Molecular mechanisms of GABA^ receptor anchoring and trafficking.
Josef Thomas Jacques Kittler
A thesis submitted to the University of London for the degree
of Doctor of Philosophy
October 2000
MRC Laboratory for Molecular Cell Biology and
Department of Pharmacology,
UniversityCollegeLondon ProQuest Number: U643207
All rights reserved
INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.
In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest.
ProQuest U643207
Published by ProQuest LLC(2016). Copyright of the Dissertation is held by the Author.
All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code. Microform Edition © ProQuest LLC.
ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346
ABSTRACT
y-Aminobutyric acid type A (GABA^) receptors are members of the ligand
gated ion channel superfamily and are the major sites of fast synaptic inhibition in
the brain. GABA^ receptors are clustered at inhibitory synapses, however, precisely
how these receptors are inserted into postsynaptic membranes and stabilised at
synapses remains unknown. The focus of this thesis is to further understand the
mechanisms important for the targeting and cell surface stability of ionotropic
GABA^ receptors.
To examine the membrane trafficking of these receptors a fusion protein of
the y2L subunit with green fluorescent protein (GFP) was produced. This fusion
protein was functional and allowed the visualisation of receptor membrane targeting
and endocytosis in live cells. Interestingly, the targeting of this construct to
GABAergic synapses in cultured hippocampal neurones was dependent upon
coassembly with receptor a and p subunits. This suggests that the assembly and
membrane targeting of GABA^ receptors containing the y2 subunit follow similar
itineraries in heterologous systems and neurones.
GABAa receptor P and y subunits were also found to associate with the
adaptin complex AP2, a protein implicated in the recruitment of transmembrane proteins into clathrin coated pits. Furthermore, in cultured hippocampal neurones
blocking dynamin-dependant endocytosis caused a gradual increase in the amplitude
of mIPSCs that reached a plateau at 1.7 to 2.3-fold of it’s control value within 40-50
min. These results suggest there must be a relatively fast turnover of GABA^
receptors between the cell surface and intracellular compartments. To further study the role of the GABA^ receptor binding partner,
GABARAP, we compared the subcellular distribution of this protein with that of gephyrin, a protein important for GABA^ receptor synaptic clustering. In cultured hippocampal neurones GABARAP associated weakly with synaptic GABA^ receptor and gephyrin clusters. However, GABARAP was found at high levels on intracellular membrane compartments including the Golgi and subsynaptic cisternae. Furthermore, GABARAP was found to associate with N-ethylmaleimide sensitive factor (NSF), a protein essential for intracellular membrane transport events and important for receptor trafficking. This suggests that GABARAP may act to facilitate the trafficking of GABA^ receptors via it’s ability to interact with NSF.
The results presented in this thesis suggest that GABA ^ receptors cycle into and out of the plasma membrane in a process that may be regulated by their association with adaptin complexes and recruitment of NSF via GABARAP. This may allow neurones to specifically modify cell surface receptor levels which may have a critical role in controlling the efficacy of inhibitory synaptic transmission. ACKNOWLEDGEMENTS
I would like to thank Moss for his supervision during my time as a graduate student. He has provided a wonderful environment to work in and balanced supervision that have fostered my enthusiasm for Neuroscience. I am also very grateful to Andres for constructive criticism and advice and for the many interesting discussions. I would also like to thank the present and ex members of the Moss lab particularly Nick, Helene, Jon,
Fiona, and Jasmina for essential help and advice during my time in the Moss lab. I am grateful to Patrick Delmas and Trevor Smart who carried out the electrophysiological studies, Philippe Rostaing and Antoine Triller who carried out the electronmicroscopy and
Bill Wisden who produced the transgenic mouse lines. Mark Marsh and Colin Hopkins provided helpful discussions with respect to receptor endocytosis. Thanks also to Jianfeng
Wang, Harvey McMahon, Giampietro Schaivo, Jean-Marc Fritschy, Daniel Cutler,
Richard Huganir, Stefano Vicini, Richard Olsen, James Rothman and Werner Sieghart who have generously contributed reagents used in the research described in this thesis.
I am also grateful to my family, for their invaluable support.
This thesis is dedicated to Ann for her constant support and friendship that have been so important over the last four years. CONTENTS
page
Title 1
Abstract 3
Acknowledgements 5
Contents 6
List of Figures and Tables 11
List of Abbreviations 13
Chapter 1.
Introduction 16
1.1 GABA is the major inhibitory neurotransmitter in the brain 16
1.2 Three distinct classes of GABA response 16
1.3 Pharmacology of the GABA^ receptor 17
1.4 Molecular biology of GAB A^ receptors 18
1.5 Subunit diversity 19
1.6 GABA^ receptor subunit expression and distribution 22
1.7 Subunit composition of receptors 23
1.8 GABA a receptor cell surface targeting 24
1.9 GABA^ receptor assembly 26
1.10 Selective subcellular targeting of GABA^ receptors 27
1.11 Formation of postsynaptic specialisations 30
1.12 Clustering of muscle nicotinic acetylcholine receptors at the
neuromuscular junction 31 1.13 Clustering and anchoring of ion channels at central synapses 33
1.14 Excitatory synapses 34
1.15 Anchoring of the NMDA receptor complex at the postsynaptic density 35
1.16 Clustering and trafficking of AMP A receptors 37
1.17 Inhibitory synapses 39
1.18 The glycine receptor 39
1.19 Clustering of GABA^ receptor 41
1.20 Synapse formation and ionotropic receptor clustering:
genera] principles, different mechanisms 44
1.21 Receptor trafficking, protein-protein interactions and synaptic plasticity 45
1.22 Aims of this thesis 46
Chapter 2.
Materials and Methods
2.1.1 Molecular Biology 47
2.1.1 DNA constructs 47
2.1.2 Bacterial strains 47
2.1.3 Growth media and agar plates 48
2.1.4 Preparation of electrocompetent bacterial cells. 48
2.1.5 Transformation of bacteria with plasmid DNA 48
2.1.6 Ethanol precipitation of DNA 49
2.1.7 Phenol/chloroform extraction 49
2.1.8 Agarose gel electrophoresis of DNA 49
2.1.9 Preparation of restriction digested vector DNA, plasmid
inserts and PCR products 50
2.1.10 Purification of restriction digested vector DNA,
7 plasmid inserts and PCR products 50
2.1.11 Polymerase Chain Reaction (PCR) 50
2.1.12 List of oligonucleotides used for PCR, mutagenesis and sequencing 51
2.1.13 Ligations. 51
2.1.14 Mini-preparation of plasmid DNA (mini-preps) 52
2.1.15 DNA sequencing 53
2.1.16 Maxi-preparation of plasmid DNA by caesium chloride banding 53
2.2.0 Cell Biology 54
2.2.1 Antibodies 54
2.2.2 Cell line culture 55
2.2.3 Transient transfection of A293 & COS cells 55
2.2.4 Culture and microinjection of low density hippocampal cultures 55
2.2.5 Immunofluorescence microscopy 56
2.2.6 Live cell confocal microscopy 56
2.3.0 Biochemistry 57
2.3.1 Sodium Dodecyl Sulphate Polyacrylamide Gel Electrophoresis 57
2.3.2 Transfer of PAGE gels 59
2.3.3 Western blotting 59
2.3.4 GST-Fusion protein production 60
2.3.5 Affinity-purification ("pull-down") assays 60
2.3.6 Immunoprécipitation from brain extract 61
2.3.7 Immunoprécipitation from transfected cells. 61
2.3.8 lodinated antibody binding 62
2.4.0 Commonly Used Buffers 62 Chapter 3.
3.1 Introduction 65
3.2 Expression of t2-GFP inserted at either the amino or carboxyl terminus 69
3.3 Expression of alp2y2 GFPN and a ip 272-GFPC receptors in
live A293 cells 72
3.4 GABA^ receptors containing 'y2L -GFP form functional ligand
gated ion channels 75
3.5 Surface expression of y2-GFPN is dependent on
co-expression with al and p2 subunits 80
3.6 GABA^receptors containing y2-GFPN constitutively endocytose
and are removed from the surface upon PKC activation 81
3.7 Cell surface expression and synaptic targeting of y2L-GFPN in
hippocampal neurones is dependent on exogenous a and p subunits. 86
3.8 Production of a Y2L-GFPN transgenic mouse 87
3.9 Discussion 91
Chapter 4.
4.1 Introduction 95
4.2 GABA^ receptor internalisation in A293 cells is mediated
by clathrin-coated pits 97
4.3 GABA^ receptor internalisation in cultured hippocampal
neurones is mediated by clathrin-coated pits. 99
4.4 The clathrin adaptor protein AP-2 specifically interacts with GAB A^
receptor p and y subunit intracellular domains 101
4.5 GABA a receptors co-fractionate with the clathrin adaptor protein AP-2 in purified clathrin-coated vesicles. 103
4.6 GABA^ receptors in cultured hippocampal neurones co-localise with
AP-2 in clathrin coated pits. 105
4.7 Blocking dynamin-dependent endocytosis results in an increase
in the amplitude of mIPSCs 109
4.8 Discussion 113
Chapter 5.
5.1 Introduction 116
5.2 Distribution of GABARAP in cultured hippocampal neurones 118
5.3 Localisation of GABARAP and gephyrin to GABA^^ receptor
clusters and synaptic sites 118
5.4 Ultrastructural localisation of GABARAP 120
5.5 Association of GABARAP with A-ethylmaleimide sensitive factor 127
5.6 GABARAP and NSF co-localise in cultured hippocampal neurones 129
5.7 Discussion 131
Chapter 6. Final Discussion
6.1 Summary I 35
6.2 GABAa receptor clustering and targeting 136
6.3 GABA^ receptor trafficking as a putative mechanism for synaptic plasticity 137 6.4 Future Directions I39
References 142
10 LIST OF TABLES AND FIGURES
Figure page
1: GABA^ receptor structure. 20
2: Expression of y2L-GFP fusion proteins in mammalian cells. 71
3:Visualisation of 72L-GFP fusion proteins co-expressed with al and (32 in live mammalian cells. 73
4: Cell surface localisation of g2L-GFP fusion proteins co-expressed in a l and (32 in mammalian cells. 74
5: Equilibrium GABA-concentration response curves obtained from
A293 cells expressing GFP/yZL subunit fusion proteins. 76
6: Analysis of GABA-evoked currents from A293 cells expressing al(3272L-GFPC receptors. 78
7: Analysis of GABA-evoked currents from A293 cells expressing alp2y2L-GFPN receptors. 79
8: Subunit dependency of y2L-GFPN cell surface targeting in mammalian cells. 82
9: Internalisation of GABA^ receptors containing y2L-GFPN. 84
10: PKC mediated downmodulation of GABA^ receptors containing
72L-GFPN 85
11: Visualisation of y2L-GFPN in cultured hippocampal neurones. 88
12: Targeting of y2L-GFPN in mice. 90
13: Clathrin-mediated endocytosis of recombinant GABA^ receptors. 98
14: Clathrin-mediated endocytosis of GABA^^ receptors in cultured hippocampal neurones. 100
11 15: The intracellular domains of (33 and 72 GABA^ receptor subunits bind the adaptin a and b subunits of AP2. 102
16: The intracellular domains of (31, (33, 72s and 72L GABA^ receptor subunits bind the adaptin a and b subunits of AP2. 104
17: GABA;^ receptors immunoprecipitate with AP2 from brain 106
18: Co-fractionation of GABA^ receptor p3 subunit with a- and p-adaptin throughout the clathrin-coated vesicle purification. 107
19: GABA^ receptors co-localise with AP2 in clathrin-coated pits in cultured hippocampal neurones. 108
20: Blocking endocytosis increases the amplitude of GABA^ mediated mIPSCs in hippocampal neurones. 110
21 : Time course of the effects of P4 endocytosis block on
GABA;^ mediated mIPSCs. 111
22: Distribution of GABARAP in hippocampal neurones. 119
23: The co-distribution of GABARAP with proteins of inhibitory synapses. 121
24: Only low levels of GABARAP are found at the inhibitory postsynaptic scaffold. 122
25: Subcellular distribution of GABARAP in dendrites and axons. 124
26:Subcellular distribution of GABARAP in the neuronal somata. 126
27: GABARAP associates with NSF. 128
28:GABARAP co-localises with NSF in cultured hippocampal neurones. 130
Table
1: Expression of 72L-GFPN in hippocampal neurones. 89
12 ABBREVIATIONS
AKAP A kinase anchoring protein
AMPA a-amino-3-hydroxy-5-methyl-4
isoxazoleproprionic acid
3-AT 3-aminotriazole
ATP adenosine triphosphate
P-gal p-galactosidase
CAl cornu ammonis, subregion 1
CA3 cornu ammonis, subregion 3
CACA ci5'-4—amino-crotonic acid
CamKII Ca^Vcalmodulin-dependent protein kinase
cAMP cyclic adenosine monophosphate
cGMP cyclic guanosine monophosphate
cDNA complementary deoxyribonucleic acid
CMV cytomegalovirus
DAG diacylglycerol
DGC dystrophin-associated glycoprotein complex
E C 5 0 concentration of agonist which produces half-
maximal response
ER endoplasmic reticulum
EST expressed sequence tag
et al. and others
GABA gamma-aminobutyric acid
13 GABAy, gamma-aminobutyric acid type A
GABAg gamma-aminobutyric acid type B
GAB Ac gamma-aminobutyric acid type C
GAD glutamic acid decarboxylase
GAP GTPase-activating protein
GEF guanine nucleotide exehange factor
GFP green fluorescent protein
GlyR glycine receptor
GLYT glycine transporter
GST glutathione-S-transferase
GTP guanosine triphosphate
GTPyS guanosine 5’-0-(3-thiotriphosphate)
5-HT3R 5-hydroxytryptamine type 3 receptor
IPSC inhibitory postsynaptic current mIPSC miniature IPSC
LTD long term depression
LTP long term potentiation
MAGUK membrane associated gu an y late kinase
MAP microtubule-associated protein mRNA messenger ribonucleic acid
MTB microtubule-binding domain nAChR nicotinic acetylcholine receptor
NMDA N-methyl-D-aspartate
NMJ neuromuscular junction nNOS neuronal nitrie oxide synthase
NP-40 nonylphenoxy polyethoxy ethanol
14 NRC NMDA receptor complex
NSF A-ethylmaleimide sensitive factor
^^P-y-ATP ATP with phosphorous 32 isotope at the
gamma position
PC12 pheochromocytoma cell line
PKA cAMP-dependent protein kinase
PKC Ca^Vphospholipid-dependent protein kinase
PSD postsynaptic density
SAP synapse-associated protein
SD synthetic dropout medium
SDS-PAGE sodium dodecyl sulphate polyacrylamide gel
electrophoresis
SH3 src-homology 3
SV40 simian virus promoter
TM transmembrane domain
TPR tetratricopeptide repeats
Y2H yeast two-hybrid
15 CHAPTER 1
1.1 GABA is the major inhibitory neurotransmitter in the brain
y-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the brain
and it is estimated that at least one third of synapses are GABAergic (Bloom and Iverson,
1971). GABA was originally discovered as an inhibitory neurotransmitter in crustacean
neurones (Boistel and Fatt, 1958). Mechanisms for the synthesis, storage, presynaptic
release, postsynaptic action and removal of GABA were discovered in the mammalian
central nervous system, fulfilling the criteria for a vertebrate neurotransmitter. GABA can
be found in high concentrations in the mammalian brain (Awapara et al., 1950; Neal and
Iversen, 1969) and it’s application to cortical neurones was found to induce membrane
hyperpolarization with similar reversal potentials to inhibitory postsynaptic potentials
(IPSPs) (Krnjevic and Schwartz, 1967). A specific mechanism for the removal of GABA
was demonstrated by the ability of neurones to take up [^H] GABA through a high
affinity transporter (Iverson and Neal, 1968). GABA taken up by cultured neurones
could then, following potassium induced depolarisation of the cell, be released in a
calcium dependent manner (Iversen et al., 1970; Farb et al., 1979). Furthermore, evidence
for the presence of the GABA synthesising enzyme glutamic acid decarboxylase (GAD)
was provided when it was shown that application of [^H] glutamate to cultured neurones
resulted in the synthesis and storage of [^H] GABA (Rando et al., 1981).
1.2 Three distinct classes of GABA response
Based on pharmacological and electrophysiological methodologies three classes of
GABA receptor have been identified. Initially the presence of only a single type of GABA receptor was known. This receptor was activated by muscimol and inhibited by
16 bicuculline and its activation leads to opening of an integral chloride channel resulting in
a rapid hyperpolarisation of the membrane potential. Following the identification of a
novel GABA receptor by Hill and Bowery (1981) the classical GABA receptor was
termed GABA^ and the novel receptor GABAg. This novel receptor, is insensitive to
bicuculine and muscimol, is activated by baclofen, inhibited by 2-hydroxysaclofen and
produces a slower inhibitory current (Bowery, 1980; Hill and Bowery, 1981). This
receptor couples to G-proteins to inhibit adenylyl cyclase and to activate potassium
channels and inhibit calcium channels (Bormann, 1988) and was recently identified to be
a seven transmembrane G-protein coupled receptor (Kaupmann et al., 1997). Following
the discovery that the GABA analogue cis-4-aminocrotonic acid (CACA) could inhibit
neuronal activity in a bicuculline insensitive manner a third class of GABA response was
proposed and termed GAB Ac (Drew et al., 1984). The receptors for this response, are
activated by GABA and CACA, insensitive to both bicuculline and baclofen, inhibited by
picrotoxin, and assemble from a subclass of GABA^ receptor subunits to form GAB Ac
receptors (Shimada et al., 1992; Feigenspan et al., 1993; Qian and Dowling, 1993).
1.3 Pharmacology of the GABA^ receptor
GABA^ receptors are the sites of action for a range of therapeutic agents,
including the benzodiazepines, barbiturates, steroids and anaesthetics (Macdonald and
Olsen 1994; Rabow et al., 1995). These drugs act by modulating a number of properties of the chloride channel. Benzodiazepines such as valium and diazepam act to potentiate
GABA-responses by increasing the frequency of channel opening without having a measurable effect on channel open time or conductance (Study and Barker, 1981).
Barbiturates can both potentiate GABA responses and, at higher concentrations can directly activate the receptor channel. Barbiturate enhancement of GABA responses occurs by increasing average channel open time without affecting channel conductance or
17 opening frequency (Jackson et al., 1992). GABA^ receptors are also the site of action of a
number of steroids including progesterone, corticosterone, testosterone and steroid
anaesthetics. They are thought to potentiate GABA responses by increasing both the
frequency and open time of channel opening (Twyman and Macdonald, 1992). A number
of general anaesthetics such as isoflurane and halothane increase GABA-induced currents
by potentiating the action of GABA or by directly activating the channel. Ethanol has also
been shown to have a potentiating effect on GABA^ receptors (Dietrich et al., 1989) with
sites on receptor transmembrane domains believed to be required for receptor modulation
(Mihic et al., 1997).
GABA^ receptors are also inhibited by a number of other pharmacological agents.
Picrotoxin, a plant convulsant is a non-competitive GABA^ receptor inhibitor that is
thought to act by binding to a site within the channel (Zhang et al., 1994) leading to
stabilisation of receptors in an agonist bound desensitised state (Newland and Cull-Candy,
1992). GABA^ receptors are also the target of a number of alosteric inhibitors including
Zn2+ (Smart, 1992), the anticonvulsant, loreclezole (Wafford et al., 1994) and the
antihelminthic compound, invermectin (Krusek and Zemkova, 1994).
1.4 Molecular biology of GABA^ receptors
Benzodiazepine affinity chromatography allowed the purification of two GABA^
receptor subunits. Analysis using denaturing sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) revealed these to be a 53 kDa a subunit and 58 kDa (3
subunit (Sigel et al., 1982; Sigel et al., 1983; Sigel and Barnard, 1984). Peptide
microsequencing of these purified receptor subunits provided sufficient information to
design oligonucleotide probes for screening bovine cDNA libraries. This resulted in the cloning of an a subunit of 456 amino acids and (3 subunit of 474 amino acids (Scholfield et al., 1987). Co-injection into Xenopus oocytes of cRNA in vitro transcribed from the
18 receptor a and (3 subunit cDNAs resulted in the formation of GABA gated chloride channels. Analysis of the deduced amino acid sequence of the a and (3 subunit revealed that these receptors showed significant homology with each other and with the nicotinic acetylcholine receptor (nAChR) (Noda et al., 1982). GABA^ receptors and nAChR are members of the ligand gated ion channel superfamily that also contains the glycine receptor (Grennigloh et al., 1987), and 5-hydroxytryptamine (S-HT^) receptor (Marieq et al., 1991). The members of this family have a similar subunit topology consisting of a cleavable signal sequence, large extracellular amino terminus, four transmembrane (TM) domains and a large intracellular loop between TM domains III and IV (Fig. 1). Molecular weights of 240 kDa for GABA^ receptor (Mamalaki et al., 1989), 290 kDa for the nACh receptor (Lindstrom et al., 1979) and 260 kDa for the glycine receptor (Langosch et al.,
1988) are consistent with these ion channels being pentameric assemblies of subunits.
Evidence for the quaternary structure of a ligand gated ion channel has been obtained for the nAChR. The very high expression levels of nACh receptors in the electric organ of
Torpedo califorinca have allowed purification of the receptor in a semi-crystaline array
(Unwin, 1988). This has allowed electron microscopic analysis of the channels to 9 angstroms resolution, confirming that these receptors are pentamers arranged around a central aqueous pore (Unwin, 1988, 1995). Analysis of the rotational symmetries of
GABA^ receptors suggest that the majority of these receptors are also pentameric
(Nayeem et al., 1994).
1.5 Subunit diversity
Following the cloning of the a l and pi GABA^ receptor subunits (Scholfield et al., 1987) a large number of other subunits were identified by screening cDNA libraries with degenerate oligonucleotides to a conserved region in TM II. Five additional a
19 extracellular
n III IV
intracellular
B Pore extracellular
intracellular
Cl
Figure liGABA^ receptore structure. A) Transmembrane topology of an ionotropic GABA receptor subunit. The protein Has a large extracellular N-terminus, four transmembrane domains (TM 1-lV), and a large intracellular loop between TM III and TM IV. B)Proposed pentameric arrangement of homologous subunits lining a central anion selective pore. The pore is lined by the second transmembrane domain (TM II) of each subunit.
20 subunits were identified: a2, a3 (Levitan et al., 1988a,b), a4 (Ymer et al., 1989a), a5
(Khrestchatisky et al., 1989; Malherbe et al., 1990) and a 6 (Kato, 1990; Luddens et al.,
1990). A further 3 (3 subunits were also cloned, (32 and (33 from rat and bovine brain
(Ymer et al., 1989b) and (34 which is only found in chicken (Lasham et al., 1991). A
novel class of subunit isoform was identified with the cloning of the y2 subunit, which has
42% identity to the a l subunit and 35% similarity to the (31 subunit, yl (Ymer et al.,
1990) and y3 (Wilson-Shaw et al., 1991) subunits were also identified and in addition a
chicken specific y4 subunit has also been isolated (Harvey et al., 1993). A fourth class of
subunit, Ô, was also identified from cDNA library screens and has 35% similarity to a ,(3
and y subunits (Shivers et al., 1989). More recently, two additional receptor subunits have
been identified from express sequence tag (EST) databases. The e subunit (Davies et al.,
1997a; Whiting et al., 1997) is most closely related to a ,(3 and y subunits whereas the 7i
subunit is most similar to (3 and 8 subunits and is predominantly expressed in uterus with only very low levels found in brain (Hedblom and Kirkness, 1997). The p class of
GABA^ receptor subunit has three members (p 1-3) and has closest homology to GABA^ receptor (3 subunits but has the lowest homology to other subunit members overall
(Cutting et al., 1991; Ogurusu and Shingai, 1996; Wang et al., 1994). Expression of the p 1 subunit in Xenopus Oocytes revealed that this subunit shows the pharmacological profile of the GABA^ response. This suggests that p family members form part of a separate subunit class of GABA^ receptors that form the GABA^ receptor.
Further diversity of receptor structure is generated by alternative splicing of receptor subunit mRNAs. Two variants of the a 6 subunit (a6S and a 6L) have been identified that differ by a 10 amino acid insertion in the a 6L. Interestingly, this 10 amino acids insertion is essential for cell surface targeting of this subunit (Korpi et al., 1994;
Taylor et al., 2000). A number of (3 subunits are also alternatively spliced. The chicken (32
21 subunit exists as two isoforms, one with an additional 17 amino acids containing a
potential PKC phosphorylation site (Harvey et al., 1994). The human (32 subunit also
exists as two splice variants one which contains a 38 amino acid insert that contains a
consensus site for phosphorylation by calcium calmodulin dependent kinase (McKinley et
al., 1995). Alternative splicing also results in human (33 subunits with variant signal
sequences (Kirkness and Fraser, 1993). In the case of the y2 subunit, alternative splicing
generates 2 forms of this protein, y2L and y2S that differ by the presence of 8 amino acids
in y2L (Whiting et al., 1990; Kofuji et al., 1991) which contain a consensus phosphorylation site for protein kinase C (PKC).
1.6 G ABA A receptor subunit expression and distribution
In situ hybridisation using subunit specific oligonucleotide probes and
immunohistochemistry with subunit specific antibodies has revealed that the expression of
GABA^ receptor subunits is both spatially and developmentally regulated, with subunits having separate but overlapping distributions in brain (Wisden et al., 1992; Laurie et al.,
1992a; Zimprich et al., 1991, Fritschy et al., 1992, Fritschy and Mohler, 1995). The a l,
(32, (33 and y2 subunits are all found to be abundantly expressed throughout the adult rat brain (Wisden et al., 1992; Laurie et al., 1992a; Fritschy and Mohler, 1995). In contrast, the pi subunit has a lower and more restricted expression than the p2 or p3 subunits. The yl and y3 subunits are widely expressed but at lower levels than the y2 subunit. The ô subunit is expressed at high levels in the thalamus and cerebellar granule cell layer
(Shivers et al., 1989) and the a 6 subunit is the most restricted subunit being found only in cerebellar granule cells (Kato, 1990; Luddens et al., 1990). By in situ hybridisation,
Laurie and co-workers have carried out an in depth study of the developmental expression profile of receptor subunits (Laurie et al., 1992b). From this work it was found that a2, a3, a5, pi, p2, P3, y l, y 2 and y3 subunits are expressed neonataly
22 whereas al, a4, a6, f>2, y 2 and ô subunits are the major subtypes expressed in adult
brain. Exeeptions include the adult hippocampus, which contains all receptor subunits
except a 6 and the Purkinje cells of the cerebellum which show no temporal change in
subunit expression profile.
1.7 Subunit composition of receptors
Although in some brain regions, receptor heterogeneity is limited by the temporal
and/or spatial distribution of some receptor subunits the large variety of subunits
nonetheless provides the potential for considerable heterogeneity of receptor structure.
Some important basic conclusions on receptor structure have however been made from
recombinant receptor expression studies, pi and pS subunits can form spontaneously open
chloride channels that are inhibited by picrotoxin and activated by pentobarbital but not
GABA (Krishek et al., 1996; Davies et al 1997b., Connolly et al., 1996b). However,
single channels expressed alone do not form GABA-gated channels (Scholfield et al.,
1987; Pritchet et al., 1989b; Shivers et al., 1989; Connolly et al., 1996a; Davies et al.,
1997a; Hedblom and Kirkness, 1997). Co-expression of a and p subunits results in the
production of GABA gated channels. These channels can be blocked by bicuculline and
picrotoxin and potentiated by barbiturates and can also be inhibited by Zn2-i- (Scholfield et al., 1987; Levitan et al., 1988a, Levitan 1988b; Draguhn et al., 1990). Co-expression of
a y subunit with a and p subunits produces receptors that can be potentiated by benzodiazepines (Pritchet et al., 1989b) and that are insensitive to inhibition by Zn2-I-
(Draguhn et al., 1990). Replacement of the y subunit with either ô or e results in the production of receptors that are not potentiated by benzodiazepines (Davies et al., 1997a;
Shivers et al., 1989).
