DOCSLIB.ORG

Enterohemolysin Operon of Shiga Toxin-Producing Escherichia Coli

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Enterohemolysin Operon of Shiga Toxin-Producing Escherichia Coli FEBS 26317 FEBS Letters 524 (2002) 219^224 View metadata, citation and similar papers at core.ac.uk brought to you by CORE Enterohemolysin operon of Shiga toxin-producing Escherichiaprovided by coliElsevier :- Publisher Connector a virulence function of in£ammatory cytokine production from human monocytes Ikue Taneike, Hui-Min Zhang, Noriko Wakisaka-Saito, Tatsuo Yamamotoà Division of Bacteriology, Department of Infectious Disease Control and International Medicine, Niigata University Graduate School of Medical and Dental Sciences, 757 Ichibanchou, Asahimachidori, Niigata, Japan Received 5 April 2002; revised 14 June 2002; accepted 19 June 2002 First published online 8 July 2002 Edited by Veli-Pekka Lehto Stx [6]. In the case of the outbreak strains in Japan in 1996, Abstract Shiga toxin-producing Escherichia coli (STEC) is associated with hemolytic uremic syndrome (HUS). Although more than 98% of STEC were positive for enterohemolysin most clinical isolates ofSTEC produce hemolysin (called en- [8]. terohemolysin), the precise role ofenterohemolysin in the patho- Enterohemolysin and K-hemolysin (which is produced from genesis ofSTEC infectionsis unknown. Here we demonstrated approximately 50% of E. coli isolates from extraintestinal in- that E. coli carrying the cloned enterohemolysin operon (hlyC, fections [9], or from porcine STEC strains [6]) are members of A, B, D genes) from an STEC human strain induced the pro- the RTX family, associated with the ATP-dependent HlyB/ duction ofinterleukin-1 L (IL-1L) through its mRNA expression HlyD/TolC secretion system through which hemolysin K but not tumor necrosis factor- from human monocytes. No (HlyA) is secreted across the bacterial membranes. Both the L IL-1 release was observed with an enterohemolysin (HlyA)- enterohemolysin and K-hemolysin operons consist of the hlyC, negative, isogenic E. coli strain carrying a mutation in the hlyA, hlyB, and hlyD genes [10^12]. hlyA gene. The data suggest that enterohemolysin, a pore-form- K ing toxin, induces the production ofIL-1 L, which is one of Enterohemolysin and -hemolysin are, however, genetically serum risk markers for HUS. ß 2002 Federation of European and immunologically distinct hemolysins. Enterohemolysin is Biochemical Societies. Published by Elsevier Science B.V. All a cell-associated hemolysin, in contrast to K-hemolysin which rights reserved. is released from bacterial cells [7]. In the case of enterohemo- lysin, hemolysis is observed on blood agar containing washed Key words: Enterohemolysin operon; Hemolysis; but not unwashed sheep erythrocytes, in sharp contrast to Interleukin-1L; Human monocyte; mRNA expression; K-hemolysin, which is detected even on blood agar containing Shiga toxin-producing Escherichia coli unwashed sheep erythrocytes [6]. In HUS, it has been shown that serum levels of proin£am- matory cytokines such as interleukin-1L (IL-1L) and tumor 1. Introduction necrosis factor-K (TNF-K) are elevated [13^15]. Both IL-1L and TNF-K regulate the expression of the Stx receptor (a Shiga toxin (Stx)-producing Escherichia coli (STEC; alter- glycolipid globotriosylceramide, Gb3) on the endothelial cell natively called enterohemorrhagic E. coli, EHEC) belonging membrane [16,17]. Bacterial lipopolysaccharide (LPS) and Stx to serotype O157:H7 was identi¢ed as an emerging bacterial stimulate the production of IL-1L and TNF-K from human pathogen of food-borne infections in the United States in monocytes [17,18]. However, whether enterohemolysin in- 1982 [1]. In Japan, during 1996, explosive outbreaks occurred duces the production of proin£ammatory cytokines has not with more than 17 877 people infected including 12 fatalities yet been investigated. [2]. STEC includes not only serotype O157:H7 (the most prev- In the present study, we investigated if E. coli carrying the alent serotype), but other serotypes (e.g.) O26, O111, O128, cloned enterohemolysin genes