with a 10 to <15 mm short axis), are scanning sequences used are optimized for the evaluation of considered non-measurable disease. Bone lesions, leptom the type and site of disease. Furthermore, as with CT, the eningeal disease, ascites, pleural/pericardial effusions, lym modality used at follow-up is the same as was used at baseline phangitis cutis/pulmonitis, inflammatory breast disease, and 15 and the lesions are measured/assessed on the same pulse abdominal masses (not followed by CT or MRI), are consid Sequence. ered as non-measurable. Cystic lesions that meet the criteria PET-CT. The low dose or attenuation correction CT por for radiographically defined simple cysts sare not be consid tion of a combined PET-CT is not always of optimal diagnos ered as malignant lesions (neither measurable nor non-mea tic CT quality for use with RECIST measurements. However, Surable) since they are, by definition, simple cysts. Cystic if the CT performed as part of a PET-CT is of identical lesions thought to represent cystic metastases can be consid diagnostic quality to a diagnostic CT (with IV and oral con ered as measurable lesions, if they meet the definition of trast), then the CT portion of the PET-CT can be used for measurability described above. However, if non-cystic RECIST measurements and can be used interchangeably with lesions are present in the same patient, these are preferred for conventional CT in accurately measuring cancer lesions over selection as target lesions. 25 time. Target lesions. All measurable lesions up to a maximum of Endoscopy, Laparoscopy. Such techniques are used to con 2 lesions per organ and 5 lesions in total, representative of all firm complete pathological response when biopsies are involved organs, should be identified as target lesions and obtained or to determine relapse in trials where recurrence recorded and measured at baseline. Target lesions are selected following complete response (CR) or Surgical resection is an 30 endpoint. on the basis of their size (lesions with the longest diameter), Cytology, Histology. These techniques can be used to dif are representative of all involved organs, but in addition lend ferentiate between partial responses (PR) and complete themselves to reproducible repeated measurements. It may be responses (CR) in rare cases (e.g., residual lesions in tumor the case that, on occasion, the largest lesion does not lend types, such as germ cell tumors, where known residual benign itself to reproducible measurement in which circumstance the 35 tumors can remain). The cytological confirmation of the neo next largest lesion which can be measured reproducibly is plastic origin of any effusion that appears or worsens during selected. A Sum of the diameters (longest for non-nodal treatment when the measurable tumor has met criteria for lesions, short axis for nodal lesions) for all target lesions is response or stable disease is mandatory to differentiate calculated and reported as the baseline Sum diameters. If between response or stable disease (an effusion may be a side lymph nodes are included in the Sum, then only the short axis 40 effect of the treatment) and progressive disease. is added into the Sum. The baseline Sum diameters are used as FDG-PET. FDG-PET response assessments can be incor reference to further characterize any objective tumor regres porated to complement CT scanning in assessment of pro sion in the measurable dimension of the disease. gression (particularly possible new disease). New lesions on Non-target lesions. All other lesions (or sites of disease) the basis of FDG-PET imaging are identified according to the including any measurable lesions over and above the 5 target 45 following algorithm: lesions are identified as non-target lesions and are recorded at Negative FDG-PET at baseline, with a positive FDG-PET baseline. Measurements of these lesions are not required, but at follow-up is a sign of PD based on a new lesion. the presence, absence, or in rare cases unequivocal progres No FDG-PET at baseline and a positive FDG-PET at fol sion of each is noted throughout follow-up. low-up: If the positive FDG-PET at follow-up corre Methods for Evaluation of Measurable Disease 50 sponds to a new site of disease confirmed by CT, this is All measurements are taken and recorded in metric nota PD. If the positive FDG-PET at follow-up is not con tion using a ruler or calipers. All baseline evaluations are firmed as a new site of disease on CT, additional follow performed as closely as possible to the beginning of treatment up CT scans are needed to determine if there is truly and never more than 4 weeks before the beginning of the progression occurring at that site (if so, the date of PD is treatment. 55 the date of the initial abnormal FDG-PET scan). If the The same method of assessment and the same technique is positive FDG-PET at follow-up corresponds to a pre used to characterize each identified and reported lesion at existing site of disease on CT that is not progressing on baseline and during follow-up. Imaging-based evaluation is the basis of the anatomic images, this is not PD. preferred to evaluation by clinical examination unless the FDG-PET may be used to upgrade a response to a CR in a lesion(s) being followed cannot be imaged but are assessable 60 manner similar to a biopsy in cases where a residual by clinical exam. radiographic abnormality is thought to represent fibrosis Clinical lesions. Clinical lesions are only considered mea or scarring. The use of FDG-PET in this circumstance Surable when they are Superficial (e.g., skin nodules and pal should be prospectively described in the protocol and pable lymph nodes) and >10 mm diameter as assessed using supported by disease-specific medical literature for the calipers (e.g., skin nodules). In the case of skin lesions they 65 indication. However, it must be acknowledged that both are documented by color photography, including a ruler to approaches may lead to false positive CR due to limita estimate the size of the lesion. tions of FDG-PET and biopsy resolution/sensitivity. US 9,345,770 B2 83 Note: A positive FDG-PET scan lesion means one which -continued is FDG avid with an uptake greater than twice that of the Surrounding tissue on the attenuation corrected image. Overall Best Overall Response Target Non-Target New Res- when Confirmation Response Criteria Lesions Lesions Lesions ponse is Required Evaluation of Target Lesions Any PD* * * Yes or No PD Complete Response (CR): Disappearance of all target Any Any Yes PD lesions. Any pathological lymph nodes (whether target or *See RECIST 1.1 manuscript for further details on what is evidence of a new lesion. **Only for non-randomized trials with response as primary endpoint, non-target) must have reduction in short axis to <10 mm. 10 In exceptional circumstances, unequivocal progression in non-target lesions may be accepted as disease progression, Partial Response (PR): At least a 30% decrease in the sum Note: of the diameters of target lesions, taking as reference the Patients with a global deterioration of health status requiring discontinuation of treatment without objective evidence of disease progression at that time should be reported as "symp baseline sum diameters. tomatic deterioration.” Every effort should be made to document the objective progression Progressive Disease (PD): At least a 20% increase in the even after discontinuation of treatment. Sum of the diameters of target lesions, taking as reference the 15 For Patients with Non-Measurable Disease (i.e., Non-Target Smallest Sum on study (this includes the baseline sum if that is Disease) the smallest on study). In addition to the relative increase of 20%, the Sum must also demonstrate an absolute increase of at least 5 mm (Note: the appearance of one or more new Non-Target Lesions New Lesions Overall Response lesions is also considered progressions). CR No CR Non-CR non-PD No Non-CR non-PD* Stable Disease (SD): Neither sufficient shrinkage to Notall evaluated No not evaluated Unequivocal PD Yes or No PD qualify for PR nor sufficient increase to qualify for PD, taking Any Yes PD as reference the Smallest Sum diameters while on study. 25 *Non-CR/non-PD is preferred over stable disease” for non-target disease since SD is Evaluation of Non-Target Lesions increasingly used as an endpoint for assessment of efficacy in some trials so to assign this Complete Response (CR): Disappearance of all non-target category when no lesions can be measured is not advised lesions and normalization of tumor marker level. All lymph Duration of Response nodes must be non-pathological in size (<10 mm short axis). Duration of Overall Response: 30 Note: If tumor markers are initially above the upper normal The duration of overall response is measured from the time limit, they must normalize for a patient to be considered in measurement criteria are met for CR or PR (whichever is first complete clinical response. recorded) until the first date that recurrent or progressive disease is objectively documented (taking as reference for Non-CR/Non-PD: Persistence of one or more non-target progressive disease the Smallest measurements recorded lesion(s) and/or maintenance of tumor marker level above the 35 since the treatment started). normal limits. The duration of overall CR is measured from the time Progressive Disease (PD): Appearance of one or more new measurement criteria are first met for CR until the first date lesions and/or unequivocal progression of existing non-target that progressive disease is objectively documented. lesions. Unequivocal progression should not normally trump 40 Duration of Stable Disease: target lesion status. It must be representative of overall dis Stable disease is measured from the start of the treatment ease status change, not a single lesion increase. until the criteria for progression are met, taking as reference the Smallest measurements recorded since the treatment Evaluation of Best Overall Response started, including the baseline measurements. The best overall response is the best response recorded 45 Progression-Free Survival from the start of the treatment until disease progression/re Progression-free survival (PFS) is defined as the duration currence (taking as reference for progressive disease the of time from start of treatment to time of progression or death, Smallest measurements recorded since the treatment started). whichever occurs first. The patient’s best response assignment depends on the Statistical Considerations achievement of both measurement and confirmation criteria. 50 Study Design The effects of combination therapy of dasatinib and vac For Patients with Measurable Disease (i.e., Target Disease) cine on immune response rate are evaluated. A patient who responded to at least 3 of the 6 peptides is considered to have a positive immune response. The secondary objectives Overall Best Overall Response 55 Target Non-Target New Res- when Confirmation include evaluation of clinical response rate, overall Survival Lesions Lesions Lesions ponse is Required (OS), progression free survival (PFS), and immunological CR CR No CR e4 wks. endpoints, which include number of CD8" T cells, MDSC/ Confirmation** Treg regulatory cells and blood vessels in tumor lesions, level CR Non-CRNon- No PR e4 wks. of EphA2 protein expressed within the tumor lesion and the PD Confirmation** 60 CR Not evaluated No PR level of the CXCL10/IP-10 chemokine in patient serum pre PR Non-CRNon- No PR Versus post-treatment. PD, not evaluated Up to 28 evaluable patients are randomized in 1:1 ratio to SD Non-CRNon- No SD Documented at least receive either: PD, not evaluated once e4 wks. from baseline 65 A. Vaccine alone starting in the first 28-day cycle followed PD Any Yes or No PD no prior SD, PR or CR by vaccine combined with daily dasatinib starting on the first day of the second cycle (Arm A) US 9,345,770 B2 85 86 B. Vaccine combined with daily dasatinib starting on the age of patients achieving CR or PR by RECIST criteria, with first day of cycle 1 (Arm B) corresponding exact 95% CI. Both immune response rate and Patients not evaluable for immune response are replaced. clinical response rate of the two treatment groups are com Randomization is stratified by BRAF mutation status. pared using Fisher exact test. The immune response for the Data Analysis B-raf mutant carrier and non-carrier in is also evaluated. Analysis Sets. The Kaplan-Meier estimate of PFS and OS with corre Evaluable Patients are patients who meet all of the protocol sponding 95% confidence band is provided for each dose inclusion/exclusion criteria and begin treatment with the pro level. The corresponding median survival time (with 95% tocol assigned regimen. All evaluable patients are used in the confidence limits) is determined, along with OS and PFS analysis of safety, immune response, clinical response, OS 10 estimates at selected time points. The exact log rank test is and PFS. used to compare the PFS and OS between the two study arms. Baseline Characteristics The association between the positive immune response Baseline characteristics on all evaluable patients are pro and: vided on demographic variables (age, sex, race/ethnicity), a. Objective clinical response. performance status, laboratory parameters, prior treatments, 15 b. CD8+ T cell infiltration in tumor after cycle 1. and disease characteristics, including tumor size, number of c. Reduction in Suppressor cells in the tumor and blood. nodes involved, and metastatic sites. d. Reduction in blood vessel density in the tumor after Safety Profile cycle 1. NCI CTCAE version 4.0 is used to evaluate the serious e. Reduction in EphA2 protein expression in tumor after adverse events (SAEs) in each cycle of the treatment, and for cycle 1. 30 days beyond the last protocol specified treatment. Sever f. Increased level of the CXCR3 ligand chemokine CXCL AEs rate for each treatment arm are calculated and the corre 10/IP-10 in patient serum after cycle 1 is evaluated. sponding exact 95% confidence interval (CI) are provided. Chi-square (or Fisher exact) test is used to test the associa All adverse events that are determined to be possibly, prob tion between immune response and the categorical outcomes ably or definitely related to treatment are tabulated according 25 (e.g. objective clinical response). Wilcoxon test is used to to grade and type (according to the NCI CTCAE, Version compare the continuous outcomes (e.g. CD8" T cell infiltra 4.0). For each adverse event category, frequencies are tabu tion, Suppressor cell populations, tumor blood vessel density, lated by treatment group according to the highest grade per EphA2 protein expression, chemokine level) between the patient within 30 days after any study treatment. immune responders and non-responders. Efficacy Analysis 30 It will be apparent that the precise details of the methods or The immune response rate, defined as proportion of compositions described may be varied or modified without patients that responded to 3 out of the 6 peptides, for each departing from the spirit of the described invention. We claim study arm is calculated with 95% exact CI. The clinical all Such modifications and variations fall within the scope and response rate for each study arm is estimated by the percent spirit of the claims below.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 84

<21 Oc SEO ID NO 1 <211 LENGTH: 9 <212> TYPE PRT <213> ORGANISM: Homo sapiens <22 Os FEATURE; <221 NAME/KEY: Misc Feature <222> LOCATION: (9) ... (9) OTHER INFORMATION: X is L or W