The above results suggest that the majority of receptors will contain at least la,
1 p and ly to form receptors with the properties of most native receptors (Pritchet 1989a;
23 Scholfield et al., 1987). Immunoprécipitation studies have been used to probe the
composition of native GABA^ receptors and the most prevalent receptor subunit
combinations (Benke et al., 1990; Benke et al., 1991; Stephenson, 1995; Me Kern an and
Whiting, 1996). Co-existence of more than one a subunit (McKernan et al., 1991;
Mertens et al., 1993; Pollard et al., 1993; Khan et al., 1996) or two different p subunits (Li
and De Bias, 1997) has been observed in the same receptor. Although some receptors
have been found to contain more than one y subunit (Quirk et al., 1994b) most GABA^
receptors are believed to contain only a single y subunit type (Quirk et al., 1994a; Mossier
et al., 1994). The 6 subunit can substitute for y subunits in some receptors (Quirk et al.,
1994a). a l, P2 and subunits are expressed together in many brain regions suggesting
that they may co-assemble to form an important population of receptors (Laurie et al.,
1992a) and it is generally thought that these subunits comprise the most common receptor
type in the brain (Benke et al., 1991). Immunoprécipitation studies with expressed
recombinant a l, p2 and y2 subunits suggests that the stoichiometry of these channels is
2a, 2p and ly (Tretter et al., 1997).
1.8 GABA^ receptor cell surface targeting
Many neurones express multiple receptor subunit subtypes (Wisden et al., 1992;
Laurie et al., 1992a; Fritschy and Mohler, 1995) providing the potential for considerable
heterogeneity of receptor structure. However, only some subunit combinations can oligomerise to form functional ion channels. The mechanisms that exist to ensure that only physiologically appropriate GABA^ receptor subunit complexes can access the cell
surface are still not entirely clear. In the case of nAChRs, receptor assembly occurs in the
ER which serves as a checkpoint to retain inappropriate subunit combinations (Green and
Miller, 1995).
24 Studies of recombinant GABA^ receptors expressed in heterologous systems with
receptor a l, (31-2 and y2 subunits, have revealed that access to the cell surface only
occurs for a(3 and a (3 y subunit combinations (Angelotti and MacDonald, 1993;
MacDonald and Olsen, 1994; Rabow et al., 1995; Connolly et al., 1996a). In A293 cells
expressing different combinations of a l, (32 and y2 subunits, single subunit combinations
and the aly2, (322y subunit combinations are retained within the endoplasmic
reticulum (ER) (Connolly et al., 1996a). This suggests that assembly of receptors occurs
in the ER with only a subset of receptor subunit combinations being able to access the cell
surface. Moreover, the a l or P2 subunits when expressed alone are rapidly degraded
(Gorrie et al., 1997) suggesting that some subunit combinations may misfold and be
retained in the ER whereupon they are targeted for degradation. The retention and degradation of misfolded subunits is likely to be directed by ER chaperone molecules
(Hammond and Helenius, 1994) as GABA^ receptor subunits have been found to associate with both BiP and Calnexin (Connolly et al., 1996b; Gorrie et al., 1997). It is thought that calnexin binding acts to prevent protein aggregation and premature exit of
incompletely folded and oligomerised proteins from the ER by associating with immature carbohydrate residues (Hammond et al., 1994). Interestingly, differential cell surface trafficking of y2L and y2S subunit splice variants has also been demonstrated. The two subunits differ by the presence of 8 amino acids within the major intracellular domain of this subunit (Whiting et al., 1990). Whereas the y2L subunit is retained within the ER when expressed alone, the y2S subunit can access the cell surface as a non-functional monomer (Connolly et al., 1996a; Connolly et al., 1999a). Surprisingly, however, co expression of the y2S subunit with either the a l or p2 results in the retention of y2s in the
ER suggesting that in vivo the y2S subunit is unlikely to occur as a monomer (Connolly et a]., 1999a).
25 The mechanisms of ER retention of receptor subunits are not fully understood. It is possible that some subunits can only fold correctly when completely oligomerised and therefore in the absence of the necessary oligomerisation partners, they are bound by chaperones and retained. However, in the case of the y2L subunit, the presence of an additional 8 amino acids is sufficient to result in ER retention. This suggests that some subunits fold correctly in the ER but have an ER retention signal which must be masked to allow their continued maturation through the biosynthetic pathway. This has recently been shown for the GABAg receptor R1 subunit (Margeta-Mitovic et al., 2000). It appears likely that a key factor essential for exit from the ER is the ability to oligomerise. For instance, the (33 subunit is able to homo-oligomerise and access the cell surface forming spontaneously gated ion channels (Connolly et al., 1996b; Wooltorton et al., 1997).
Receptor subunit combinations such as a/y and (3/y, which cannot access the cell surface can presumably only form dimers and are unable to oligomerise into pentameric channels
(Gorrie et al., 1997; Tretter et al., 1997).
1.9 GABAa receptor assembly
As described above, for most subunits to access the cell surface they must correctly assemble into oligomeric complexes. Studies have implicated GABA^^ receptor subunit N-terminal domains in this process (Hackam et al., 1998) and the N-terminal domain of the p 1 subunit was found to contain signals for both homo and heterooligomerisation (Hackam et al., 1997; Enz et al., 1999). Importantly, specific amino acid sequences present in subunit N-termini have been found to act as assembly domains important for oligomerisation (Srinivasan et al., 1999; Taylor et al., 1999, 2000;
Klausberger et al., 2000). Using a chimeric approach, four amino acids in the N-terminal
26 domain of the [33 subunit have been identified that mediate functional cell surface
expression of this subunit compared to P2, which is retained within the ER (Taylor et al.,
1999). Substitution of these four amino acids into the p2 subunit was sufficient to enable
the p2 subunit to homo-oligomerise and exit the ER. Interestingly, these residues were not
critical for formation of a lp 2 or aip3 subunits but were important for the
oligomerisation of p subunits with y subunits. Studies have also identified a domain,
conserved in all a subunit isoforms that is essential for oligomerisation of al subunits
with P3 subunits but not the y2 subunit and that therefore plays a critical role in assembly
of ap and apy subunits (Taylor et al, 2000). Q67 and W69 from this domain have been
identified to play a particularly important role in mediating assembly (Srinivasan et al.,
1999; Taylor 2000). W94 has also been implicated as necessary for GABA^ receptor assembly (Srinivasan et al., 1999). Interestingly, W69 and W94 are common to all ligand gated ion channel subunits whereas Q67 is conserved in GABA^, S-HT, and glycine receptor subunits, and to nAcR a subunits. This suggests that these conserved residues may play a role in the assembly of all ligand gated ion channels. Finally, using C-terminal truncated y2 subunits as well as mutated and chimeric fragments, amino acid sequences y2
(91-104) and y2 (83-90) have also been identified that mediate assembly of the y2 subunit with a l and p3 subunits respectively (Klausberger et al., 2000).
1.10 Selective subcellular targeting of GABA^ receptors
Studies in both polarised epithelial cells and in neurones have revealed that different GABA^ receptor subunit combinations can be targeted to different subcellular domains. In polarised epithelial cells the subcellular localisation of GABA^ receptors containing a l and pi, p2 or P3 subunits is determined by the identity of the P-subunit.
Whereas expression of aip i complexes resulted in a non-polarised distribution, both aip2 and alp3 subunit combinations were specifically targeted to the basolateral domain
27 of these cells (Connolly et al., 1996a). These results suggest that (3-subunits may confer particular subcellular trafficking destinations on GABA^ receptors in neurones. The differential subcellular trafficking of receptor subunit combinations has also been shown
in vivo. Studies focusing on the subcellular distribution of al, a 6, (32, (33, y2and 5
subunits in cerebellar granule cells have found the differential targeting of specific subunit combinations (Nusser et al., 1996b; Nusser et al., 1998b). Immunogold localisations indicate that receptors containing a l, a 6, (32/3 and y2 subunits are found concentrated on
GABAergic Golgi synapses and at lower levels at extrasynaptic sites. In contrast, the
Ô subunit was present only at dendritic and somatic extrasynaptic sites. Furthermore, the a 6, (32/3and y2 subunits but not the a l and ô subunits, could also be detected at some glutamatergic mossy fiber synapses where they co-localised with AM PA type glutamate receptors (Nusser et al., 1996b; Nusser et al., 1998b). Other immunogold studies have identified the differential synaptic localisation of two major GABA^ receptor a subunits on hippocampal pyramidal cells. Whereas the a l subunit was localised to the majority of
GABAergic synapses, the a2 subunit was only detected in a subset of somatodendritic synapses and was found enriched at synapses on the axon initial segment (Nusser et al.,
1996a). Differential targeting of a2 and a5 containing GABA^ receptors has also been detected in hippocampal pyramidal cells and olfactory bulb granule cells by immunofluorescence (Fritschy et al., 1998). Furthermore, the differential targeting of a subunits has also been detected in the mammalian retina where a l, a2, and a3 subunits were found to have non-overlapping distributions on retinal a-ganglion cells (Koulen et al., 1996).
The mechanisms and functional consequences of selective targeting of different receptor subunit combinations is not entirely clear. The kinetic and pharmacological properties of GABA^ receptors depend on their subunit composition (Macdonald and
Olsen, 1994; Rabow et al., 1995). This suggests that the targeting of receptors with
28 specific properties to defined domains may be necessary for the fine tuning of the
integrative properties of a particular neurone. In both hippocampal pyramidal cells and cerebellar granule neurones, synaptic and extrasynaptic receptors appear to have different
functional properties (Brickley et al., 1999; Banks and Pearce, 2000). It has been
suggested that extrasynaptic GABA^ receptors may be involved in setting the resting conductance of the postsynaptic cell via tonic activation by ambient G ABA or GABA-
spillover from the synaptic cleft (Brickley et al., 1996; Wall and Usowicz, 1997; Nusser et al., 1998b; Rossi and Haman, 1998; Brickley et al., 1999). The extrasynaptic 6 subunit containing receptors in cerebellar granule cells would be well suited for this role since they have a high affinity for GAB A and do not desensitise (Saxena and Macdonald, 1994,
1996). Similarly, the relatively slow deactivation kinetics of extrasynaptic GABA^ receptors on CAl pyramidal neurones may also be specialised for mediating tonic inhibition (Banks and Pearce, 2000).
The potential mechanisms for differential receptor targeting are unknown. The importance of ionotropic receptor intracellular domains for the targeting of other receptors has been shown. For instance the intracellular domain of the nAChR a3 subunit targets nAChRs to subdomains within individual synapses in vivo (Williams et al., 1998).
Similarly intracellular domains are also important for the synaptic targeting of glutamate receptors (Dong et al., 1997). It is therefore likely that interactions between GABA^ receptor subunit intracellular domains with associated proteins may be important for the differential targeting of GABA^ receptors. For example, deletion of the y2 subunit gene results in the disruption of the synaptic targeting of both GABA^ receptors and gephyrin
(Essrich et al., 1998). Consistent with this, in cerebellar granule cells it appears that receptors lacking the y2 subunit are specifically excluded from the synapse (Brickley et al., 1999). These results suggest that the y2 subunit plays an essential role in the synaptic targeting of GABA^ receptors, possibly via an association with gephyrin, a molecule
29 essential for GABA^ receptor clustering (Essrich et al., 1998; Kneussel et al., 1999).
GABARAP, a novel microtubule binding protein that interacts with the intracellular loop of the y2 subunit could also be involved in the synaptic targeting of the y2 subunit. It
seems unlikely however that the y2 subunit is the only subunit essential for receptor targeting. The Ô subunit which can substitute for the y subunit in some receptor subunit combinations is found only extrasynaptically (Nusser et al., 1998b). Although in the case of Ô subunit containing receptors, the lack of the y2 subunit may preclude these receptors being targeted to synapses it is also possible that an association between the ô subunit and
an interacting protein could serve to exclude ô subunit containing receptors from synaptic sites. Similarly, the differential targeting of receptors containing different a and/or different (3 subunits suggests that these subunits can also play a role in receptor targeting
(Connolly et al., 1996a; Nusser et al., 1996a).
1.11 Formation of postsynaptic specialisations
Neurotransmitter receptors are for the most part concentrated at the postsynaptic face of the synaptic cleft directly opposite the presynaptic terminal. For instance, at the neuromuscular junction, muscle acetylcholine receptors are found at a concentration of up to 10 000 receptors per p.m^ at the site of motor axon innervation whereas in surrounding extrasynaptic regions their concentration is approximately 1000 fold less (Froehner,
1991). Similarly, glycine receptors (Triller et al., 1985), GABA^ receptors (Craig et al.,
1994) and glutamate receptors (Craig et al., 1993) are also concentrated at postsynaptic sites. To achieve this, neurones have evolved very specific sorting mechanisms that are critical for the correct targeting and clustering of receptors to specific subcellular domains. Receptor targeting mechanisms are likely to be dependent on protein-protein interactions between receptor intracellular domains and associated proteins. A number of
30 molecules important for receptor sorting and clustering have been identified, either as molecules that co-purify with the receptor or by using receptor intracellular domains as baits in yeast two hybrid (Y2H) screens (Kneussel and Betz, 2000a,b; Garner et al., 2000;
Sheng and Pak, 2000).
1.12 Clustering of muscle nicotinic acetylcholine receptors at the neuromuscular junction
The most detailed picture of the mechanisms important for the targeting and clustering of an ionotropic receptor have emerged from studies on the clustering of muscle nAChRs at the neuromuscular junction (NMJ) which were initialy greatly facilitated by the availability of Torpedo ray electric organ (Noda et al., 1982; Sanes and
Lichtman, 1999). This preparation contains very large amounts of nAChRs greatly facilitating their purification. A 43 kDa molecule, rapsyn was found to co-purify with the nAChRs in this preparation (Sobel et al., 1977). This protein was also found to co-localise with nAChRs at the mammalian neuromuscular junction (Froehner et al., 1981).
Interestingly, removal of rapsyn was found to result in an increase in the nAChR membrane mobility without affecting receptor function (Rousselet et al., 1982). Chemical crosslinking studies (Burden et al., 1983) and electron microscopy (Toyoshima et al.,
1988; Mitra et al., 1989) also provided evidence for the intimate association of rapsyn with the nAChR. Rapsyn was also shown to bind actin suggesting a mechanism by which rapsyn could link nAChRs to the cytoskeleton (Walker et al., 1984). The cloning of cDNA sequences for the nAChR (Noda et al., 1982) and rapsyn (Frail et al., 1987) further aided in understanding the role of rapsyn with respect to nAChR function. When nAChRs are heterologously expressed in Xenopus oocytes or fibroblasts they distribute uniformly within the plasma membrane. In contrast, when rapsyn is expressed alone in the same cells it forms clusters and more importantly when co-expressed with nAChRs induces a
31 redistribution of receptors into clusters that precisely co-localise with rapsyn (Froehner et
al., 1990).
Another set of proteins expressed at high levels at the neuromuscular junction
constitute the dystrophin-associated glycoprotein complex (DGC). Importantly, rapsyn
was also found to associate with and cluster P-dystroglycan, a component of the DGC.
This suggested that rapsyn may act as a scaffold that links the DGC to nAChRs as well as
linking this complex to actin (Ervasti and Campbell, 1993; Apel et al., 1995; Cartaud et
al., 1998). Confirmation of the essential role of rapsyn in nAChR clustering came from
rapsyn deficient mice which fail to cluster both nAChRs and the DGC at the neuromuscular junction (Gautam et al., 1995).
Rapsyn contains a myristolation site, a cystein-rich domain, eight tetracopeptide repeat (TPR) domains and a C-terminal coiled-coil domain (Colledge and Froehner,
1998). The myristolation site is important for plasma membrane targeting (Philips et al.,
1991b). TPRs are thought to mediate protein-protein interactions, and in rapsyn are important for it’s self association, whereas the coiled coil region is important for association with the nAChR (Ramarao and Cohen, 1998). Heterologous coexpression studies have shown that rapsyn can cluster neuronal nAChRs however, the clustering of neuronal nAChRs was not disrupted in the rapsyn knockout indicating that rapsyn is not important for the clustering of neuronal nAChRs receptors in vivo (Feng et al., 1998a).
Two other proteins have also been identified to be critical for nAChR clustering at the neuromuscular junction. The protein agrin is presynapticaly released from innervating motor neurones and can induce the clustering of nAChRs on the surface of cultured myotubes (Wallace, 1989). Mice that have had the agrin gene deleted form poor nAchR clusters at the neuromuscular junction confirming the importance of this protein (Gautam et al., 1996). Agrin stimulates phosphorylation of nAChR subunits on serines and tyrosines which is thought to be important for the initiation of receptor clustering (Qu et
32 al., 1990). Tyrosine phosphorylation of the receptor is likely to be mediated by MuSK, a
muscle specific tyrosine kinase that becomes restricted in distribution to the mature
neuromuscular junction. Gene deletion of MuSK produces a very similar phenotype to the
agrin knockout (DeChiara et al., 1996). Furthermore, the agrin induced clustering of
nAChRs in cultured myotubes does not occur in myotubes cultured from the MuSK knockout stongly suggesting that this protein may be part of an agrin receptor.
Interestingly, MuSk can itself cluster at the neuromuscular junction in the rapsyn
knockout (Apel et al., 1997). This suggests that MuSK forms a ‘primary scaffold’ that then recruits rapsyn which then clusters nAChRs to allow their phosphorylation by MuSK as well as recruiting other proteins including the DGC (Sanes and Litchman, 1999).
1.13 Clustering and anchoring of ion channels at central synapses
In the central nervous system ion channels are selectively targeted to specific post synaptic domains within the highly differentiated and polarised architecture of the neuronal plasma membrane. This selective targeting and clustering of receptors is essential for efficient synaptic transmission (Essrich et al., 1998; Feng et al., 1998a,b). For instance, in the case of inhibitory neurotransmission even a partial decrease in GABA^ receptor clustering and anchoring can result in significant behavioural dysfunction due to decreased efficacy of synaptic inhibition (Crestani et al., 1999). Studies on the NMJ have greatly advanced our understanding of mechanisms important for the development and maintenance of synaptic structure. However, it is not yet clear whether lessons learnt from studying the NMJ will be relevant to the formation and maintenance of central synapses.
Evidence for the importance of alternative receptor clustering mechanisms in the CNS come from studies on the agrin knockout mouse which failed to show any defects in the formation of both glutamatergic and GABAergic synapses in central neurones
(Serpinskaya et al., 1999) and the rapsyn knockout which has normal neuronal nAChR
33 clustering (Feng et al., 1998a). Furthermore, although the NMJ and central synapses have
similarities in both structure and function, there all also a number of differences between
these two types of synapse (Sanes and Lichtman, 1999). The most important of these is
that muscle fibres receive a single large input whereas most of the rest of their surface is
nonsynaptic. By contrast, in the CNS, many neurones receive a large number of small
inputs that cover a large part of their somatic and dendritic surfaces. Furthermore, many central neurones receive both inhibitory and excitatory input and ion channels must
therefore be specifically targeted to postsynaptic domains aposed to presynaptic terminals containing the correct neurotransmitter. For example, in hippocampal neurones that are innervated by both inhibitory GABAergic and excitatory glutamatergic synapses, the respective GABA^ receptors and glutamate receptors are separately clustered on dendrites at discrete sites (Craig et al., 1994). In addition, as has already been discussed, in the case of GABA^ receptors, different subunit combinations can be targeted to different subcellular domains within the same neurone. Although some of the processes of receptor clustering and synapse formation in the CNS may occur by mechanisms functionally homolgous to those important for receptor targeting and clustering at the NMJ, additional mechanisms are likely to exist to account for the specificity of postsynaptic receptor targeting in central neurones.
1.14 Excitatory synapses
Three classes of glutamate receptor have been identified based on their pharmacological and molecular properties (Hollmann and Heinemann, 1994). AMP A (a- amino-3-hydroxy-5-methyl-4-isoxazole propionic acid) receptors mediate fast excitatory synaptic transmission; NMDA (A-methyl-D-aspartate) receptors are highly permeable to calcium ions and kainate receptors which also contribute to excitatory synaptic transmission (Hollmann and Heinemann, 1994; Chittajallu et al., 1999). Glutamate
34 receptors have a large extracellular N-terminus, four membrane spanning domains and an intracellular carboxyl terminus. Studies have revealed that many of the proteins important for the formation of macromolecular signalling complexes at glutamatergic synapses are members of a growing superfamily of proteins that contain PDZ domains (reviewed in
Garner et al., 2000). PDZ domains consist of -90 amino acids that can bind to short peptide sequences with 10-100 nM affinity. The prototypical peptide sequence is the
T/SXV motif and is most often found at the carboxyl terminal of target proteins, although internal T/SXV motifs have also been described (see Garner et al., 2000).
1.15 Anchoring of the NMDA receptor complex at the postsynaptic density
The NMDA receptor subtype of glutamate receptor is a calcium permeable ion channel that is essential for excitatory synaptic transmission (Hollman and Heinamann,
1994). Opening of NMDA receptors results in the activation of cytoplasmic signalling cacades that cause long term changes in neurones that are important for both synaptic plasticity and learning (Bliss and Collingridge, 1993). These receptors form a major component of the postsynaptic density (PSD) present at asymmetric glutamatergic synapses. There has been significant interest in understanding the molecular mechanisms underlying NMDA receptor postsynaptic localisation and signalling. It has emerged that
NMDA receptors form part of a large complex of interacting proteins that make up a significant part of the excitatory postsynaptic density and that has been termed the NMDA receptor complex (NRG) (Sheng and Lee, 2000). Significant progress in the characterisation of NMDA receptor interacting proteins has been facilitated by the membrane topology of these receptors and their tight association with other proteins in the
PSD. Firstly, the large intracellular tail of NMDA receptor subunits mediates the vast majority of interactions with associated proteins and furthermore, these intracellular carboxyl tails have proved to be particularly good baits in yeast two hybrid (Y2H) screens
35 (Sheng and Pak, 2000). Furthermore, PSDs can be isolated biochemically because they
are highly crosslinked, detergent resistant structures. This has facilitated the biochemical
isolation of a number of core components of the PSD which have often also been found to
be both components of the NRC and important for NMDA receptor signalling (Kennedy,
1997).
One of the first, and most important NMDA receptor associated proteins to be
identified from a Y2H screen is SAP90/PSD-95 (Kornau et al., 1995). This protein is a
prototypical PDZ domain containing protein and is also a member of the synapse
associated protein (SAP)/ membrane associated guanylate kinase (MAGUK) family of proteins. Other members of this family including SAP97/hDLG, SAP 102 and Chapsyn
110/SAP93 have also been characterised. All SAPs/MAGUKs contain three N-terminal
PDZ domains, a Src-homolgoy 3 (SH3) domain and a C-terminal inactive guanylate kinase (GK) domain. These domains serve as regions for protein-protein interactions and in the case of PSD-95 allow the simultaneous binding of proteins to the NMDA receptor
(Sheng and Pak, 2000; Sheng and Lee, 2000). PSD-95 can associate with signalling proteins such as nNOS (Brenman et al., 1996) and synGAP (Kim et al., 1998), the microtubule binding protein CRIPT (Niethammer et al., 1998) as well as guanylate kinase associated proteins (Kim et al., 1997). Via the GKAP interacting protein Shank, PSD-95 is also linked to both metabotropic glutamate receptors via an interaction between Shank and Homer and to the actin cytoskeleton via cortactin (Naisbitt et al., 1999; Tu et al.,
1999). PSD-95 can also associate with neuroligin, a membrane spanning protein that can associate with presynaptic neurexins and therefore form a transynaptic bridge which may be essential for synaptogenesis (Scheiffele et al., 2000). NMDA receptors can also associate with the cytoskeleton via the cytoskeletal associated proteins a-actinin and spectrin as well as via a direct association between neurofilament light chain and the NRl subunit of NMDA receptors (Wyszynski et al., 1997; Weschler and Teichberg, 1998;
36 Ehlers et al., 1998). From the results described above in conjunction with recent proteomics analysis of the NRC (Husi et al., 2000), it is clear that NMDA receptors form part of an extensive macromolecular complex that contains numerous associations with proteins important for signalling, trafficking and cytoskeletal attachment.
1.16 Clustering and trafficking of AMPA receptors
AMPA receptors are also present at asymmetric glutamatergic postsynaptic densities and their function is essential for glutamatergic synaptic transmission (Hollman and Heinamann, 1994). Although present within the same synapses as NMDA receptors,
AMPA receptors have a distinct cell biology. AMPA receptors do not associate with PSD-
95 and since this protein is a major component of the NRC this suggests that AMPA receptors form part of a separate protein complex. In agreement with this AMPA receptors are only loosely associated with the postsynaptic density and are removed from this preparation upon mild detergent extraction. Furthermore, whereas NDMA receptors and PSD 95 remain clustered at postsynaptic sites upon disruption of the actin and tubulin cytoskeleton, the clustering of AMPA receptors is dependent on F-actin (Allison et al.,
1998, 2000).
AMPA receptors are clustered by distinct classes of PDZ containing proteins. The
AMPA receptor GluR2 and GluR3 subunits bind the PDZ domain containing proteins
GRIPl and GRIP2/ABP (Dong et al.,1997, Shrivastava et al., 1998). Both GRIPl and
GRIP 2 are neuronal proteins that contain 7 PDZ domains whereas ABP is a GRIP2 splice variant that has only the first 6 PDZ domains. The GluR2 and GluR3 subunits interact with GRIPl and GRIP2/ABP via their fourth and fifth PDZ domains whereas the other
PDZ domains are likely to link AMPA receptors to a variety of proteins involved in signal transduction and trafficking. These include interaction with SNARF like proteins and the neuronal ras GFF, GRASP, which may be important for the synaptic targeting and
37 maintenance of receptor clusters (Dong et al., 1997; Ye et al., 2000). GluR2 and GluR3 also bind via their carboxyl tails to the single PDZ domain of PICKl (Xia et al., 1999;
Dev et al., 1999). In contrast to GRIP/ABP proteins, PICKl also promotes the clustering of GluR2 in the plasma membrane of transfected cells suggesting that it may be involved in clustering AMPA receptors (Xia et al., 1999). PICKl contains a coiled domain that allows it to self associate in the Y2H system providing a potential mechanism for clustering (Xia et al., 1999). The GluRl subunit of AMPA receptors has also been found to associate with the second PDZ domain of SAP 97 (but not SAP90/PSD-95, SAP 102 or chapsyn llO/PSD-93) (Leonard et al., 1998). Interestingly, SAP-97 may act to recruit an
AKAP/PKA complex to glutamate receptors (Colledge et al., 2000).
How AMPA receptors and their associated PDZ containing proteins are tethered to the cytoskeleton and PSD is still unclear. However, overexpressing the C-terminal tail of the GluR2 subunit in neurones results in a loss of synaptic targeting of these receptors providing the best evidence so far that interactions between the C-termini of AMPA receptors with PDZ containing proteins is important for AMPA receptor clustering (Dong et al., 1997). Interestingly, a molecule has recently been identified that may act as a signal to cluster AMPA receptors in a similar fashion to the nAChR clustering protein agrin.