elicited proin£ammatory cyto- and O145 have also been implicated in human infections [3,4]. kines from human monocytes. For this, we constructed an Infection is initially associated with abdominal symptoms enterohemolysin-negative (hlyA) derivative from the cloned such as abdominal pain, water diarrhea, and hemorrhagic co- enterohemolysin genes, and evidence was provided that en- litis and also with serious systemic disorders, such as hemo- terohemolysin produces IL-1L, but not TNF-K, from human lytic uremic syndrome (HUS), especially in young children monocytes. [3^5]. STEC, in many cases, also encodes hemolysin (called enterohemolysin [6], or EHEC-hemolysin [7]) in addition to 2. Materials and methods 2.1. Bacterial strains and plasmid *Corresponding author. Fax: (81)-25-227 0762. STEC human strain F60 (serotype O128:H12) was isolated on oc- E-mail address: [email protected] (T. Yamamoto). casions of outbreaks of STEC infections in Japan in 1996. It produces both Stx1 and Stx2, and manifests enterohemolysin activities in a Abbreviations: STEC, Shiga toxin-producing Escherichia coli; Hly, great quantity, compared with other STEC human strains isolated hemolysin; IL-1L, interleukin-1L; TNF-K, tumor necrosis factor-K; from Japan [8]. E. coli HB101 is a hybrid between E. coli K-12 and HUS, hemolytic uremic syndrome; RT-PCR, reverse transcription- E. coli B, lacks restriction ability, and was used as a host of recombi- polymerase chain reaction; Stx, Shiga toxin nant plasmids. 0014-5793 / 02 / $22.00 ß 2002 Federation of European Biochemical Societies. Published by Elsevier Science B.V. All rights reserved. PII: S0014-5793(02)03027-2 FEBS 26317 19-7-02 Cyaan Magenta Geel Zwart 220 I. Taneike et al./FEBS Letters 524 (2002) 219^224 The recombinant plasmid pACH1 (24.5 kbp in size) carried the 2.6. Cytokine mRNA assay entire enterohemolysin operon (hlyC, hlyA, hlyB, hlyD genes) which To detect mRNA, after incubation, total cellular RNA of the originated in the enterohemolysin-positive plasmid pO128-60 (120 kbp monocytes was extracted using acid guanidinium thiocyanate/phe- in size) of STEC strain F60 [8]. The GenBank accession number for nol/chloroform. The amount of RNA was assessed with a RiboGreen the gene sequence of this enterohemolysin operon is AB032930. The RNA quantitation kit (Molecular Probes, Inc., The Netherlands). determined sequence covers the 7 869-nucleotide sequence of the en- A reverse transcription-polymerase chain reaction (RT-PCR) was terohemolysin operon region, including the entire enterohemolysin performed as described previously [21]. Primers for IL-1L (5P-AAA- genes (hlyC, hlyA, hlyB, hlyD) (7 127 bp; Fig. 1), the 477-nucleo- CAGATGAAGTGCTCCTTCCAGG and 5P-TGGAGAACACCA- tide-upstream region from the hlyC gene, and the 265-nucleotide- CTTGTTGCTCCA, generating a 391-bp product), TNF-K (5P- downstream region to the hlyD gene. GGACGTGGAGCTGGCCGAGGAG and 5P-CACCAGCTGGT- TATCTCTCAGCTC, generating a 352-bp product), and glyceralde- 2.2. Construction of a mutant hlyA gene hyde-3-phosphate dehydrogenase (GAPDH) (5P-GGGAGCCAAA- For mutagenesis of the hlyA gene, the pACH1 plasmid DNA carry- AGGGTCATCATCTC and 5P-CCATGCCAGTGAGCTTCCCG- ing the entire enterohemolysin operon was cut with SplI, whose site TTC, generating a 353-bp product) were kindly provided by Dr. was located 81 bp downstream to the initiation codon ATG within Yasuhiro Natori (International Medical Center of Japan, Tokyo, Ja- hlyA. The generated single stranded ends were polymerized and the pan) [22,23]. Negative controls were performed by omitting RNA two resultant double-stranded ends of the linear pACH1 DNA were from cDNA synthesis and speci¢c PCR ampli¢cation. Cycling con- ligated using a DNA blunting kit (Takara Shuzo Co., Shiga, Japan). ditions were denaturation for 45 s at 94‡C, annealing for 45 s at 55‡C, The plasmid (pACHT1) thus obtained was subjected to sequence and polymerization for 45 s at 72‡C (35 cycles). Ampli¢ed PCR prod- analysis for the whole mutant enterohemolysin operon region, as de- ucts were analyzed by gel electrophoresis with 2% agarose and stained scribed above. pACHT1 was used in experiments on hemolysis and with ethidium bromide. PX174 RF DNA/HaeIII fragments (Life cytokine production. Technologies, Gaithersburg, MD, USA) were used as molecular size standards. 