<4 OOs SEQUENCE: 1 Arg Lieu. Thr Pro Gly Val His Glu Xaa 1. 5

SEO ID NO 2 LENGTH: 9 TYPE PRT ORGANISM: Homo sapiens

<4 OOs SEQUENCE: 2 Ile Lieu. Gly Val Lieu. Thir Ser Lieu Val 1. 5

SEO ID NO 3 LENGTH: 9 TYPE PRT ORGANISM: Homo sapiens

<4 OOs SEQUENCE: 3 US 9,345,770 B2 87 - Continued Phe Lieu. Asn Lys Cys Glu Thir Trp Val 1. 5

<210s, SEQ ID NO 4 &211s LENGTH: 9 212. TYPE: PRT <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: Misc Feature <222s. LOCATION: (9) ... (9) 223s OTHER INFORMATION: X is T or W

<4 OOs, SEQUENCE: 4 Arg Lieu. Lieu Val Val Tyr Pro Trp Xaa 1. 5

<210s, SEQ ID NO 5 &211s LENGTH: 10 212. TYPE: PRT <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: Misc Feature <222s. LOCATION: (9) ... (9) 223s OTHER INFORMATION: X is C or W

<4 OOs, SEQUENCE: 5 Arg Lieu. Lieu. Gly Asn Val Lieu Val Xaa Val 1. 5 1O

<210s, SEQ ID NO 6 &211s LENGTH: 9 212. TYPE PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 6 Gly Lieu. Lieu. Arg Phe Val Thr Ala Val 1. 5

<210s, SEQ ID NO 7 &211s LENGTH: 9 212. TYPE: PRT <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (2) ... (2) <223> OTHER INFORMATION: Xaa can be any naturally occurring amino acid 22 Os. FEATURE: <221 > NAMEAKEY: Misc Feature <222s. LOCATION: (9) ... (9) 223s OTHER INFORMATION: X is L or M

<4 OO > SEQUENCE: 7 Gly Xaa Lieu. Gly Met Val Ser Gly Lieu. 1. 5

<210s, SEQ ID NO 8 &211s LENGTH: 9 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 8 Val Lieu. Lieu. Gly Ala Val Cys Gly Val 1. 5

<210s, SEQ ID NO 9 &211s LENGTH: 10 212. TYPE: PRT <213> ORGANISM: Homo sapiens US 9,345,770 B2 89 90 - Continued

FEATURE: NAMEAKEY: Misc Feature LOCATION: (9) ... (9) OTHER INFORMATION: X is L or W

SEQUENCE: 9 Lieu. Leu Val Pro Thr Cys Val Phe Xaa Val 1.

SEQ ID NO 10 LENGTH: 9 TYPE PRT ORGANISM: Homo sapiens

< 4 OOs SEQUENCE: 1.O Thir Lieu Ala Asp Phe Asp Pro Arg Val 1. 5

SEQ ID NO 11 LENGTH: 9 TYPE PRT ORGANISM: Homo sapiens FEATURE: NAMEAKEY: Misc Feature LOCATION: (2) ... (2) OTHER INFORMATION: X is L or A

SEQUENCE: 11 Lieu. Xaa Ala Lieu Pro His Ser Cys Lieu. 1. 5

SEQ ID NO 12 LENGTH: 9 TYPE PRT ORGANISM: Homo sapiens FEATURE: NAMEAKEY: Misc Feature LOCATION: (9) ... (9) OTHER INFORMATION: X is L or W

SEQUENCE: 12 Ile Leu Lleu Trp Glu Ile Phe Thr Lieu 1. 5

SEQ ID NO 13 LENGTH: 9 TYPE PRT ORGANISM: Homo sapiens FEATURE: NAMEAKEY: Misc Feature LOCATION: (1) ... (1) OTHER INFORMATION: X is I or T

SEQUENCE: 13

Xala Lieu. Ser Asn. Leu Ser Phe Pro Wall 1. 5

SEQ ID NO 14 LENGTH: 9 TYPE PRT ORGANISM: Homo sapiens

< 4 OOs SEQUENCE: 14 Lieu. Ile Lieu Pro Lieu Lleu Phe Tyr Lieu. 1. 5

SEO ID NO 15 US 9,345,770 B2 91 92 - Continued

&211s LENGTH: 9 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 15 Asp Ile Trp Asp Gly Ile Pro His Val 1. 5

<210s, SEQ ID NO 16 &211s LENGTH: 9 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 16 Tyr Lieu. Glin Val Asp Lieu. Arg Phe Lieu. 1. 5

<210s, SEQ ID NO 17 &211s LENGTH: 9 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 17 Asn Met Lieu. Gly Met Lieu. Ser Gly Lieu. 1. 5

<210s, SEQ ID NO 18 &211s LENGTH: 10 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 18 Lieu. Lieu. Glin Glu Arg Gly Val Ala Tyr Ile 1. 5 1O

<210s, SEQ ID NO 19 &211s LENGTH: 9 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 19 Thir Lieu. Phe Trp Lieu Lleu Lieu. Thir Lieu. 1. 5

<210s, SEQ ID NO 2 O &211s LENGTH: 9 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 2O Val Ile Ala Met Phe Phe Trp Lieu. Leu 1. 5

<210s, SEQ ID NO 21 &211s LENGTH: 383 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 21 Met Thr Ala Thr Glu Ala Lieu. Lieu. Arg Val Lieu Lleu Lleu Lieu. Lieu Ala 1. 5 1O 15 Phe Gly His Ser Thr Tyr Gly Ala Glu. Cys Phe Pro Ala Cys Asn Pro 2O 25 3O

Glin Asn Gly Phe Cys Glu Asp Asp Asn Val Cys Arg Cys Glin Pro Gly US 9,345,770 B2 93 - Continued

35 4 O 45 Trp Glin Gly Pro Lieu. Cys Asp Gln Cys Val Thr Ser Pro Gly Cys Lieu. SO 55 6 O His Gly Lieu. Cys Gly Glu Pro Gly Glin Cys Ile Cys Thr Asp Gly Trp 65 70 7s 8O Asp Gly Glu Lieu. Cys Asp Arg Asp Val Arg Ala Cys Ser Ser Ala Pro 85 90 95 Cys Ala Asn. Asn Gly Thr Cys Val Ser Lieu. Asp Asp Gly Lieu. Tyr Glu 1OO 105 11 O Cys Ser Cys Ala Pro Gly Tyr Ser Gly Lys Asp Cys Glin Llys Lys Asp 115 12 O 125 Gly Pro Cys Val Ile Asn Gly Ser Pro Cys Gln His Gly Gly Thr Cys 13 O 135 14 O Val Asp Asp Glu Gly Arg Ala Ser His Ala Ser Cys Lieu. Cys Pro Pro 145 150 155 160 Gly Phe Ser Gly Asn Phe Cys Glu Ile Val Ala Asn Ser Cys Thr Pro 1.65 17O 17s Asn Pro Cys Glu Asn Asp Gly Val Cys Thr Asp Ile Gly Gly Asp Phe 18O 185 19 O Arg Cys Arg Cys Pro Ala Gly Phe Ile Asp Llys Thr Cys Ser Arg Pro 195 2OO 2O5 Val Thr Asn Cys Ala Ser Ser Pro Cys Glin Asn Gly Gly Thr Cys Lieu. 21 O 215 22O Gln His Thr Glin Val Ser Tyr Glu. Cys Lieu. Cys Llys Pro Glu Phe Thr 225 23 O 235 24 O Gly Lieu. Thir Cys Val Llys Lys Arg Ala Lieu. Ser Pro Glin Glin Val Thr 245 250 255 Arg Lieu Pro Ser Gly Tyr Gly Lieu Ala Tyr Arg Lieu. Thr Pro Gly Val 26 O 265 27 O His Glu Lieu Pro Val Glin Gln Pro Glu. His Arg Ile Lieu Lys Val Ser 27s 28O 285 Met Lys Glu Lieu. Asn Llys Llys Thr Pro Lieu. Lieu. Thr Glu Gly Glin Ala 29 O 295 3 OO Ile Cys Phe Thr Ile Leu Gly Val Lieu. Thir Ser Lieu Val Val Lieu. Gly 3. OS 310 315 32O Thr Val Gly Ile Val Phe Lieu. Asn Lys Cys Glu Thir Trp Val Ser Asn 3.25 330 335 Lieu. Arg Tyr Asn His Met Lieu. Arg Llys Llys Lys Asn Lieu. Lieu. Lieu. Glin 34 O 345 35. O Tyr Asn. Ser Gly Glu Asp Lieu Ala Val Asn. Ile Ile Phe Pro Glu Lys 355 360 365 Ile Asp Met Thr Thr Phe Ser Lys Glu Ala Gly Asp Glu Glu Ile 37 O 375 38O

<210s, SEQ ID NO 22 &211s LENGTH: 147 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 22 Met Val His Lieu. Thr Pro Glu Glu Lys Ser Ala Val Thr Ala Leu Trp 1. 5 1O 15

Gly Llys Val Asin Val Asp Glu Val Gly Gly Glu Ala Lieu. Gly Arg Lieu. 2O 25 3O US 9,345,770 B2 95 - Continued Lieu Val Val Tyr Pro Trp Thr Glin Arg Phe Phe Glu Ser Phe Gly Asp 35 4 O 45 Lieu. Ser Thr Pro Asp Ala Wal Met Gly ASn Pro Llys Val Lys Ala His SO 55 6 O Gly Lys Llys Val Lieu. Gly Ala Phe Ser Asp Gly Lieu Ala His Lieu. Asp 65 70 7s 8O Asn Lieu Lys Gly Thr Phe Ala Thr Lieu. Ser Glu Lieu. His Cys Asp Llys 85 90 95 Lieu. His Val Asp Pro Glu Asn. Phe Arg Lieu. Lieu. Gly Asn Val Lieu Val 1OO 105 11 O Cys Val Lieu Ala His His Phe Gly Lys Glu Phe Thr Pro Pro Val Glin 115 12 O 125 Ala Ala Tyr Glin Llys Val Val Ala Gly Val Ala Asn Ala Lieu Ala His 13 O 135 14 O Lys Tyr His 145

<210s, SEQ ID NO 23 &211s LENGTH: 923 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 23 Met Glu Arg Gly Lieu Pro Lieu. Lieu. Cys Ala Val Lieu Ala Lieu Val Lieu. 1. 5 1O 15 Ala Pro Ala Gly Ala Phe Arg Asn Asp Llys Cys Gly Asp Thir Ile Llys 2O 25 30 Ile Glu Ser Pro Gly Tyr Lieu. Thir Ser Pro Gly Tyr Pro His Ser Tyr 35 4 O 45 His Pro Ser Glu Lys Cys Glu Trp Lieu. Ile Glin Ala Pro Asp Pro Tyr SO 55 6 O Glin Arg Ile Met Ile Asn. Phe Asn Pro His Phe Asp Lieu. Glu Asp Arg 65 70 7s 8O Asp Cys Llys Tyr Asp Tyr Val Glu Val Phe Asp Gly Glu Asn. Glu Asn 85 90 95 Gly His Phe Arg Gly Lys Phe Cys Gly Lys Ile Ala Pro Pro Pro Val 1OO 105 11 O Val Ser Ser Gly Pro Phe Leu Phe Ile Llys Phe Val Ser Asp Tyr Glu 115 12 O 125 Thr His Gly Ala Gly Phe Ser Ile Arg Tyr Glu Ile Phe Lys Arg Gly 13 O 135 14 O Pro Glu. Cys Ser Glin Asn Tyr Thr Thr Pro Ser Gly Val Ile Llys Ser 145 150 155 160 Pro Gly Phe Pro Glu Lys Tyr Pro Asn Ser Lieu. Glu. Cys Thr Tyr Ile 1.65 17O 17s

Val Phe Val Pro Llys Met Ser Glu Ile Ile Leu Glu Phe Glu Ser Phe 18O 185 19 O

Asp Leu Glu Pro Asp Ser Asn Pro Pro Gly Gly Met Phe Cys Arg Tyr 195 2OO 2O5 Asp Arg Lieu. Glu Ile Trp Asp Gly Phe Pro Asp Val Gly Pro His Ile 21 O 215 22O

Gly Arg Tyr Cys Gly Glin Lys Thr Pro Gly Arg Ile Arg Ser Ser Ser 225 23 O 235 24 O

Gly Ile Leu Ser Met Val Phe Tyr Thr Asp Ser Ala Ile Ala Lys Glu 245 250 255 US 9,345,770 B2 97 98 - Continued