Neuronal activity regulated pentraxin (NARP) is an activity regulated secreted immediate early gene. It is selectively expressed at excitatory synapses and can induce the clustering of AMPA receptors (O’Brien et al., 1999).
AMPA receptors appear to be more dynamic in their association with the PSD and can translocate in and out of synaptic sites (O’Brien et al., 1998; Liao et al., 1995; Shi et al., 1999). AMPA receptors have also recently been shown to cycle between cell surface and intracellular pools (Luscher et al., 1999; Luscher et al., 2000). Interestingly, an association was found between AMPA receptor GluR2 subunit and A-ethylmaleimide sensitive factor (NSF) (Song et al., 1998; Osten et al., 1998; Nishimune et al., 1998), a
38 protein critical for intracellular membrane trafficking events (Rothman, 1994; Schiavo and Owen, 1999). The association between AMPA receptors and NSF appears to be important for the cell surface trafficking and cycling of these receptors (Noel et al., 1999;
Luscher et al., 1999). These results further confirm the dynamic nature of AMPA receptor trafficking at synaptic sites. This suggests that the association of some types of ionotropic receptor with synaptic sites may be a very dynamic process that could be important for synaptic plasticity (Luscher et al., 2000).
1.17 Inhibitory synapses
1.18 The glycine receptor
Glycine receptors mediate the majority of fast synaptic inhibition in the spinal cord and are also found in the retina and brain stem (Vannier and Triller, 1997) where they are found concentrated at specific postsynaptic domains (Triller et al., 1985).
Purification of the glycine receptor complex by affinity chromatography resulted in the co-purification of a 93 kDa peripheral membrane protein (Pfeiffer et al., 1982; Schmitt et al., 1987). This protein could associate with tubulin suggesting that it may link glycine receptors to the tubulin cytoskeleton (Kirsch et al., 1991) and was subsequently cloned and termed gephyrin from the Greek gephura for bridge (Prior et al., 1992). Gephyrin may also be able to associate with the actin cytoskeleton via an interaction with profilin
(Mammoto et al., 1998). Both gephyrin and glycine receptor clustering is affected by disruption of the actin and microtubule based cytoskeleton providing further support for a model whereby gephyrin clusters glycine receptors via association with the cytoskeleton
(Kirsch and Betz, 1995). Further evidence for the role of gephyrin in glycine receptor clustering came from gene depletion studies using gephyrin antisense oligonucleotides which prevented the clustering of glycine receptors in cultured spinal cord neurones
39 (Kirsch et al., 1993). Binding of gephyrin to the glycine receptor complex was shown to be dependent on an 18 amino acid sequence in the glycine receptor p-subunit (Meyer et al., 1995). Interestingly, gephyrin aggregation at synaptic sites appears to precede that of glycine receptors suggesting that it may act to recruit glycine receptors to postsynaptic domains (Vannier and triller, 1997). Furthermore, the postsynaptic aggregation of glycine receptors is activity dependent and is blocked by the glycine receptor antagonist strychnine (Kirsch and Betz, 1998; Levi et al., 1998). Direct confirmation of the essential role of gephyrin in glycine receptor clustering has come from gene deletion. In the gephyrin knockout mouse all glycine receptor clustering is disrupted (Feng et al., 1998b).
A number of different isoforms of gephyrin exist due to alternative splicing, some of which show distinct spatial and developmental distribution patterns (Prior et al., 1992;
Ramming et al., 2000). Gephyrin is also expressed in non-neuronal tissues including lung, kidney and liver suggesting other roles for this protein (Prior et al., 1992). Further evidence for other roles for gephyrin come from it’s primary structure which shows striking homology with proteins involved in molybdenum co-factor (MoCo) biosynthesis
(Stallmeyer et al., 1999). MoCo forms the cataliticaly active centre of all molybdoenzymes except nitrogenase and is highly conserved in archaea, eubacteria and eukaryotes. Molybdoenzymes are essential for numerous metabolic processes including sulfur detoxification and purine catabolism in mammals, nitrate assimilation in autotrophs and phytohormone synthesis in plants. In Escherichia coli (E.coli) two proteins MogA and MoeA have an important role in MoCo biosynthesis. Cinnamon and Cnxl have been identified as Drosophila melanogaster and Arabidopsis homologs thaliana of MogA and
MoeA respectively, and are thought to have similar functions (Kamdar et al., 1997;
Stallmeyer., 1995). Interestingly, the only known mammalian homolog of MogA and
MoeA is gephyrin. Cinnamon, Cnxl and gephyrin all have the MogA and MoeA like domains in the same protein suggesting a gene fusion event (Schwarz et al., 1997;
40 Stallmeyer et al., 1999). The essential role of gephyrin in MoCo biosynthesis was also confirmed in the gephyrin knockout which has severe disruption in the function of a number of molybdoenzymes (Feng et al., 1998b).
Interestingly, a yeast two hybrid screen with the entire gephyrin molecule identified an association with two isoforms of a novel protein, collybistin (Kins et al.,
2000). The structure of collybistin suggests that it is a member of the DEL family of
GDP/GTP exchange factors (GEF) which activate the rho/rac family of small GTPases.
This suggests that gephyrin may be able to modulate the actin cytoskeleton via collybistin.
Gephyrin was also identified as a binding partner in a yeast two hybrid screen with the amino terminal portion of the rapamycin and FKBP12 target 1 (RAFT-1). RAFT-1 is the in vivo target for the complex of rapamycin with it’s intracellular receptor, FKBP12.
Rapamycin acts as a potent immunosupressant by preventing progression of the cell cycle through Gl. There is increasing evidence that RAFT-1 may be able to regulate mRNA translation by participating in mitogen activated signalling pathways (Sabatini et al.,
1999). This suggests that gephyrin via an association with RAFT-1 may be able to control local protein synthesis at inhibitory synapses.
1.19 Clustering of GABA^ receptors
GABA^ receptors are predominantly found clustered at inhibitory GABAergic synapses on the neuronal cell soma, along dendritic shafts and at the axon initial segment
(Macdonald and Olsen, 1994). The molecular mechanisms important for GABA^ receptor targeting and clustering are not completely understood. However, it has become clear that the glycine receptor clustering molecule gephyrin is also essential for GABA^^ receptor clustering. Gephyrin co-localises with GABA^ receptor clusters in many brain regions including spinal cord (Cabot et al., 1995), retina (Sassoe-Pognetto et al., 1995), olfactory bulb (Giustetto et al., 1998) and hippocampus, cortex and cerebellum (Sassoe-Pognetto et
41 al., 2000) as well as in cultured hippocampal neurones (Craig et al., 1996). This suggests that gephyrin may also be important for the formation of GABAergic synapses and that it may have a general role as an organising molecule at inhibitory synapses in the brain.
Further evidence for the essential role of gephyrin in clustering GABA^ receptors came from studies where it was found that depletion of gephyrin using antisense oligonucleotides resulted in a disruption of GABA^ receptor clustering in cultured hippocampal neurones (Essrich et al., 1998). Confirmation of the importance of gephyrin in anchoring GABA^ receptors at synaptic sites came from studies of cortical neurones cultured from the gephyrin knockout mouse. In these experiments it was found that neurones from wild type homozygous mice had an almost complete loss of GABA^ receptor clusters containing the a l and y2 subunits (Kneussel et al., 1999). Surprisingly however, a biochemical association between GABA^ receptors and gephyrin has not been demonstrated suggesting that other molecules may also be important for GABA^^ receptor clustering. There has therefore been an interest in identifying other potential GABA^ receptor associated proteins that may also play a role in GABA^ receptor anchoring. For example, it is possible that a bridging molecule may exist to link GABA^ receptors to gephyrin. Although immunoprécipitation studies have found a number of proteins to be associated with GABA^ receptors their identity is not known (Kannenberg et al., 1997).
The GABAa receptor associated protein (GABARAP) is a molecule that may be important for the synaptic anchoring of GABA^ receptors. GABARAP, a 17kDa polypeptide identified from a yeast two hybrid screen using the intracellular domain of the
GABA^ receptor y2 subunit, has been shown to associate with GABA^ receptors in vivo
(Wang et al., 1999). GABARAP has sequence similarity to the light chain 3 of microtubule-associated proteins (MAPs) 1A and IB and can bind microtubules suggesting it may anchor GABA^ receptors to the cytoskeleton (Wang et al., 1999; Wang and Olsen,
42 2000). It has also been suggested that GABARAP may serve as a linker molecule between
GABA;^ receptors and gephyrin (Passafaro and Sheng, 1999; Kneussel and Betz, 2000a).
Microtubules are thought to play an essential role in the organisation of
GABAergic postsynaptic specialisations largely because they have been found to associate with key components of these sites. GABA^ receptors were found to co-purify with tubulin (Item et al., 1994) and both gephyrin and GABARAP have tubulin binding properties (Kirsch et al., 1991; Wang et al., 1999; Wang and Olsen, 2000). Surprisingly however, a recent study reports that microtubules are not required for the clustering or synaptic localisation of either GABA^ receptors or gephyrin at steady state (Allison et al.,
2000). These results suggest that the microtubule binding properties of gephyrin and
GABARAP are not important for the maintenance of the inhibitory postsynaptic scaffold.
Furthermore, they imply that other mechanisms exist to maintain the clustering and anchoring of proteins at GABAergic postsynaptic domains. Gephyrin could be anchored to postsynaptic membranes via a putative myristolation site or via association with proteins such as profilin (Mamoto et al., 1998) and collybistin (Kins et al., 2000) that can both bind phophoinositides (Kneussel and Betz, 2000b). In contrast to the results of
Allison and Colleagues (Allison et al., 2000), a recent study has reported the importance of an intact aetin and microtubule cytoskeleton for GABA^ receptor function (Meyer et al., 2000). However in this study it was found that disrupting the cytoskeleton facilitated an agonist induced downregulation of receptor function.This suggests that actin and microtubules may be important for trafficking of GABA^ receptors and their endocytosis, however other mechanisms may be important for synaptic anchoring of receptors.
43 1.20 Synapse formation and ionotropic receptor clustering: general principles, different mechanisms
It is apparent from the sections described above that the majority of ionotropic receptor classes are specifically targeted and clustered at postsynaptic sites. However, the mechanisms important for these processes appear to be different for each class of receptor. In each case a scaffold molecule, such as rapsyn, PSD-95, GRIP, PICK and gephyrin have the ability to self associate and / or associate with the cytoskeleton providing potential mechanisms for both anchoring and clustering. Importantly these molecules can also recruit signalling proteins to postsynaptic receptors to form macromolecular signalling complexes (Sanes and Lichtman, 1999; Garner et al., 2000;
Braithwaite et al., 2000; Kneussel and betz, 2000a,b; Sheng and Pak, 2000). Although a number of key postsynaptic receptor scaffolds have been identified the molecular mechanisms important for the formation and maintenance of postsynaptic specialisations in the CNS are still unclear (Lee and Sheng, 2000).
In the case of GABA^ receptors gephyrin has been reported to be essential for
GABA a receptor clustering (Essrich et al., 1998; Kneussel et al., 1999). However, it is not known how gephyrin associates with GABA^ receptors. The recent evidence that GABA^ receptors and gephyrin can cluster at inhibitory postsynaptic domains in the absence of microtubules suggests that other mechanisms than cytoskeletal anchoring must also be important for the maintenance of GABAergic synapses (Allison et al., 2000). Other
GABA a receptor associated molecules such as GABARAP have been identified whose function with respect to GABA^^ receptor targeting are not yet clear (Wang et al., 1999).
Furthermore, the mechanisms by which specific GABA^^ receptor combinations are differentially targeted to distinct neuronal subdomains is also unclear. It is therefore likely that additional protein-protein interactions will be discovered that are important for the
44 regulation of cell surface trafficking, clustering, anchoring and removal of GABA^ receptors.
1.21 Receptor trafficking, protein-protein interactions and synaptic plasticity
It is clear from recent studies that receptor trafficking is likely to play a key role in neuronal plasticity (Luthi et al., 1999; Shi et al., 1999; Luscher et al., 1999; Hayashi et al.,
2000; Man et al., 2000; Linden and Wang, 2000; Malinow et al., 2000). Furthermore, mechanisms important for the trafficking of receptors are likely to be dependent on specific protein-protein interactions (Braithwaite et al., 1999; Garner et al., 2000; Hayashi et al., 2000; Osten et al., 2000).
Studies have reported LTP and LTD at GABAergic synapses in a number of brain regions (Gaillard, 1999a,b; reviewed in Kano, 1995). Furthermore, differences in postsynaptic receptor number have been found to determine GAB A mini amplitude
(Nusser et al., 1997) and potentiation at hippocampal inhibitory synapses (Nusser et al.,
1998a). This would suggests that processes important for GABA^ receptor trafficking, such as membrane insertion, anchoring and removal, could significantly modulate cell surface receptor number and underlie some forms of GABAergic LTP and LTD. These changes in the strength of GABAergic synaptic transmission could be important in modulating neuronal plasticity since this could have an important effect on the integrative properties and input-output relationship of a neurone (Linden et al., 1999). For example,
LTD of GABAergic inhibition has recently been shown to underlie the increased excitability of CAl neurones associated with LTP (Lu et al., 2000). An in depth understanding of GABA^ receptor trafficking and the protein-protein interactions important for this process is therefore an important goal essential for furthering our understanding of the molecular mechanism underlying neuronal plasticity.
45 1.22 Aims of this thesis
1) To construct a fusion protein between a GABA^^ receptor subunit and the green
fluorescent protein (GFP) and determine if this construct has similar properties to the
equivalent wild type receptor subunit. If this is the case, to use this construct to study
GABA^ receptor trafficking and membrane targeting.
2) To investigate if GABA^ receptor endocytosis occurs in neurones and if so, to
determine the mechanisms and functional consequences of receptor endocytosis.
3) To further investigate the role of the GABA^ receptor associated protein GABARAP
with respect to GABA^ receptor function and trafficking. To compare the distribution
of GABARAP with that of GABA^ receptors and the GABA^ receptor clustering
molecule gephyrin.
46 CHAPTER 2
All chemicals were purchased from Sigma unless otherwise stated, and all restriction enzymes were purchased from New England Biolabs. All tissue culture reagents, unless otherwise stated, were from GibcoBRL Lifetechnologies. Oligonucleotides were synthesised by Cruachem, and Gibco. Radionucleotides were purchased from Amersham.
2.1.0 Molecular Biology
Most of the techniques described can be found in Sambrook et al. (1989).
2.1.1 DNA constructs
Murine al, P2, yS and yl. subunit cDNAs were expressed from the mammalian expression vector pGWl (McDonald et al., 1998). The y2L and y2S subunits differ by the presence of 8 amino acids within the major intracellular domain of this subunit
(Macdonald and Olsen 1994; Rabow et al., 1995). The subunits were tagged with 9E10 epitope (EQKLISEEDL) between amino acids 4 and 5 as described previously (Connolly et al., 1996a).
2.1.2 Bacterial strains
Subcloning and PGR were performed using the E .C o li strains XLlBlue (F’;:Tn 10 proA+B+laclq A (lacZ)M15/recAl end gyM96(Naf) Al thi hsdRl 7(rK-mK+) supE44 rel
1 lac.
Production of GST-fusion proteins was performed using the E.Coli strain BL21 (F-ompT
[Ion}hsdSB{ï'Q- m g - an E .C oli B strain) with DE3, a prophage carrying the T7 RNA polymerase gene (Studier, et al., 1990).
47 2.1.3 Growth media and agar plates
Bacteria were grown in Luria-Bertani medium (LB). For plasmids encoding Ampicilin resistance, Ampicilin was added to a concentration of lOOpg/ml. For growth of BL21 bacteria, chloramphenicol was added to a concentration of 30|Xg/ml.
For plates, agar was added to 15g/l. All growth was carried out at 37 °C.
2.1.4 Preparation of electrocompetent bacterial cells.
Cells were streaked onto an LB agar plate without antibiotics. A single colony was then used to inoculate 10 mis of LB which was then incubated at 37 °C overnight. The overnight culture was then added to 1 litre of LB and grown to an absorbance at OD^ qo of
0.6. The bacteria were spun down at 4000 rpm for lOmins and then washed in 500mls sterile ice-cold water. The bacteria were again spun down, washed in 25mls ice-cold glycerol, spun down again and finally resuspended in 2.5ml 10% glycerol. Aliquots of lOOpl were stored at -8 0 °C.
2.1.5 Transformation of bacteria with plasmid DNA
20]i\ of electrocompetent bacteria with the DNA of interest were added to a 0.2cm electroporation cuvette kept on ice. A Biorad genepulser was then used to give a single pulse with the settings of 2.5KV, 200Q and 25pF. Following this the bacteria were resuspended in 500 pi of LB and incubated at 37 °C for 1 hour before plating onto LB- agar plates containing the appropriate antibiotics and incubating overnight at 37 °C.
48 2.1.6 Ethanol precipitation of DNA
To precipitate DNA from an aqueous solution, 0.1 volumes of 3M Sodium Acetate pH 5.2 was added to the solution followed by two volumes of 100 % ethanol. After incubation of the solution at -20 °C for at least lOmins followed by centrifugation at 13,000 rpm for
10 mins, the DNA pellet was washed with 70% ethanol and dried at room temperature for
10 mins. For the precipitation of small amounts of DNA, such as ligations, Ipl of glycogen (1 mg/ml) was added before addition of Sodium Acetate and ethanol.
2.1.7 Phenol/chloroform extraction
A 1:1 mixture of Phenol and Chloroform equilibrated with Tris pH 8.0,
Phenol/Chloroform (p/c), was obtained from Camlabs. Extraction of DNA samples in a volume of 50-500pl was earried out by vortexing with an equal volume of p/c in a microfuge tube followed by centifugation at full speed for 5 min. The aqueous phase was then transferred to a new microfuge tube and the process repeated followed by a final extraction with chloroform to remove any traees of phenol. Finally the DNA in the aqueous phase was precipitated with ethanol.
2.1.8 Agarose gel electrophoresis of DNA
See Sambrook et al. (1989) chapter 6.
Briefly, 1% agarose gels were prepared by disolving agarose in IxTAE by heating in a microwave. After cooling , ethidium bromide was added to the solution to a concentration of lOOng/ml and the gel poored. lOx loading buffer consisting of 0.25% bromophenol blue, 0.25% xylene cyanol FF andl5% Ficoll-400 was added to samples prior to loading on gel and DNA was resolved at 100 Volts. Finally, DNA was visualized by placing the gel on a UV transilluminator.
49 2.1.9 Preparation of restriction digested vector DNA, plasmid inserts and PCR products lOpg of plasmid DNA or 20pl of PCR product was digested in a final volume of a lOOpl with 5pi each of the appropriate restriction enzyme(s) and lOpl buffer at 37 °C for 2 hours or overnight. In the case of single digests of vector DNA self-ligation of the vector was inhibited by adding Ipl of shrimp alkaline phosphatase (Amersham) to the reaction mixture after digestion followed by a further incubation at 37 °C for 30 min. Digested
DNA was purified by agarose gel electrophoresis followed by extraction of the band from the agarose gel using glass milk (gene clean).
2.1.10 Purification of restriction digested vector DNA, plasmid inserts and PCR products
Restriction digested DNA was purified by resolving it by agarose gel electrophoresis. The appropriate band was then cut out using a clean scalpel blade and purified using the
GeneClean kit (BIOlOl) following the manufacturer’s instructions.
2.1.11 Polymerase Chain Reaction (PCR)
PCR was carried using Taq polymerase (Promega) in a final concentration of: Ix the appropriate buffer supplied by the manufacturer, 0.25 mM dNTPs and IpM forward and reverse primers . Amplification was caned out with 30 cycles of: dénaturation at 94 °C for
30s, annealing at 52-56 °C (depending on the primer melting temperature) for 45s and extension at 72 °C for 1 to 2 mins (depending on length of expected product).
50 2.1.12 List of oligonucleotides used for PCR, mutagenesis and sequencing
Oligonucleotides used for constructing G A B receptor y2L subunit OFF receptor fusion
EOF? PCR amplification primers
Forward primer
CTCGAGATGGTGAGCAAGGGC
Reverse primer
CTCGAGCTTGTACAGCTCGTC
Mutagenesis primer (to introduce Xho I site into pRK5 Y2L)
GATATTAGTTTTTGTTCCTCCGAGATCTGACTTTTGG
Primers used for constructing the FLAG tagged GABARAP expression construct
Forward primer
CTCGGATCCAAGTTCGTGTACAAAG
Reverse primer
GGGGAGTCTTCACAGACCGTAGAC
2.1.13 Ligations.
A rough estimate of the relative concentrations of vector and insert was made based on the intensity of bands on an agarose gel. Three different insert:vector ratios were used; approximately 2:1, 5:1 and 10:1. A control with no insert was also carried out. The reaction mixture was as follows:
51 vector
insert
Ipl lOmM ATP (pH 7.5)
Ipl NEB T4 DNA Ligase Buffer
Ipl NEB T4 DNA Ligase
H2O to a final volume of lOpl
The reaction mixture was then incubated overnight at 16 °C. Following incubation, Ipl glycogen was added and the reaction mix ethanol precipitated. The pellet was then resuspended in lOpl water, and this was electroporated into XLlBlue bacteria as described. Mini-Preps (see next section) were carried out if an enhancement of more than two-fold from the control was seen from the numbers of colonies on the plates.
Mini-Preps were screened for successful ligation by restriction digestion, using the same enzymes which were used to prepare the fragments before ligation.
Plasmids containing inserts were sequenced to verify the correct insertion of the ligation product and in the case of PCR inserts for fidelity of the amplification.
2.1.14 Mini-preparation of plasmid DNA (mini-preps)
Alkaline lysis method
5ml of bacterial culture was centrifuged at 3500rpm for 5min in a bench-top centrifuge.
The medium was removed and the bacteria resuspended in lOOpl of solution I. To this was added 200pl solution II (made fresh on the day of use), and mixed by inverting several times. After 5min, 150pl solution III was added. After mixing (not vortexing), and leaving on ice for lOmin, the tubes were centrifuged at full speed in a bench-top microfuge for lOmin. The supernatant was then removed to a fresh tube, and ethanol
52 precipitated, followed by centrifugation at full speed for lOmin. The pellet was washed in
1ml 70% ethanol, dried, and resuspended in 50pl water to which 1 |al RNAse was added.
2.1.15 DNA sequencing
This was carried out using the United States Biochemical sequencing kit.
5pl of the mini prep was added to Ipl IM NaOH and Ipl sequencing primer (21ng/pl). This was incubated at 70^C for lOmin, and then allowed to cool slowly to 30®C. 4pl TDMN was added and left on ice before proceeding with the labelling reaction of the USB protocol.
TDMN; 3.2g TES, 0.5ml chloroform, 0.386g DTT, 4ml IM MgCl2, 2ml 5M NaCl, ->50ml water
2.1.16 Maxi-preparation of plasmid DNA by caesium chloride banding
This was carried out as described in Sambrook et al (1989) pages 1.38-1.39 & 1.42-1.46.
I litre of bacterial culture in LB ampicillin grown overnight at 37®C was centrifuged at
4,000 rpm for 15 mins. This was resuspended in 10ml Solution I, to which 20ml Solution
II was added and mixed well. 15ml Solution III was added and left on ice for 5min. This was centrifuged for lOmin at 4,000 rpm. To the supernatant was added an equal volume of isopropanol, followed by centrifugation for lOmin at 4,000 rpm. The pellet was resuspended in 6ml lOX TE to which was added 6 g CsCl and lOOpl lOmg/ml Ethidium
Bromide. This was centrifuged at 100,000 rpm overnight in a Beckman TEN 100 ultracentrifuge rotor. DNA bands were pulled using a 5ml syringe and wide-bore
53 hypodermic needle and the ethidium bromide removed by butanol extraction with water saturated butanol a sufficient number of times to remove all Ethidium Bromide colouring.
The DNA was precipitated by adding 2 volumes of ethanol and centrifuged at 4,000rpm for 5min. The DNA pellet was then resuspended in 1ml I OX TE followed by 2X phenol/chloroform extraction and IX chloroform extraction. The DNA was again precipitated by adding 2 volumes of ethanol and centrifuged at 4,000rpm for 5min. and finally resuspended in TE to a concentration of 1 mg/ml. The DNA concentration was determined by reading the absorbance at 260nm.
2.2.0 Cell Biology
2.2.1 Antibodies
The anti-myc (9E10) antibody was obtained from 9E10 hybridoma cells (Connolly et al.,
1996a) and used directly as supernatant (10 |Llg/ml) or purified on immobilized protein A.
Anti-GFP and anti-GABA^ receptor p2/(33 subunit mouse monoclonals were obtained from Roche Molecular Biochemicals and used at 1 (ig/ml and 10 |ig/ml, respectively. The rabbit anti-y2 antibody was raised against a 15 amino acid peptide from the amino terminus of y2 (Benke et al., 1994) and used at 5 |ig /ml. The rabbit anti-al subunit was raised to an N-terminal peptide (Gorrie et al., 1997) and used at 5 p,g/ml. The rabbit anti- glutamic acid decarboxylase (GAD) antibody was from Chemicon and used at 1:200.
Guinea Pig anti-GABA^ receptor y2 subunit antibody (Benke et al., 1994), rabbit anti-
GABARAP antibody (Wang et al., 1999), Anti a and p-adaptin antibodies (Sigma), rabbit anti-synaptophysin antibody and mouse anti-gephyrin antibody Mab7a (Chemicon) were used for immunofluorescence at 1:100. The Anti pl/3 was used for immunofluorescence at 10 |ig/ml (McDonald et al., 1998). Anti-NSF mouse monoclonal (2E5) and anti- synaptophysin mouse monoclonal (Chemicon) were used for immunofluorescence at
54 10|Lig/ml. Secondary antibodies were from Molecular Probes and Jackson and used at
1:400.
2.2.2 Cell line culture
COS cells and Human embryonic kidney cells were most routinely used for transiently expressing proteins of interest. They were grown at 37°C with 5% CÜ2 in Dulbeco's
Modified Eagle Medium (DMEM) supplemented with 1 mM Glutamine and 10% Foetal
Calf Serum.
2.2.3 Transient transfection of A293 & COS cells
Two dishes, seeded at 2X10^ cells/10-cm dish, of exponentially growing cells at 30-50% confluence were used per transfection. Cells were trypsinised from the dish and washed once in 50ml DMEM. After centrifugation at l,000rpm for 2min, the cells were washed once in 10ml Optimem (Gibeo), and then resuspended in 0.5ml optimem. Cells were transfected by electroporation (400 V, infinity resistance, 125-|xF Bio-Rad Gene
Electropulser II) with 10 |ig of DNA using equimolar ratios of expression constructs
(Connolly et al., 1996a). Cells were used 18-36 h after transfection. For immunofluorescence studies cells were plated onto poly-L-lysine/fibronectin (10 p.g/ml)- coated coverslips and analyzed 18-36 h after transfection.
2.2.4 Culture and microinjection of low density hippocampal cultures
Low density cultures of hippocampal neurones were prepared as described previously
(Goslin and Banker, 1991) on poly-L-lysine eoated (1 mg/ml) glass coverslips over a glial feeder layer. Briefly, from embryonic day 18 (E l8) rats hippocampi were disseeted in IX hepes buffered (10 mM) HBSS under a dissecting microscope. Hippocampi were trypsinised for 15 min in IXHBSS with 0.25% trypsin followed by 3X 5 min washes in
55 IX HBSS. After the final wash, hippocampi were triturated in 1ml IX HBSS with 2 fire polished pasteur pipettes (5 passes each), the second pipette having a 60-70% diameter of the first. The number of live cells was then counted in trypan blue and cells were plated on polylysine treated (1 mg/ml) coverslips with parafin legs at a density of 2600-10000 cells cm^ in attachment medium. After allowing the cells to attach for 4 hours or overnight coverslips were tranferred upside down to dishes of conditioned maintenance medium over a glial feeder layer. Half the medium was changed every 7 days. For electrophysiological recordings (performed by Dr Patrick Delmas) cells were prepared as above and plate on polylysine treated (0.05 mg/ml) 3 cm dishes at a density of 30 000-50
000 cells per cm^. Half the medium was changed every 7 days and cells were used after
14-21 days in culture.