2.3. Media and bacterial growth 2.7. Data analysis For bacterial growth, tryptic soy agar (Difco Laboratories, Detroit, MI, USA) was used as solid media. We used antibiotics (20 Wgof Data were presented as mean þ S.D. of triplicate experiments, and U chloramphenicol per ml) to maintain the recombinant plasmids during evaluated by Mann^Whitney’s -test. cultivation. Luria^Bertani (LB) broth (Difco) was used as liquid media which was inoculated and incubated at 37‡C for 12^18 h with agitation. In 3. Results some experiments, RPMI 1640 medium (ICN Biomedicals, Aurora, OH, USA) supplemented with 10% fetal bovine serum (Gibco BRL, Grand Island, NY, USA) was also employed. When bacteria were 3.1. Construction of pACHT1 carrying the mutant hlyA gene þ grown in the liquid media, antibiotics were not added. In the case The enterohemolysin recombinant plasmid pACH1 car- of E. coli HB101 carrying pACH1 or pACHT1, after incubation, a ried the unique SplI site within the hlyA gene (Fig. 1). portion of the liquid culture was streaked on tryptic soy agar and the pACH1 DNA was cut with SplI and ¢lled in with DNA poly- colonies developed were examined for the presence of the recombinant merase, and the plasmid pACHT1 carrying the mutant hlyA plasmid (chloramphenicol-resistant) with the replica plating method. All of the colonies examined were resistant to chloramphenicol gene was constructed. The mutant hlyA gene carried the (20 Wg/ml). CGTACGTACG sequence (4-base GTAC insertion) instead of the CGTACG sequence (SplI site), resulting in a frame 2.4. Hemolysis assay shift from the 31st codon and a new stop codon at the posi- For hemolysis assay on agar plates, bacteria were streaked on tryp- tion of the 42nd codon (Fig. 1). The deduced amino acid tic soy agar supplemented with 5% fresh, washed, de¢brinated sheep sequence of the mutant hlyA gene is only 41 amino acids erythrocytes and 10 mM CaCl2 [6].
Load more

Recommended publications
  • STEC) Detection in Food Shiga Toxin-Producing Escherichia Coli (STEC) Are Synonymous with Verocytotoxigenic Escherichia Coli (VTEC)
    Report of the Scientific Committee of the Food Safety Authority of Ireland 2019 Advice on Shiga toxin-producing Escherichia coli (STEC) detection in food Shiga toxin-producing Escherichia coli (STEC) are synonymous with verocytotoxigenic Escherichia coli (VTEC). Similarly, stx genes are synonymous with vtx genes. The terms STEC and stx have been used throughout this report. Report of the Scientific Committee of the Food Safety Authority of Ireland Advice on Shiga toxin-producing Escherichia coli (STEC) detection in food Published by: Food Safety Authority of Ireland The Exchange, George’s Dock, IFSC Dublin 1, D01 P2V6 Tel: +353 1 817 1300 Email: [email protected] www.fsai.ie © FSAI 2019 Applications for reproduction should be made to the FSAI Information Unit ISBN 978-1-910348-22-2 Report of the Scientific Committee of the Food Safety Authority of Ireland CONTENTS ABBREVIATIONS 3 EXECUTIVE SUMMARY 5 GENERAL RECOMMENDATIONS 8 BACKGROUND 9 1. STEC AND HUMAN ILLNESS 11 1.1 Pathogenic Escherichia coli . .11 1.2 STEC: toxin production.............................................12 1.3 STEC: public health concern . 13 1.4 STEC notification trends . .14 1.5 Illness severity ....................................................16 1.6 Human disease and STEC virulence ..................................17 1.7 Source of STEC human infection . 22 1.8 Foodborne STEC outbreaks .........................................22 1.9 STEC outbreaks in Ireland . 24 2. STEC METHODS OF ANALYSIS 28 2.1 Detection method for E. coli O157 in food . .29 2.2 PCR-based detection of STEC O157 and non-O157 in food.............29 2.3 Discrepancies between PCR screening and culture-confirmed results for STEC in food ............................................32 2.4 Alternative methods for the detection and isolation of STEC .