Gly Phe Ser Ala Asn Ser Wall Luell Glin Ser Ser Wall Ser Glu Asp 26 O 265 27 O

Phe Cys Met Glu Ala Lell Gly Met Glu Ser Gly Glu Ile His Ser 27s 285

Asp Glin Ile Thir Ala Ser Ser Glin Ser Thir Asn Trp Ser Ala Glu 29 O 295 3 OO

Arg Ser Arg Luell Asn Tyr Pro Glu Asn Gly Trp Thir Pro Gly Glu Asp 3. OS 310 315

Ser Arg Glu Trp Ile Glin Wall Asp Luell Gly Lell Lell Arg Phe Wall 3.25 330 335

Thir Ala Wall Gly Thir Glin Gly Ala Ile Ser Glu Thir Lys Lys 34 O 345 35. O

Wall Thir Ile Asp Wall Ser Ser Asn Gly Glu Asp 355 360 365

Trp Ile Thir Ile Lys Glu Gly Asn Pro Wall Lell Phe Glin Gly Asn 37 O 375

Thir Asn Pro Thir Asp Wall Wall Wall Ala Wall Phe Pro Pro Luell Ile 385 390 395 4 OO

Thir Arg Phe Wall Arg Ile Pro Ala Thir Trp Glu Thir Gly Ile Ser 4 OS 415

Met Arg Phe Glu Wall Gly Lys Ile Thir Asp Pro Ser 425 43 O

Gly Met Luell Gly Met Wall Ser Gly Luell Ile Ser Asp Ser Glin Ile Thir 435 44 O 445

Ser Ser Asn Glin Gly Asp Arg Asn Trp Met Pro Glu Asn Ile Arg Luell 450 45.5 460

Wall Thir Ser Arg Ser Gly Trp Ala Luell Pro Pro Ala Pro His Ser Tyr 465 470

Ile Asn Glu Trp Lell Glin Ile Asp Luell Gly Glu Glu Ile Wall Arg 485 490 495

Gly Ile Ile Ile Glin Gly Gly His Arg Glu Asn Wall Phe Met SOO 505

Arg Phe Ile Gly Ser Asn Asn Gly Ser Asp Trp Met 515 525

Ile Met Asp Asp Ser Arg Ala Ser Phe Glu Gly Asn Asn 53 O 535 54 O

Asn Asp Thir Pro Glu Lell Arg Thir Phe Pro Ala Lell Ser Thir Arg 5.45 550 555 560

Phe Ile Arg Ile Tyr Pro Glu Arg Ala Thir His Gly Gly Luell Luell 565 st O

Arg Met Glu Luell Lell Gly Glu Wall Glu Ala Pro Thir Ala Pro 585 59 O

Thir Thir Pro Asn Gly Asn Lell Wall Asp Glu Asp Asp Asp Ala 595 605

Asn Cys His Ser Gly Thir Gly Asp Asp Phe Glin Lell Thir Gly Thir 610 615

Thir Wall Luell Ala Thir Glu Pro Thir Wall Ile Asp Ser Thir Glin 625 630 635 64 O

Ser Glu Phe Pro Thir Gly Phe Asn Cys Glu Phe Gly Trp Ser 645 650

His Thir Phe Cys His Trp Glu His Asp ASn His Wall Glin Lys 660 665 67 O US 9,345,770 B2 99 100 - Continued

Trp Ser Val Lieu. Thir Ser Lys Thr Gly Pro Ile Glin Asp His Thir Gly 675 68O 685

Asp Gly Asn Phe Ile Tyr Ser Glin Ala Asp Glu Asn Glin Lys Gly 69 O. 695 7 OO

Val Ala Arg Lieu Val Ser Pro Val Wall Ser Glin Asn Ser Ala His 7 Os 71O

Cys Met Thr Phe Trp Tyr His Met Ser Gly Ser His Wall Gly Thir Luell 72 73 O 73

Arg Val Lys Lieu. Arg Tyr Glin Lys Pro Glu Glu Asp Glin Luell Wall 740 74. 7 O

Trp Met Ala Ile Gly His Glin Gly Asp His Trp Glu Gly Arg Wall 7ss 760 765

Lieu. Lieu. His Llys Ser Lieu Lys Lieu Tyr Glin Wall Ile Phe Glu Gly Glu 770 775 78O

Ile Gly Lys Gly Asn Lieu. Gly Gly Ile Ala Wall Asp Asp Ile Ser Ile 78s 79 O 79.

Asn Asn His Ile Ser Glin Glu Asp Ala Pro Ala Asp Luell Asp 805 810 815

Llys Lys Asn Pro Glu Ile Lys Ile Asp Glu Thir Gly Ser Thir Pro Gly 82O 825 83 O

Tyr Glu Gly Glu Gly Glu Gly Asp Asn Ile Ser Arg Pro Gly 835 84 O 845

Asn Val Lieu Lys Thr Lieu. Asp Pro Ile Luell Ile Thir Ile Ile Ala Met 850 855 860

Ser Ala Lieu. Gly Val Lieu Lieu. Gly Ala Wall Cys Gly Wall Wall Lieu Tyr 865 87O

Cys Ala Cys Trp His Asn Gly Met Ser Glu Arg Asn Lell Ser Ala Luell 885 890 895

Glu Asn Tyr Asn. Phe Glu Lieu Val Asp Gly Wall Lell Lys Asp 9 OO 905 91 O

Lys Lieu. Asn Thr Glin Ser Thr Tyr Ser Glu Ala 915 92 O

<210s, SEQ ID NO 24 211 LENGTH: 757 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 24

Met Lieu. Lieu. Arg Lieu Lleu Lieu Ala Trp Ala Ala Ala Gly Pro Thir Luell 1. 5 1O 15

Gly Glin Asp Pro Trp Ala Ala Glu Pro Arg Ala Ala Gly Pro Ser 2O 25

Ser Cys Tyr Ala Lieu. Phe Pro Arg Arg Arg Thir Phe Lell Glu Ala Trp 35 4 O 45

Arg Ala Cys Arg Glu Lieu. Gly Gly Asp Luell Ala Thir Pro Arg Thir Pro SO 55 6 O

Glu Glu Ala Glin Arg Val Asp Ser Luell Wall Gly Ala Gly Pro Ala Ser 65 70 8O

Arg Lieu. Lieu. Trp Ile Gly Lieu. Glin Arg Glin Ala Arg Glin Glin Luell 85 90 95

Glin Arg Pro Leu Arg Gly Phe Thr Trp Thir Thir Gly Asp Glin Asp Thir 1OO 105 11 O

Ala Phe Thr Asn Trp Ala Gln Pro Ala Ser Gly Gly Pro Pro Ala 115 12 O 125 US 9,345,770 B2 101 102 - Continued

Glin Arg Wall Ala Lell Glu Ala Ser Gly Glu His Arg Trp Luell Glu 13 O 135 14 O

Gly Ser Thir Lell Ala Wall Asp Gly Luell Glin Phe Gly Phe 145 150 155 160

Glu Gly Ala Pro Ala Lell Glin Asp Glu Ala Gly Glin Ala Gly Pro 1.65 17O 17s

Ala Wall Thir Thir Pro Phe His Luell Wall Ser Thir Glu Phe Glu Trp 18O 185 19 O

Lell Pro Phe Gly Ser Wall Ala Ala Wall Glin Glin Ala Gly Arg Gly 195

Ala Ser Luell Luell Cys Wall Lys Glin Pro Glu Gly Gly Wall Gly Trp Ser 21 O 215 22O

Arg Ala Gly Pro Lell Cys Lell Gly Thir Gly Cys Ser Pro Asp Asn Gly 225 23 O 235 24 O

Gly Glu His Glu Wall Glu Glu Wall Asp Gly His Wall Ser 245 250 255

Arg Thir Glu Gly Phe Arg Luell Ala Ala Asp Gly Arg Ser Glu 26 O 265 27 O

Asp Pro Cys Ala Glin Ala Pro Cys Glu Glin Glin Glu Pro Gly Gly 27s 285

Pro Glin Gly Ser His Arg Luell Gly Phe Arg Pro Ala Glu 29 O 295 3 OO

Asp Asp Pro His Arg Cys Wall Asp Thir Asp Glu Glin Ile Ala Gly 3. OS 310 315

Wall Glin Glin Met Wall Asn Wall Gly Gly Phe Glu Cys 3.25 330 335

Ser Glu Gly His Glu Lell Glu Ala Asp Gly Ile Ser Cys Ser Pro 34 O 345 35. O

Ala Gly Ala Met Gly Ala Glin Ala Ser Glin Asp Lell Gly Asp Glu Luell 355 360 365

Lell Asp Asp Gly Glu Asp Glu Glu Asp Glu Asp Glu Ala Trp Ala 37 O 375

Phe Asn Gly Gly Trp Thir Glu Met Pro Gly Ile Lell Trp Met Glu Pro 385 390 395 4 OO

Thir Glin Pro Pro Asp Phe Ala Luell Ala Tyr Arg Pro Ser Phe Pro Glu 4 OS 415

Asp Arg Glu Pro Glin Ile Pro Pro Glu Pro Thir Trp Pro Pro Pro 425 43 O

Lell Ser Ala Pro Arg Wall Pro Tyr His Ser Ser Wall Lell Ser Wall Thir 435 44 O 445

Arg Pro Wall Wall Wall Ser Ala Thir His Pro Thir Lell Pro Ser Ala His 450 45.5 460

Glin Pro Pro Wall Ile Pro Ala Thir His Pro Ala Lell Ser Arg Asp His 465 470

Glin Ile Pro Wall Ile Ala Ala Asn Pro Asp Lell Pro Ser Ala Tyr 485 490 495

Glin Pro Gly Ile Lell Ser Wall Ser His Ser Ala Glin Pro Pro Ala His SOO 505

Glin Pro Pro Met Ile Ser Thir Lys Pro Glu Lell Phe Pro Ala His 515 525

Glin Ser Pro Met Phe Pro Asp Thir Arg Wall Ala Gly Thir Glin Thir Thir 53 O 535 54 O US 9,345,770 B2 103 104 - Continued

Thr His Leu Pro Gly Ile Pro Pro Asn His Ala Pro Lell Wall Thir Thir 5.45 550 555 560

Lieu. Gly Ala Glin Lieu Pro Pro Glin Ala Pro Asp Ala Lell Wall Luell Arg 565 st O sts

Thir Glin Ala Thr Glin Leu Pro Ile Ile Pro Thir Ala Glin Pro Ser Luell 58O 585 59 O

Thir Thir Thr Ser Arg Ser Pro Val Ser Pro Ala His Glin Ile Ser Wall 595 6OO 605

Pro Ala Ala Thr Glin Pro Ala Ala Luell Pro Thir Lell Lell Pro Ser Glin 610 615

Ser Pro Thir Asn. Glin. Thir Ser Pro Ile Ser Pro Thir His Pro His Ser 625 630 635 64 O

Lys Ala Pro Glin Ile Pro Arg Glu Asp Gly Pro Ser Pro Luell Ala 645 650 655

Lieu. Trp Leu Pro Ser Pro Ala Pro Thir Ala Ala Pro Thir Ala Luell Gly 660 665 67 O

Glu Ala Gly Lieu Ala Glu. His Ser Glin Arg Asp Asp Arg Trp Luell Luell 675 68O 685

Val Ala Lieu. Leu Val Pro Thr Cys Wall Phe Luell Wall Wall Luell Luell Ala 69 O. 695 7 OO

Lieu. Gly Ile Val Tyr Cys Thr Arg Gly Pro His Ala Pro Asn Lys 7 Os 71O

Arg Ile Thir Asp Cys Tyr Arg Trp Wall Ile His Ala Gly Ser Lys Ser 72 73 O 73

Pro Thr Glu Pro Met Pro Pro Arg Gly Ser Lieu. Thr Gly Wall Gln Thr 740 74. 7 O Cys Arg Thr Ser Val 7ss

<210s, SEQ ID NO 25 &211s LENGTH: 976 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 25

Met Glu Lieu. Glin Ala Ala Arg Ala Phe Ala Lell Lell Trp Gly 1. 5 15

Ala Lieu Ala Ala Ala Ala Ala Ala Glin Gly Lys Glu Wall Wall Luell Luell 2O 25

Asp Phe Ala Ala Ala Gly Gly Glu Luell Gly Trp Lell Thir His Pro 35 4 O 45

Gly Lys Gly Trp Asp Lieu Met Glin Asn Ile Met Asn Asp Met Pro Ile SO 55 6 O

Tyr Met Tyr Ser Val Cys Asn Val Met Ser Gly Asp Glin Asp Asn 65 70

Lieu. Arg Thr Asn Trp Val Tyr Arg Gly Glu Ala Glu Arg Ile Phe Ile 85 90 95

Glu Lieu Lys Phe Thr Val Arg Asp Cys Asn Ser Phe Pro Gly Gly Ala 1OO 105 11 O

Ser Ser Cys Lys Glu Thir Phe Asn Luell Tyr Ala Glu Ser Asp Luell 115 12 O 125

Asp Tyr Gly Thr Asn Phe Gln Lys Arg Luell Phe Thir Ile Asp Thir 13 O 135 14 O

Ile Ala Pro Asp Glu Ile Thr Val Ser Ser Asp Phe Glu Ala Arg His 145 150 155 160 US 9,345,770 B2 105 106 - Continued