Neurones were microinjected after 14-18 days in culture with a final pipette concentration of 0.05 jig/jLil DNA dissolved in IX phosphate buffered saline using equimolar ratios of expression constructs. DNA (1.2 pi) was loaded into pre-pulled high resistance (-30 megaohm) "Pyrex" glass pipettes and injected into the nucleus of single neurones as described previously (Couve et al., 1998). After injections, cells were incubated for 24h in a humidified incubator (5% CO^) at 37 °C.
2.2.5 Immunofluorescence microscopy and quantitation of co-localisation
Cultured hippocampal neurones or A293 cells were fixed in 4% paraformaldehyde and then blocked in phosphate buffered saline (PBS) containing 10% fetal bovine serum and
0.5% bovine serum albumin. Where appropriate, cells were permeabilised with 0.2%
Triton X-100 for 10 min in blocking solution. Subsequent antibody dilutions were
56 performed in blocking solution and washes were in PBS. When antibody internalisation assays were performed with A293 cells, living cells were incubated with 9E10 (50 |Lig /ml) for 1 h on ice in DMEM supplemented with 25 mM HEPES and 0.5% bovine serum albumin, pH7.4 (Connolly et al., 1999b). Excess antibody was removed, and internalization was performed at 37 °C. For cultured hippocampal neurones receptors were labelled at 37 °C with EDI7 (25 fig/ml) in culture medium. Coverslips were examined using a confocal microscope (MRCIOOO, Bio-Rad) with excitation at 488 nm for GPP, 568 nm for Texas red and 647 nm for Cy5 conjugated secondary antibodies. For quantitation of colocalisation, images were stored digitally and analysed using the Bio-
Rad confocal software. Images were background subtracted to a user defined threshold to select immunoreactive punctae. The number of fluorescenct punctae for each fluorescent signal were counted on a 150-200 p,m of randomly chosen dendrites per cell and the number of overlapping punctae of the two fluorescent signals was counted to determine the extent of colocalization of the two immunoreactive punctae.
2.2.6 Live cell confocal microscopy
Live cell microscopy was performed using an inverted MRC 600 laser scanning microscope (Bio-Rad) with a 60 X 1.4 NA oil immersion lens 1.5 X zoom and single line excitation (488nm). A293 cells were transfected with the combinations of expression constructs described in the text and plated onto poly-L-lysine (lOpg/ml)-coated 22 mm coverslips. These coverslips were sealed with parafin to 6 cm dishes that were machined to contain a 15 mm hole in the centre of the dish. The cells were maintained in DMEM supplemented with 25 mM HEPES and 0.5% bovine serum albumin, pH7.4 while on the microscope stage.
57 2.3.0 Biochemistry
2.3.1 Sodium Dodecyl Sulphate Polyacrylamide Gel Electrophoresis (SDS-PAGE)
3X SDS PAGE sample buffer (80mM Tris-HCl pH6.8, lOOmM DTT, 10% glycerol,
2%SDS and 0.1 % bromophenol blue) was added to samples before loading.
Separating gels were made up as follows:
Tris-HCl pH 8.8 1.5M7.5 ml
W ater 4- PROTOGEL (National Diagnostics) 26.6ml
(relative amounts of water and acrylamide depended upon the size of proteins to be resolved)
10% SDS 0.3 ml
25% Ammonium Persulphate 0.3 ml
N,N,N’,N’-tetramethyl-ethylene diamine (TEMED) 12pl
Stacking gels were made up as follows:
Tris-HCl pH 6.8 0.625M 2 ml
Water 6 ml
PROTOGEL 1.66 ml
SDS 10% lOOpl
25% Ammonium Persulphate lOOpl
TEMED lOpl
Gels were run in IX PAGE Buffer until the dye front reached the bottom of the gel. If proteins were to be visualised directly, they were fixed and stained with 1% Coomassie
Blue in 10% acetic acid/20% methanol and destained in 10% acetic acid/20% methanol. If
58 proteins were to be visualised by western blotting, proteins in the PAGE gel were transfrred to a nitrocellulose membrane as described below.
2.3.2 Transfer of PAGE gels
The SDS-PAGE gel was placed against a pre-wetted Hybond nitrocellulose membrane
(Amersham) with three pieces of Whatman 3mm filter paper on each side, and the completed "sandwich" placed in a BioRad transfer apparatus cassette. This procedure was carried out with all components submerged in transfer buffer. Transfer was carried out in a BioRad transfer apparatus with IX Transfer Buffer at 400mA for 2h. After transfer the filter was stained using 0.1% Ponceau S in 5% acetic acid, and the positions of protein lanes and molecular weight markers marked with a ball-point pen. Excess Ponceau S was washed away with water.
2.3.3 Western blotting
Following transfer the filter was blocked with 4% marvel milk in 0.05% Tween-20 in
PBS for 1 h. Antibodies were diluted to the appropriate concentration in blocking buffer and applied to the filter in a sealed plastic bag for Ih with vigorous shaking. Excess antibody was washed off with 4% marvel milk and 0.05% Tween-20 in PBS (5X 5 min).
Secondary antibodies were conjugated to Horseradish Peroxidase and washed off with 4% marvel milk in 0.05% Tween-20 in PBS (4 X 10 min) followed by 2X 5 min with 0.05%
Tween-20 in PBS. HRP conjugated anti-mouse and anti-rabbit secondary antibodies for
Western blotting were from Jackson and used at 1:5000 and detected by application of
Super Signal Chemiluminescent substrate (Pierce).
59 2.3.4 GST-Fusion protein production
BL21 bacteria were transformed with pGEX constructs and plated onto LB Agar plates containing Ampicillin and Chloramphenicol. A 10ml LB Amp/Chlor culture was grown overnight at 37®C, and added to 11 LB Amp the following morning. This was allowed to grow to an OD A600 of 0.5-0.7 (approx. 2.5 hours), after which isopropylthio-p-D- galactoside (IPTG) was added to a final concentration of 0.5mM. Induction was carried out at room temperature, and allowed to continue for 3-4h. The bacteria were centrifuged at 4,000 rpm, the pellet was then washed in 10ml buffer A, centrifuged again and the pellet was generally left overnight at -20^C at this stage. The following day the pellet was resuspended in 10ml IX TE containing lOOpM phenylmethylsulfonyl fluoride (PMSF) and 1 jLig/ml each of antipain, leupeptin and pepstatin. Triton-X 100 was added to 1% and the mixture was sonicated at full power for 3 X 30s followed by addition of 25ml Buffer
C -I- PMSF + and the mixture centrifuged at 30,000 rpm for 30min. To the supernatant was added 1ml of pre-swollen glutathione-Agarose beads, and the mixture left at 4®C rotating for 2h (Glutathione-Agarose beads were pre-swollen in water for 30min, and then washed three times in Buffer C before use). After affinity-purification, the beads were washed four times with Buffer C + PMSF. Finally, the pellet of glutathione-agarose beads was resuspended in 1ml of buffer C and antipain, leupeptin and pepstatin were added to 10 pg/ml. Recombinant myc-tagged NSF was a kind gift of Dr Gianpietro Schiavo (ICRF-
London, UK) and purified as described previously (Sollner et al., 1993).
2.3.5 Affinity-purification ("pull-down”) assays
GST-fusion proteins were synthesised as described above, and were left bound to the glutathione agarose beads. Brain lysate was made by homogenising the tissue in a Down's
60 Homogeniser in 20mM HEPES pH 7.5, 150mM NaCl, ImM EDTA, 2 mM EGTA, 1%
Triton X-100, plus protease inhibitors PMSF, leupeptin, antipain, pepstatin (10 |ig/ml).
This was then centrifuged at 50,000 rpm for 30min at 4°C. The supernatant was incubated with the GST-fusion proteins bound to beads rotating for 2h at 4 °C. 50pg fusion protein was used per assay and 5mg of brain lysate. After incubation, the beads were washed four times with 1ml ice-cold lysis buffer, and resuspended in 50pl 2X SDS-PAGE sample buffer. Proteins were separated by SDS-PAGE and detected by western blotting.
2.3.6 Immunoprécipitation from brain extract
Brain lysate was prepared as above. After centrifugation, the lysate was precleared with
50pl of a 1:1 slurry of protein A beads (Pharmacia Biotech) in lysis buffer with 50pg rabbit non-immune IgG (Pierce) for Ih at 4®C, rotating on a wheel. The beads were removed by centrifugation, and to the supernatant was added a further 50pl protein A (for polyclonal antibodies) or protein G (for monoclonal antibodies) slurry plus the antibody of interest. Immunoprécipitations were carried out using 5-10 pg of antibody or an equivalent amount of IgG control. This was incubated at 4®C for 4h on a rotating wheel.
The beads were then washed four times with 1ml ice-cold lysis buffer, and resuspended in
50pl 3X SDS-PAGE sample buffer. Proteins were separated by SDS-PAGE and detected by western blotting.
2.3.7 Immunoprécipitation from transfected cells.
COS cells were transfected with the appropriate expression constructs and left to express overnight. The medium was removed from the cells, and they were washed in IX PBS.
Cell lysate was collected in IP buffer (50mM TrispH 7.6, 150mM NaCl, 50mM NaF, lOmM Na Pyrophosphate, ImM Na Orthovanadate, 5mM EGTA, 5mM EDTA, 1% triton
61 X I00, ImM PMSF, lOjig/ml Leupeptin, Antipain, and Pepstatin) and the nuclei removed by centrifugation at full speed in a bench-top microfuge for 15min. To the supernatant was added 50p,l protein A or protein G sepharose slurry along with 5-10)ig of antibody.
This was incubated for 2h on a rotating wheel at 4°C. The beads were washed 3X with IP buffer. The beads were resuspended in 50|il 2X SDS-PAGE sample buffer and proteins were separated by SDS-PAGE and detected by western blotting.
2.3.8 lodinated antibody binding
Affinity-purified 9E10 antibody was iodinated to a specific activity of 500Ci/mmol using
Bolton and Hunter Reagent according to the manufacturer’s instructions (Amersham
Pharmacia Biotech). The iodinated antibody was titrated on (33^^’°-transfected A293 cells and used at saturating concentration (lOnM) for surface binding. The affinity of the antibody for (33^^'° subunit was determined to be 0.5nM by Scatchard analysis as determined previously (Connolly et al., 1999b). Surface binding was performed by preincubation in binding medium (DMEM without bicarbonate, using 25mM HEPES and
0.5% bovine serum albumin, pH 7.4) for 1 h on ice, followed by incubation with iodinated antibody for 1.5 h on ice. Cells were washed five times in binding medium, trypsinized, and quantified by counting y emissions. Nonspecific binding was determined using mock transfected cells.
2.4.0 Commonly Used Buffers
TAE (Tris-Acetate EDTA) 40mM Tris-acetate
ImM EDTA (pH 8.0)
TBE (Tris-Borate EDTA) 90mM Tris-borate
62 2mM EDTA
TE (Tris EDTA) usually pH 7.6 lOmM Tris.HCl (pH 7.6)
ImM EDTA (pH 8.0)
SDS-PAGE buffer (Sodium Dodecyl Sulphate
Polyacrylamide Gel Electrophoresis Buffer) 25mM Tris
250mM glycine (pH 8.3)
0.1% SDS
Western Blotting Transfer Buffer 50mM Tris
380mM glycine
0.1% SDS
20% methanol
Solution I (For mini-preparation of plasmid DNA) 50mM glucose
25mM Tris pH 8.0
lOmM EDTA
Solution II 1% SDS
200mM NaOH
Solution III 5M potassium acetate (made
by adding 29ml glacial acetic
63 acid to 50ml H2O and, on
ice, adding lOM KOH to pH 4.8)
Buffer A(For GST fusion protein purification) 50mM Tris pH 8.0
25% sucrose
lOmM EDTA
Buffer B lOmM Tris pH 7.6
ImM EDTA
Buffer C 20mM HEPES pH 7.6
lOOmM KCl
ImM EDTA
20% glycerol
5mM DTT (Dithiothreotol)
Phosphate Buffer pH 7.6 84.5mM Na2HP04
15.5mM NaH2P04
64 CHAPTER 3
3.1 Introduction
As discussed in the introduction, the large number of GABA^ receptor subtypes provides the potential for considerable structural diversity. However, biochemical and immunological analysis of neuronal receptors has revealed the existence of receptors containing only a limited number of subunit combinations. There must therefore be mechanisms to control subunit oligomerisation allowing only certain subunit combinations to form. Furthermore, GABA^ receptors are clustered and anchored at specific postsynaptic sites within the neurone. These processes as well as the mechanisms important for the cell surface targeting of GABA^ receptors are essential for the correct function of inhibitory synaptic transmission (Essrich et al., 1998; Crestani et al., 1999).
However, the molecular mechanisms that govern the assembly, cell surface sorting, postsynaptic membrane insertion and anchoring of these channels are still poorly understood. To gain further insight into these processes it would be useful to be able to study receptor assembly and clustering in live cells. This is particularly important because it has been shown that the levels of GABA^ receptors can be regulated by a number of processes including kinase activation and kindling (Barnes, 1996; Connolly et al., 1999b;
Nusser et al., 1997). Shi et al., recently used fusion proteins of GPP and the GluRl subunit of AMPA type glutamate receptors to study the translocation of these receptors into spines upon induction of LTP (Shi et al., 1999). Numerous other groups have also used GPP fusions to study receptor processes (Carter and Sorkin, 1998; Doherty et al.,
1999; David-Watine et al., 1999).
To date the study of GABA^ receptor assembly (Connolly et al., 1996a; Gorrie et al., 1997, Taylor et al., 1999, 2000), targeting (Connolly et al., 1996b) and endocytosis
(Connolly et al., 1999a,b) in mammalian cell lines and neurones has been limited to antibody labelling methodologies. However these methodologies are not adequate for
65 visualising receptors in live cells and cannot be used to label intracellular receptors in non-permeabilised cells. Furthermore, fixation and sample preparation for light microscopy can lead to re-distribution of proteins and changes in the morphology of endosomal compartments (Carter and Sorkin, 1998). In addition to this, although antibody feeding can be used to study receptor internalisation, a number of limitations to this approach can arise including non-stoichiometric labelling of receptors, partial dissociation of antibody-receptor complexes in acidic organelles and sorting of antibody and receptor to different compartments (Carter and Sorkin, 1998; Connolly et al., 1999a). GPP from the jelly fishAequoria victoria has been used as a fluorescent reporter molecule in the localisation of an increasing number of proteins (Tsien, 1998). Importantly, the fusion of
GPP to the receptor allows the study of receptor localisation and surface stability to be investigated in live cells. To facilitate the study of GABA^ receptor assembly, membrane targeting and trafficking, y2 subunit green fluorescent protein (GPP) fusion proteins were constructed that contain GPP either at the amino or carboxyl terminus.
GABA^ receptors comprise several receptor subunit classes the majority of which contain multiple members. It is however, generally believed that the majority of receptors in the CNS contain at least an a, (3 and y subunit (Macdonald and Olsen, 1994; Rabow,
1995). Of these subunit classes, they2 subunit is important in multiple aspects of GABA^ receptor function and therefore appeared to be a particularly good candidate for tagging with GPP. Firstly, although production of GABA-gated channels is achieved upon expression of receptor a and (3 subunits, the co-expression of a y subunit isoform confers benzodiazepine sensitivity (Gunther et al., 1995). The GABA^ receptor y2 subunit is also the major site of tyrosine phosphorylation of GABA^ receptors (Moss et al., 1995).
Importantly, the GABA^ receptor y2 subunit has also been shown to be essential for the cell surface targeting and postsynaptic clustering of major GABA^^ subtypes in vivo
(Essrich et al., 1998). The intracellular loop of the y2 subunit is also essential for the
66 interaction with the cytoskeletal linker molecule GABARAP, a small 17 kDa microtubule binding molecule that may be important for receptor anchoring (Wang et al., 1999).
Finally, the protein kinase C mediated internalisation of GABA^ receptors has been found to be dependent on the presence of a yZ subunit (Connolly 1999b). It is therefore clear that the y2 subunit plays a key role in GABA^ receptor function and would be a good candidate subunit to use to make a fluorescent GABA^ receptor subunit GFP fusion protein.
Alternative splicing generates 2 forms of the y2 subunit, y2L and y2S that differ by the presence ^f^^m ino acids in y2L (Whiting et al., 1990; Kofuji et al., 1991). Recently it has been shown that these two subunits differ in their ability to access the cell surface.
Whereas the y2S subunit is able to access the cell surface as a non-functional monomer, the y2L subunit can only access the cell surface when co-expressed with an a and p subunit (Connolly et al 1996a, 1999a). It was therefore decided to make GFP fusion proteins of the y2L subunit. This would ensure that when co-expressed with an a and p subunit any y2LGFP cell surface fluorescence would be representative of fully oligomerised receptors containing a, p and y2L subunits.
Addition of the green fluorescent protein to the y2L subunit would result in an increase in 30 kDa to the molecular weight of this subunit polypeptide. This could in theory affect the folding, subunit assembly and / or function of the subunit. It is also possible that fusing the two polypeptides could have a negative influence on the fluorescence of GFP.
Experiments were carried out to determine a number of the criteria listed below that would be essential for the use of the y2L subunit GFP fusion proteins.
Specifically that:
67 1) the expressed y2L subunit GFP fusion proteins were of the correct size and that the
GFP moiety was not subject to proteolysis
2) the fusion proteins produced a green fluorescent signal.
3) upon heterologous expression the subunit could be correctly targeted to cell surface in
a similar fashion to the wild type subunit and that it behaved similarly to the wild type
subunit with respect to it’s cell biology.
4) cell surface receptors containing y2L subunit GFP fusion proteins were functional and
had a similar pharmacology to wild type receptors.
5) the y2L subunit GFP fusion proteins could be introduced into neurones and targeted to
inhibitory postsynaptic sites at the cell surface.
The expression, assembly and function of GABA^ receptors containing the y2L subunit GFP amino and carboxyl terminal fusion proteins was tested in A293 cells using both biochemical and immunocytochemical techniques. The correct function of these channels was also tested in A293 cells using electrophysiological methodologies. Finally, to study the expression and synaptic targeting of these constructs in neurones they were introduced into cultured hippocampal neurones by nuclear microinjection.
68 3.2 Expression of72 -GFP inserted at either the amino or carboxyl terminus
To construct GFP fusion proteins of the y2L subunit, it was necessary to determine
the best region in which to attach/insert the GFP moiety. GABA^ receptors contain
extracellular amino and carboxyl termini and a large intracellular loop. In theory, it would
be possible to introduce the GFP coding region into the intracellular loop however this
could disrupt putative interactions between this region and receptor associated proteins.
This would be particularly problematic for studying clustering and anchoring of receptors
since it is thought that receptor associated interactions may be important for attachment to
the cytoskeleton (Wang et al., 1999). To avoid this, GFP was added to the extracellular
regions. The yZL subunit has a particularly short extracellular carboxyl terminus. It was
therefore possible that addition of GFP to the carboxyl terminus may affect assembly or
folding due to the resultant close proximity of GFP to the membrane. For this reason, an
amino terminus yZL GFP fusion protein was constructed.
Because the y2L subunit is a transmembrane protein that contains a signal
sequence that is cleaved to form the mature polypeptide it was necessary to insert GFP
after this region. An amino terminus y2L GFP fusion protein was constructed by inserting
EGFP between amino acids 4 and 5 of the mature (minus the signal sequence) y2L
subunit. This construct was termed y2L-GFPN (Fig. 2A) and also incorporated a myc
(9E10) epitope tag directly after the GFP (Fig. 2A). To construct y2L-GFPN, an Xho I
site was introduced between amino acid 4 of y2L and the first amino acid of the myc
(9E10) tag by site directed mutagenesis. GFP was amplified by polymerase chain reaction
(PCR) using primers containing flanking Xho I sites and ligated into the Xho I site of
Y2L to produce y2 L-GFPN. A carboxyl terminus y2L GFP fusion protein (termed y2L -
GFPC) was provided by Dr Jianfeng Wang (Fig. 2A) and the properties of this construct
were compared to those of the y 2 L-GFPN. To construct 2Iy-
69 GFPC, t2L was amplified by PCR and cloned as a BamHl/Spel fragment into peGFPC-
N1 (Cion tech).
The expression of y2L -GFPN and y2L -GFPC in A293 cells was examined using
SDS-polyacrylamide gel electrophoresis followed by western blotting. Since the y2L subunit GFP fusion proteins contained GFP it should be possible to detect expression of these fusion proteins with an anti-GFP antibody as well as with an anti- y2L subunit antibody. In addition, because y2 L-GFPN also contains a myc (9E10) tag, it should be possible to detect expression of this protein using anti myc (9E10) antibody. Using an antibody to GFP a broad band (75-80kDa) of the expected molecular weight could clearly be detected in cells transfected with yZL -GFPN, but not in untransfected cells (Fig. 2B).
The expression of y2L-GFPN was also compared to cells transfected with myc (9E10) tagged wild type y2L subunit (Connoly et al., 1996) using a mouse anti-myc antibody and an antibody raised to the amino terminus of y2L (Fig. 2C). Wild type receptor could be detected as a broad band between 45 and 50 kDa and y2L -GFPN could be detected as a broad band between 75 and 80kDa. That both myc (9E10) tagged y2L and y2L -GFPN appeared as broad bands may be due to proteolysis, a common observation for this subunit (Moss et al., 1992; Connoly et al., 1996a,b). Importantly the y2L -GFPN chimera expressed at similar levels to the wild type myc (9E10) tagged receptor (Fig. 2B,C).
Surprisingly, in cells transfected with y2L -GFPC only a faint band could be detected at 80kDa (see arrow Fig. 2B) with a prominent doublet at 30kDa which is the expected molecular weight of GFP alone. This would suggest that although insertion of
GFP at the C-terminus of the y2L subunit produces a full length chimera, in the majority of the y2L -GFPC polypeptides GFP appears to be proteolysed. Furthermore, it was very difficult to detect y2L -GFPC using the anti y2L subunit antibody suggesting that this
70 Y2L- (ÎKPN s.sT em — MBA^Lin ya
y2L- (;KPt Ssc ôSSâ^^nTr C _ _r _
B C anti-GFP anti-y; anti-9E10 ^ - 9 7 — 97
_ 6 6 i 66 e •
ut y2LI y2L- ut •y2L y2L- (;FPN GFPN
— 31 Y2L y2L- y2L- ut GFPN GFPC'
Figure 2: Expression of y2L -GFP fusion proteins in mammalian cells. A, Schematic representation of GFP inserted at the amino terminus (y 2L-GFPN), 4 amino acids upstream of the signal sequence (s.s.). The transmembrane domains are represented by black bars. In y2L -GFPN, GFP is followed by a myc (9E10) epitope tag. In y2L -GFPC, GFP is fused to the carboxyl terminus of y2L. B, Expression of y2L -GEPN and y2L -GFPC in mammalian cells. A293 cells were transfected with wild type y2L, y2L -GFPN, y2L -GFPC or no DNA and lysates separated on 10 % SDS-PAGE. Gels were transferred to nitrocellulose membranes and analysed by western blotting with a monoclonal antibody against GFP (anti-GFP). A faint band at approximately 80 kDa could be detected in y2L -GFPC lysates. No bands were detected in untransfected (no DNA) or y2L lysates. C, A293 cells transfected with y2L or y2L -GFPN or control untransfected cells (ut) were treated as above and analysed with an anti-y2 polyclonal antibody or monoclonal anti-myc (9E10).
71 construct is more labile and may be more rapidly degraded than either the wild type or y2L -G FPN .
3.3 Expression of alpZyZ-GFPN and alpZyZ-GFPC receptors in live A293 cells
The biochemical results revealed that both y2L GFP fusion proteins were expressed (although in the case of yZL-GFPC this appeared to be at lower levels). The next step was to determine if these proteins could produce a fluorescent signal and could be targeted to the cell surface. To achieve this the y2L -GFPN and y2L -GFPC constructs were expressed in conjunction with an a l and p2 GABA^ receptor subunit in A293 cells. Using confocal microscopy a significant proportion of alp2y2-GFPN fluorescence could be detected at the cell surface in live cells (Fig. 3A). It was also possible to visualise the Y2L-GFPC in cells co-transfected with alp 2 (Fig. 3B) however, fewer cells showed obvious cell surface fluorescence and this usually appeared to be weaker than that of y2L-
GFPN.
To verify that receptors containing y2L-GFPN and y2L -GFPC were at the cell surface, immunofluorescence experiments were carried out. Unpermeabilised cells were immunolabelled with antibodies to either GFP, the amino terminus of the y2L subunit or myc in the case of alp2y2L -GFPN (fig. 4A-C) expressing cells. In the case of alp2'y2L-
GFPC (Fig. 4D,E), expressing cells were immunolabelled with antibodies to GFP or the amino terminus of the y2L subunit. Labelled cells were then visualised with Texas Red secondary antibody. For y2L-GFPN and to a lesser extent y2L-GFPC, confocal microscopy revealed a large amount of colocalisation of the EGFP signal with that of
Texas Red, seen as yellow (Fig. 4A-E). Since the labelling experiments were carried out in the absence of cell permeabilisation, this demonstrated that both y2L -GFP chimeras are targeted to the cell surface.
72 Figure 3: Visualisation of y2L-GFP chimeras co-expressed with a l and p2 in live mammalian cells. A293 cells were transfected with either a I p2y2L-GFPN (B) or a I p2y2L -GFPC (A) and viewed using a confocal microscope. Bright green fluorescence could be detected at the plasma membrane. Green fluorescence could also be detected in intracellular compartments. The scale bar = 10 um.
73 alp2y2L-GFPN alp272L-GFPC
anti-Y2 anti-Y2
anti-OFP anti-GFP
anti-9E10 Figure 4: Cell surface localisation of y2L -GFP chimeras co-expressed with a l and p2 in mammalian cells. A293 cells were transfected with either a 1 (32y2L-GFPN (A-C) or a 1 [32y2L-GFPC (D,E) and immunolabelled without permeabilisation using polyclonal antibodies to the N-terminus of y2L (A,D), monoclonal anti-GFP (B,E) or monoclonal anti-9E10 (C) followed by detection with anti rabbit or mouse conjugated Texas Red secondary antibodies. Images were collected by confocal microcopy. Signals can be seen to co-localise as yellow staining at the cell surface indicating surface receptors. The scale bar = 10 pm. 74 The western blot experiments would suggest that a large amount of proteolysis of
GFP occurs to the y2L -GFPC polypeptide. However, the ability to detect some of the y2L
-GFPC fusion protein at the cell surface with the anti-GFP antibody is in agreement with the faint 80kDa band detectable by western blot and the ability to record functional
G ABA activated responses in cells expressing this subunit (see below). Furthermore, in the case of y2L -GFPC, since GFP is fused to the carboxyl terminus of the subunit, the fact that it can be detected in unpermeabilised cells, directly demonstrates that the carboxyl terminus of the GABA^ receptor y2L subunit is extracellular.