    [Show full text]
  • Neutralizing Equine Anti-Shiga Toxin
    al of D urn ru Jo g l D a e Yanina et al., Int J Drug Dev & Res 2019, 11:3 n v o e i l t o International Journal of Drug Development a p n m r e e e e t n n n n n I I t t t a n h d c r R a e e s and Research Research Article Preclinical Studies of NEAST (Neutralizing Equine Anti-Shiga Toxin): A Potential Treatment for Prevention of Stec-Hus Hiriart Yanina1,2, Pardo Romina1, Bukata Lucas1, Lauché Constanza2, Muñoz Luciana1, Berengeno Andrea L3, Colonna Mariana1, Ortega Hugo H3, Goldbaum Fernando A1,2, Sanguineti Santiago1 and Zylberman Vanesa1,2* 1Inmunova S.A., San Martin, Buenos Aires, Argentina 2National Council for Scientific and Technical Research (CONICET) Center for Comparative Medicine, Institute of Veterinary Sciences of the Coast (ICiVetLitoral), Argentina 3National University of the Coast (UNL)/Conicet, Esperanza, Santa Fe, Argentina *Corresponding author: Zylberman Vanesa, Inmunova S.A. 25 De Mayo 1021, CP B1650HMP, San Martin, Buenos Aires, Argentina, Interno 6053, Tel: +54-11- 2033-1455; E-mail: [email protected] Received July 29, 2019; Accepted August 30, 2019; Published Sepetmber 07, 2019 Abstract STEC-HUS is a clinical syndrome characterized by the triad of thrombotic microangiopathy, thrombocytopenia and acute kidney injury. Despite the magnitude of the social and economic problems caused by STEC infections, there are currently no specific therapeutic options on the market. HUS is a toxemic disorder and the therapeutic effect of the early intervention with anti-toxin neutralizing antibodies has been supported in several animal models.
    [Show full text]
  • Safe Handling of Acutely Toxic Chemicals Safe Handling of Acutely
    Safe Handling of Acutely Toxic Chemicals , Mutagens, Teratogens and Reproductive Toxins October 12, 2011 BSBy Sco ttBthlltt Batcheller R&D Manager Milwaukee WI Hazards Classes for Chemicals Flammables • Risk of ignition in air when in contact with common energy sources Corrosives • Generally destructive to materials and tissues Energetic and Reactive Materials • Sudden release of destructive energy possible (e.g. fire, heat, pressure) Toxic Substances • Interaction with cells and organs may lead to tissue damage • EfftEffects are t tilltypically not general ltllti to all tissues, bttbut target tdted to specifi c ones • Examples: – Cancers – Organ diseases – Inflammation, skin rashes – Debilitation from long-term Poison Acute Cancer, health or accumulation with delayed (ingestion) risk reproductive risk emergence 2 Toxic Substances Are All Around Us Pollutants Natural toxins • Cigare tte smo ke • V(kidbt)Venoms (snakes, spiders, bees, etc.) • Automotive exhaust • Poison ivy Common Chemicals • Botulinum toxin • Pesticides • Ricin • Fluorescent lights (mercury) • Radon gas • Asbestos insulation • Arsenic and heavy metals • BPA ((pBisphenol A used in some in ground water plastics) 3 Application at UNL Chemicals in Chemistry Labs Toxin-producing Microorganisms • Chloro form • FiFungi • Formaldehyde • Staphylococcus species • Acetonitrile • Shiga-toxin from E. coli • Benzene Select Agent Toxins (see register) • Sodium azide • Botulinum neurotoxins • Osmium/arsenic/cadmium salts • T-2 toxin Chemicals in Biology Labs • Tetrodotoxin • Phenol
    [Show full text]
  • Shiga Toxin E. Coli Detection Differentiation Implications for Food