Wall Luell Asn Wall Glu Glu Arg Ser Wall Gly Pro Lell Thir Arg 1.65 17O

Gly Phe Luell Ala Phe Glin Asp Ile Gly Ala Wall Ala Luell Luell 18O 185 19 O

Ser Wall Arg Wall Tyr Lys Pro Glu Lell Lell Glin Gly Luell 195

Ala His Phe Pro Glu Thir Ile Ala Gly Ser Asp Ala Pro Ser Luell Ala 21 O 215 22O

Thir Wall Ala Gly Thir Cys Wall Asp His Ala Wall Wall Pro Pro Gly Gly 225 23 O 235 24 O

Glu Glu Pro Arg Met His Ala Wall Asp Gly Glu Trp Luell Wall Pro 245 250 255

Ile Gly Glin Cys Lell Glin Ala Gly Glu Wall Glu Asp Ala 26 O 265 27 O

Glin Ala Ser Pro Gly Phe Phe Phe Glu Ala Ser Glu Ser 28O 285

Pro Cys Luell Glu Cys Pro Glu His Thir Luell Pro Ser Pro Glu Gly Ala 29 O 295 3 OO

Thir Ser Glu Cys Glu Glu Gly Phe Phe Arg Ala Pro Glin Asp Pro 3. OS 310 315

Ala Ser Met Pro Cys Thir Arg Pro Pro Ser Ala Pro His Luell Thir 3.25 330 335

Ala Wall Gly Met Gly Ala Wall Glu Luell Arg Trp Thir Pro Pro Glin 34 O 345 35. O

Asp Ser Gly Gly Arg Glu Asp Ile Wall Ser Wall Thir Glu Glin 355 360 365

Trp Pro Glu Ser Gly Glu Gly Pro Glu Ala Ser Wall Arg 37 O 375

Tyr Ser Glu Pro Pro His Gly Luell Thir Arg Thir Ser Wall Thir Wall Ser 385 390 395 4 OO

Asp Luell Glu Pro His Met Asn Thir Phe Thir Wall Glu Ala Arg Asn 4 OS 415

Gly Wall Ser Gly Lell Wall Thir Ser Arg Ser Phe Arg Thir Ala Ser Wall 425 43 O

Ser Ile Asn Glin Thir Glu Pro Pro Wall Arg Lell Glu Gly Arg Ser 435 44 O 445

Thir Thir Ser Luell Ser Wall Ser Trp Ser Ile Pro Pro Pro Glin Glin Ser 450 45.5 460

Arg Wall Trp Tyr Glu Wall Thir Arg Lys Gly Asp Ser Asn 465 470

Ser Asn Wall Arg Arg Thir Glu Gly Phe Ser Wall Thir Luell Asp Asp 485 490 495

Lell Ala Pro Asp Thir Thir Luell Wall Glin Wall Glin Ala Luell Thir Glin SOO 505

Glu Gly Glin Gly Ala Gly Ser Lys Wall His Glu Phe Glin Thir Luell Ser 515 525

Pro Glu Gly Ser Gly Asn Lell Ala Wall Ile Gly Gly Wall Ala Wall Gly 53 O 535 54 O

Wall Wall Luell Luell Lell Wall Lell Ala Gly Wall Gly Phe Phe Ile His Arg 5.45 550 555 560

Arg Arg Asn Glin Arg Ala Arg Glin Ser Pro Glu Asp Wall Tyr Phe 565 st O sts US 9,345,770 B2 107 108 - Continued

Ser Ser Glu Glin Lell Pro Luell Lys Thir Tyr Wall Asp Pro His 58O 585 59 O

Thir Glu Asp Pro Asn Glin Ala Wall Luell Phe Thir Thir Glu Ile 595 605

His Pro Ser Wall Thir Arg Glin Wall Ile Gly Ala Gly Glu Phe 610 615

Gly Glu Wall Lys Gly Met Luell Thir Ser Ser Gly Glu 625 630 635 64 O

Wall Pro Wall Ala Ile Thir Luell Ala Gly Thir Glu Lys Glin 645 650 655

Arg Wall Asp Phe Lell Gly Glu Ala Gly Ile Met Glin Phe Ser His 660 665 67 O

His Asn Ile Ile Arg Lell Glu Gly Wall Ile Ser Tyr Pro Met 675 685

Met Ile Ile Thir Glu Met Glu Asn Gly Ala Lell Asp Phe Luell 69 O. 695 7 OO

Arg Glu Asp Gly Glu Phe Ser Wall Luell Glin Lell Wall Gly Met Luell 7 Os

Arg Gly Ile Ala Ala Gly Met Luell Ala Asn Met Asn Tyr Wall 72 73 O 73

His Arg Asp Luell Ala Ala Arg Asn Ile Luell Wall Asn Ser Asn Luell Wall 740 74. 7 O

Wall Ser Asp Phe Gly Luell Ser Arg Wall Lell Glu Asp Asp Pro 760 765

Glu Ala Thr Thr Thr Ser Gly Gly Ile Pro Ile Arg Trp Thr 770 775

Ala Pro Glu Ala Ile Ser Arg Phe Thir Ser Ala Ser Asp Wall 79 O 79.

Trp Ser Phe Gly Ile Wall Met Trp Glu Wall Met Thir Gly Glu Arg 805 810 815

Pro Trp Glu Lell Ser Asn His Glu Wall Met Ala Ile Asn Asp 825 83 O

Gly Phe Arg Luell Pro Thir Pro Met Asp Pro Ser Ala Ile Glin 835 84 O 845

Lell Met Met Glin Cys Trp Glin Glin Glu Arg Ala Arg Arg Pro Phe 850 855 860

Ala Asp Ile Wall Ser Ile Lell Asp Luell Ile Arg Ala Pro Asp Ser 865

Lell Thir Luell Ala Asp Phe Asp Pro Arg Wall Ser Ile Arg Luell Pro 885 890 895

Ser Thir Ser Gly Ser Glu Gly Wall Pro Phe Arg Thir Wall Ser Glu Trp 9 OO 905 91 O

Lell Glu Ser Ile Lys Met Glin Glin Thir Glu His Phe Met Ala Ala 915 92 O 925

Gly Tyr Thir Ala Ile Glu Lys Wall Wall Glin Met Thir Asn Asp Asp Ile 93 O 935 94 O

Lys Arg Ile Gly Wall Arg Lell Pro Gly His Glin Arg Ile Ala Tyr 945 950 955 96.O

Ser Luell Luell Gly Lell Asp Glin Wall Asn Thir Wall Gly Ile Pro Ile 965 97O 97.

<210s, SEQ ID NO 26 &211s LENGTH: 181 212. TYPE : PRT US 9,345,770 B2 109 110 - Continued <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 26 Met Cys Lys Gly Lieu Ala Ala Lieu Pro His Ser Cys Lieu. Glu Arg Ala 1. 5 1O 15 Lys Glu Ile Lys Ile Llys Lieu. Gly Ile Lieu. Lieu. Glin Llys Pro Asp Ser 2O 25 3O Val Gly Asp Lieu Val Ile Pro Tyr Asn. Glu Lys Pro Glu, Llys Pro Ala 35 4 O 45 Llys Thr Glin Llys Thir Ser Lieu. Asp Glu Ala Lieu. Glin Trp Arg Asp Ser SO 55 6 O Lieu. Asp Llys Lieu. Lieu. Glin Asn. Asn Tyr Gly Lieu Ala Ser Phe Llys Ser 65 70 7s 8O Phe Lieu Lys Ser Glu Phe Ser Glu Glu Asn Lieu. Glu Phe Trp Ile Ala 85 90 95 Cys Glu Asp Tyr Llys Lys Ile Llys Ser Pro Ala Lys Met Ala Glu Lys 1OO 105 11 O Ala Lys Glin Ile Tyr Glu Glu Phe Ile Glin Thr Glu Ala Pro Lys Glu 115 12 O 125 Val Asn. Ile Asp His Phe Thr Lys Asp Ile Thr Met Lys Asn Lieu Val 13 O 135 14 O Glu Pro Ser Lieu. Ser Ser Phe Asp Met Ala Glin Lys Arg Ile His Ala 145 150 155 160 Lieu Met Glu Lys Asp Ser Lieu Pro Arg Phe Val Arg Ser Glu Phe Tyr 1.65 17O 17s Glin Glu Lieu. Ile Llys 18O

<210s, SEQ ID NO 27 &211s LENGTH: 1106 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 27 Met Arg Lieu Pro Gly Ala Met Pro Ala Lieu Ala Lieu Lys Gly Glu Lieu. 1. 5 1O 15 Lieu. Lieu. Lieu. Ser Lieu Lleu Lleu Lieu. Lieu. Glu Pro Glin Ile Ser Glin Gly 2O 25 3O Lieu Val Val Thr Pro Pro Gly Pro Glu Lieu Val Lieu. Asn Val Ser Ser 35 4 O 45 Thr Phe Val Lieu. Thr Cys Ser Gly Ser Ala Pro Val Val Trp Glu Arg SO 55 6 O Met Ser Glin Glu Pro Pro Glin Glu Met Ala Lys Ala Glin Asp Gly Thr 65 70 7s 8O Phe Ser Ser Val Lieu. Thir Lieu. Thir Asn Lieu. Thr Gly Lieu. Asp Thr Gly 85 90 95 Glu Tyr Phe Cys Thr His Asn Asp Ser Arg Gly Lieu. Glu Thir Asp Glu 1OO 105 11 O

Arg Lys Arg Lieu. Tyr Ile Phe Val Pro Asp Pro Thr Val Gly Phe Leu 115 12 O 125

Pro Asn Asp Ala Glu Glu Lieu Phe Ile Phe Lieu. Thr Glu Ile Thr Glu 13 O 135 14 O

Ile Thir Ile Pro Cys Arg Val Thr Asp Pro Gln Leu Val Val Thr Lieu. 145 150 155 160 His Glu Lys Lys Gly Asp Wall Ala Lieu Pro Val Pro Tyr Asp His Glin US 9,345,770 B2 111 112 - Continued

1.65 17O 17s

Arg Gly Phe Ser Gly Ile Phe Glu Asp Arg Ser Ile Cys Thir 18O 185 19 O

Thir Ile Gly Asp Arg Glu Wall Asp Ser Asp Ala Tyr Wall Arg 195

Lell Glin Wall Ser Ser Ile Asn Wall Ser Wall ASn Ala Wall Glin Thir Wall 21 O 215 22O

Wall Arg Glin Gly Glu Asn Ile Thir Luell Met Cys Ile Wall Ile Gly Asn 225 23 O 235 24 O

Glu Wall Wall Asn Phe Glu Trp Thir Pro Arg Glu Ser Gly Arg 245 250 255

Lell Wall Glu Pro Wall Thir Asp Phe Luell Luell Asp Met Pro Tyr His Ile 26 O 265 27 O

Arg Ser Ile Luell His Ile Pro Ser Ala Glu Luell Glu Asp Ser Gly Thir 28O 285

Thir Asn Wall Thir Glu Ser Wall Asn Asp His Glin Asp Glu 29 O 295 3 OO

Ala Ile Asn Ile Thir Wall Glu Ser Gly Tyr Wall Arg Luell Luell Gly 3. OS 315 32O

Glu Wall Gly Thir Lell Phe Ala Glu Luell His Arg Ser Arg Thir Luell 3.25 330 335

Glin Wall Wall Phe Glu Pro Pro Pro Thir Wall Lell Trp Phe 34 O 345 35. O

Asp Asn Arg Thir Lell Asp Ser Ser Ala Gly Glu Ile Ala Luell Ser 355 360 365

Thir Arg Asn Wall Ser Thir Arg Wall Ser Glu Lell Thir Luell Wall 37 O 375

Arg Wall Wall Ala Ala Gly His Thir Met Arg Ala Phe His 385 395 4 OO

Glu Asp Ala Glu Wall Lell Ser Phe Glin Luell Glin Ile Asn Wall Pro 4 OS 415

Wall Arg Wall Luell Glu Lell Ser Glu Ser His Pro Asp Ser Gly Glu Glin 425 43 O

Thir Wall Arg Gly Arg Gly Met Pro Glin Pro Asn Ile Ile Trp 435 44 O 445

Ser Ala Arg Asp Lell Lys Arg Pro Arg Glu Lell Pro Pro Thir 450 45.5 460

Lell Luell Gly Asn Ser Ser Glu Glu Glu Ser Glin Lell Glu Thir Asn Wall 465 470

Thir Trp Glu Glu Glu Glin Glu Phe Glu Wall Wall Ser Thir Luell Arg 485 490 495

Lell Glin His Wall Asp Arg Pro Luell Ser Wall Arg Thir Luell Arg Asn SOO 505

Ala Wall Gly Glin Asp Thir Glin Glu Wall Ile Wall Wall Pro His Ser Luell 515 525

Pro Phe Wall Wall Wall Ile Ser Ala Ile Luell Ala Lell Wall Wall Luell 53 O 535 54 O

Thir Ile Ile Ser Lell Ile Ile Luell Ile Met Luell Trp Glin Pro 5.45 550 555 560

Arg Glu Ile Arg Trp Wall Ile Glu Ser Wall Ser Ser Asp Gly 565 st O sts

His Glu Ile Tyr Wall Asp Pro Met Glin Luell Pro Asp Ser Thir 58O 585 59 O US 9,345,770 B2 113 114 - Continued

Trp Glu Luell Pro Arg Asp Glin Luell Wall Luell Gly Arg Thir Luell Gly Ser 595 605

Gly Ala Phe Gly Glin Wall Wall Glu Ala Thir Ala His Gly Luell Ser His 610 615

Ser Glin Ala Thir Met Lys Wall Ala Wall Lys Met Lell Ser Thir Ala 625 630 635 64 O

Arg Ser Ser Glu Lys Glin Ala Luell Met Ser Glu Lell Ile Met Ser 645 650 655

His Luell Gly Pro His Lell Asn Wall Wall Asn Luell Lell Gly Ala Thir 660 665 67 O

Gly Gly Pro Ile Ile Ile Thir Glu Arg Gly Asp 675 685

Lell Wall Asp Lell His Arg Asn His Thir Phe Lell Glin His His 69 O. 695 7 OO

Ser Asp Arg Arg Pro Pro Ser Ala Glu Luell Ser Asn Ala Luell 7 Os 71O 71s

Pro Wall Gly Luell Pro Lell Pro Ser His Wall Ser Lell Thir Gly Glu Ser 72 73 O 73

Asp Gly Gly Tyr Met Asp Met Ser Lys Asp Glu Ser Wall Asp Wall 740 74. 7 O

Pro Met Luell Asp Met Gly Asp Wall Lys Ala Asp Ile Glu Ser 7ss 760 765

Ser Asn Met Ala Pro Tyr Asp Asn Wall Pro Ser Ala Pro Glu 770 775

Arg Thir Arg Ala Thir Lell Ile Asn Glu Ser Pro Wall Luell Ser Tyr 79 O 79.