3.4 GABAa receptors containing y2L -GFP form functional ligand gated ion channels
Once it had been determined that the y2L subunit GFP fusions were expressed and exhibited green fluorescence it was obvious to check if they exhibited similar functional properties to the wild type receptors. The functional effects of inserting EGFP at the amino or carboxyl terminus of the y2L subunit were tested by using whole-cell patch clamp electrophysiology in A293 cells (electrophysiological recordings were carried out by Professor Trevor Smart, School of Pharmacy). y2L -GFPN or y2L -GFPC expressed in
A293 cells in conjunction with a l and (32 GABA^ receptor subunits (alp2y2L-GFPN or al|32y2L-GFPC) were compared to A293 cells containing al|32y2L. The equilibrium
G ABA concentration response curves for receptors incorporating y2L-GFPN or y2L-
GFPC subunits were similar to that observed for wild-type a l(32y2L receptors.
Examination of the curves (Fig. 5) revealed a small leftward shift for both a 1 (32Y2L-
GFPC and al|32y2L-GFPN receptors, yielding ECggS of 4.5 ± 0.21 fiM (al(32y2L-GFPC, n = 3) and 3.1 ±0.19 |iM (al(3272L-GFPN, n = 4), compared to the wild-type receptor
EC50 of 10.22 ± 0.26 |llM (al|32'y2L, n = 7). However, the slopes of the curves were
75 al|5272L o ai|32^2L-GFPC 12-1 V aip272L-GFPN
1.0 -
o s- o Ï ■ •■ a
0.4- Îz
02 - Ü
0.0 -
0.1 1 10 100 1000 GABAconcmtration( j.iM)
Figure 5: Kquilibrluni GABA concentration response curves obtained from A293 cells expressing GFP/y2I. subunit chimeras Rquilibrium GABA concentration response curves obtained from A293 cells expressing a 1 p2y2L-GPPC, a 1 p2y2L-GFPN, or a 1 p2y2F wild-type receptors. In each cell the GABA-activated currents have been normalised to the current evoked by 500 pM GABA. Each point represents the mean ± s.e.in. (n= 3-7) A293 cells were voltage-clamped at -50 mV holding potential and GABA was rapidly applied from a nearby (<200 pm) Y-tube. The curves were generated by the equation:
I = Imax.(l/(l-h(EC50/| Aj)n),
where 1 and Imax represent the currents induced by a concentration. A, and saturating concentration of GABA respectively. EC50 represents the GABA concentration required to evoke half the maximal response and iiH is the Hill slope.
76 essentially unaltered (n„ 1.0 ± 0.06, alpiyZL-GFPC; 1.2 ± 0.08, alp2y2L-GFPN; 1.15 ±
0.03, aip2Y2L;n = 3-7).
The reduced EC^ for the GFP tagged GABA^ receptors could have been partly caused by heterogeneity in the expressed receptor population. This could occur if for example, there was poor assembly of the y2L GFP fusions into heteromeric receptors resulting in a higher proportion of ap receptor isoforms. To determine further if this was the case the sensitivities of the receptors to Zn^"^ and diazepam were tested. The y 2 subunit confers both sensitivity to diazepam and insensitivity to zinc. Therefore, if a significant proportion of receptors contained aP subunit isoforms lacking the y2L subunit the result would be a poor potentiation by diazepam and an increased zinc sensitivity of the whole cell GABA response compared to cells expressing wild type receptors.
A293 cells expressing GABA^ receptors were subjected to rapid application of
200 pM GABA to evoke near maximal peak and steady-state GABA-activated currents
(cf. Fig. 4). This concentration was then co-applied with 10 pM Zn^^, a concentration that would not normally affect apy subunit containing receptors but is approximately 6 times the IC50 for Zn^^ inhibiting GABA (ECggj-activated responses on aP constructs (Draguhn et al., 1990; Smart et al., 1991; Smart et al., 1994). Whereas y2L-GFPN subunit- containing GABA/^ receptors were similar in their Zn^^ sensitivity to wild-type receptors
(Fig. 7A,B), alp2y2L-GFPC subunit-containing receptors showed an increased Zn^^ sensitivity with substantial reduction in the steady state current (Fig. 6A,B). A comparison of the expressed GABA^ receptor sensitivities to diazepam (IpM) revealed that GABA
(IpM)-activated currents were generally potentiated to a similar extent in alp2y2L-GFPN receptor expressing cells compared to their alp2y2L-GFPC counterparts (Fig. 6C, 1C), suggesting that interference with benzodiazepine allosteric modulation by GFP was unlikely.
77 alp2Y2L-GFPC A G.4BA Zii 2+ Rec
lOOpA B c r5 s
4
3
< 0,4 1 02 a 00 0 GABA Zir+ Rec GABA +Dia Rec Ipeak □ Iss
Figure 6 : Analysis of GABA-evoked currents from A293 cells expressing aipZyZL-GFPC receptors. A, Typical GABA (200 pM) activated currents obtained in the absence and presence of 10 pM Zn2+ and following a 3 min recovery. Holding potential -50 mV. B, Bar graph of peak and steady-state 200 pM GABA-activated cuirents recorded before, during 10 pM Zn2+ and after recovery. C, Histogram of 1 pM GABA-activated currents obtained in the absence and presence of 1 pM diazepam and following recovery. All bars represent the mean ± s.e.m. from n = 3 cells.
78 A GABA Zir' Rec
200pA B C 5 s 1.2 6 S 10 5
0 8 4
0.6 3
04 2
! 0 2 1
O 00 0 |l ____ GABA Zir+ Rec GABA +Dia Rec Ipcak □ Iss
Figure?: Analysis of GABA-evoked currents from A293 cells expressing aip2Y2L-GFPN receptors. A, Sample membrane currents evoked by 200pM GABA prior to, during co-application of lOpM Zn2-t- and following 3 min recovery. Holding potential -50 mV. B, Bargraph of peak and steady-state 200pM GABA-activated currents obtained in the presence and absence of lOuM Zn2+ and following recovery. C, GABA (IpM) activated currents recorded before, during exposure to IpM diazepam and following recovery. Bars represent mean ± s.e.m. from n = 4 cells.
79 The increased sensitivity in cells expressing alp2y2L-GFPC compared to alp2y2L-GFPN suggests that there are significant numbers of receptors composed of just alp2 subunits in the (xlp2y2L-GFPC expressing cells. This suggests that while the y2L-
GFPC subunit can form functional aip2y2L heteromers the efficiency of the assembly process may be reduced when compared to the y2L-GFPN subunit-containing receptors.
This appears to result in the production of aip2 receptors in cells transfected with al, p2 and y2L-GFPC cDNAs.
The biochemical, immunocytochemical and electrophysiological experiments so far described strongly suggest that addition of GFP to the carboxyl terminus of the y2L subunit reduces the expression and stability of this construct as well as it’s ability to assemble with of a l, P2 and y2 subunits. Because insertion of GFP at the amino terminus of the y2L subunit appears to be functionally silent all further experiments were carried out using Y2L-GFPN.
3.5 Surface expression of y2L -GFPN is dependent on co-expression with a l and p2 subunits
To study the assembly of GABA^ receptors containing y2L-GFPN, this subunit was expressed in A293 cells alone or in combination with a l or P2 subunits. The subcellular distribution of y2L-GFPN fluorescence was investigated in live cells using confocal microscopy and in both permeabilised and non-permeabilised cells. In live cells the majority of fluorescence signal showed a perinuclear localisation consistent with retention in the ER (Fig. 8A). This could be observed as a tight ring and a very bright perinuclear ball of fluorescence. In fixed cells, surface expression of this protein could not be detected under non-permeabilised conditions (Fig. 8C) using anti-y2 antibody but abundant y2L-
GFPN green fluorescence could be seen in the same cell (Fig. 8B) confirming that y2L-
80 GFPN alone cannot access the cell surface. Similarly, immunofluorcscncc experiments were carried out on non-permeabilised cells expressing either al/y2L-GFPN or p2 I'^h -
GFPN with anti-y2 antibody, followed by permeabilisation and staining with sera to the a l or P2 subunits (to verify the co-expression of these subunits). This revealed that the al/y2L-GFPN or (32 /y2L-GFPN combinations were also unable to access the cell surface
(8D-I) and appeared to be ER retained. Therefore the cell surface targeting of y2L-GFPN
(Fig. 4) is clearly dependent on co-expression with the receptor P2 and a l subunits. This has been previously demonstrated for the wild type 'y2L subunits (Connolly et al., 1996a;
1999a) and confirms that the trafficking properties of y2L-GFPN are identical to those of the wild type y2L.
3.6 GABA a receptors containing y2 -GFPN constitutively endocytose and are removed from the surface upon PKC activation
Further experiments were carried out to investigate the endocytosis and cell surface stability of GABreceptors containing alp2y2L-GFPN expressed in A293 cells using antibody feeding and triple immunofluorescence confocal microscopy. To monitor receptor internalisation the extracellular myc (9E10) epitope present on yj-GFPN (Fig.
2A) was used to carry out antibody internalisation experiments with affinity purified anti- myc (9E10) antibody. Surface receptors in live cells were labelled with 50 pg /ml myc
(9E10) antibody at 4 °C and following removal of excess antibody, cells were incubated at
37 °C for 1 h. After incubation, cells were fixed and the remaining cell surface receptors were visualised using a Texas Red-conjugated secondary antibody. Cells were then permeabilised and internalised receptors were detected using a Cy5-conjugated secondary antibody. Using this approach combined with triple fluorescence confocal microscopy to detect y2L-GFPN at 488nm Texas Red at 568nm, Cy5 at 647nm, it was possible to distinguish between cell surface and internalised GABA^ receptors as well as newly
81 Y2L-GFPN 72L-GFPN anti -72
anti-|32/3 72 L-GFPN anti -72
anti-al 72L-GFPN anti -72
Figure 8: Subunit dependency of 72 L -GFPN cell surface targeting in mammalian cells. Subcellular localisation of 72L -GFPN was assessed in A293 cells expressing 72L-GFPN (A-C), P2/72L-GFPN (D-F) and a l/72L-GFPN (G-I) via confocal microscopy. Expression was measured using endogenous y2L-GFPN fluorescence (A. B, E, H) or immunofluorescence in unpermeabilised (C, F, I) or permeabilised cells (D.G) using anti-72 (C, F, I), anti-p2/3 (D) or anti-al (G) and anti-rabbit or mouse Cy5 conjugated secondary antibodies. The scale bar = 10 pM.
82 synthesised receptors in the ER, Golgi and tan sport vesicles. Cell surface receptors could be detected as the 'y2L-GFPN fluorescence colocalising with Texas Red (Fig. 9A,C,D,F) and internalised receptors as the yZL-GFPN fluorescence colocalised with Cy5 whereas green fluorescence not found to colocalise with either Texas Red or Cy5 represented receptors on their way through the biosynthetic pathway (Fig. 9C,F). From this experiment it was possible to see that GABreceptors containing aip2'y2L-GFPN internalised efficiently to an intracellular compartment that was distinct from receptors on their way through the biosynthetic pathway as visualised by the endosome like structures that contained both green and blue fluorescence (Fig 9F,F).
It has been previously reported that GABA^ receptor surface levels are reduced upon protein kinase C activation (Connolly et al., 1999b). Live A293 cells transfected with alp2y2L-GFPN were imaged by confocal microscopy under steady state (Fig. lOA) or after PKC activation with 200 ng/ml phorbol 12-myristate 13-acetate (PMA) followed by incubation at 37 °C for 1 h (Fig. lOB). Following PKC activation it was possible to detect a decrease in cell surface fluorescence of y2L-GFPN due to a reduction in cell surface levels (Fig. lOB). Quantitation of GABA^receptor surface levels by visualisation of GFP fluorescence may be inaccurate since this method would detect both cell surface and intracellular receptors. Therefore, to quantitate the PKC induced decrease in number of 9F10-tagged alp2y2L-GFPN cell surface receptors we used iodinated 9F10 antibody and also compared it to the PKC induced decrease of alp2'y2L wild type 9F10 tagged receptors. In these experiments all subunits were 9F10 epitope tagged to achieve statistically significant results (Connolly et al., 1999b). A293 cells expressing aip2y2L
(Fig. IOC) or alp2y2L-GFPN (Fig. lOD) were incubated in the presence or absence of
200 ng/ml PMA, for 1 h at 37 °C. Following incubation, the levels of cell surface receptor were determined by binding of iodinated 9F10 antibody to the cells at 4 °C. Since this procedure is carried out following incubation no antibody-induced internalisation due to
83 O'D 60 '
» \
V \
Figure 9: Internalisation of GABA^ receptors containing ylL-GFPN. A293 cells transfected with alp2y2L -GFPN were prebound with anti-9E10 antibody for 1 h on ice. Excess antibody was removed and cells were fixed at time 0 or incubated for 60 min at 37 ^C. Surface receptors were detected in the absence of detergent using Texas Red-conjugated secondary antibody (arrows- A, D). Internalised receptors were subsequently detected after permeabilisation using Cy5-conjugated secondary antibody (arrow heads- B, E). All receptors could be visualised by green fluorescence (arrows- C, F). Scale bar= 10pm.
84 D 125 -
100 -
75 - % 9E10 % 9E10 binding binding
Û - m
Figure 10: Down modulation of GABA^ receptors containing yZL-GFPN upon protein kinase C activation. Live cells were viewed before (A) or after activation of PKC with 200ng/ml PMA followed by incubation at 37 oC for 1 h (B). The scale bar = 10 pM. Surface receptor levels were quantified for A293 cells expressing alp2y2L(C) or (xl(32y2L -GFPN (D) using iodinated 9E10 antibody before or after activation of PKC with PMA, n=3, * = significantly different from control, as determined using the students t-test (p<0.05).
85 receptor cross-linking can occur.
It has been previously reported that in the absence of phorbol ester treatment, 72L cell surface receptor levels remain constant (Connolly et al., 1999b). Similar levels of cell surface receptors could also be detected in untreated cells expressing y2L and y2L-GFPN
(Fig. 10 C column 1 ,D column 1). In contrast, a consistent reduction in I25I-9EI0 binding was observed in cells treated for 1 h with PMA for cells expressing y2L (Fig. lOA column
2) and y2L-GFPN containing receptors (Fig. lOB column 2). These results suggest that receptors containing y2L-GFPN internalise from the cell surface in a similar fashion to wild type receptors upon activation of PKC.
3.7 Cell surface expression and synaptic targeting of ylL-GFPN in hippocampal neurones is dependent on exogenous a and |3 subunits.
We also examined the expression and membrane targeting of y2L-GFPN in cultured hippocampal neurones by nuclear micro-injection of recombinant subunit cDNAs followed by confocal microscopy (Couve et al., 1998). Micro-injection into hippocampal neurones of y2L-GFPN alone resulted in a diffuse reticular pattern of staining reminiscent of the ER. No obvious membrane localisation or clustering of receptor could be detected
(Fig. 1 IB). In contrast, micro-injection of aip2y2L-GFPN into hippocampal neurones resulted in distinct membrane targeting of GFP GABA^ receptor fluorescence, as indicated in the “tram track” staining pattern of neuronal processes (arrow in Fig. 11 A).
Furthermore, large clusters of fluorescence could be seen along dendrites and endosomal like aggregates were visible in the cell soma (Fig. 11 A). This would suggest that membrane targeting of exogenous y2L-GFPN in hippocampal neurones can only occur upon co-expression and co-assembly with exogenous a and p subunits. To test this directly neurones were microinjected with the y2L-GFPN together with either the a l or
P2 cDNAs. Cell surface expression was then monitored by fluorescence for y2L-GFPN. In
86 contrast to expression of ')2L-GFPN with a l and |32 cDNAs expression of '^L-GFPN with either the (32 or a 1 cDNAs failed to produce cell surface expression of "^L-GFPN
(Table 1). Finally, to determine if the clusters of fluorescence in triple transfected neurones could be found at synaptic sites hippocampal neurones micro-injected with al(32y2L-GFPN, were labelled with an antibody to glutamic acid decarboxylase, a classical marker of GABAergic synapses (Craig et al., 1994) (Fig. 11). Clusters of the dendritic fluorescence of al(32'y2L-GFPN (Fig. 11C) could be seen to colocalise with staining of inhibitory synaptic sites marked by the GAD antibody (Fig. 1 ID), confirming that recombinant GFP tagged GABA^ receptors could be targeted to inhibitory synaptic sites in cultured hippocampal neurones.
3.8 Production of a y2L-GFPN transgenic mouse
It would be a distinct advantage to have a preperation which would allow the incorporation of the y2L-GFPN construct into endogenous receptor clusters throughout neuronal development and synaptogenesis while avoiding complicated neuronal transfection procedures. To achieve this, transgenic mouse lines were produced (by Dr
Bill Wisden, MRC LMB, Cambridge) by random integration of a targeting construct containing y2L-GFPN under the control of the neural specific promoter Thy 1 (Fig. 12D).
Two transgenic mouse strains (Fig 12A,B) were obtained for the y2L-GFPN construct as determined by in situ hybridisation for GFP, whereas no signal was detected in the wild type control (Fig. 12C). It is hoped that under such expression conditions, where the y2L-GFPN construct is constitutively expressed under the control of a neuronal promoter, oligomerisation of this construct with endogenous receptors will occur. Unfortunately, there was insufficient time to further characterise these two mice strains.
87 Figure 11: Visualisation of /2L-GFPN in cultured hippocampal neurones. Hippocampal neurones were microinjected with alp2y2L-GFPN (A) or Y2L-GFPN (B) alone and viewed by confocal microscopy. High magnification images of a dendrite from each cell are shown in the lower panels of A and B. Co-localisation of clusters of aip2y2L-GFPN fluorescence (C) in a microinjected neurone immunolabelled with a rabbit anti-GAD antibody and Texas-Red conjugated anti-rabbit secondary (D). Arrows show clusters of green fluorescence (C) localised to inhibitory synapses marked by GAD immunoreactivity (D). The scale bar = 20 pM. Subunit combination Cell surface expression
y2LGFPN —
Y2LGFPN+ a l —
72LGFPN+P2 —
72LGFPN+al+P2 +++
Tablel: Expression of 72 L-GFPN in hippocampal neurones. Cultured hippocampal neurones were microinjected with GABA^ receptor expression constructs. 24 h after microinjection expression of the 72LGFPN construct was examined via fluorescence and confocal microscopy. Cell surface staining was defined as visible “tram track” fluorescence along neuronal processes. At least 8 expressing cells were examined for each subunit combination.
89 A 400*GFP y2 B 409-GFF^/2 C wild-type
-OB Ctx ctx
c a ;
CA1 CA1
Cbm t DON 1
SS 9EI0 STOP
Noll .VUT
Kl 3.9 2.8
Figure 12: Targeting of y2L-GFPN in mice. Expression of the transgene for y2L-GFPN was detected in two mouse lines (400-GFPy2 and 409-GFPy2) by in situ hybridization using an antisense probe to GFP (A, B). No signal for the GFP probe could be detected in a wild type control (C). Random integration of the targteting construct produced two lines with different y 2L-GFPN expression patterns. In the 400-GFPy2 line high levels of GFP expression can be detected in cortex (Ctx), CAl, CA3 and dentate gyrus (DG) of the hippocampal formation as well as medium to low levels in the caudate pu tame n (CPu) and thalamus (T), dorsal cochlear nucleus (DCN) and cerebellar granule layer (Gr). In contrast in line 409-GFPy2 no GFP expression can be detected in the dentate, caudate putamen and DCN and expression levels are lower in cortex. Interestingly, line 409-GFPy2 has higher GFP expression levels in the granule cell layer and olfactory bulb (OB). The y2L-GFPN targeting construct is shown below the in situ hybridization panels.
90 3.9 Discussion
The extensive subunit heterogeneity of GABA^ receptors combined with the complex receptor subunit expression profile of many neurone types provides the potential for considerable structural diversity (MacDonald and Olsen, 1994; Rabow et al., 1995).
The consensus of opinion derived from a range of experimental approaches is that the majority of benzodiazepine sensitive GABA^ receptor subtypes in the CNS are composed of a, p and y subunits (Macdonald and Olsen 1994; Rabow et al., 1995).
It is clear therefore, that understanding the mechanisms involved in the assembly, membrane targeting, surface stability and endocytosis of these receptors is an essential goal. Gene knockout studies have highlighted the importance of the y^ subunit for the function and targeting of GABA^^ receptors. Production of GABA-gated channels is achieved upon expression of receptor a and P subunits however, the co-expression of a y subunit isoform is necessary to confer benzodiazepine sensitivity to these channels
(Gunther et al., 1995). Furthermore, the y2 subunit is necessary for postsynaptic, gephyrin dependent, clustering of major GABA^ subtypes (Essrich et al., 1998), for the interaction with the cytoskeletal linker molecule GAB ARAB (Wang et al., 1999) and is important in regulating receptor internalisation (Connolly et al., 1999b). In order to study the role of the y2 subunit in receptor function in live cells using a non-invasive approach, GABA^ receptor y2L subunit green fluorescent fusion proteins were constructed. This approach has proved useful for the study of other neurotransmitter receptors including glycine receptors (David-Watine et al., 1999), ionotropic AMPA type glutamate receptors (Shi et al., 1999) and metabotropic glutamate receptors (Doherty et al., 1999).
Insertion of GFP at the amino or carboxyl terminus of the y2L subunit produced GFP fusion proteins that exhibited green fluorescence. Cell surface expression of these GFP fusion proteins was dependent on co-expression with a l and p2 subunits as previously described for the wild type y2L subunit (Connolly et al., 1996a). Homomeric expression
91 of the t2L GFPN fusion resulted in ER retention as previously demonstrated for the wild type y2L subunit. The binary combinations al/'y2L-GFFN and |32/'y2L-GFPN were also unable to access the cell surface in common with both wild type al/ylL and (32/'y2L subunit combinations (Connolly et ah, 1996a). Confirmation of fluorescence experiments was obtained from electrophysiological studies. Co-expression of a and (3 subunits with either y2L-CFPN or y2L-CFPC produced functional, CABA-gated channels with EC values for both CAB A and diazepam similar to wild-type receptors. The insertion of CFP at the carboxyl terminus however, appeared to increase the zinc sensitivity of the receptors. This is consistent with a substantial population of al/p2 receptors in cells expressing the a l, p2 and y2L-CFPC cDNAs (Draguhn et ah, 1990; Smart et ah, 1992)
This would suggest lower expression levels of this fusion protein or a reduced ability to oligomerise with a and P subunits. In agreement with this, SDS-PACE of cell lysates expressing this chimera followed by western blot analysis revealed that a proportion of the carboxyl terminus CFP is proteolysed. Furthermore, it was more difficult to detect expression of this fusion protein by western blot of lysates using antibodies to y2L suggesting that it may be more labile. This may also explain the greater difficulty to immunolabel surface receptors containing this chimera. The greater instability y2L-CFPC may be due to the short carboxyl terminus of the y2L subunit which would place the large
CFP domain very close to the membrane which may cause subunit misfolding or a reduced ability to oligomerise with other subunits. In contrast expression of y2L-CFPN produced a stable fusion protein with properties essentially identical to wild type subunits.
Interestingly, the expression of the CABA^ receptor a l subunit fused to CFP at it’s carboxyl terminus has been reported however whether this construct is expressed at similar levels to the wild type subunit has not been analysed in detail (Connor et al., 1998;
Chapell et al., 1998; Bueno et al., 1998).
92 Since insertion of GFP at the amino terminus produced a subunit with properties closer to that of the wild type it was used for further studies. Furthermore, this fusion protein also had the added advantage of a myc (9E10) extracellular epitope tag. This enabled the study of GFP tagged receptor endocytosis. Using antibody feeding combined with triple fluorescence enabled the visualisation of cell surface and internalised receptors as well as receptors in the biosynthetic pathway. This confirmed previous reports that
GABA^ receptors expressed in A293 cells can constitutively endocytose (Connolly et al.,
1999b). Importantly, the ability to co-localise internalised myc (9E10) with GABA^ receptor green fluorescence confirms that previous antibody feeding studies which reported constitutive endocytosis of receptors (Connolly et al., 1999a,b) were not visualising the trafficking of antibody per se uncoupled from receptor.
In agreement with previous studies, it was also possible to demonstrate that the cell surface stability of al|32y2L-GFPN receptors could be modulated in live cells.
Activation of PKC resulted in a decrease in cell surface fluorescence for receptors composed of a 1 P2 t2L-GFP-N subunits. These findings were confirmed biochemicaly by using iodinated 9E10 antibody to precisely quantitate cell surface receptor levels in the presence and absence of PKC activation. This effect was found to be similar in magnitude to receptors containing wild type y2L subunits (Connolly et al., 1999b). The results presented here provide evidence that the cell surface stability and endocytic properties of the y2L-GFPN appear to be identical to the wild type y2L subunit.
Using y2L-GFPN we also examined the assembly and membrane targeting of
GABA^ receptors in cultured hippocampal neurones using nuclear microinjection.
Expression of y2L-GFPN alone in these neurones resulted in a diffuse reticular pattern of staining with no plasma membrane fluorescence being detected. Interestingly, injection of neurones with the binary combinations al/y2L-GFPN and p2/y2L-GFPN also did not produce plasma membrane staining of y2L-GFPN. Only when y2L-GFPN was co
93 expressed with both exogenous al and p2 subunits was cell surface fluorescence observed. Furthermore yZL-GFPN in the presence of the a l and P2 cDNAs was targeted to GABAergic synapses as demonstrated by co-localisation with GAD immunoreactivity.
Presumably, the failure of y2L-GFPN to reach the plasma membrane on homomeric expression in hippocampal neurones is attributable to low levels of expression of endogenous a and P subunits available for oligomerisation with y2L-GFPN in the ER.
Interestingly, recombinant a l or p2 receptor subunits expressed in superior cervical ganglion neurones are also unable to access the cell surface on homomeric expression
(Gorrie et al., 1997). Therefore, these results strongly suggest that similar mechanism control the cell surface expression of the y2L subunit in both heterologous systems and neurones.
In conclusion the addition of GFP to the N-terminus of the GABA^ receptor yZL subunit is functionally silent and the work presented here demonstrates that this approach can be used to study receptor assembly and membrane targeting within living cells.
Furthermore, the production of a 72L-GFPN GABA^ receptor subunit transgenic mouse lines should greatly facilitate the use of this construct to study GABA^ receptor trafficking. Particularly, it will be possible to culture hippocampal neurones from these mice which can then be used to study multiple aspects of receptor targeting, anchoring and clustering in live cells. The availability of this line may also facilitate studies on the trafficking of the receptor in vivo using techniques such as two-photon microscopy
(Lendvai et al., 2000). Furthermore, the presence of the extracellular myc (9B10) tag on this construct will facilitate biochemistry and endocytosis assays. Therefore, the GABA^^ receptor subunit GFP fusion protein will be a powerful tool to analyse the membrane trafficking of these receptors in the brain.
94 CHAPTER 4
4.1 Introduction
Given the central role that GABreceptors play as mediators of synaptic inhibition, it is important to understand how receptor number at the cell surface is regulated. Insulin treatment of neurones in culture (Wan et al., 1997) and the kindling model of epileptogenesis (Nusser et al., 1998a) have both been shown to increase GABA^ receptor surface number. In contrast, GABA^ receptors have also been found to be down regulated by an agonist-dependent mechanism (Barnes, 1996; Tehrani and Barnes,
1997b). As was described in chapter 3, it has also been shown that recombinant GABA^ receptors can constitutively recycle between the cell surface and an intracellular endosomal compartment (Connolly et al., 1999a, 1999b). Furthermore, studies using the y2L subunit GFP fusion protein verified the initial observations made using antibody feeding experiments, and confirmed that internalised receptors are targeted to a separate intracellular pool than those being transported through the biosynthetic pathway (Kittler et al., 2000a). Neuronal GABA^ receptors have also been found to constitutively endocytose
(Connolly et al., 1999b). Using immunofluorescence, biochemical and electrophysiological techniques it has also been shown, in both Xenopus Oocytes (Chapell et al., 1998) and A293 cells (Connolly et al., 1999b; Kittler et al., 2000a), that GABA^^ receptor levels are reduced upon protein kinase C (PKC) activation.