    SL440 Shiga Toxin-Producing Escherichia coli: Detection, Differentiation, and Implications for Food Safety1 William J. Zaragoza, Max Teplitski, and Clifton K. Fagerquist2 Introduction for the effective detection of the Shiga-toxin-producing pathogens in a variety of food matrices. Shiga toxin is a protein found within the genome of a type of virus called a bacteriophage. These bacteriophages can There are two types of Shiga toxins—Shiga toxin 1 (Stx1) integrate into the genomes of the bacterium E. coli, giving and Shiga toxin 2 (Stx2). Stx1 is composed of several rise to Shiga toxin-producing E. coli (STEC). Even though subtypes knows as Stx1a, Stx1c, and Stx1d. Stx2 has seven most E. coli are benign or even beneficial (“commensal”) subtypes: a–g. Strains carrying all of the Stx1 subtypes affect members of our gut microbial communities, strains of E. humans, though they are less potent than that of Stx2. Stx2 coli carrying Shiga-toxin encoding genes (as well as other subtypes a,c, and d are frequently associated with human virulence determinants) are highly pathogenic in humans illness, while the other subtypes affect different animals. and other animals. When mammals ingest these bacteria, Subtypes Stx2b and Stx2e affect neonatal piglets, while STECs can undergo phage-driven lysis and deliver these target hosts for Stx2f and Stx2g subtypes are not currently toxins to mammalian guts. The Shiga toxin consists of an known (Fuller et al. 2011). Stx2f was originally isolated A subunit and 5 identical B subunits. The B subunits are from feral pigeons (Schmidt et al. 2000), and Stx2g was involved in binding to gut epithelial cells.
    [Show full text]
  • National Shiga Toxin-Producing Escherichia Coli (STEC) Surveillance
    National Enteric Disease Surveillance: STEC Surveillance Overview Surveillance System Overview: National Shiga toxin-producing Escherichia coli (STEC) Surveillance Shiga toxin-producing Escherichia coli (STEC) are estimated to cause more than 265,000 illnesses each year in the United States, with more than 3,600 hospitalizations and 30 deaths (1). STEC infections often cause diarrhea, sometimes bloody. Some patients with STEC infection develop hemolytic uremic syndrome (HUS), a severe complication characterized by renal failure, hemolytic anemia, and thrombocytopenia that can be fatal. Most outbreaks of STEC infection and most cases of HUS in the United States have been caused by STEC O157. Non- O157 STEC have also caused US outbreaks. Although all STEC infections are nationally notifiable, for several reasons many cases are likely not recognized (2). Not all persons ill with STEC infection seek medical care, healthcare providers may not obtain a specimen for laboratory diagnosis, or the clinical diagnostic laboratory may not perform the necessary diagnostic tests. Accounting for under-diagnosis and under-reporting, an estimated 96,534 STEC O157 and 168,698 non-O157 infections occur each year (1). STEC transmission occurs through consumption of contaminated foods, ingestion of contaminated water, or direct contact with infected persons (e.g., in child-care settings) or animals or their environments. Colored scanning electron micrograph (SEM) of Escherichia coli bacteria. National STEC surveillance data are collected through passive surveillance of laboratory-confirmed human STEC isolates in the United States. Clinical diagnostic laboratories submit STEC O157 isolates and Shiga toxin-positive broths to state and territorial public health laboratories, where they are further characterized.