Met Asp Luell Wall Gly Phe Ser Glin Wall Ala Asn Gly Met Glu Phe 805 810 815

Lell Ala Ser Lys Asn Wall His Arg Asp Luell Ala Ala Arg Asn Wall 825 83 O

Lell Ile Cys Glu Gly Lell Wall Ile Asp Phe Gly Luell Ala 835 84 O 845

Arg Asp Ile Met Arg Asp Ser Asn Ile Ser Lys Gly Ser Thir Phe 850 855 860

Lell Pro Luell Trp Met Ala Pro Glu Ser Ile Phe Asn Ser Luell Tyr 865 87O

Thir Thir Luell Ser Asp Wall Trp Ser Phe Gly Ile Lell Lell Trp Ile 885 890

Phe Thir Luell Gly Gly Thir Pro Pro Glu Luell Pro Met Asn Glin 9 OO 905 91 O

Phe Asn Ala Ile Arg Gly Arg Met Ala Glin Pro His 915 92 O 925

Ala Ser Asp Glu Ile Glu Ile Met Glin Cys Trp Glu 93 O 935 94 O

Phe Glu Ile Arg Pro Pro Phe Ser Glin Luell Wall Lell Lell Luell Arg 945 950 955 96.O

Lell Luell Gly Glu Gly Lys Tyr Glin Glin Wall Asp Glu 965

Phe Luell Arg Ser Asp His Pro Ala Ile Luell Arg Ser Glin Ala Arg Luell 985 99 O

Pro Gly Phe His Gly Lell Arg Ser Pro Leu Asp Thr Ser Ser Wall Lieu. 995 1OOO 1005 US 9,345,770 B2 115 116 - Continued

Ala Wall Glin Pro Asn Glu Gly Asp Asn Asp Tyr Ile Ile O1 5

Pro Luell Pro Asp Pro Glu Wall Ala Asp G lu. Gly Pro Lell O25 O35

Glu Gly Ser Pro Ser Ser Ser Thir Lieu. A S. Glu Wall Asn O4 O OSO

Thir Ser Ser Thir Ile Ser Asp Ser Pro Leul G lu. Pro Glin Asp O55 O65

Glu Pro Glu Pro Glu Pro Glin Luell Glu Luell Glin Wall Glu Pro Glu Of O O7 5

Pro Glu Lell Glu Glin Luell Pro Asp Ser Gly Cys P ro Ala Pro Arg O85 O9 O

Ala Glu Ala Glu Asp Ser Phe Luell 1 OO 1O 5

<210s, SEQ ID NO 28 &211s LENGTH: 2322 212. TYPE : PRT &213s ORGANISM: Homo Sap iens

<4 OOs, SEQUENCE: 28

Met Glin Ser Gly Arg Gly Pro Pro Luell Pro Ala Pro Lieu Ala Luell 1. 5 15

Ala Luell Thir Lieu. Thir Met Lell Ala Arg Luell Ala Ser Ala Ser Phe 2O 25 3O

Phe Gly Glu Asn His Lell Glu Wall Pro Wall Ala Thir Lieu. Thir Asp 35 4 O

Ile Asp Luell Gln Lieu. Glin Phe Ser Thir Ser Glin Pro Ala Lieu. Luell SO 55 6 O

Lell Luell Ala Ala Gly Pro Ala Asp His Luell Luell Lell Lieu. Tyr Ser 65 70

Gly Arg Luell Glin Wall Arg Lell Wall Luell Gly Glin Glu Lieu. Arg Luell 85 90 95

Glin Thir Pro Ala Glu Thir Lell Luell Ser Asp Ser Ile Pro His Thr Wall 1OO 105 11 O

Wall Luell Thir Wall Wall Glu Gly Trp Ala Thir Luell Ser Wall Asp Gly Phe 115 12 O 125

Lell Asn Ala Ser Ser Ala Wall Pro Gly Ala Pro Lell Glu Wall Pro Tyr 13 O 135 14 O

Gly Luell Phe Val Gly Gly Thir Gly Thir Luell Gly Lell Pro Tyr Lieu. Arg 145 150 155 160

Gly Thir Ser Arg Pro Lell Arg Gly Luell His Ala Ala Thir Lieu. Asn 1.65 17O 17s

Gly Arg Ser Lieu. Luell Arg Pro Luell Thir Pro Asp Wall His Glu Gly 18O 185 19 O

Ala Glu Glu Phe Ser Ala Ser Asp Asp Wall Ala Lell Gly Phe Ser Gly 195

Pro His Ser Lieu Ala Ala Phe Pro Ala Trp Gly Thir Glin Asp Glu Gly 21 O 215 22O

Thir Luell Glu Phe Thir Lell Thir Thir Glin Ser Arg Glin Ala Pro Luell Ala 225 23 O 235 24 O

Phe Glin Ala Gly Gly Arg Arg Gly Asp Phe Ile Wall Asp Ile Phe 245 250 255

Glu Gly His Lieu. Arg Ala Wall Wall Glu Gly Glin Gly Thir Wall Luell 26 O 265 27 O US 9,345,770 B2 117 118 - Continued

Lell His Asn Ser Wall Pro Wall Ala Asp Gly Glin Pro His Glu Wall Ser 27s 285

Wall His Ile Asn Ala His Arg Luell Glu Ile Ser Wall Asp Glin Pro 29 O 295 3 OO

Thir His Thir Ser Asn Arg Gly Wall Luell Ser Tyr Lell Glu Pro Arg Gly 3. OS 310 315

Ser Luell Luell Luell Gly Gly Lell Asp Ala Glu Ala Ser Arg His Luell Glin 3.25 330 335

Glu His Arg Luell Gly Lell Thir Pro Glu Ala Thir Asn Ala Ser Luell Luell 34 O 345 35. O

Gly Met Glu Asp Lell Ser Wall Asn Gly Glin Arg Arg Gly Luell Arg 355 360 365

Glu Ala Luell Luell Thir Arg Asn Met Ala Ala Gly Cys Arg Luell Glu Glu 37 O 375

Glu Glu Glu Asp Asp Ala Gly His Tyr Glu Ala Phe Ser Thir 385 390 395 4 OO

Lell Ala Pro Glu Ala Trp Pro Ala Met Glu Luell Pro Glu Pro Cys Wall 4 OS 415

Pro Glu Pro Gly Lell Pro Pro Wall Phe Ala ASn Phe Thir Glin Luell Luell 425 43 O

Thir Ile Ser Pro Lell Wall Wall Ala Glu Gly Gly Thir Ala Trp Luell Glu 435 44 O 445

Trp Arg His Wall Glin Pro Thir Luell Asp Luell Met Glu Ala Glu Luell Arg 450 45.5 460

Lys Ser Glin Wall Lell Phe Ser Wall Thir Arg Gly Ala Arg His Gly Glu 465 470

Lell Glu Luell Asp Ile Pro Gly Ala Glin Ala Arg Met Phe Thir Luell 485 490 495

Lell Asp Wall Wall Asn Arg Ala Arg Phe Ile His Asp Gly Ser Glu SOO 505

Asp Thir Ser Asp Glin Lell Wall Luell Glu Wall Ser Wall Thir Ala Arg Wall 515 525

Pro Met Pro Ser Cys Lell Arg Arg Gly Glin Thir Tyr Lell Luell Pro Ile 53 O 535 54 O

Glin Wall Asn Pro Wall Asn Asp Pro Pro His Ile Ile Phe Pro His Gly 5.45 550 555 560

Ser Luell Met Wall Ile Lell Glu His Thir Glin Pro Lell Gly Pro Glu 565 st O sts

Wall Phe Glin Ala Tyr Asp Pro Asp Ser Ala Glu Gly Luell Thir Phe 585 59 O

Glin Wall Luell Gly Thir Ser Ser Gly Luell Pro Wall Glu Arg Arg Asp Glin 595 605

Pro Gly Glu Pro Ala Thir Glu Phe Ser Arg Glu Lell Glu Ala Gly 610 615

Ser Luell Wall Wall His Arg Gly Gly Pro Ala Glin Asp Luell Thir Phe 625 630 635 64 O

Arg Wall Ser Asp Gly Lell Glin Ala Ser Pro Pro Ala Thir Luell Lys Wall 645 650 655

Wall Ala Ile Arg Pro Ala Ile Glin Ile His Arg Ser Thir Gly Luell Arg 660 665 67 O

Lell Ala Glin Gly Ser Ala Met Pro Ile Luell Pro Ala Asn Luell Ser Wall 675 68O 685 US 9,345,770 B2 119 120 - Continued

Glu Thir Asn Ala Wall Gly Glin Asp Wal Ser Wall Lell Phe Arg Val Thir 69 O. 695 7 OO

Gly Ala Luell Glin Phe Gly Glu Lieu. Glin Lys Glin Gly Ala Gly Gly Wall 7 Os

Glu Gly Ala Glu Trp Trp Ala Thr Glin Ala Phe His Glin Arg Asp Wall 72 73 O 73

Glu Glin Gly Arg Val Arg Lieu. Ser Thr Asp Pro Glin His His Ala 740 74. 7 O

Asp Thir Wall Glu Asn Lell Ala Lieu. Glu Wall Glin Wall Gly Glin Glu 760 765

Ile Luell Ser Asn Lieu. Ser Phe Pro Wall. Thir Ile Glin Arg Ala Thr Wall 770 775

Trp Met Luell Arg Lieu. Glu Pro Lieu. His Thr Glin Asn Thir Glin Glin Glu 79 O 79.

Thir Luell Thir Thir Ala His Lell Glu Ala Thr Luell Glu Glu Ala Gly Pro 805 810 815

Ser Pro Pro Thir Phe His Glu Wal Wall Glin Ala Pro Arg Llys Gly 82O 825 83 O

Asn Luell Glin Lieu. Glin Gly Thir Arg Lieu. Ser Asp Gly Glin Gly Phe Thir 835 84 O 845

Glin Asp Asp Ile Glin Ala Gly Arg Val Thr Gly Ala Thir Ala Arg 850 855 860

Ala Ser Glu Ala Wall Glu Asp Thr Phe Arg Phe Arg Wall Thir Ala Pro 865 87s 88O

Pro Phe Ser Pro Lieu Tyr Thir Phe Pro Ile His Ile Gly Gly Asp 885 890 895

Pro Asp Ala Pro Wall Lell Thir Asn. Wall Lieu. Luell Wall Wall Pro Glu Gly 9 OO 905 91 O

Gly Glu Gly Wall Lieu. Ser Ala Asp His Lieu. Phe Wall Lys Ser Luell Asn 915 92 O 925

Ser Ala Ser Tyr Lieu. Tyr Glu Wal Met Glu Arg Pro Arg His Gly Arg 93 O 935 94 O

Lell Ala Trp Arg Gly Thir Glin Asp Llys Thr Thir Met Wall Thir Ser Phe 945 950 955 96.O

Thir Asn Glu Asp Lieu. Lell Arg Gly Arg Lieu. Wall Glin His Asp Asp 965 97.