Little is known, however, regarding the molecular mechanisms responsible for the redistribution and cycling of GABA^ receptors between the cell surface and intracellular locations. Dynamin-dependent endocytosis has been shown to be important in the regulation of cell surface levels of a number of integral membrane proteins (Schmid,
1997) including opioid receptors (Chu et al., 1997), the p-adrenergic receptor (Pitcher et al., 1998) and more recently ionotropic glutamate receptors (Luscher et al., 1999; Carrol
95 et al., 1999; Man et al., 2000). Endocytosis of such membrane proteins involves their recruitment into clathrin-coated pits by adaptor proteins such as adaptin complexes and/or |3-arrestin (Schmid, 1997). Each adaptor complex contains four polypeptides called adaptins, two of approximately 100 kDa, as well as a 50 kDa ]x chain and 25 kDa a chain.
Different adaptor complexes have different functions and are associated with different pools of clathrin coated vesicles (CCVs). The AP2 adaptor complex is associated with clathrin-coated vesicles endocytosing from the cell surface. AP2 contains 100 kDa a and p2 subunits as well as |l i 2 and a2 chains and can interact with membrane proteins that contain appropriate signals for sorting into CCVs (Schmid, 1997; Marsh ^ d McMahon,
1999). The target transmembrane protein/adaptor complex is then capable of interacting with other binding partners including clathrin, the GTPase dynamin and it’s binding partner amphyphysin (Marsh and McMahon, 1999) which are key elements of the endocytotic machinery. Amphiphysin is a cytoplasmic protein that can bind both the a chain of AP2 and dynamin (Wigge et al., 1997b) and has been implicated in the recruitment of dynamin to budding eoated pits. Dynamin contains a proline rich region which binds to an SH3 domain in amphiphysin. Disruption of this interaction with peptides or recombinant amphiphysin SH3 domain blocks recruitment of dynamin to coated pits and clathrin mediated endocytosis (Wigge et al., 1997a; Marks and McMahon,
1998).
Experiments were carried out to determine if adaptin mediated recruitment into clathrin coated pits and dynamin dependent endocytosis were also important for GABA^ receptor internalisation. To further understand the role of GABA^ receptor endocytosis in neurones, experiments were also carried out to determine the consequences of blocking endocytosis on inhibitory synaptic transmission.
96 4.2 GABA^ receptor internalisation in A293 cells is mediated by clathrin-coated pits
It has previously been shown that recombinant GABA^ receptors expressed in
A293 cells can constitutively endocytose to a transferin receptor-containing compartment
(Connolly et al., 1999a,b). The first thing was therefore to determine if the endocytosis of
GABreceptors was mediated by clathrin-coated pits. Internalisation of receptors was followed by labelling surface receptors with antibodies to an extracellular myc (9E10) epitope tag on the amino terminus of receptor subunits. These experiments were performed in the absence and presence of hypertonic (350 mM) sucrose. Hypertonic conditions impair clathrin-mediated endocytosis by blocking clathrin-coated pit formation
(Heuser et al., 1989). These conditions have been used to demonstrate the clathrin- dependent endocytosis of a number transmembrane proteins, including AMPA type glutamate receptors (Carroll et al., 1999).
A293 cells transiently expressing were prebound with 50
|LLg/ml myc (9E10) antibody at 4 °C and following removal of excess antibody, cells were incubated at 37°C for 1 h . In the absence of high sucrose, GABA^ receptors internalised efficiently to an intracellular compartment as shown in Fig.l3B. However, treatment with
350 mM sucrose strongly inhibited internalisation of these alp3y2L receptors (Fig. 13C).
Receptor ap subunits have also been shown to endocytose although to a more peripheral recycling compartment than apy constructs (Connolly et al., 1999a,b). Similarly, y2S subunits have been shown to access the cell surface as non-functional homomers and internalise constitutively (Connolly et al., 1999a). High sucrose strongly inhibited the endocytosis of both (9Eio)^^(9Eio)p^ receptors (Fig. 13D-F) and ^^^'°^y2S homomers (Fig.
13G-I ) expressed in A293 cells. Therefore these observations strongly suggests that
GABA^ receptors composed of alp3, alp3y2S or homomeric y2S subunits all internalise in A293 cells via a common mechanism.
97 60'+Sucrose
I Ù
« ( ' i / i / «
Figure 13 : Clathrin-mediated endocytosis of recombinant GABA^ receptors. A293 cells expressing rxl p3y2L (A-C and J-L), alp3 (D-F) or y2L(G-l) GABA a receptor subunits (all subunits 9E10 tagged) were prebound with anti-9E10 antibody (50 pg/ml). Excess antibody was removed and cells incubated at 37^C for 60 min. Surface receptors were detected in the absence of permeabilisation with FlTC-conjugated secondary antibody followed by permeabilisation and detection of internalised primary antibody with Texas Red-conjugated secondary antibody. Significant internalisation could be detected for all subunit combinations (B,E,H,K) after 60 min compared to 0 min (A,D,G,J). This internalization was blocked by treatment with 350 mM sucrose to block clathrin-mediated endocytosis (C,F,I,L). Internalisation in the presence of PKC activation by PDBu (K,L) was also blocked by 350 mM sucrose (L). Scale bar, 10 uM. 98 As described in Chapter 3, GABA^ receptor surface levels are reduced upon PKC activation (Connolly et al., 1999b). PKC was found to act by blocking receptor recycling to the cell surface (Connolly et al., 1999b). Therefore, the down modulation of receptor number upon PKC activation is still dependent on the removal of receptors by endocytosis. The endocytosis of GABA,^ receptors under conditions of PKC activation was therefore also investigated. For these experiments, only GABA^ receptors composed of a l p3y2L subunits were analysed since it has been shown previously that PKC- mediated down modulation of surface receptor number was dependent on the presence of the y2 subunit. Internalisation of alp3y2L receptors upon PKC activation with 100 nM
PDBu was followed in the presence or absence of 350 mM sucrose (Fig. 13J-L). Similarly to constitutive endocytosis, internalisation of receptors under conditions of PKC activation (Fig 13K) was inhibited by blocking clathrin mediated endocytosis (Fig. 13L).
4.3 GABA^ receptor internalisation in cultured hippocampal neurones is mediated by clathrin-coated pits.
It has previously been shown that constitutive endocytosis of GABA^^ receptors occurs in cultured hippocampal neurones (Connolly et al., 1999b). The involvement of clathrin- coated pits in neuronal GABA^ receptor endocytosis was followed using a similar antibody feeding approach. In the presence or absence of hypertonic conditions GABA^ receptors on the surface of cultured hippocampal neurones (2 weeks in vitro) were labelled with an antibody that recognises the extracellular amino terminus of the p2 and
P3 subunits. After incubation, the cells were fixed and surface receptors were detected using a FITC-conjugated secondary antibody followed by permeabilisation and detection of internalised receptors with a Texas Red-conjugated-secondary antibody. Following antibody feeding, internalised receptors were visualised as the red staining in the cell soma and along dendrites whereas surface receptors were stained green and yellow (Fig.
99 + sucrose
Figure 14: Clathrin-mediated endocytosis of GABA^ receptors in cultured hippocampal neurons. Neurones were labeled with anti-GABA/^ receptor |32/p3 subunit antibody incubated for 30 min at 37 ^C. Surface receptors were detected in the absence of permeabilisation with FITC-conjugated secondary antibody followed by permeabilisation and detection of internalised antibody with Texas Red-conjugated secondary antibody. Internalised antibody could be detected after 30 min (A).This internalisation was blocked by treatment with 350 mM sucrose to block clathrin-mediated endocytosis (B). Scale bar, 10 pM.
100 14A). The treatment of hippocampal neurones with 350 mM sucrose significantly inhibited this internalisation of receptors, which could be seen by the large reduction in red staining in the cell soma and along dendrites (Figl4B), strongly suggesting that
GABA^ receptor internalisation in neurones occurs via clathrin-dependent endocytosis.
4.4 The clathrin adaptor protein AP-2 specifically interacts with GABA^ receptor p and y subunit intracellular domains
Adaptor complexes have been implicated in the selective recruitment of integral membrane proteins into clathrin-coated pits (Schmid, 1997). The results presented above provide evidence that GABA^ receptors are internalised via clathrin coated pits in both cell lines and neurones. It therefore seemed possible that recruitment of receptors into clathrin-coated pits could occur via an interaction between the intracellular domains of receptor subunits with the endocytic adaptor complex AP2. To examine the interaction of clathrin adaptor proteins with GABA^ receptor subunits the major intracellular domains of the a, p and y2 subunits were expressed as soluble glutathione-S-transferase (GST) fusion proteins (Brandon et al., 1999). Purified al, p3 and y2S GST-fusion proteins immobilised on glutathione agarose beads were incubated with detergent solubilized
A293 cell extracts. Using this assay, GST-p3 and GST-y2S were found to interact with a-adaptin (Fig. 15A). In contrast GST-al or GST alone were not found to associate with a-adaptin. To further verify that GABA^^ receptor p3and yS subunit intracellular domains interact with the intact adaptin complex, material bound to the respective fusion proteins was also probed with an antisera that recognises the P-adaptin subunit of AP2. P- adaptin was found to bind to GST-p3 and GST-y2S but not GST-al or GST alone (Fig.
15B). The same procedure was used to determine if GABA^ receptors interact with adaptins in brain extracts. GST-fusion proteins of the intracellular domains of GABA^ receptor a l, pi, p3, y2S and y2L subunits were exposed to detergent solubilised brain
101 A 116 Input a l (53 y2S GST
a-adaptin 97
B 116
(3-adaptin 97
Figure 15. The intracellular domains of |33 and y2 GABA^ receptor subunits bind the adaptin a and P subunits of AP2. al-GST, p3-GST, y2-GST and GST were incubated with A293 cells extracts. After extensive washing bound material was resolved by SDS-PAGE and analyzed by immunoblotting with an anti-cx (A) or anti-p adaptin antibody (B). Binding of a- and P- adaptin to both p3-GST and y2-GST but not al-GST or GST was detected.
102 extracts and associated proteins were resolved by SDS-PAGE and probed with antibodies specific for the a- or f-adaptin subunits. GST-pl, GST-p3, GST-yZS and GST-y2L were found to interact with a- adaptin from brain extracts (Fig. 16A). In contrast GST-al or
GST alone were not found to associate with a - adaptin (Fig. 16A). GST-pl, GST-PS,
GST-yZS and GST-yZL were also found to bind to p-adaptin from brain extracts whereas no binding of GST-al and GST alone to P-adaptin could be detected (Fig.l6B).
The results described above using affinity ‘pull down’ assays strongly suggest that
GAB A A receptors interact with adaptin complexes in both cell lines and brain. It was necessary, however to further verify the interaction in vivo. The interaction of adaptin complexes with neuronal GABA^ receptors was therefore further tested via immunoprécipitation. Detergent solubilized brain extracts were immunoprecipitated with an antibody that recognises the P-adaptin subunit of the AP2 complex or control non- immune antisera. Precipitated material was then probed using an antibody that recognises the GAB A^ receptor p2 and p3 subunits. These subunits are components of most neuronal
GABA^ receptor subtypes (Benke et al., 1994; Wisden et al., 1992). GABA^ receptors clearly co-immunoprecipitated with anti p-adaptin antisera but not with control IgG (Fig.
17). These results suggest that GABA^ receptors can associate with adaptin complexes in brain and that this may be a mechanism to allow the recruitment of receptors to clathrin- coated pits.
4.5 GABAa receptors co-fractionate with the clathrin adaptor protein AP-2 in purified clathrin-coated vesicles.
To provide further evidence that GABA^ receptors are internalised via clathrin- mediated endocytosis, the co-fractionation of GABA^ receptor subunits with adaptin complexes in clathrin-coated vesicles (CCVs) was investigated (purified bovine CCVs were prepared by Dr Jasmina Jovanovic while in the laboratory of Dr Paul Greengard,
103 A
1 16 Input al pi p3 yZS y2L GST
a-adaptin 97
B
116
P-adaptin ## ## # # # 97
Figurel6: The intracellular domains of (33, y2S and y2L GABAy^ receptor subunits bind the adaptin a and (3 subunits of AP2. a 1 -GST, (31 -GST, (33-GST, y2S-GST. y2L-GST and GST were exposed to brain extracts. After extensive washing bound material was resolved by SDS-PAGE and analysed by immunoblotting with an anti-a (A) or anti-|3 adaptin antibody (B). Binding of a - and (3- adaptin to (31-GST, [33-GST, y2S-GST and y2L-GST but not al-G ST or GST was detected.
104 Rockfeller). Therefore the distribution of a-adaptin, (3-adaptin and the GABreceptor
p3 subunit was examined by fractionation followed by SDS-PAGE and immunoblotting.
A progressive enrichment of both of a - and p-adaptin from homogenate through to final
CCV fraction was observed (Fig. 18 B,C). Importantly, a significant amount of GABA^ receptor p3 subunit could be detected in the CCV fraction (Fig. ISA). This is in agreement with results reported by Tehrani and Barnes (1997a,b) for the presence of the a l subunit in the CCV fraction.
4.6 GABA^ receptors in cultured hippocampal neurones co-localise with AP-2 in clathrin coated pits.
To provide further evidence for the in vivo association of GABA^ receptors with adaptin complexes the co-distribution of these two proteins in cultured hippocampal neurones was analysed using immunofluorescence and confocal microscopy.
Hippocampal neurones that had been maintained in culture for 3 weeks were double labelled with a rabbit antibody to GABA^ receptor pi and P3 subunits (McDonald et al.,
1998) and a monoclonal p-adaptin antibody, and visualised with FITC-conjugated anti rabbit and Texas Red-conjugated anti mouse secondary antibodies, respectively. The anti p-adaptin antibody revealed cell surface clusters of fluorescence on the soma and dendrites that represent AP2 in clathrin coated pits on the plasma membrane (Fig. 19A).
GABA^ receptors exhibited a clustered distribution of receptor expression on the cell soma and dendrites (Fig.l9B). Importantly, co-localisation of some GABA^ receptor clusters with AP2 complexes, seen as yellow staining in the merged panel, could be detected on the plasma membrane (Fig. 19C).
105 I.p . P-adaptin IgG
' *
Blot BD17
Figure 17: GABA^ receptors immunoprecipitate with AP2 from brain. Detergent-solubilized brain extracts were immunoprecipitated with anti P-adaptin or control IgG. Bound material was resolved by SDS-PAGE and analysed by immunoblotting with an anti-GABAA p2/p3 subunit antibody.
106 A H P2 S3 P4 S5 CCV GABAa Receptor B a-adaptin
C (3-adaptin
Figure 18: Co-fractionation ofGABA a receptor (33 subunit with a- and p-adaptin throughout the clathrin-coated vesicles purification. Equal amounts of protein fractions ( 100 pg) were resolved by SDS-PAGE and analysed by immunoblotting with an anti-GABAA receptor (33 subunit antibody (A), anti-a (B) or anti-(3 adaptin (C) antibody.
107 ■ m
Figure 19: GABA^^ receptors co-localise with AP2 in clathrin-coated pits in cultured hippocampal neurones. Cultured hippocampal neurones (3 weeks old) were permeabilised and probed with a mouse anti P-adaptin monoclonal antibody (A) and rabbit anti-GABAy\ receptor pl/p3 subunit polyclonal antibody (B). Antibodies were visualised with anti-rabbit FITC-conjugated and anti-mouse Texas Red-conjugated secondai^ antibodies. An enlargement of a dendrite is shown in each panel. GABAy\ receptor which co-localise with AP2 can be seen as yellow clusters in the merged image in C (see arrow heads). Scale bar, 10 pM.
108 4.7 Blocking dynamin-dependent endocytosis results in an increase in the amplitude of mIPSCs
The biochemical and morphological results presented above strongly suggest that
GAB A A receptors in A293 cells and neurones are undergoing constitutive endocytosis facilitated by an association with AP2. It was of interest to investigate the functional significance of this internalisation. To do this the effects of compounds that block clathrin-dependent endocytosis on GABA^ receptor-mediated miniature inhibitory postsynaptic currents (mIPSCs) was examined (this work was carried out by Dr Patrick
Delmas, Wellcome Laboratory of Molecular Neuropharmacology, UCL). mIPSCs were recorded at -70mV in the presence of TTX (0.5 pM), APV (50 pM) and CNQX (20 pM).
To selectively block endocytosis a 10 amino acid peptide -P4 (QVPSRPNRAP) was used that is known to interfere with the binding of amphyphysin with dynamin and block endocytosis (Marks and McMahon, 1998; Wigge and McMahon, 1998). The interaction between dynamin and amphyphysin is essential for endocytosis (Wigge et al., 1997a,
Marsh and McMahon, 1999). About 10 min after the establishment of the whole-cell recording mode, the size of the GABA^ mIPSC began to increase and reached a plateau at
1.7-2.3-fold of its control value within 40-50 min (Fig. 20 & 21). In addition to its effect on mIPSC amplitude the P4 peptide also increased mIPSC frequency (Fig. 20). Although this could possibly result from a higher rate of quantal release (Thompson et al., 1993;
Cohen et al., 1992) it could also be fully accounted for by the recruitment of mIPSCs previously below the threshold of detection, owing to an increased number of active receptors (Liao et al., 1995; Wan et al., 1997; Man et al., 2000). As a control, experiments were performed in which neurones were loaded with a control peptide -SP
(PRAPNSRQPV), which had no significant effect on GABA^ mIPSC amplitude or frequency (Fig 21). Blocking endocytosis in a hippocampal slice preperation by intracellular patch perfusion of a GST fusion protein of the amphiphysin SH3 domain
109 A 3 min 27 min
■ o r — Y^pl^y^yjnyy^l'Vv^
B
742 events, p = 21 pA 545 events, ^ = 15 pA
0) 2 0 -
10 15 20 25 30 35 40 10 15 20 25 30 35 40 45 50 55 60 Amplitude (pA) Amplitude (pA)
Figure 20: Blocking endocytosis increases the amplitude of GABA^^-mediated mIPSCs in hippocampal neurones. (A), Consecutive traces of mIPSCs selected 3 min (left panel) and 27 min (right panel) after achieving whole-cell recording with pipette solution containing the endocytosis blocking P4 peptide (50 uM). (B), Histograms showing amplitude distributions of a 4 min recording of mlPSCs starting at the time indicated in (A). 110 2501
X = 24 ms
200- Q. E X = 22 ms CO -o 150-
ICO i 1 0 0 - O Z 50-
0 10 20 30 40 50 60 Time (min)
Figure 21: Time course of the effects of P4 endocytosis block on GABA^-inediated mIPSCs. Normalised mIPSC amplitude plotted against time after break-in with an internal solution containing either 50 pM P4 ( • ) or 50 uM SP control (O). The amplitude of the mIPSCs was calculated by averaging individual mIPSCs every I min recording. Each point represents the mean ± s.e.m. of 4-5 cells. The time on the X axis represents the time following patch breakthrough. Inset: single exponential decay of mIPSCs selected 3 min (a) and 40 min (b) after break-in with the P4 peptide. No change in kinetics was detected during the enhancement of mIPSCs by the P4 peptide.
II produces a similar increase in G ABA mIPSC amplitude (Dr Philippe Thomas and
Professor Trevor Smart -personal communication). The amphiphysin SH3 domain has previously been shown to block endocytosis by disrupting the interaction between dynamin and amphiphysin (Wigge et al., 1997a; Wigge and McMahon, 1998). Therefore, these fusion protein studies are in agreement with the results obtained using the P4 peptide. The results obtained using either the P4 peptide or amphiphysin SH3 domain suggest an increased number of active post-synaptic GABA^ receptors following blockade of endocytosis, which is consistent with the cycling of GABA^ receptors between synaptic and intracellular sites.
112 4.8 Discussion
The work presented here supports the hypothesis that GABA^ receptors are removed from the postsynaptic plasma membrane by clathrin-mediated endocytosis.
Internalisation of recombinant GABA^ receptors expressed in A293 cells was blocked by hypertonic sucrose which blocks clathrin-mediated endocytosis (Heuser et al., 1999;
Carroll et al., 1999). Furthermore the PKC-induced down regulation of GABA^ receptors
(Chapel et al., 1998; Connolly et al., 1999b) was also blocked by the high sucrose protocol suggesting that the kinase induced reduction in receptor number is also dependent on the same mechanism of internalisation. This is consistent with previous observations in A293 cells made using electron microscopy showing the localisation of the t2S subunit to coated pits at steady state in this system (Connolly et al., 1999a).
Endocytosis of neuronal GABA^ receptors in cultured hippocampal neurones was also inhibited by blocking clathrin-mediated endocytosis.
To further elucidate the mechanism by which GABA^ receptors are selectively recruited to clathrin-coated pits, investigations were carried out to determine if these receptors could associate with proteins implicated in the recruitment of integral membrane proteins to clathrin-coated pits. GABA^ receptors were found to associate, via their intracellular loops, with the adaptin complex AP2, expressed in both cell lines and brain.
Interestingly, association of adaptin complexes was found to occur only with the intracellular loops of the GABA^ receptor p and y subunits but not with a subunits. This is an intriguing result but may be explained by the fact that a subunits are incapable of accessing the cell surface as monomers in both cell lines and neurones (Connolly et al.,
1996; Gorrie et al., 1997). They should therefore only be present at the cell surface as heteromeric receptors eomplexed with p and y subunits. Presumably, this is sufficient to allow their internalisation via the association of GABA^ receptor P and y subunits with adaptin complexes. The previous report of detection of GABA,^ receptor a l subunits in
113 clathrin-coated vesicles (Tehrani and Barnes, 1997a,b) agrees with the suggestion that a subunits can access clathrin coated pits but this is likely to occur only in association with
GABA a receptor p and y subunits. Furthermore, previous studies have shown that the trafficking itineraries of ap versus apy containing subunits differ, with apy containing receptors able to access a deeper endosomal compartment (Connolly et al., 1999 a,b). This may explain why both p and y subunits are able to separately associate with adaptins.
Importantly, it was also possible to show that GABA^ receptors co-fractionate with adaptin complexes in clathrin-coated vesicles. Furthermore, it was also possible to detect co-localisation of AP2 and GABA^ receptors at a number of sites on the plasma membrane of cultured hippocampal neurones. As would be expected, only a subset of receptors were co-localised with adaptin complexes since the majority of receptors would be expected to be associated with the inhibitory postsynaptic scaffold.
To further investigate the role of endocytosis and recycling in regulating the number of synaptic GABA^ receptors the effects of loading neurones with reagents that block endocytosis were investigated. Cultured hippocampal neurones were loaded via the patch pipette with a peptide that blocks endocytosis by disrupting the interaction between dynamin and amphyphysin, an interaction that is essential for endocytosis (Wigge et al.,
1997a; Marks and McMahon, 1998; Luscher et al., 1999). This resulted in a significant
‘run up’ in the amplitude of GABA^-mediated mIPSCs consistent with an accumulation of surface GABA^ receptors. These results confirm that synaptic GABA^ receptors undergo constitutive endocytosis by a dynamin-dependent mechanism. This cycling of
GABA a receptors may function to regulate the number of receptors in the inhibitory postsynaptic domain thereby allowing the neurone to regulate the efficacy of inhibitory synaptic transmission. These results are also consistent with our observation that these receptors associate with the AP2 adaptin complex. AP2 complexes have been implicated in the recruitment of a growing number of plasma membrane proteins into clathrin-coated
114 pits to allow their internalisation (Schmid, 1997) including ionotropic glutamate receptors
(Man et al., 2000). It is therefore likely that the association between GABA^ receptors and
AP2 serves to recruit these receptors into coated pits to allow their removal via the endocytic pathway. Similarly to the internalisation of ionotropic glutamate receptors, it remains to be discovered if internalisation of GABA^ receptors occurs by regulation of the interaction with adaptin complexes or if this internalisation occurs to all receptors ‘by default’ directly upon release from the postsynaptic scaffolds that link these receptors to the cytoskeleton. It is clear that clathrin-mediated endocytosis of GABA^ receptors could be an important means of regulating the levels of cell surface expression of these receptors and therefore of modulating their function. However it will be of importance to discover the signalling pathways neurones use to control GABA^ receptor endocytosis.
Downregulation of GABA^ receptor function has been previously observed by prolonged treatment with GAB A, barbiturates, benzodiazepines and neurosteroids (Barnes, 1996) and has recently also been shown to be essential for the E-S coupling component of long term potentiation (LTP) (Lu et al., 2000). Clathrin-mediated endocytosis of GABA^ receptors, dependent on their recruitment to clathrin-coated pits via association with adaptin complexes is therefore likely to be an important mechanism for regulating the strength of inhibitory synaptic transmission and synaptic plasticity.
115 CHAPTER 5
5.1 Introduction
GABA^ receptors are predominantly found clustered at inhibitory GABAergic synapses
(Craig et al., 1994). Two microtubule binding proteins, gephyrin and GAB ARAB, are believed to be important for clustering and anchoring GABA^ receptors by facilitating binding to the cytoskeleton (Essrich et al., 1998; Kneussel et al., 1999; Wang et al., 1999).
Gephyrin co-localises with GABA^ receptor clusters in many brain regions (Craig et al.,
1996; Sassoe-Pogneto et al., 2000) and is a determinant for the synaptic localisation of
GABAa receptors in neurones (Essrich et al., 1998; Kneussel et al., 1999). However, there is little evidence for a direct interaction between GABA^ receptors and gephyrin.
GAB ARAB, a IVkDa polypeptide identified from a yeast two hybrid screen using the intracellular domain of the GABA^ receptor yZ subunit, has been shown to associate with
GABAa receptors in vivo and is also capable of binding microtubules (Wang et al., 1999;
Wang and Olsen, 2000). It has also been suggested that GAB ARAB may serve as a linker between GABAa receptors and gephyrin (Bassafaro and Sheng, 1999; Kneussel and Betz,
2000). In agreement with this it has been recently reported that GAB ARAB and gephyrin interact weakly in vitro (Kneussel et al., 2000).
A 16 kDa polypeptide, GATE-16, exhibits high amino acid sequence homology to
GAB ARAB (Sagiv et al., 2000). GATE-16 acts as a soluble transport factor to promote intra-Golgi transport (Legesse-Miller et al., 1998). GATE-16 also interacts with NSF
(Sagiv et al., 2000), a protein that plays an essential role in intracellular membrane trafficking events (Rothman, 1994). NSE has recently been shown to be of importance in the membrane trafficking and cell surface targeting of ionotropic AMBA type glutamate receptors (Nishimune et al., 1998; Osten et al., 1998; Song et al., 1998; Noel et al.,1999;
Luscher et al., 1999) and to play a role in (3-adrenergic receptor internalisation (McDonald
116 et al., 1999). These observations suggest that NSF may have a role in receptor trafficking events.
Using light and electron microscopy it was possible to show that in neurones
GABARAP immunoreactivity (IR) is largely associated with intracellular membrane structures including the Golgi apparatus and subsynaptic cistemae, with only low levels being associated with synaptic GABA^ receptors. Furthermore, little overlap in the subcellular distribution of GABARAP and gephyrin was evident. However GABARAP was able to directly interact with NSF. Together these observations suggest that
GABARAP is not a major component of the inhibitory postsynaptic scaffold, but may play a role in intracellular receptor trafficking by recruiting NSF to GABA^ receptors cycling between intracellular compartments and the cell surface.