    [Show full text]
  • Combined Action of Shiga Toxin Type 2 and Subtilase Cytotoxin in the Pathogenesis of Hemolytic Uremic Syndrome
    toxins Article Combined Action of Shiga Toxin Type 2 and Subtilase Cytotoxin in the Pathogenesis of Hemolytic Uremic Syndrome Romina S. Álvarez 1, Fernando D. Gómez 1, Elsa Zotta 1,2, Adrienne W. Paton 3, James C. Paton 3, Cristina Ibarra 1 , Flavia Sacerdoti 1 and María M. Amaral 1,* 1 Laboratorio de Fisiopatogenia, Departamento de Fisiología, Instituto de Fisiología y Biofísica Bernardo Houssay (IFIBIO Houssay-CONICET), Facultad de Medicina, Universidad de Buenos Aires, Buenos Aires 1121, Argentina; [email protected] (R.S.Á.); [email protected] (F.D.G.); [email protected] (E.Z.); [email protected] (C.I.); [email protected] (F.S.) 2 Cátedra de Fisiopatología, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Buenos Aires 1113, Argentina 3 Research Centre for Infectious Diseases, Department of Molecular and Biomedical Science, University of Adelaide, Adelaide 5005, Australia; [email protected] (A.W.P.); [email protected] (J.C.P.) * Correspondence: [email protected]; Tel.: +54-11-5285-3280 Abstract: Shiga toxin-producing E. coli (STEC) produces Stx1 and/or Stx2, and Subtilase cytotoxin (SubAB). Since these toxins may be present simultaneously during STEC infections, the purpose of this work was to study the co-action of Stx2 and SubAB. Stx2 + SubAB was assayed in vitro on monocultures and cocultures of human glomerular endothelial cells (HGEC) with a human proximal tubular epithelial cell line (HK-2) and in vivo in mice after weaning. The effects in vitro of both toxins, co-incubated and individually, were similar, showing that Stx2 and SubAB contribute similarly to renal cell damage.
    [Show full text]
  • Toxins and the Gut: Role in Human Disease a Fasano
    iii9 PAPER Gut: first published as 10.1136/gut.50.suppl_3.iii9 on 1 May 2002. Downloaded from Toxins and the gut: role in human disease A Fasano ............................................................................................................................. Gut 2002;50(Suppl III):iii9–iii14 Bacterial enteric infections exact a heavy toll on the TOXINS THAT ACTIVATE ENTEROCYTE human population, particularly among children. Despite SIGNAL PATHWAYS Intestinal cells operate through three well estab- the explosion of knowledge on the pathogenesis of lished intracellular signal transduction pathways enteric diseases experienced during the past decade, to regulate water and electrolyte fluxes across the the number of diarrhoeal episodes and human deaths intestinal mucosa: cyclic adenosine monophos- phate (cAMP); cyclic guanosine monophosphate reported worldwide remains of apocalyptic dimensions. (cGMP); and calcium dependent pathways (fig However, our better understanding of the pathogenic 1). Recently, a fourth pathway involving nitric mechanisms involved in the onset of diarrhoea is finally oxide (NO) has been described. leading to preventive interventions, such as the cAMP development of enteric vaccines, that may have a An extremely heterogeneous group of microor- significant impact on the magnitude of this human ganisms, Escherichia coli encompass almost all features of possible interaction between intestinal plague. The application of a multidisciplinary approach microflora and the host, ranging from a role of to study bacterial pathogenesis, along with the recent mere harmless presence to that of highly patho- sequencing of entire microbial genomes, have made genic organisms. In fact, the E coli species is made up of many strains that profoundly differ from possible discoveries that are changing the way scientists each other in terms of biological characteristics view the bacterium–host interaction.