Ser Glu Thir Thr Glu Asp Asp Ile Pro Phe Wall Ala Thir Arg Glin Gly 98O 985 99 O

Glu Ser Ser Gly Asp Met Trp Glu Glu Val Arg Gly Wall Phe Arg 995

Wall Ala Ile Glin Pro His Ala Pro W Glin. Thir Ile O1O

Ser Ile Phe His Wall Gly Gly Arg A Luell Luell Thir

Thir Asp Wall Ala Phe Ser Asp Ala Asp Ser G Phe Ala Asp

Ala Lieu Wall Lieu. Thir Arg Llys Asp Lieu. Gly Ser Ile

Wall Wall Asp Glu Pro Thr Arg Pro Ile Phe Thir Glin

Glu Lieu. Arg Llys Arg Val Lieu. Phe Wal Hi Ser Gly Ala

Asp Gly Trp Ile Glin Lieu. Glin Wall Ser Asp G Gln His Glin US 9,345,770 B2 121 122 - Continued

10

Ala Ala Lell Luell Glu Wall Glin Ala Ser Glu Lell Arg 2O

Wall Asn Gly Ser Ser Wall Wall Pro Glin Gly Glin Gly

Thir Asp Thir Ala Wall His Luell Asp Thir Luell Asp Ile

Arg Gly Asp Glu Wall His Wall Thir Gly Pro Arg

Trp Glin Lell Wall Arg Gly Glin Pro Ala Ala Phe Ser

Glin Asp Lell Luell Asp Ala Wall Luell Tyr His Asn Gly

Ser Ser Pro Arg Asp Met Ala Phe Ser Wall Glu Ala Gly 21 O 215

Pro His Thir Asp Ala Luell Glin Wall Thir le Ala Lell Glu 225 23 O

Gly Pro Lell Ala Pro Luell Luell Wall Arg His Ile 235

Wall Phe Glin Gly Glu Ala Glu Ile Arg Arg Glin Lell Glu 250

Ala Glin Glu Ala Wall Pro Ala Asp Ile Wall Phe Ser Wall 265 27s

Ser Pro Pro Ser Ala Luell Wall Met Wall Ser Arg Gly 28O 29 O

Ala Luell Asp Glu Pro Pro Ser Luell Asp Pro Wall Glin Ser Phe 295 3OO 305

Ser Glin Ala Wall Asp Gly Arg Wall Lell Luell His Ser 310 315

Arg Pro Ala Trp Ser Ala Phe Ser Lell Asp Wall Ala Ser 3.25 33 O 335

Gly Luell Ala Pro Luell Glu Gly Wall Luell Wall Glu Luell Glu Wall 34 O 345 350

Lell Pro Ala Ile Pro Luell Glu Ala Glin Asn Phe Ser Wall Pro 355 360 365

Glu Gly Ser Luell Thir Luell Ala Pro Pro Lell Lell Arg Wall Ser 37O 375 38O

Gly Pro Phe Pro Thir Luell Luell Gly Luell Ser Lell Glin Wall Lell 385 390 395

Glu Pro Pro Glin His Gly Ala Luell Glin Glu Asp Gly Pro Glin 4 OO 405 41 O

Ala Thir Lell Ser Ala Ser Trp Arg Met Wall Glu Glu Glin 425

Lell Arg Wall His Gly Ser Glu Thir Lell Thir Asp Ser 44 O

Phe Lell Met Ala Asn Ser Glu Met Asp Glin Ser His 45.5

Pro Ala Phe Thir Wall Wall Luell Pro Wall Asn Asp Glin Pro 465 47 O

Pro Lell Thir Thir Asn Gly Luell Glin Met rp Glu Gly Ala 485

Thir Pro Ile Pro Ala Glu Ala Luell Arg Ser Asp Gly Asp 495 SOO US 9,345,770 B2 123 124 - Continued

Ser Gly Ser Glu Asp Luell Wall Tyr Thir Ile Glu Glin Pro Ser Asn 5 OS 510 515

Gly Wall Wall Luell Arg Ala Pro Gly Thir Glu Wall Arg Ser 53 O

Phe Glin Ala Glin Luell Gly Gly Luell Wall Lell Phe Ser His 545

Arg Thir Lell Asp Phe Arg Phe Arg Lell Ser Asp Gly 560

Glu Thir Ser Pro Phe Phe Arg Wall Ala Glin sts

Glin Lell Lell Ser Luell Gly Ser Glin Thir Lell Thir Wall 590

Pro Ser Wall Glin Pro Luell Ser Ser Glin Thir Lell Arg Ala Ser 6OO 605

Ser Ala Gly Thir Asp Pro Glin Luell Luell Lell Arg Wall Wall 615

Arg Pro Glin Luell Gly Arg Luell Phe His Ala Glin Glin Asp Ser 63 O 635

Thir Glu Ala Luell Wall Asn Phe Thir Glin Ala Glu Wall Ala 645 650

Gly Ile Lell Tyr Glu Glu Met Pro Pro Glu Pro Phe Trp 660 665

Glu His Asp Thir Luell Glu Luell Glin Luell Ser Pro Pro Ala 675

Arg Wall Ala Ala Thir Luell Ala Wall Ala Wall Phe Glu Ala 69 O.

Ala Pro Glin Arg Pro Ser His Luell Trp Asn Gly Lell 7Os 71O

Trp Pro Glu Gly Glin Arg Ala Arg Ile Thir Wall Ala Ala Lell 72 O 72

Asp Ser Asn Luell Luell Ser Wall Pro Ser Pro Glin Arg Ser 74 O

Glu Asp Wall Luell Phe Wall Thir Glin Phe Pro Ser Arg Gly

Glin Luell Lell Wall Ser Glu Pro Luell His Ala Glin Pro His 760 770

Phe Luell Glin Ser Glin Luell Ala Gly Glin Lell Wall Ala His 775 78s

Gly Gly Gly Thir Glin Asp Gly Phe His Phe Arg Ala His 79 O 8OO

Lell Glin Gly Pro Ala Ser Wall Ala Gly Pro Glin Thir Ser 805 815

Glu Phe Ala Ile Thir Arg Asp Wall Asn Glu Arg Pro Pro 83 O

Glin Pro Glin Ala Ser Wall Pro Luell Arg Luell Thir Gly Ser Arg 835 84 O

Ala Pro Ile Ser Arg Ala Glin Luell Ser Wall Wall Pro Asp Ser 850 855

Ala Pro Gly Glu Ile Glu yr Glu Wall Glin Arg Ala Pro His Asn 865 87 O 87s

Gly Phe Lell Ser Luell Wall Gly Gly Luell Gly Pro Wall Thir Arg 88O 885 890 US 9,345,770 B2 125 126 - Continued

Phe Glin Ala Asp Wall Asp Ser Gly Arg Lell Ala Phe Wall Ala 9 OO 905

Asn Ser Ser Wall Ala Ile Phe Glin Lell Ser Met Ser Asp 915 92 O

Gly Ser Pro Pro Luell Pro Met Ser Luell Ala Wall Asp Ile Lell 93 O 935

Pro Ala Ile Glu Wall Glin Luell Arg Ala Pro Lell Glu Wall Pro 945 950

Glin Lell Gly Arg Ser Ser Luell Ser Glin Glin Glin Luell Arg Wall 96.O 965

Wall Ser Asp Arg Glu Glu Pro Glu Ala Ala Luell Ile Glin 97O 97.

Gly Pro Glin Gly His Luell Luell Wall Gly Gly Pro Thir Ser 985 990

Ala Phe Ser Glin Phe Glin Asp Glin Gly Glu Wall Wall Phe Ala 2OOO 2005 2010

Phe Thir Asn Phe Ser Ser Ser His Asp His Phe Arg Wall Lell Ala 2015 2O2O 2O25

Lell Arg Gly Wall Asn Ala Ser Ala Wall Wall Asn Wall Thir Wall 2O35 2O4. O

Arg Ala Lell Lell His Wall Trp Ala Gly Gly Pro Trp Pro Glin Gly 2O45 2OSO 2O55

Ala Thir Lell Arg Luell Asp Pro Thir Wall Luell Asp Ala Gly Glu Lell 2O60 2O65 2. Of O

Ala Arg Thr Gly Ser Wall Pro Arg Phe Arg Lieu. Glu Gly 2O8 O

Pro His Gly Arg Wall Wall Arg Wall Pro Arg Arg Thir Glu 2095 2 O O

Pro Gly Ser Glin Luell Glu Glin Phe Thir Glin Asp Lell

Glu Gly Arg Luell Gly Glu Wall Gly Arg Glu Gly Arg

Ala Gly Pro Ala Gly Ser Luell Thir Lell Luell Trp Ala

Glin Wall Pro Pro Ala Ala Ser Luell Asp Ala Thir Glu

Pro Asn Ala Ala Arg Ser Wall Ala Luell Ser Wall

Pro Ala Ala Arg Thir Ala Gly Pro Ser Ser Thir

Pro Gly Glu Pro Gly Pro Met Ala Ser Ser Pro Glu Pro Ala 22 OO 22O5

Wall Gly Gly Phe Luell Ser Phe Luell Glu Ala ASn Met Phe 2215 222 O

Ser Wall Ile Ile Pro Met Cys Luell Wall Luell Lell Lell Luell Ala Lell 2225 223 O 2235

Ile Luell Pro Lell Luell Phe Tyr Luell Arg Arg Asn Thir Gly 224 O 2.245 225 O

His Asp Wall Glin Wall Luell Thir Ala Pro Arg ASn Gly Lell 2255 226 O 2265

Ala Gly Asp Thir Glu Thir Phe Arg Wall Glu Pro Gly Glin Ala 2270 2275 228O

Ile Pro Lell Thir Ala Wall Pro Gly Glin Gly Pro Pro Pro Gly Gly US 9,345,770 B2 127 128 - Continued

2285 229 O 2295

Glin Pro Asp Pro Glu Lieu. Lieu. Glin Phe Cys Arg Thr Pro Asn. Pro 23 OO 23 OS 2310

Ala Luell Lys Asn Gly Glin Tyr Trp Val 2315 232O

<210s, SEQ ID NO 29 &211s LENGTH: 931 212. TYPE : PRT &213s ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 29

Met Asp Met Phe Pro Leu. Thir Trp Val Phe Luell Ala Lell Phe Ser 1. 5 1O 15

Arg His Glin Wall Arg Gly Glin Pro Asp Pro Pro Gly Gly Arg Luell 2O 25

Asn Ser Lys Asp Ala Gly Tyr Ile Thr Ser Pro Gly Tyr Pro Glin Asp 35 4 O 45

Pro Ser His Glin Asn. Cys Glu Trp Ile Wall Tyr Ala Pro Glu Pro SO 55 6 O

Asn Glin Ile Wall Lieu. Asn. Phe Asn. Pro His Phe Glu Ile Glu Lys 65 70

His Asp Tyr Asp Phe Ile Glu Ile Arg Asp Gly Asp Ser Glu 85 90 95

Ser Ala Asp Luell Lieu. Gly Llys His Cys Gly ASn Ile Ala Pro Pro Thir 105 11 O

Ile Ile Ser Ser Gly Ser Met Leu Tyr Ile Phe Thir Ser Asp 115 12 O 125

Ala Arg Glin Gly Ala Gly Phe Ser Lieu. Arg Glu Ile Phe Thir 13 O 135 14 O

Gly Ser Glu Asp Cys Ser Lys Asn Phe Thr Ser Pro Asn Gly Thir Ile 145 150 155 160

Glu Ser Pro Gly Phe Pro Glu Lys Tyr Pro His Asn Lell Asp Cys Thir 1.65 17O 17s

Phe Thir Ile Luell Ala Llys Pro Llys Met Glu Ile Ile Lell Glin Phe Luell 18O 185 19 O

Ile Phe Asp Luell Glu. His Asp Pro Lieu. Glin Wall Gly Glu Gly Asp 195 2OO

Tyr Asp Trp Lieu. Asp Ile Trp Asp Gly Ile Pro His Wall Gly Pro 21 O 215 22O

Lell Ile Gly Tyr Cys Gly Thr Lys Thr Pro Ser Glu Luell Arg Ser 225 23 O 235 24 O

Ser Thir Gly Ile Lieu. Ser Lieu. Thir Phe His Thir Asp Met Ala Wall Ala 245 250 255

Asp Gly Phe Ser Ala Arg Tyr Tyr Lieu. Wall His Glin Glu Pro Luell 26 O 265 27 O

Glu Asn Phe Glin Cys Asn Val Pro Lieu. Gly Met Glu Ser Gly Arg Ile 27s 28O 285

Ala Asn Glu Glin Ile Ser Ala Ser Ser Thr Ser Asp Gly Arg Trp 29 O 295 3 OO

Thir Pro Glin Glin Ser Arg Lieu. His Gly Asp Asp Asn Gly Trp Thir Pro 3. OS 310 315

Asn Luell Asp Ser Asn Lys Glu Tyr Lieu. Glin Wall Asp Lell Arg Phe Luell 3.25 330 335 US 9,345,770 B2 129 130 - Continued

Thir Met Luell Thir Ala Ile Ala Thir Glin Gly Ala Ile Ser Arg Glu Thir 34 O 345 35. O