117 5.2 Distribution of GABARAP in cultured hippocampal neurones
Initially, the subcellular distribution of GABARAP was examined in cultured hippocampal neurones by immunofluorescence and confocal microscopy using an antisera to
GABARAP (Wang et al., 1999). In order to determine in which compartments GABARAP was localised, double labelling experiments with an antibody to GABARAP and an antibody to
MAP2 were carried out. MAP2 is localised to the somatodendritic region of hippocampal neurones in culture (Craig and Banker, 1994). The majority of GABARAP (Fig. 22A) is in
MAP2 positive cell soma and processes (Fig. 22B). GABARAP in the cell soma appears to be in intracellular compartments and in processes GABARAP has a clustered distribution along dendrites (Fig. 22A). A proportion of GABARAP can also be detected in a MAP2 negative axonal process (Fig. 22A- see arrows). These results suggest that GABARAP can be found in both somatodendritic and axonal compartments of neurones.
5.3 Localisation of GABARAP and gephyrin to GABA^ receptor clusters and synaptic sites
It was important to gain further information on the relationship between
GABARAP and gephyrin in GABA^ receptor clustering. To achieve this the co distribution of GABARAP and gephyrin with the GABA^ receptor y2 subunit was examined in cultured hippocampal neurones using double immunofluorescence and confocal microscopy. In agreement with previous studies in mature cultures (Essrich et al., 1998), a high number of GABA^ receptor clusters containing the y2 subunit co localised with gephyrin (Fig. 23A-C). In contrast, only a low level of co-localisation could be detected between GABARAP clusters and the ^2 subunit (Fig. 23D-F). Previous studies have shown clusters of GABA^ receptors on cultured hippocampal neurones correlate only partially with functional synapses (Kannenberg et al., 1999). It was therefore important to determine if clusters of GABARAP and gephyrin were found at
118 Figure 22: Distribution of GABARAP in hippocampal neurones. Cultured hippocampal neurones (3 weeks old) were permeabilised and probed with a rabbit anti-GABARAP polyclonal antibody (A) and mouse anti-MAP2 monoclonal antibody (B). The majority of GABARAP (A) is in MAP2 positive cell soma and processes (B). GABARAP can also be detected in a MAP2 negative axonal process (arrow heads in A). Scale bar 10 uM.
119 synaptic sites. Double labelling experiments were therefore carried out using anti- synaptophysin antisera to mark synapses in conjunction with either the MAB 7a anti- gephyrin or anti-GABARAP antibody (Wang et al., 1999). As reported previously (Craig et al., 1996; Essrich et al., 1998), gephyrin clusters were found predominantly at synaptic sites (Fig. 23G-I). In contrast, only a small amount of GABARAP staining overlapped with synaptophysin (Fig. 23J-L). Finally, the distribution of GABARAP was also compared to that of gephyrin in order to determine if the distribution of these molecules had similar subcellular distributions, as would be expected if GABARAP was acting as a bridging molecule between the y2 subunit and gephyrin (Passafaro and Sheng, 1999;
Kneussel et al., 2000). From these experiments it could be seen that only a small proportion of GABARAP clusters co-localised with gephyrin (Fig. 23M-0).
The degree of co-localisation of gephyrin and GABARAP clusters with that of the
GABA^ receptor yZ subunit and synaptophysin (Fig. 24) was quantified (see methods).
88.4±7.8 % (n=6 cells) of 72 subunit containing GABA^ receptor clusters were positive for gephyrin whereas only 20.0±1.7 % (n=4 cells) of 72 subunit clusters co-localised with
GABARAP. Quantification of the overlap between GABARAP and gephyrin with synaptophysin revealed that 62.8±7.2 % (n=5 cells) of gephyrin clusters were detected at synapses whereas only 17.6±2.8 % (n=5 cells) of GABARAP clusters were synaptic.
Finally, only 19.0±4.7 % (n=4 cells) of gephyrin puncta overlapped with GABARAP staining.
5.4 Ultrastructural localisation of GABARAP
The immunocytochemical studies described above suggested that the majority of
GABARAP in neurones is localised to intracellular compartments. To gain more detailed information regarding the subcellular distribution of GABARAP immunoreactivity (IR),
120 Figure 23: The co-distribution of GABARAP (E, K) and gephyrin (B, H) with the GABA^ receptor y2 subunit (A, D) and synaptophysin (G, J) was examined in 3 week old cultured hippocampal neurons. An enlargement of the same dendrite is shown at the bottom of each panel. Gephyrin (B) could be detected at the majority of GABA^ receptor y2 subunit positive sites (A) as can be seen in the merged panel (C) whereas only low levels of GABARAP (E) co-localise with y2 (D) as seen in the merged panel (F). Many gephyrin clusters (H) are found at synaptophysin postive sites (G) as seen in the merged panel (I) whereas only low levels of GABARAP (K) are found at synaptophysin positive sites (J) as seen in the merged panel (L). The co-distribution of gephyrin (M) with GABARAP (N) was also analysed. There is only a low overlap between gephyrin (M) and GABARAP (N) as seen in the merged panel (O). Scale bar 10 pm. 121 1 0 0
G o Z fd N f—4 V 0 f -H1 O U
Figure 24: Only low levels of GABARAP are found at the inhibitory postsynaptic scaffold. For each column, the number of co-localised clusters was determined for 150-200 pm of dendrite for 4-5 cells as described in the methods. Co-localisation of gephyrin (column 1) and GABARAP (column 2) with the GABAy\ receptor y2 subunit. Co-localisation of gephyrin (column 3) and GABARAP (column 4) to synaptophysin positive synaptic sites. Co-localisation of gephyrin and GABARAP (column 5).
22 the distribution of GABARAP-IR in ventral horn of rat cervical spinal cord and in the hippocampus of adult rat was examined using electron microscopy (This work was carried out by Philippe Rostaing in the laboratory of Dr Antoine Triller, Ecole Normale, Paris). In the spinal cord, synaptic activity is controlled by glycine and GAB A mediated inhibition, while in the hippocampus it is mediated by GAB A only. In both cases the corresponding receptors are associated in the postsynaptic membrane with gephyrin (Triller et al. 1985;
1987; Todd et al. 1996; Vannier and Triller 1997; Sassoe-Pognetto et al. 2000). The patterns of GABARAP expression were identical in the hippocampus and in spinal cord.
Consistent with the immunofluorescence experiments, the majority of GABARAP was detected in intracellular compartments with only low levels found at synaptic sites. With pre-embedding immunoperoxidase methods numerous GABARAP-IR deposits were found in dendrites, axons or in somata. In dendrites, the GABARAP-IR was either scattered in the cytoplasm (Fig 25A 1 and A3 -crossed arrows) or more rarely, associated with postsynaptic membranes (Fig 25A1-4 arrows). As a result of the preembedding method, the localisation of the electron dense deposit could result from a translocation and subsequent adsorption of the enzymatic reaction product. To exclude this possibility the distribution of GABARAP was also examined using gold-toned silver-intensified nanogold particles. The labelling observed with the immunoperoxidase method was confirmed using the immunogold method (Fig. 25B, C). The gold particles were scattered in the dendroplasm (Fig 4B) and could also be detected adjacent to postsynaptic membranes (Fig. 25 C l,2), the latter being close to synaptic boutons containing a pleiomorphic population of vesicles. Interestingly, with the immunogold method it was evident that when GABARAP was detected in proximity to postsynaptic membranes it was often associated with minute cistemae (Fig 25B, C). Such subsynaptic ci stern ae have been shown to contain many components of the protein synthetic machinery (Gardiol et al. 1999) or alternatively may be part of subsynaptic tubulo-vesicular endosomes. The
123 A, ' ?>=. » A3 J Æ&mmii y.f
. “-J; : %'- - .
r» A4
^6 ' " %:V y.%j^v)C3 'b'
% % # ■ . ""' ' _ k 2 % |
1 b
Figure 25: Subcellular distribution of GABARAP-IR in dendrites and axons. A I-A4, discontinuous deposit of electron dense HRP reaction product (A 1-4) in the cytoplasm of dendrites (de) which decorate (arrows) or not (crossed arrows) the postsynaptic differentiation facing presynaptic boutons filled with a pleiomorphic population of vesicles. B, C, immunogold detection of GABARAP. Gold particles which can be associated (arrows) or not (crossed arrows) with cistemae (arrowheads) are either scattered in the dendritic cytoplasm (B) or close to a postsynaptic membrane (C l-4). Note that the shape of the gold particle-associated postsysnaptic cistemae can vary from one another. D, double detection of GABARAP associated gold particles (arrows) and gephyrin immunoperoxidase electron dense deposits (double crossed arrow). Note the absence of colocalisation. E, The presence of GABARAP-IR can also be detected in axons. A 1-2, B. Cl-3, D, E and A3, A4 and C4 are from the ventral horn of the spinal cord and from the hippocampus respectively. Calibration bars; 0.5 //m. 124 presence of GABARAP-IR at these sites may therefore suggest a role for this protein in dendritic protein synthesis and local membrane insertion or endocytosis.
When GABARAP-IR was found at the postsynaptic level, it was not directly adjacent to or at a constant distance from the plasma membrane as seen for proteins of the postsynaptic scaffold such as gephyrin (Triller et al. 1987). In agreement with this, double-labelling experiments indicated that in most cases, gephyrin and GABARAP-IR were not co-localised (Fig 25D). These results provide further evidence that GABARAP is not a key component of the inhibitory postsynaptic scaffold. The presence of
GABARAP-IR in axons, already seen in cultured neurones, was confirmed with the immunogold approach (Fig. 25E).
The distribution the GABARAP staining found on intracellular membranes was further investigated. With the immunoenzymatic method, a discontinuous GABARAP-IR was scattered in the somata of most neurones (Fig 26A-D). At this location, deposits of electron dense immunoenzymatic reaction product were associated with cisternae of the endoplasmic reticulum (Fig 26B1-2) or of the Golgi apparatus (Fig 26C-D). With both immunoenzymatic (Fig 26B1) and immunogold methods (Fig 26B2) GABARAP-IR decorated the cytoplasmic side of rough endoplasmic cisternae. At the Golgi apparatus, the distribution pattern of the GABARAP-IR was further examined. The immunoenzymatic electron-dense deposits predominated at the edges of the stacks of
Golgi cisternae (Fig 26C1-3) where vesicles bud or fuse (Mellman and Warren, 2000).
This labelling was confirmed using the immunogold method (Fig 26D1-3). Therefore the localisation of GABARAP-IR at the edge of the Golgi apparatus and other intracellular membranes is compatible with a role for this GABARAP in intracellular protein transport.
125 * > % 3# C y '
Figure 26: Subcellular distribution ot GABARAP IR in the neuronal somata. The deposits of immunoenzymatic reaction product are associated with the Golgi apparatus (arrow, Go) and with the reticulum (arrowheads). B 1-2, Reticulum associated GABARAP-IR: the electron dense deposit (arrowhead, Bl) or the associated gold particles (arrowheads. B2) are adjacent to the cytoplasmic side of the reticulum cisternae. C-D, Golgi apparatus associated GABARAP-IR. The electron dense deposit (arrows, C 1-3) or the associated gold particles (arrows, Dl-3) are associated with the cytoplasmic side of the Golgi cisternae. Note that the labeling predominates at the edge of the stacks where vesicle bud or fuse.
26 5.5 Association of GABARAP with A-ethylmaleimide sensitive factor (NSF)
The low levels of co-localisation of GABARAP with either the synaptic clusters of the y2 subunit or gephyrin strongly suggests that GABARAP is not acting to cluster
GABA^ receptors at synaptic sites or to act as a linker molecule between the y2 subunit and gephyrin. The localisation of GABARAP to intracellular membrane compartments, including the Golgi apparatus and subsynaptic cisternae suggests that GABARAP may be important for intracellular transport of GABA^ receptors. Interestingly, a close homologue of GABARAP, GATE-16, has been shown to act as an intracellular transport factor via its ability to interact with NSF (Sagiv et al., 2000). NSF plays a role in the trafficking of AMPA type glutamate receptors (reviewed by Haas, 1998; Jahn, 1998) and the |3-adrenergic receptor (McDonald et al., 1999). It was therefore of interest to examine whether GABARAP, like its homolog GATE-16, could associate with NSF since this would provide further evidence for the role of GABARAP in GABA^ receptor trafficking.
This was tested using affinity ‘pull down’ assays from COS-7 cell lysates expressing myc-tagged rat NSF (Song et al., 1998) with full length GABARAP expressed as a glutathione-S-transferase (GST) fusion protein (Wang et al., 1999). Purified GST-
GABARAP immobilised on glutathione agarose beads was exposed to detergent solubilised extracts of COS-7 cells transiently transfected with myc-tagged NSF. After extensive washing, bound proteins were eluted in SDS sample buffer, resolved by SDS-
PAGF and analysed by Western blotting using anti-myc antibodies. Using this assay
GST-GABARAP was found to interact with myc-NSF (Fig. 27A). In contrast, GST alone was not found to interact with myc-NSF (Fig. 27A). These results suggest that
GABARAP can interact with NSF in the cytosol, however this does not exclude an indirect interaction between the two proteins. To verify that GABARAP interacts directly with NSF, GST-GABARAP immobilised on glutathione agarose beads was incubated with recombinant myc-tagged NSF in vitro (Sollner et al., 1993). Using this assay.
127 NSF UT NSF NSF B Input; myc-NSF (pg) 97 0 2.5 5 0 2.5 5 97
66 66 GST GST Input RAP CST-CABARAI»GST
+ NSF +NSF +GBR U.T. +GBR U.T. 9 7 _____ 97 D Blot9E10
66 ■ 66 2 1 . Brain GST GST RAP Blot FLAG
1 4 . Input I P . FLAG
Figure 27: GABARAP associates with NSF. GABARAP-GST (GST RAP- in A and C) and GST were exposed to cell lysates transfected with myc-tagged NSF (A), purified recombinant myc-NSF (B) or brain extracts. After extensive washing bound material was resolved by SDS-PAGE and analysed by immunoblotting with an anti-myc (A, B) or anti-NSF antibody (C). Binding of NSF to GABARAP-GST but not GST was detected in all cases (A-C). GABARAP (GBR) co-immunoprecipitates with NSF from cell lysates (D). Lysates from untransfected cells (U.T.) or cells co-transfected with myc- G ABA RAP and FLAG-NSF (+NSF,+GBR) were immunoprecipitated with anti-FLAG. Bound material was resolved by SDS-PAGE and analyzed by immunoblotting with an anti-myc antibody to detect NSF (blot 9E10) and anti-FLAG antibody (blot FLAG) to detect GABARAP (D).
28 significant amounts of recombinant myc-tagged NSF was found to associate with
GABARAP (Fig. 27B), confirming a direct interaction between NSF and GABARAP.
To confirm if GABARAP could also interact with NSF in brain. GST-GABARAP was exposed to brain extracts and associated proteins were resolved by SDS-PAGE and probed with an anti-NSF antibody. GST-GABARAP was found to interact with NSF from brain extracts (Fig. 27C). In contrast GST alone did not bind to NSF from brain lysates
(Fig. 27C). These results strongly suggest that GABARAP is able to interact with NSF in brain.
The interaction of GABARAP with NSF was further tested via immunoprécipitation. Extracts of COS-7 cells transiently transfected with myc-tagged
NSF and FLAG-tagged GABARAP were immunoprecipitated with anti-FLAG antibody and then precipitated material was probed using anti-myc and anti-FLAG antibodies. NSF can clearly be seen to co-immunoprecipitate with GABARAP (Fig. 27D). These results further confirm that GABARAP can associate with NSF.
5.6 GABARAP and NSF co-localise in cultured hippocampal neurones
Finally, to provide further evidence that GABARAP and NSF associate in vivo, the localisation of these two proteins was examined in cultured hippocampal neurones using double immunofluorescence and confocal microscopy. Hippocampal neurones that had been maintained in culture for three weeks were double labelled with a rabbit antibody to
GABARAP (Fig. 28A) and a monoclonal anti-NSF antibody (Fig. 28B), and visualised with FITC conjugated anti-rabbit and Texas Red conjugated anti-mouse secondary antibodies, respectively. Importantly, a large amount of co-localisation of GABARAP with NSF, seen as yellow staining in the merged panel, could be detected (Fig. 28C).
129 Figure 28: GABARAP co-localizes with NSF in cultured hippocampal neurones. Cultured hippocampal neurones (3 weeks old) were permeabilised and probed with a rabbit anti-GABARAP polyclonal antibody (A) and mouse anti-NSF monoclonal antibody (B). Antibodies were visualised with anti-rabbit FITC-conjugated and anti-mouse Texas Red-conjugated secondary antibodies. An enlargement of the same dendrite is shown in each panel. GABARAP, which co-localises with NSF can be seen as yellow staining in the merged image (C). Scale bar 10 pm.
30 5.7 Discussion
The correct targeting of GABA^ receptors to the appropriate synaptic sites is critical for efficient inhibitory synaptic transmission (Essrich et al., 1998). Using the yeast two-hybrid system a novel 17kDa microtubule binding protein called GABARAP has been isolated which binds specifically to the GABA^ receptor y2 subunit (Wang et al.,
1999). GABARAP can bind to microtubules in vitro, immunoprecipitates with GABA^ receptors from brain and co-localises with some GABA^ receptor clusters in cultured cortical neurones suggesting that this new receptor associated protein may be involved in linking GABA^ receptors to the cytoskeleton at GABAergic synapses (Wang et al., 1999;
Wang and Olsen, 2000).
In addition to GABARAP, gephyrin, another tubulin binding protein, has been implicated in the synaptic targeting and clustering of GABA^ receptors (Essrich et al.,
1998). Gephyrin was originally shown to play a central role in clustering of glycine receptors via its ability to bind the glycine receptor p subunit and tubulin (reviewed by
Kneussel and Betz, 2000a,b). The essential role of gephyrin in mediating glycine receptor clustering has been demonstrated by gene knock-out, which abolishes glycine receptor clustering at synaptic sites (Feng et al., 1998b). In addition to its role at glycinergic synapses, gephyrin also co-localises with GABA^ receptor subunits at synaptic sites within the CNS suggesting a role for gephyrin in the synaptic clustering of GABA^ receptors (Craig et al., 1996; Sasso-Pognetto et al., 2000). Confirmation of the importance of gephyrin in GABA^ receptor anchoring comes form inhibition of gephyrin expression using either antisense oligonucleotides or gene deletion, both of which reduce the clustering of GABA^ receptors at synaptic sites (Essrich et al., 1998; Kneussel et al.,
1999). However whether gephyrin directly interacts with GABA^ receptor subunits remains to be determined.
131 To further elucidate the role of GABARAP and gephyrin in GABA^ receptor membrane trafficking, the distribution of these two proteins was compared in hippocampal neurones to that for y2 subunit containing GABA^ receptors. In this system
GABAa receptors have been previously documented to be enriched at synaptic sites
(Craig et al., 1994; 1996). Using immunofluorescence virtually all GABA^ receptor clusters containing the y2 subunit also contained gephyrin-IR. In addition, many of the clusters of gephyrin-IR were at synaptic sites as defined by co-localisation of gephyrin staining with synaptophysin staining. In contrast, the majority of GABA^ receptor clusters did not contain GABARAP-IR. Furthermore, GABARAP-IR was rarely found at synaptic sites as reflected by low levels of co-localisation with synaptophysin staining and confirmed with electron microscopy. Non-quantitative fluorescent methods in spinal cord neurones have also revealed that the majority of GABARAP is not associated with
GABA^ receptor clusters (Knuessel et al., 2000). The strong co-localisation of gephyrin-
IR with GABA^ receptor clusters is consistent with a role for this protein in receptor anchoring as suggested by previous studies (Essrich et al., 1998; Kneussel et al., 1999).
The low level of GABARAP co-localisation with GABA^ receptor clusters and synaptophysin suggest that this protein is not primarily involved in receptor anchoring at synaptic sites. From the expression patterns of gephyrin and GABARAP it was evident that immunoreactivity for these 2 proteins showed only limited co-localisation despite the observation that they can interact in vitro (Knuessel et al., 2000). This suggests that
GABARAP is unlikely to act as a linker molecule between GABA^ receptors and gephyrin. Interestingly, in a recent study it has been proposed that GABA^ receptors and gephyrin are clustered at inhibitory synapses independently of the tubulin cytoskeleton
(Allison et al., 2000). This would further suggest that the microtubule binding activity of
GABARAP is unlikely to be important for the maintenance of the inhibitory synaptic scaffold.
132 GABARAP-IR was found in both somatodendritic and axonal domains with clusters of fluorescence being evident within neuronal processes. Using electron microscopy GABARAP was localised to intracellular membrane compartments including the Golgi apparatus and subsynaptic cisternae. Furthermore the study presented here demonstrates that GABARAP and NSF can associate and share overlapping distributions in hippocampal neurones. A homologue of GABARAP, GATE 16 has been isolated which has 68% amino acid identity to rat GABARAP (Sagiv et al., 2000). GATE 16, like
GABARAP, is highly expressed in the brain on intracellular membranes and is capable of binding NSF.
The rapid cycling of AMPA receptors between intracellular compartments and the cell surface has recently been reported and it has been suggested that the interaction between NSF and AMPA receptors may be important for this process (Luscher et al.,
1999). Previously, it has been reported that GABA^ receptors constitutively endocytose in both recombinant and neuronal systems (Connolly et al., 1999a,b; Kittler et al., 2000a).
Furthermore as described in chapter 4 of this thesis, reagents that block endocytosis rapidly increase GABA^ receptor mediated synaptic responses (Kittler et al., 2000b).
These results suggest that synaptic GABA^ receptors can cycle between intracellular and cell surface pools in a similar fashion to AMPA receptors (Luscher et al., 1999). NSF via an association with GABARAP could be important for the cell surface trafficking of
GABA^ receptors in a manner analogous to role played by NSF in AMPA receptor trafficking (Nishimune et al., 1998; Osten et al., 1998; Song et al., 1998; Noel et al.,
1999).
NSF has also been implicated in (3-adrenergic receptor endocytosis via a direct association with (3-arrestin 1 (McDonald et al., 1999) and is also essential for endosome fusion (Burd et al., 1997; Robinson et al., 1997). Another GABARAP homologue, Aut7p has been isolated from yeast (Lang et al., 1998). Interestingly, Aut7p has microtubule
133 binding activity and controls the targeting of vesicles to the vacuolar system, a pathway that has many similarities to the endosomal / lysozomal system in mammalian cells (Lang et ah, 1998). This may suggest that GABARAP and NSF could alternatively be important in GABA^ receptor endocytosis. Given that Aut7p a yeast homologue of GABARAP is important for trafficking to the mammalian equivalent of a deep endosomal/lyzosomal compartment it is possible that GABARAP may be conferring specificity to the destination within the endosomal system of GABA^ receptors containing the y2 subunit.
The relevance of this to trafficking of neuronal GABA^ receptors is unclear.
Our observations strongly suggest that gephyrin and GABARAP are likely to be involved in different aspects of GABA^ receptor function. The studies described here show that GABARAP is not a key component of the inhibitory postsynaptic scaffold and therefore is unlikely to play a role in synaptic anchoring or to act as a bridging molecule between GABA^ receptors and gephyrin. The subcellular localisation of GABARAP and it’s ability to bind NSF suggest it plays a role in the transport of GABA^ receptors between intracellular storage compartments and cell surface domains. GABARAP may therefore have an important role in the production and maintenance of GABAergic synapses.
134 CHAPTER 6 FINAL DISCUSSION
6.1 Summary
In the mammalian brain, GABA^ receptors are specifically targeted to distinct postsynaptic domains where they are concentrated in receptor clusters. This thesis describes studies carried out to gain further insight into the mechanisms important for the specific accumulation of GABA^^ receptors at synaptic sites. To this end, molecular, biochemical and cell biological methodologies were used to analyse receptor trafficking in neurones.
In order to study GABA^^ receptor trafficking in live cells, a GABA^ receptor y2L subunit GFP fusion protein was constructed. Both amino and carboxyl terminus y2L subunit GFP fusion proteins, when co-expressed with receptor a l and p2 subunits, produced GAB A gated chloride channels that could be potentiated by benzodiazepines. However, addition of GFP to the C-terminus of y2L produced a receptor subunit that was less stable and assembled less efficiently into functional receptors as determined by biochemical and electrophysiological methods. In contrast to this, addition of GFP to the amino terminus of the ylL subunit produced a receptor with properties that were very similar to those of the wild type 72 L subunit. Using the y2L-GFPN subunit GFP fusion protein it was possible to verify in live cells observations made on the endocytosis and subunit dependency of cell surface trafficking of this subunit. Furthermore, the y2L-
GFPN was also targeted to inhibitory synapses in cultured hippocampal neurones.
Interestingly, the cell surface targeting of the ylL -GFPN fusion protein showed the same subunit dependency in neurones as in recombinant systems.
The endocytosis of GABA^ receptors observed in A293 cells using y2L -GFPN was also observed for GABA^ receptors in cultured hippocampal neurones and found to occur via clathrin dependent endocytosis. The intracellular domains of the GABA^
135 receptor (3 and y2 subunits were found to associate with the AP2 adaptin complex, which may recruit receptors into clathrin coated pits. Furthermore, blocking endocytosis resulted in a significant run up of mIPSC amplitude providing evidence that receptors are trafficking between the cell surface and intracellular storage compartments.
Work was also carried out to study the role of GABARAP in GABA,^ receptor trafficking and clustering. The distribution of GABARAP was compared to that of
GABA^ receptors and the putative GABA^ receptor clustering molecule gephyrin. Only low levels of GABARAP were found at inhibitory postsynaptic sites suggesting that this protein is not a key component of the inhibitory synaptic scaffold. Interestingly,
GABARAP was localised to intracellular compartments and subsynaptic cisternae.
Furthermore, GABARAP was found to bind to NSF, a molecule essential for intracellular trafficking events (Rothman, 1994) that has recently been implicated in receptor trafficking (McDonald et al., 1999; Nishimune et al., 1998; Song et al., 1998; Osten et al.,
1998; Noel et al., 1999). These results suggest that GABARAP may be involved in the trafficking of GABA^ receptors between intracellular storage compartments and cell surface sites.
6.2 G ABA A receptor clustering and targeting
There is substantial evidence that gephyrin is important for receptor clustering
(Essrich et al., 1998; Kneussel et al., 1999). However since it has not been possible to identify a biochemical interaction between GABA^ receptors and gephyrin in vivo, the mechanism by which gephyrin may cluster receptors remains unclear. It has been suggested that the yl subunit binding protein GABARAP could act as a linker molecule between the y2 subunit and gephyrin (Passafaro and Sheng, 1999; Kneussel and Betz,
2000a). Studies presented in this thesis, using both immunofluorescence and immunoelectron microscopy show only low levels of colocalisation of these two proteins.
136 suggesting it is unlikely that GABARAP serves to link GABA^ receptors to gephyrin. The y2 subunit may be important for the synaptic targeting of GABA^ receptors (Essrich et al.,
1998; Brickely et al., 1999) however the molecular mechanisms important for this process remain unclear. It is possible that a yZ specific protein-protein association may be acting to recruit and / or tether y2 containing receptors at synapses. GABARAP is the only y2 specific associated protein identified to date however the low levels of GABARAP at synaptic sites as demonstrated here would suggest that this protein is not likely to be involved in maintaining GABA^ receptors at synapses. Furthermore, the targeting of
GABA^ receptors is likely to be complex given that differing receptor subunit combinations can be targeted to unique subcellular domains in neurones (Koulen et al.,
1996; Nusser et al., 1996 a,b; Nusser et al., 1998b). This suggests that additional mechanisms must exist to explain the specific targeting of GABA^ receptor subunit combinations.