    [Show full text]
  • Effects of Bacterial Lipopolysaccharide and Shiga Toxin on Induced
    bioRxiv preprint doi: https://doi.org/10.1101/2021.09.07.459335; this version posted September 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Effects of bacterial lipopolysaccharide and Shiga Toxin on induced Pluripo- tent Stem Cell-derived Mesenchymal Stem Cells Daiana Martire-Greco a;d∗‡ Alejandro La Greca b∗ Luis Castillo Montanez˜ a Celeste Biani b Antonella Lombardi b Federico Birnberg-Weiss a Alessandra Norris b Flavia Sacerdoti c;d Mar´ıa Marta Amaral c;d Nahuel Rodrigues-Rodriguez a Jose Ramon´ Pittaluga a Veronica´ Alejandra Furmento b Veronica´ Ines´ Landoni a;d Santiago Gabriel Miriuka b;d Carlos Luzzani b;d Gabriela Cristina Fernandez´ a;d aLaboratorio de Fisiolog´ıa de los Procesos Inflamatorios. Instituto de Medicina Experimental (IMEX-CONICET). Academia Nacional de Medicina, Buenos Aires, Argentina. bLaboratorio de Investigacion´ Aplicada a Neurociencias (LIAN), FLENI-CONICET, Buenos Aires, Argentina. cLaboratorio de Fisiopatogenia, Instituto de Fisiolog´ıa y Biof´ısica Bernardo Houssay (IFIBIO Houssay-CONICET), Departamento de Fisiolog´ıa, Facultad de Medicina, Buenos Aires (Ar- gentina). dConsejo Nacional de Investigaciones Cient´ıficas y Tecnicas´ (CONICET), Buenos Aires, Ar- gentina. ∗ These authors contributed equally to this work z Corresponding author: [email protected] Lead Contact Daiana Martire-Greco Running title iPSC-MSC response to LPS and Stx. Competing interest The authors declare no competing interest. 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.09.07.459335; this version posted September 7, 2021.
    [Show full text]
  • Concurrent Sessions Abstracts
    20th World Congress of the International Society on Toxinology "Toxinology in the 21st century: Public health impact from basic, translational and clinical sciences" CONCURRENT SESSION ABSTRACTS 08 – 13 September, 2019 Buenos Aires, Argentina INDEX Page Concurrent Session I 1A. Public Health and Toxinology 2 1B. New Developments in Basic Toxinology I. 7 Concurrent Session II 2A. New Developments in Antivenoms 14 2B. New Developments in Basic Toxinology II. 20 Concurrent Session III 3A. Emerging Technologies in Toxinology 28 3B. Organ Systems and Toxins I 35 Concurrent Session IV 4A. Non-antibody and Adjuvant – Based Therapeutics 41 4B. Organ Systems and Toxins II 47 Concurrent Session V 5A. North American Society on Toxinology 55 Concurrent Session VI 6A. North American Society on Toxinology 60 Concurrent Session VII 7A. Clinical I 66 Concurrent Session VIII 8A. New Biology and Evolution of Venomous Organisms I 77 8B. Clinical II. Emerging Clinical Topics: Safety and Effectiveness of Current Antivenoms; Clinical Presentations of Intoxication and Management; 83 Epidemiology. Concurrent Session IX 9A. New Biology and Evolution of Venomous Organisms II 89 9B. SBTX: Innovation in Clinical and Basic Research in Toxinology 96 1 Concurrent Session I 1A. Public Health and Toxinology. Chairs: José M. Gutiérrez/Fan Hui Wen 1. Abdulrazaq Habib (Bayero University, Nigeria): Burden of Snakebite and Antivenom Supply Challenges in Africa. [email protected] 2. Mohammad Afzal Mahmood: A framework for shifting the paradigm and developing coalitions to address neglected public health problems: Lessons from the Myanmar Snakebite Project. [email protected] 3. Fan Hui Wen: (Instituto Butantan, Brazil): Public health policies to better manage the burden of scorpion sting envenoming.