Glin Asn Gly Tyr Tyr Wall Ser Luell Glu Wall Ser Thir Asn 355 360 365

Gly Glu Asp Trp Met Wall Tyr Arg His Gly Lys Asn His Lys Wall Phe 37 O 375

Glin Ala Asn Asn Asp Ala Thir Glu Wall Wall Luell Asn Luell His Ala 385 390 395 4 OO

Pro Luell Luell Thir Arg Phe Wall Arg Ile Arg Pro Glin Thir Trp His Ser 4 OS 415

Gly Ile Ala Luell Arg Lell Glu Luell Phe Gly Cys Arg Wall Thir Asp Ala 425 43 O

Pro Ser Asn Met Lell Gly Met Luell Ser Gly Lell Ile Ala Asp Ser 435 44 O 445

Glin Ile Ser Ala Ser Ser Thir Glin Glu Tyr Luell Trp Ser Pro Ser Ala 450 45.5 460

Ala Arg Luell Wall Ser Ser Arg Ser Gly Trp Phe Pro Arg Ile Pro Glin 465 470

Ala Glin Pro Gly Glu Glu Trp Luell Glin Wall Asp Lell Gly Thir Pro 485 490 495

Thir Wall Gly Wall Ile Ile Glin Gly Ala Arg Gly Gly Asp Ser Ile SOO 505

Thir Ala Wall Glu Ala Arg Ala Phe Wall Arg Phe Lys Wall Ser Tyr 515 525

Ser Lieu Asn Gly Lys Asp Trp Glu Tyr Ile Gln Asp Pro Arg Thr Gln 53 O 535 54 O

Glin Pro Luell Phe Glu Gly Asn Met His Tyr Asp Thir Pro Asp Ile 5.45 550 555 560

Arg Arg Phe Asp Pro Ile Pro Ala Glin Tyr Wall Arg Wall Pro Glu 565 st O sts

Arg Trp Ser Pro Ala Gly Ile Gly Met Arg Luell Glu Wall Luell Gly 585 59 O

Asp Trp Thir Asp Ser Pro Thir Wall Glu Thir Lell Gly Pro Thir Wall 595 605

Ser Glu Glu Thir Thir Thir Pro Pro Thir Glu Glu Glu Ala Thir 610 615

Glu Gly Glu Asn Cys Ser Phe Glu Asp Asp Asp Luell Glin Luell 625 630 635 64 O

Pro Ser Gly Phe Asn Asn Phe Asp Phe Luell Glu Glu Pro Cys Gly 645 650 655

Trp Met Asp His Ala Trp Luell Arg Thir Thir Trp Ala Ser Ser 660 665 67 O

Ser Ser Pro Asn Asp Arg Thir Phe Pro Asp Asp Arg Asn Phe Luell Arg 675 685

Lell Glin Ser Asp Ser Glin Arg Glu Gly Glin Tyr Ala Arg Luell Ile Ser 69 O. 695 7 OO

Pro Pro Wall His Lell Pro Arg Ser Pro Wall Cys Met Glu Phe Glin Tyr 7 Os 72O

Glin Ala Thir Gly Gly Arg Gly Wall Ala Luell Glin Wall Wall Arg Glu Ala 72 73 O 73

Ser Glin Glu Ser Lell Lell Trp Wall Ile Arg Glu Asp Glin Gly Gly 740 74. 7 O

Glu Trp His Gly Arg Ile Ile Luell Pro Ser Asp Met Glu Tyr US 9,345,770 B2 131 132 - Continued

760 765

Glin Ile Wall Phe Glu Gly Val Ile Gly Gly Arg Ser Gly Glu Ile 770 775

Ala Ile Asp Asp Ile Arg Ile Ser Thir Asp Wall Pro Lell Glu Asn Cys 79 O 79.

Met Glu Pro Ile Ser Ala Phe Ala Gly Glu ASn Phe Wall Asp Ile 805 810 815

Pro Glu Ile His Glu Arg Glu Gly Tyr Glu Asp Glu Ile Asp Asp Glu 825 83 O

Glu Wall Asp Trp Ser Asn Ser Ser Ser Ala Thir Ser Gly Ser Gly 835 84 O 845

Ala Pro Ser Thir Asp Llys Glu Lys Ser Trp Luell Tyr Thir Luell Asp Pro 850 855 860

Ile Luell Ile Thir Ile Ile Ala Met Ser Ser Luell Gly Wall Luell Luell Gly 865 87O

Ala Thir Ala Gly Lieu. Lieu. Lieu Cys Thir Ser Ser Gly 885 890 895

Lell Ser Ser Arg Ser Cys Thr Thr Luell Glu ASn Asn Phe Glu Luell 9 OO 905 91 O

Asp Gly Luell Llys His Llys Val Met ASn His Glin 915 92 O 925

Ser Glu Ala 93 O

<210 SEQ ID NO 3 O &211s LENGTH: 212. TYPE : PRT &213s ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 3 O

Met Trp Asn Lieu Lieu. His Glu. Thr Asp Ser Ala Wall Ala Thir Ala Arg 1. 5 15

Arg Pro Arg Trp Lieu. Cys Ala Gly Ala Luell Wall Lell Ala Gly Gly Phe 25

Phe Luell Luell Gly Phe Leu Phe Gly Trp Phe Ile Ser Ser Asn Glu 35 4 O 45

Ala Thir Asn Ile Thr Pro Llys His Asn Met Ala Phe Luell Asp Glu SO 55 6 O

Lell Ala Glu Asn. Ile Llys Llys Phe Luell Tyr Asn Phe Thir Glin Ile 65 70 7s

Pro His Luell Ala Gly Thr Glu Gln Asn Phe Glin Lell Ala Glin Ile 85 90 95

Glin Ser Glin Trp Lys Glu Phe Gly Luell Asp Ser Wall Glu Luell Ala His 105 11 O

Asp Wall Luell Lieu. Ser Tyr Pro Asn Thir His Pro Asn Ile 115 12 O 125

Ser Ile Ile Asn Glu Asp Gly Asn Glu Ile Phe Asn Thir Ser Luell Phe 13 O 135 14 O

Glu Pro Pro Pro Pro Gly Tyr Glu Asn Wall Ser Asp Ile Wall Pro Pro 145 150 155 160

Phe Ser Ala Phe Ser Pro Glin Gly Met Pro Glu Gly Asp Luell Wall 1.65 17O 17s

Wall Asn Ala Arg Thr Glu Asp Phe Phe Lell Glu Arg Asp Met 18O 185 19 O US 9,345,770 B2 133 134 - Continued

Ile Asn Ser Gly Ile Wall Ile Ala Arg Tyr Gly Lys Wall 195

Phe Arg Gly Asn Lys Wall Lys Asn Ala Glin Luell Ala Gly Ala Lys Gly 21 O 215

Wall Ile Luell Ser Asp Pro Ala Asp Phe Ala Pro Gly Wall Lys 225 23 O 235 24 O

Ser Pro Asp Gly Trp Asn Luell Pro Gly Gly Gly Wall Glin Arg Gly 245 250 255

Asn Ile Luell Asn Lell Asn Gly Ala Gly Asp Pro Lell Thir Pro Gly 26 O 265 27 O

Pro Ala Asn Glu Tyr Ala Arg Arg Gly Ile Ala Glu Ala Wall 27s 285

Lell Pro Ser Ile Pro Wall His Pro Ile Gly Tyr Asp Ala Glin 29 O 295 3 OO

Lell Luell Glu Met Gly Gly Ser Ala Pro Pro Asp Ser Ser Trp Arg 3. OS 310 315

Gly Ser Luell Wall Pro Asn Wall Gly Pro Gly Phe Thir Gly Asn 3.25 330 335

Phe Ser Thir Glin Lys Wall Met His Ile His Ser Thir Asn Glu Wall 34 O 345 35. O

Thir Arg Ile Asn Wall Ile Gly Thir Luell Arg Gly Ala Wall Glu Pro 355 360 365

Asp Arg Wall Ile Lell Gly Gly His Arg Asp Ser Trp Wall Phe Gly 37 O 375

Gly Ile Asp Pro Gln Ser Gly Ala Ala Wall Wall His Glu Ile Wall Arg 385 390 395 4 OO

Ser Phe Gly Thir Lell Glu Gly Trp Arg Pro Arg Arg Thir Ile 4 OS 415

Lell Phe Ala Ser Trp Asp Ala Glu Glu Phe Gly Lell Lell Gly Ser Thir 425 43 O

Glu Trp Ala Glu Glu Asn Ser Arg Luell Luell Glin Glu Arg Gly Wall Ala 435 44 O 445

Ile Asn Ala Asp Ser Ser Ile Glu Gly ASn Tyr Thir Luell Arg Wall 450 45.5 460

Asp Thir Pro Lell Met Ser Luell Wall His Asn Lell Thir Glu 465 470

Lell Ser Pro Asp Glu Gly Phe Glu Gly Ser Lell Glu Ser 485 490 495

Trp Thir Lys Ser Pro Ser Pro Glu Phe Ser Gly Met Pro Arg Ile SOO 505 51O

Ser Luell Gly Ser Gly Asn Asp Phe Glu Wall Phe Phe Glin Arg Luell 515 525

Gly Ile Ala Ser Gly Arg Ala Arg Thir Asn Trp Glu Thir Asn 53 O 535 54 O

Lys Phe Ser Gly Tyr Pro Lell His Ser Wall Glu Thir Glu 5.45 550 555 560

Lell Wall Glu Phe Asp Pro Met Phe His Luell Thir Wall 565 st O sts

Ala Glin Wall Arg Gly Gly Met Wall Phe Glu Luell Ala Asn Ser Ile Wall 58O 585 59 O

Lell Pro Phe Asp Cys Arg Asp Tyr Ala Wall Wall Lell Arg Ala 595 6OO 605

Asp Ile Ser Ile Ser Met His Pro Glin Glu Met Thir US 9,345,770 B2 135 136 - Continued

610 615

Tyr Ser Wall Ser Phe Asp Ser Luell Phe Ser Ala Wall Asn Phe Thir 625 630 635 64 O

Glu Ile Ala Ser Lys Phe Ser Glu Arg Luell Glin Asp Phe Asp Lys Ser 645 650 655

Asn Pro Ile Wall Lell Arg Met Met Asn Asp Glin Lell Met Phe Luell Glu 660 665 67 O

Arg Ala Phe Ile Asp Pro Lell Gly Luell Pro Asp Arg Pro Phe Arg 675 685

His Wall Ile Ala Pro Ser Ser His Asn Lys Tyr Ala Gly Glu Ser 69 O. 695 7 OO

Phe Pro Gly Ile Tyr Asp Ala Luell Phe Asp Ile Glu Ser Wall Asp 7 Os

Pro Ser Ala Trp Gly Glu Wall Arg Glin Ile Wall Ala Ala 72 73 O 73

Phe Thir Wall Glin Ala Ala Ala Glu Thir Luell Ser Glu Wall Ala 740 74. 7 O

SEQ ID NO 31 LENGTH: 1338 TYPE : PRT ORGANISM: Homo sapiens

< 4 OOs SEQUENCE: 31

Met Val Ser Tyr Trp Asp Thir Gly Wall Luell Luell Ala Luell Luell Ser 1. 5 15

Cys Luell Luell Luell Thir Gly Ser Ser Ser Gly Ser Lell Lys Asp Pro 25 3O

Glu Luell Ser Luell Gly Thir Glin His Ile Met Glin Ala Gly Glin Thir 35 4 O 45

Lell His Luell Glin Arg Gly Glu Ala Ala His Lys Trp Ser Luell Pro SO 55 6 O

Glu Met Wall Ser Glu Ser Glu Arg Luell Ser Ile Thir Ser Ala 65 70 7s

Gly Arg Asn Gly Glin Phe Ser Thir Lell Thir Luell Asn Thir 85 90 95

Ala Glin Ala Asn His Thir Gly Phe Tyr Ser Luell Ala Wall 105 11 O

Pro Thir Ser Lys Glu Thir Glu Ser Ala Ile Tyr Ile Phe Ile 115 12 O 125

Ser Asp Thir Gly Arg Pro Phe Wall Glu Met Ser Glu Ile Pro Glu 13 O 135 14 O

Ile Ile His Met Thir Glu Gly Arg Glu Luell Wall Ile Pro Arg Wall 145 150 155 160

Thir Ser Pro Asn Ile Thir Wall Thir Luell Lys Phe Pro Luell Asp Thir 1.65 17O 17s

Lell Ile Pro Asp Gly Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe 18O 185 19 O

Ile Ile Ser Asn Ala Thir Lys Glu Ile Gly Lell Lell Thir Glu 195 2OO

Ala Thir Wall Asn Gly His Lell Tyr Thir ASn Tyr Lell Thir His Arg 21 O 215 22O

Glin Thir Asn Thir Ile Ile Asp Wall Glin Ile Ser Thir Pro Arg Pro Wall 225 23 O 235 24 O US 9,345,770 B2 137 138 - Continued