    [Show full text]
  • The Evolving Field of Biodefence: Therapeutic Developments and Diagnostics
    REVIEWS THE EVOLVING FIELD OF BIODEFENCE: THERAPEUTIC DEVELOPMENTS AND DIAGNOSTICS James C. Burnett*, Erik A. Henchal‡,Alan L. Schmaljohn‡ and Sina Bavari‡ Abstract | The threat of bioterrorism and the potential use of biological weapons against both military and civilian populations has become a major concern for governments around the world. For example, in 2001 anthrax-tainted letters resulted in several deaths, caused widespread public panic and exerted a heavy economic toll. If such a small-scale act of bioterrorism could have such a huge impact, then the effects of a large-scale attack would be catastrophic. This review covers recent progress in developing therapeutic countermeasures against, and diagnostics for, such agents. BACILLUS ANTHRACIS Microorganisms and toxins with the greatest potential small-molecule inhibitors, and a brief review of anti- The causative agent of anthrax for use as biological weapons have been categorized body development and design against biotoxins is and a Gram-positive, spore- using the scale A–C by the Centers for Disease Control mentioned in TABLE 1. forming bacillus. This aerobic and Prevention (CDC). This review covers the discovery organism is non-motile, catalase and challenges in the development of therapeutic coun- Anthrax toxin. The toxin secreted by BACILLUS ANTHRACIS, positive and forms large, grey–white to white, non- termeasures against select microorganisms and toxins ANTHRAX TOXIN (ATX), possesses the ability to impair haemolytic colonies on sheep from these categories. We also cover existing antibiotic innate and adaptive immune responses1–3,which in blood agar plates. treatments, and early detection and diagnostic strategies turn potentiates the bacterial infection.
    [Show full text]
  • Military Potential of Biological Toxins
    journal of applied biomedicine 12 (2014) 63–77 Available online at www.sciencedirect.com ScienceDirect journal homepage: http://www.elsevier.com/locate/jab Review Article Military potential of biological toxins Xiujuan Zhang a, Kamil Kuča b,c,**, Vlastimil Dohnal c, Lucie Dohnalová d, Qinghua Wu e, Chu Wu a,* a College of Horticulture and Garden, Yangtze University, Jingzhou, Hubei 434023, People's Republic of China b Biomedical Research Center, University Hospital Hradec Kralove, Czech Republic c Department of Chemistry, Faculty of Science, University of Hradec Kralove, Hradec Kralove, Rokitanskeho 62, 500 03, Czech Republic d Department of Hygiene, Faculty of Military Health, University of Defence, Hradec Kralove, Czech Republic e National Reference Laboratory of Veterinary Drug Residues (HZAU), Huazhong Agricultural University, Wuhan, Hubei 430070, People's Republic of China article info abstract Article history: Toxins are produced by bacteria, plants and animals for defense or for predation. Most of the Received 27 November 2013 toxins specifically affect the mammalian nervous system by interfering with the transmission Received in revised form of nerve impulses, and such toxins have the potential for misuse by the military or terrorist 17 February 2014 organizations. This review discusses the origin, structure, toxicity and symptoms, transmis- Accepted 19 February 2014 sion, mechanism(s) of action, symptomatic treatment of the most important toxins and Available online 1 March 2014 venoms derived from fungi, plants, marine animals, and microorganisms, along with their potential for use in bioweapons and/or biocrime. Fungal trichothecenes and aflatoxins are Keywords: potent inhibitors of protein synthesis in most eukaryotes and have been used as biological Military toxins warfare agents.
    [Show full text]
  • Alphabetical Listing of Export Restricted Biological Items
    Alphabetical Listing of Export Restricted Biological Items There are two sets of regulations for export restricted biological items, the International Traffic in Arms Regulations (ITAR) from Dept. of State and the Export Administration Regulations from Dept. of Commerce. These items require export licenses to all countries. Licensing takes about 6 weeks. Fines are $250,000 to $1,094,010 per violation. See the Export Control website within the Office of Research at: https://research.uci.edu/ref/export-controls/index.html These listed items are controlled for export regardless of quantity or attenuation, genetic elements or genetically modified organisms for such agents or “toxins”, including small quantities or attenuated strains of select biological agents or “toxins” that are excluded from the lists of select biological agents or “toxins” by APHIS, CDC, or DHHS. Under the ITAR, Biological agents and biologically derived substances specifically developed, configured, adapted, or modified for the purpose of increasing their capability to produce casualties in humans or livestock, degrade equipment or damage crops are controlled under CATEGORY XIV—TOXICOLOGICAL AGENTS, INCLUDING CHEMICAL AGENTS, BIOLOGICAL AGENTS, AND ASSOCIATED EQUIPMENT. Please note that there are proposed regulations on this category that if they become final will impact the listing of biologicals. See Part 121 United States Munitions List Category XIV. Certain precursor chemicals, Biosafety gear, and lab equipment are also export restricted see Categories 1 & 2 of the
    [Show full text]