Luell Luell Arg Gly His Thir Luell Wall Luell ASn Cys Thir Ala Thir Thir 245 250 255

Pro Luell Asn Thir Wall Glin Met Thir Trp Ser Tyr Pro Asp Glu 26 O 265 27 O

Asn Arg Ala Ser Wall Arg Arg Arg Ile Asp Glin Ser Asn Ser His 285

Ala Asn Ile Phe Tyr Ser Wall Luell Thir Ile Asp Lys Met Glin Asn 29 O 295 3 OO

Asp Gly Luell Tyr Thir Arg Wall Arg Ser Gly Pro Ser Phe Lys 3. OS 310 315

Ser Wall Asn Thir Ser Wall His Ile Asp Ala Phe Ile Thir Wall 3.25 330 335

His Arg Lys Glin Glin Wall Luell Glu Thir Wall Ala Gly Lys Arg Ser 34 O 345 35. O

Arg Luell Ser Met Wall Lys Ala Phe Pro Ser Pro Glu Wall Wall 355 360 365

Trp Luell Asp Gly Lel Pro Ala Thir Glu Ser Ala Arg Luell 37 O 375

Thir Arg Ser Lel Ile Ile Asp Wall Thir Glu Glu Asp Ala 385 390 395 4 OO

Gly Asn Thir Ile Lel Lell Ser Ile Lys Glin Ser Asn Wall Phe 4 OS 415

Asn Luell Thir Ala Thir Lel Ile Wall Asn Wall Pro Glin Ile Glu 425 43 O

Ala Wall Ser Ser Phe Pro Asp Pro Ala Lieu. Pro Luell Gly Ser 435 44 O 445

Arg Glin Ile Luell Thir Thir Ala Gly Ile Pro Glin Pro Thir Ile 450 45.5 460

Lys Trp Phe Trp His Pro Asn His Asn His Ser Glu Ala Arg Cys 465 470

Asp Phe Ser Asn Asn Glu Glu Ser Phe Ile Lell Asp Ala Asp Ser 485 490 495

Asn Met Gly Asn Arg Ile Glu Ser Ile Thir Glin Arg Met Ala Ile Ile SOO 505

Glu Gly Lys Asn Lys Met Ala Ser Thir Luell Wall Wall Ala Asp Ser Arg 515 525

Ile Ser Gly Ile Tyr Ile Cys Ile Ala Ser ASn Lys Wall Gly Thir Wall 53 O 535 54 O

Gly Arg Asn Ile Ser Phe Ile Thir Asp Wall Pro Asn Gly Phe His 5.45 550 555 560

Wall Asn Luell Glu Lys Met Pro Thir Glu Gly Glu Asp Lell Luell Ser 565 st O sts

Thir Wall Asn Lys Phe Lell Arg Asp Wall Thir Trp Ile Luell Luell 585 59 O

Arg Thir Wall Asn Asn Arg Thir Met His Ser Ile Ser Glin 595 605

Met Ala Ile Thir Lys Glu His Ser Ile Thir Luell Asn Lell Thir Ile Met 610 615 62O

Asn Wall Ser Luell Glin Asp Ser Gly Thir Ala Arg Ala Arg Asn 625 630 635 64 O

Wall Thir Gly Glu Glu Ile Luell Glin Lys Glu Ile Thir Ile Arg 645 650 655

Asp Glin Glu Ala Pro Lell Luell Arg Asn Luell Ser Asp His Thir Wall US 9,345,770 B2 139 140 - Continued

660 665 67 O

Ala Ile Ser Ser Ser Thir Thir Luell Asp His Ala Asn Gly Val Pro 675 685

Glu Pro Glin Ile Thir Trp Phe Asn Asn His Lys Ile Glin Glin Glu 69 O. 695 7 OO

Pro Gly Ile Ile Lell Gly Pro Gly Ser Ser Thir Lell Phe Ile Glu Arg 7 Os

Wall Thir Glu Glu Asp Glu Gly Wall His Ala Thir Asn Glin 72 73 O 73

Gly Ser Wall Glu Ser Ser Ala Tyr Luell Thir Wall Glin Gly Thr Ser 740 74. 7 O

Asp Ser Asn Lell Glu Lell Ile Thir Luell Thir Thir Cys Val Ala 760 765

Ala Thir Luell Phe Trp Lell Lell Luell Thir Luell Phe Ile Arg Lys Met Lys 770 775 78O

Arg Ser Ser Ser Glu Ile Thir Asp Luell Ser Ile Ile Met Asp 79 O 79.

Pro Asp Glu Wall Pro Lell Asp Glu Glin Cys Glu Arg Lell Pro Tyr Asp 805 810 815

Ala Ser Trp Glu Phe Ala Arg Glu Arg Luell Lell Gly Lys Ser 825 83 O

Lell Gly Arg Gly Ala Phe Gly Lys Wall Wall Glin Ala Ser Ala Phe Gly 835 84 O 845

Ile Lys Ser Pro Thir Cys Arg Thir Wall Ala Wall Met Leu. Lys 850 855 860

Glu Gly Ala Thir Ala Ser Glu Ala Luell Met Thir Glu Lieu Lys 865

Ile Luell Thir His Ile Gly His His Lel Asn Wall Wall Asn Luell Luell Gly 885 890 895

Ala Thir Lys Glin Gly Gly Pro Lel Met Wall Ile Wall Glu Tyr Cys 9 OO 905 91 O

Gly Asn Lell Ser Asn Tyr Lel Ser Arg Asp Lieu. Phe 915 92 O 925

Phe Luell Asn Asp Ala Ala Luell His Met Glu Pro Lys Glu Lys 93 O 935 94 O

Met Glu Pro Gly Lell Glu Glin Gly Pro Arg Lell Asp Ser Wall 945 950 955 96.O

Thir Ser Ser Glu Ser Phe Ala Ser Ser Gly Phe Glin Glu Asp Llys Ser 965 97O 97.

Lell Ser Asp Wall Glu Glu Glu Glu Asp Ser Asp Gly Phe Tyr Lys Glu 98O 985 99 O

Pro le Thir Met Glu Asp Lell Ile Ser Tyr Ser Phe Glin Val Ala Arg 995 1OOO 1005

Gly Glu Phe Luell Ser Ser Air g Llys Cys Ile His Arg Asp Lell 5

Ala Arg Asn Ile Lieu. Lieu. Se r Glu ASn Asn Wall Val Lys Ile 103 O 1035

Phe Gly Lieu Ala Arg Asp Ile Asn Pro Asp 104 5 1 OSO

Wall Gly Asp Thr Arg Lieu. Pro Luell Trp Met Ala Pro 106 O 1065

Glu Ser Ile Phe Asp Llys Ile Tyr Ser Thir Ser Asp Wall Trp Of O 1. Of 5 108 O US 9,345,770 B2 141 142 - Continued

Ser yr Gly Val Lieu. Lieu. Trp Glu Ile Phe Ser Lell Gly Gly Ser O85 O O95

Pro yr Pro Gly Val Gln Met Asp Glu Asp Phe Cys Ser Arg Lell OO O 5 10

Arg Gly Met Arg Met Arg Ala Pro Glu Tyr Ser Thir Pro Glu 25

Ile Glin Ile Met Trp His Arg Pro Llys Glu

Arg Arg Phe Ala Glu Lieu. Wall Glu Asp Lieu. Lell

Glin Asn Val Glin Glin Asp Gly Asp Tyr Pro Ile Asn

Ala Lell Thr Gly Asn Ser Gly Phe Thr Tyr Thir Pro Ala

Phe Glu Asp Phe Phe Lys Glu Ser Ile Ser Pro Llys Phe

Asn Ser Gly Ser Ser Asp Asp Wall Arg Tyr Val Asn Ala Phe 2O5 215

Phe Met Ser Lieu. Glu Arg Ile Thir Phe Glu Glu Luell Luell Pro 22O 23 O

Asn Ala Thir Ser Met Phe Asp Gln Gly Asp Ser Ser Thir 235 24 O 245

Lell Luell Ala Ser Pro Met Lieu Lys Arg Phe Thir rp Thir Asp Ser 250 25 5 26 O

Pro Ala Ser Lieu Lys Ile Asp Lieu. Arg Wall Thir Ser 265 27 O 27s

Ser Glu Ser Gly Lieu. Ser Asp Wall Ser Arg Pro Ser Phe 28O 28 5 29 O

His Ser Ser Cys Gly His Val Ser Glu Gly Lys Arg Phe Thir 295 O

His Ala Glu Lieu. Glu Arg Ile Ala Cys Ser Pro 310 31 5

Pro Pro Asp Tyr Asn Ser Val Wall Luell Tyr Ser Pro Pro Ile 3.25 33 O 335

<210s, SEQ ID NO 32 &211s LENGTH: 1356 212. TYPE : PRT &213s ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 32

Met Glin Ser Llys Val Lieu. Luell Ala Wa l Al a Lieu. Trp Lieu Glu 1. 5 1O 15

Thir Arg Ala Ala Ser Val Gly Leul Pr d Se r Wal Ser Lieu. Asp Lieu Pro 2O 25

Arg Luell Ser Ile Glin Ile Le u. Thir Ile Lys Ala Asn. Thir Thir 35 4 O 45

Lell Glin Ile Thr Cys Arg Gly Gln Air g As p Lieu. Asp Trp Lieu. Trp Pro SO 55 6 O

Asn Asn Glin Ser Gly Ser Glu Gln Air g Wa Il Glu Wall. Thir Glu Cys Ser 65 70 8O

Asp Gly Luell Phe Cys Lys Thr Lieu. Thir Il e Pro Llys Val Ile Gly Asn 85 90 95

Asp Thir Gly Ala Tyr Phe Tyr Air g Glu Thir Asp Lieu Ala Ser US 9,345,770 B2 143 144 - Continued

105 11 O

Wall Ile Tyr Wall Tyr Wall Glin Asp Arg Ser Pro Phe Ile Ala Ser 115 12 O 125

Wall Ser Asp Glin His Gly Wall Wall Ile Thir Glu Asn Lys Asn 13 O 135 14 O

Thir Wall Wall Ile Pro Cys Lell Gly Ser Ile Ser Asn Lell Asn Wall Ser 145 150 155 160

Lell Ala Arg Tyr Pro Glu Arg Phe Wall Pro Asp Gly Asn Arg 1.65 17O 17s

Ile Ser Trp Asp Ser Gly Phe Thir Ile Pro Ser Tyr Met Ile 18O 185 19 O

Ser Ala Gly Met Wall Phe Cys Glu Ala Ile Asn Asp Glu Ser 195

Glin Ser Ile Met Ile Wall Wall Wall Wall Gly Tyr Arg Ile Tyr 21 O 215 22O

Asp Wall Wall Luell Ser Pro Ser His Gly Ile Glu Lell Ser Wall Gly Glu 225 23 O 235 24 O

Luell Wall Luell Asn Thir Ala Arg Thir Glu Lell Asn Wall Gly Ile 245 250 255

Asp Phe Asn Trp Glu Pro Ser Ser His Glin His Lys Luell 26 O 265 27 O

Wall Asn Arg Asp Lell Thir Glin Ser Gly Ser Glu Met Phe 285

Lell Ser Thir Luell Thir Ile Asp Gly Wall Thir Arg Ser Asp Glin Gly Luell 29 O 295 3 OO

Tyr Thir Ala Ala Ser Ser Gly Luell Met Thir Asn Ser Thir 3. OS 310 315

Phe Wall Arg Wall His Glu Pro Phe Wall Ala Phe Gly Ser Gly Met 3.25 330 335

Glu Ser Luell Wall Glu Ala Thir Wall Gly Glu Arg Wall Arg Ile Pro Ala 34 O 345 35. O

Luell Gly Tyr Pro Pro Pro Glu Ile Trp Tyr Asn Gly 355 360 365

Ile Pro Luell Glu Ser Asn His Thir Ile Ala Gly His Wall Luell Thir 37 O 375

Ile Met Glu Wall Ser Glu Arg Asp Thir Gly ASn Thir Wall Ile Luell 385 390 395 4 OO

Thir Asn Pro Ile Ser Glu Glin Ser His Wall Wall Ser Luell Wall 4 OS 41O 415

Wall Wall Pro Pro Glin Ile Gly Glu Ser Lell Ile Ser Pro Wall 425 43 O

Asp Ser Tyr Glin Tyr Gly Thir Thir Glin Thir Luell Thir Cys Thir Wall Tyr 435 44 O 445

Ala Ile Pro Pro Pro His His Ile His Trp Trp Glin Luell Glu Glu 450 45.5 460

Glu Ala Asn Glu Pro Ser Glin Ala Wall Ser Wall Thir Asn Pro Tyr 465 470 48O

Pro Glu Glu Trp Arg Ser Wall Glu Asp Phe Glin Gly Gly Asn 485 490 495

Ile Glu Wall Asn Asn Glin Phe Ala Luell Ile Glu Gly Lys Asn SOO 505

Thir Wall Ser Thir Lell Wall Ile Glin Ala Ala ASn Wall Ser Ala Luell Tyr 515 52O 525