6.3 GABA^ receptor trafficking as a putative mechanism for synaptic plasticity
Activity dependent synaptic plasticity is thought to be important for certain forms of learning and memory (reviewed in Martin et al., 2000). Most studies of neuronal plasticity have focused on FTP and LTD of glutamatergic synapses (Bliss and
Collingridge, 1993; Nicoll and Malenka, 1995). However, studies have also reported LTP and LTD at GABAergic synapses in a number of brain regions including hippocampus
(McLean et al., 1996; Gaillard, 1999a,b) cortex (Komatsu, 1994) and cerebellum (Kano et al., 1995). It is clear that such changes in the strength of GABAergic synaptic transmission could be important in modulating neuronal plasticity since this could have an important effect on the input-output relationship of a neurone. Furthermore, LTD of
GABAergic inhibition has recently been shown to underlie the increased excitability of
CAl neurones associated with LTP (Lu et al., 2000). In this case, GABAergic LTD was
137 found to be important for increasing the likelihood in the postsynaptic cell of an EPSP discharging an action potential (Bliss and Lomo, 1973; Linden, 1999; Lu et al., 2000).
LTP and LTD of synaptic transmission can be achieved by modulating the efficacy of the postsynaptic response to transmitter release. This can be achieved by modifying receptor channel properties, for instance by phosphorylation. Alternatively, under saturating conditions of neurotransmitter, increasing or decreasing the number of receptors in the postsynaptic membrane would be expected to have a significant effect on synaptic transmission. In the case of AMPA receptors, both receptor phosphorylation and receptor turnover at postsynaptic sites have been found to effect glutamatergic synaptic strength and plasticity (O’Brien et al., 1998; Luscher et al., 1999; Man et al., 2000; Wang and Linden, 2000; Lee et al., 2000). Similarly, receptor phosphorylation can modulate
GABA^ receptor channel properties (Moss et al., 1992; Moss et al., 1995; Moss and
Smart, 1996; McDonald et al., 1998). Importantly, there is evidence to suggest that regulating the number of postsynaptic GABA^ receptors can also have a significant effect on inhibitory synaptic transmission. In cerebellar stellate cells, differences in postsynaptic receptor number have been found to determine GAB A mini amplitude (Nusser et al.,
1997). Furthermore, activity dependent increases in GABA^ receptor number have been found to underlie potentiation at hippocampal inhibitory synapses (Nusser et al., 1998a).
The mechanisms behind changes in synaptic receptor number at inhibitory synapses are unknown but could be due to an increased rate of postsynaptic receptor insertion and / or decreased rate of receptor removal.
The results presented here suggest that the regulation of postsynaptic GABA^ receptor cycling could be an effective means of regulating inhibitory synaptic transmission. In neurones, GABA^ receptors were found to constitutively endocytose by a clathrin dependent mechanism, via an association with the adaptin complex AP2.
Furthermore, blocking dynamin dependent endocytosis caused a significant run up in the
138 GAB A A receptor mIPSC. This occurred on a relatively rapid time scale (over 50% increase in mIPSC amplitude over 20 min) implying that the rates of insertion and removal of receptors are relatively fast at GABAergic synapses. Importantly, this implies that modulating the turnover of receptor number, by changing the rates of either insertion or removal of receptors could significantly effect the strength of GABAergic synaptic transmission providing a mechanism for GABAergic LTP and LTD.
This thesis also reports a potential role for NSF in GABA^ receptor trafficking via an association between NSF and GABARAP. Interestingly, NSF has already been implicated in the trafficking of both metabotropic (McDonald et al., 1999) and ionotropic receptors (Nishimune et al., 1998; Song et al., 1998; Osten et al., 1998) as well as in the generation of glutamatergic synaptic plasticity (Luscher et al., 1999; Luthi et al., 1999). In agreement with this GABARAP was found localised to intracellular compartments including subsynaptic cisternae. These membrane compartments could be part of a trafficking route taken by receptors cycling between the cell surface and internal pools.
An intracellular pool of GABA^ receptors has been detected by immunoeletron microscopy (Sur et al., 1995) and GABA^ receptors have been shown to translocate to the cell surface from internal storage compartments upon some signals (Wang et al., 1997).
By playing a role in GABA^ receptor postsynaptic membrane insertion or removal,
GABARAP via an association with NSF could serve as part of a protein complex important for regulating the postsynaptic cycling of receptors.
6.4 Future Directions
To achieve cell surface targeting of y2L GFP fusion protein in cultured neurones it was necessary to introduce cDNAs for the a l and P2 subunits at the same time. Triple transfection of neurones is both difficult and time consuming. It is perhaps surprising that the y2L GFP fusion protein could not assemble with endogenous GABA^ receptor.
139 subunits when expressed in neurones. However, it could be explained by low levels of endogenous subunits available in the ER for oligomerisation, compared to very high levels of the overexpressed y2L GFP subunit achieved by microinjection. This may preclude oligomerisation of y2L GFP with endogenous subunits into functional receptors.
Similarly, recombinant a l or p2 receptor subunits expressed in superior cervical ganglion neurones are also unable to access the cell surface on homomeric expression (Gorrie et al.,
1997). To avoid these problems it would be advantageous to develop a system that would allow oligomerisation of the y2L subunit GFPN fusion protein with endogenous subunits
To facilitate the study of GABA^ receptor trafficking using the y2L -GFPN, a transgenic mouse constitutively expressing this fusion protein under a neuronal promoter was produced. In theory, since this construct will only be integrated once into the transgenic mouse genome, it should have an expression level closer to that of endogenous subunits and hopefully will therefore assemble with endogenous receptor subunits and be targeted to synaptic sites. Unfortunately, there was insufficient time to fully characterise this mouse strain. However, this mouse strain should be very useful for the study of
GABA a receptor clustering. It should be possible to culture neurones from this mouse that would express GFP labelled inhibitory synapses. This would provide a very powerful tool to study the ontogeny and dynamics of GABAergic synaptogenesis and the molecular mechanisms of GABA^^ receptor targeting in live cells.
This thesis also describes a mechanisms for GABA^ receptor removal via clathrin mediated endocytosis. However, it will be important to identify signals in the CNS that could modify the internalisation rate of receptors. With respect to the association of
GABA^ receptors with AP2, it would be interesting to determine the polypeptide sequence in receptor intracellular domains important for the interaction with AP2 complexes. It is known that both Yxx0 and LL signals interact directly with AP2 complexes (Kirchhausen et al., 1997) and in the case of Y xx0 signals this is mediated by
140 the \x2 chain of AP2. Both Yxx0 and LL motifs can be found in GABA^ receptor
intracellular domains (Barnes, 1996). Importantly, co-crystallisation studies of \l2 with
Y xx0 peptides indicate that phospho-tyrosine can not bind in the |li2 hydrophobic binding pocket (Marsh and McMahon, 1999). Therefore, phosphorylation could switch off some tyrosine based signals to regulate endocytosis (Shiratori et al., 1997; Stephens and
Banting, 1997; Marsh and McMahon, 1999). Interestingly, a Y xx0 motif in the GABA^ receptor y2 subunint forms part of the major site of GABA^ receptor tyrosine phosphorylation (Moss et al., 1995). This could therefore provide a mechanism to regulate the association of GABA^ receptors with AP2 to regulate receptor internalisation. It would therefore be of interest to determine if this motif is important for the association of
GABA^ receptors with AP2 and the consequence of phosphorylation at this site.
It would also be helpful to better understand the functional role of some GABA^^ receptor protein associations. Work presented in this thesis provides evidence that
GABARAP is not acting as a bridging molecule between GABA^ receptors and gephyrin nor is it a key component of the inhibitory postsynaptic scaffold. GABARAP does bind
NSF suggesting a role in GABA^^ receptor trafficking however, it would be useful to define further the functional consequences of the association between GABARAP and
NSF in GABA^ receptor trafficking.
141 REFERENCES
Allison DW, Gelfand VI, Specter I, Craig AM (1998) Role of actin in anchoring postsynaptic receptors in cultured hippocampal neurones: differential attachment of NMDA versus AMPA receptors. J Neurosci 18:2423-2436.
Allison DW, Chervin AS, Gelfand VI, Craig AM (2000) Postsynaptic scaffolds of excitatory and inhibitory synapses in hippocampal neurones: maintenance of core components independent of actin filaments and microtubules. J Neurosci 20:4545-4554.
Angelotti TP, Macdonald RL (1993) Assembly of GAB A A receptor subunits: alpha 1 beta 1 and alpha 1 beta 1 gamma 2S subunits produce unique ion channels with dissimilar single- channel properties. J Neurosci 13:1429-1440.
Apel ED, Roberds SL, Campbell KP, Merlie JP (1995) Rapsyn may function as a link between the acetylcholine receptor and the agrin-binding dystrophin-associated glycoprotein complex. Neurone 15:115-126.
Apel ED, Glass DJ, Moscoso LM, Yancopoulos GD, Sanes JR (1997) Rapsyn is required for MuSK signalling and recruits synaptic components to a MuSK-containing scaffold. Neurone 18:623-635.
Awapara J, Landua AJ, Fuerst R, Seale (1950) Free g-aminobutyric acid in brain. J Biol Chem 187: 35-39.
Banks MI, Pearce RA (2000) Kinetic differences between synaptic and extrasynaptic GABA(A) receptors in CAl pyramidal cells. J Neurosci 20:937-948.
Barnes EM, Jr. (1996) Use-dependent regulation of GAB A A receptors. Int Rev Neurobiol 39:53-76.
Benke D, Mertens S, Trezciak A, Gillessen D, Mohler H (1990) Identification of the gamma 2-subunit protein in native GAB A A receptors in brain. Fur J Pharmacol 189:337- 340.
Benke D, Mertens S, Trzeciak A, Gillessen D, Mohler H (1991) GAB A A receptors display association of gamma 2-subunit with alpha 1- and beta 2/3-subunits. J Biol Chem 266:4478-4483.
142 Benke D, Fritschy JM, Trzeciak A, Bannwarth W, Mohler H (1994) Distribution, prevalence, and drug binding profile of gamma- aminobutyric acid type A receptor subtypes differing in the beta- subunit variant. J Biol Chem 269:27100-27107.
Bliss TV, Lomo T (1973) Long-lasting potentiation of synaptic transmission in the dentate area of the anaesthetized rabbit following stimulation of the perforant path. J Physiol (Lond) 232:331-356.
Bliss TV, Collingridge GL (1993) A synaptic model of memory: long-term potentiation in the hippocampus. Nature 361:31-39.
Bloom FE, Iversen LL (1971) Localizing 3H-GABA in nerve terminals of rat cerebral cortex by electron microscopic autoradiography. Nature 229:628-630.
Boistel J, Fatt P (1958) Membrane permeability change during inhibitory transmitter action in crustacean muscle. J Physiol 4: 176-191.
Bormann J (1988) Electrophysiology of GAB A A and GABAB receptor subtypes. Trends Neurosci 11:112-116.
Bowery NG, Hill DR, Hudson AL, Doble A, Middlemiss DN, Shaw J, Turnbull M (1980) (-)Baclofen decreases neurotransmitter release in the mammalian CNS by an action at a novel GAB A receptor. Nature 283:92-94.
Braithwaite SP, Meyer G, Henley JM (2000) Interactions between AMPA receptors and intracellular proteins. Neuropharmacology 39:919-930.
Brandon NJ, Uren JM, Kittler JT, Wang H, Olsen R, Parker PJ, Moss SJ (1999) Subunit- specific association of protein kinase C and the receptor for activated C kinase with GAB A type A receptors. J Neurosci 19:9228-9234.
Bren man JE, Chao DS, Gee SH, McGee AW, Craven SE, Santillano DR, Wu Z, Huang F, Xia H, Peters MF, Froehner SC, Bredt DS (1996) Interaction of nitric oxide synthase with the postsynaptic density protein PSD-95 and alphal-syntrophin mediated by PDZ domains. Cell 84:757-767.
143 Brickley SG, Cull-Candy SO, Farr ant M (1996) Development of a tonic form of synaptic inhibition in rat cerebellar granule cells resulting from persistent activation of GAB A A receptors. J Physiol (Lond) 497:753-759.
Brickley SG, Cull-Candy SG, Farrant M (1999) Single-channel properties of synaptic and extrasynaptic GAB A A receptors suggest differential targeting of receptor subtypes. J Neurosci 19:2960-2973.
Bueno OF, Robinson LC, Alvarez-Hernandez X, Leidenheimer NJ (1998) Functional characterization and visualization of a GABAA receptor-GFP chimera expressed in Xenopus oocytes. Brain Res Mol Brain Res 59:165-177.
Burd CG, Peterson M, Cowles CR, Emr SD (1997) A novel SeclBp/NSF-dependent complex required for Golgi-to-endosome transport in yeast. Mol Biol Cell 8:1089-1104.
Caillard O, Ben-Ari Y, Gaiarsa JL (1999a) Mechanisms of induction and expression of long-term depression at GABAergic synapses in the neonatal rat hippocampus. J Neurosci 19:7568-7577.
Caillard O, Ben-Ari Y, Gaiarsa JL (1999b) Long-term potentiation of GABAergic synaptic transmission in neonatal rat hippocampus. J Physiol (Lond) 518:109-119.
Carroll RC, Beattie EC, Xia H, Luscher C, Altschuler Y, Nicoll RA, Malenka RC, von Zastrow M (1999) Dynamin-dependent endocytosis of ionotropic glutamate receptors. Proc Natl Acad Sci U S A 96:14112-14117.
Cartaud A, Coûtant S, Petrucci TC, Cartaud J (1998) Evidence for in situ and in vitro association between beta-dystroglycan and the subsynaptic 43K rapsyn protein. Consequence for acetylcholine receptor clustering at the synapse. J Biol Chem 273:11321-11326.
Carter RE, Sorkin A (1998) Endocytosis of functional epidermal growth factor receptor- green fluorescent protein chimera. J Biol Chem 273:35000-35007.
Chapell R, Bueno OF, Alvarez-Hernandez X, Robinson LC, Leidenheimer NJ (1998) Activation of protein kinase C induces gamma-aminobutyric acid type A receptor internalisation in Xenopus oocytes. J Biol Chem 273:32595-32601.
144 Chittajallu R, Braithwaite SP, Clarke VR, Henley JM (1999) Kainate receptors: subunits, synaptic localisation and function. Trends Pharmacol Sci 20:26-35.
Chu P, Murray S, Lissin D, von Zastrow M (1997) Delta and kappa opioid receptors are differentially regulated by dynamin-dependent endocytosis when activated by the same alkaloid agonist. J Biol Chem 272:27124-27130.
Cohen GA, Doze VA, Madison DV (1992) Opioid inhibition of GAB A release from presynaptic terminals of rat hippocampal intemeurons. Neurone 9:325-335.
Colledge M, Froehner SC (1998) To muster a cluster: anchoring neurotransmitter receptors at synapses. Proc Natl Acad Sci U S A 95:3341-3343.
Colledge M, Dean RA, Scott GK, Langeberg LK, Huganir RL, Scott JD (2000) Targeting of PKA to glutamate receptors through a MAGUK-AKAP complex. Neurone 27:107-119.
Connolly CN, Wooltorton JR, Smart TG, Moss SJ (1996a) Subcellular localisation of gamma-aminobutyric acid type A receptors is determined by receptor beta subunits. Proc Natl Acad Sci U S A 93:9899-9904.
Connolly CN, Krishek BJ, McDonald BJ, Smart TG, Moss SJ (1996b) Assembly and cell surface expression of heteromeric and homomeric gamma- aminobutyric acid type A receptors. J Biol Chem 271:89-96.
Connolly CN, Uren JM, Thomas P, Gorrie GH, Gibson A, Smart TG, Moss SJ (1999a) Subcellular localisation and endocytosis of homomeric gamma2 subunit splice variants of gamma-aminobutyric acid type A receptors. Mol Cell Neurosci 13:259-271.
Connolly CN, Kittler JT, Thomas P, Uren JM, Brandon NJ, Smart TG, Moss SJ (1999b) Cell surface stability of gamma-aminobutyric acid type A receptors. Dependence on protein kinase C activity and subunit composition. J Biol Chem 274:36565-36572.
Connor JX, Boileau AJ, Czajkowski C (1998) A GABAA receptor alpha 1 subunit tagged with green fluorescent protein requires a beta subunit for functional surface expression. J Biol Chem 273:28906-28911.
Couve A, Filippov AK, Connolly CN, Bettler B, Brown DA, Moss SJ (1998) Intracellular retention of recombinant GABAB receptors. J Biol Chem 273:26361-26367.
145 Craig AM, Blackstone CD, Huganir RL, Banker G (1993) The distribution of glutamate receptors in cultured rat hippocampal neurones: postsynaptic clustering of AMPA- selective subunits. Neurone 10:1055-1068.
Craig AM, Blackstone CD, Huganir RL, Banker G (1994) Selective clustering of glutamate and gamma-aminobutyric acid receptors opposite terminals releasing the corresponding neurotransmitters. Proc Natl Acad Sci U S A 91:12373-12377.
Craig AM, Banker G (1994) Neuronal polarity. Annu Rev Neurosci 17:267-310.
Craig AM, Banker G, Chang W, McGrath MB, Serpinskaya AS (1996) Clustering of gephyrin at GABAergic but not glutamatergic synapses in cultured rat hippocampal neurones. J Neurosci 16:3166-3177.
Crestani F, Lorez M, Baer K, Essrich C, Benke D, Laurent JP, Belzung C, Fritschy JM, Luscher B, Mohler H (1999) Decreased GABAA-receptor clustering results in enhanced anxiety and a bias for threat cues. Nat Neurosci 2:833-839.
Cutting GR, Lu L, O'Hara BF, Kasch LM, Montrose-Rafizadeh C, Donovan DM, Shimada S, Antonarakis SF, Guggino WB, Uhl GR, et al. (1991) Cloning of the gamma- aminobutyric acid (GABA) rho 1 cDNA: a G ABA receptor subunit highly expressed in the retina. Proc Natl Acad Sci U S A 88:2673-2677.
David-Watine B, Shorte SL, Fucile S, de Saint Jan D, Korn H, Bregestovski P (1999) Functional integrity of green fluorescent protein conjugated glycine receptor channels. Neuropharmacology 38:785-792.
Davies PA, Hanna MC, Hales TG, Kirkness FF (1997a) Insensitivity to anaesthetic agents conferred by a class of GABA(A) receptor subunit. Nature 385:820-823.
Davies PA, Kirkness FF, Hales TG (1997b) Modulation by general anaesthetics of rat GABAA receptors comprised of alpha 1 beta 3 and beta 3 subunits expressed in human embryonic kidney 293 cells. Br J Pharmacol 120:899-909.
DeChiara TM, Bowen DC, Valenzuela DM, Simmons MY, Poueymirou WT, Thomas S, Kinetz F, Compton DL, Rojas F, Park JS, Smith C, DiStefano PS, Glass DJ, Burden SJ, Yancopoulos GD (1996) The receptor tyrosine kinase MuSK is required for neuromuscular junction formation in vivo. Cell 85:501-512.
146 Dev KK, Nishimune A, Henley JM, Nakanishi S (1999) The protein kinase C alpha binding protein PICKl interacts with short but not long form alternative splice variants of AMPA receptor subunits. Neuropharmacology 38:635-644.
Deitrich RA, Dunwiddie TV, Harris RA, Erwin VG (1989) Mechanism of action of ethanol: initial central nervous system actions. Pharmacol Rev 41:489-537.
Doherty AJ, Coutinho V, Collingridge GL, Henley JM (1999) Rapid internalisation and surface expression of a functional, fluorescently tagged G-protein-coupled glutamate receptor. Biochem J 341:415-422.
Dong H, O'Brien RJ, Fung ET, Lanahan AA, Worley PE, Huganir RL (1997) GRIP: a synaptic PDZ domain-containing protein that interacts with AMPA receptors [see comments]. Nature 386:279-284.
Draguhn A, Verdorn TA, Ewert M, Seeburg PH, Sakmann B (1990) Functional and molecular distinction between recombinant rat GABAA receptor subtypes by Zn2+. Neurone 5:781-788.
Drew CA, Johnston GA, Weatherby RP (1984) Bicuculline-insensitive GABA receptors: studies on the binding of (-)- baclofen to rat cerebellar membranes. Neurosci Lett 52:317- 321.
Ehlers MD, Fung ET, O'Brien RJ, Huganir RL (1998) Splice variant-specific interaction of the NMDA receptor subunit NRl with neuronal intermediate filaments. J Neurosci 18:720-730.
Enz R, Cutting GR (1999) Identification of 70 amino acids important for GABA(C) receptor rhol subunit assembly. Brain Res 846:177-185.
Ervasti JM, Campbell KP (1993) A role for the dystrophin-glycoprotein complex as a transmembrane linker between laminin and actin. J Cell Biol 122:809-823.
Essrich C, Lorez M, Benson JA, Fritschy JM, Luscher B (1998) Postsynaptic clustering of major GABAA receptor subtypes requires the gamma 2 subunit and gephyrin [see comments]. Nat Neurosci 1:563-571.
Evan GI, Lewis GK, Ramsay G, Bishop JM (1985) Isolation of monoclonal antibodies specific for human c-myc proto- oncogene product. Mol Cell Biol 5:3610-3616.
147 Farb DH, Berg DK, Fischbach GD (1979) Uptake and release of [3H]gamma- aminobutyric acid by embryonic spinal cord neurones in dissociated cell culture. J Cell Biol 80:651-661.
Feigenspan A, Wassle H, Bormann J (1993) Pharmacology of GABA receptor Cl- channels in rat retinal bipolar cells. Nature 361:159-162.
Feng G, Steinbach JH, Sanes JR (1998a) Rapsyn clusters neuronal acetylcholine receptors but is inessential for formation of an interneuronal cholinergic synapse. J Neurosci 18:4166-4176.
Feng G, Tintrup H, Kirsch J, Nichol MC, Kuhse J, Betz H, Sanes JR (1998b) Dual requirement for gephyrin in glycine receptor clustering and molybdoenzyme activity. Science 282:1321-1324.
Frail DE, Mudd J, Shah V, Carr C, Cohen JB, Merlie JP (1987) cDNAs for the postsynaptic 43-kDa protein of Torpedo electric organ encode two proteins with different carboxyl termini. Proc Natl Acad Sci U S A 84:6302-6306.
Fritschy JM, Benke D, Mertens S, Oertel WH, Bachi T, Mohler H (1992) Five subtypes of type A gamma-aminobutyric acid receptors identified in neurones by double and triple immunofluorescence staining with subunit- specific antibodies. Proc Natl Acad Sci U S A 89:6726-6730.
Fritschy JM, Mohler FI (1995) GABAA-receptor heterogeneity in the adult rat brain: differential regional and cellular distribution of seven major subunits. J Comp Neurol 359:154-194.
Fritschy JM, Johnson DK, Mohler H, Rudolph U (1998) Independent assembly and subcellular targeting of GABA(A)-receptor subtypes demonstrated in mouse hippocampal and olfactory neurones in vivo. Neurosci Lett 249:99-102.
Froehner SC, Gulbrandsen V, Hyman C, Jeng AY, Neubig RR, Cohen JB (1981) Immunofluorescence localisation at the mammalian neuromuscular junction of the Mr 43,000 protein of Torpedo postsynaptic membranes. Proc Natl Acad Sci U S A 78:5230- 5234.
148 Froehner SC, Luetje CW, Scotland PB, Patrick J (1990) The postsynaptic 43K protein clusters muscle nicotinic acetylcholine receptors in Xenopus oocytes. Neurone 5:403-410.
Froehner SC (1991) The submembrane machinery for nicotinic acetylcholine receptor clustering. J Cell Biol 114:1-7.
Cardiol A, Racca C, Triller A (1999) Dendritic and postsynaptic protein synthetic machinery. J Neurosci 19:168-179.
Garner CC, Nash J, Huganir RL (2000) PDZ domains in synapse assembly and signalling. Trends Cell Biol 10:274-280.
Gautam M, Noakes PG, Mudd J, Nichol M, Chu GC, Sanes JR, Merlie JP (1995) Failure of postsynaptic specialization to develop at neuromuscular junctions of rapsyn-deficient mice. Nature 377:232-236.
Gautam M, Noakes PG, Moscoso L, Rupp F, Scheller RH, Merlie JP, Sanes JR (1996) Defective neuromuscular synaptogenesis in agrin-deficient mutant mice. Cell 85:525-535.
Giustetto M, Kirsch J, Fritschy JM, Cantino D, Sassoe-Pognetto M (1998) Localisation of the clustering protein gephyrin at GABAergic synapses in the main olfactory bulb of the rat. J Comp Neurol 395:231-244.
Gorrie GH, Vallis Y, Stephenson A, Whitfield J, Browning B, Smart TG, Moss SJ (1997) Assembly of GABAA receptors composed of alpha 1 and beta2 subunits in both cultured neurones and fibroblasts. J Neurosci 17:6587-6596.
Green WN, Millar NS (1995) lon-channel assembly. Trends Neurosci 18:280-287.
Grenningloh G, Rienitz A, Schmitt B, Methfessel C, Zensen M, Beyreuther K, Gundelfinger ED, Betz H (1987) The strychnine-binding subunit of the glycine receptor shows homology with nicotinic acetylcholine receptors. Nature 328:215-220.
Gunther U, Benson J, Benke D, Fritschy JM, Reyes G, Knoflach F, Crestani F, Aguzzi A, Arigoni M, Lang Y, et al. (1995) Benzodiazepine-insensitive mice generated by targeted disruption of the gamma 2 subunit gene of gamma-aminobutyric acid type A receptors. Proc Natl Acad Sci U S A 92:7749-7753.
Haas A (1998) NSF—fusion and beyond. Trends Cell Biol 8:471-473.
149 Hackam AS, Wang TL, Guggino WB, Cutting OR (1997) The N-terminal domain of human GAB A receptor rhol subunits contains signals for homooligomeric and heterooligomeric interaction. J Biol Chem 272:13750-13757.
Hackam AS, Wang TL, Guggino WB, Cutting GR (1998) Sequences in the amino termini of GAB A rho and GABA(A) subunits specify their selective interaction in vitro. J Neurochem 70:40-46.
Hammond C, Braakman I, Helenius A (1994) Role of N-linked oligosaccharide recognition, glucose trimming, and calnexin in glycoprotein folding and quality control. Proc Natl Acad Sci U S A 91:913-917.
Hammond C, Helenius A (1994) Folding of VSV G protein: sequential interaction with BiP and calnexin. Science 266:456-458.
Hanley JG, Koulen P, Bedford F, Gordon-Weeks PR, Moss SJ (1999) The protein MAP- IB links GABA(C) receptors to the cytoskeleton at retinal synapses. Nature 397:66-69.
Harvey RJ, Kim HC, Darlison MG (1993) Molecular cloning reveals the existence of a fourth gamma subunit of the vertebrate brain GAB A A receptor. FEBS Lett 331:211-216.
Harvey RJ, Chinchetru MA, Darlison MG (1994) Alternative splicing of a 51-nucleotide exon that encodes a putative protein kinase C phosphorylation site generates two forms of the chicken gamma-aminobutyric acidA receptor beta 2 subunit. J Neurochem 62:10-16.
Hayashi Y, Shi SH, Esteban JA, Piccini A, Poncer JC, Malinow R (2000) Driving AMPA receptors into synapses by LTP and CaMKII: requirement for GluRl and PDZ domain interaction. Science 287:2262-2267.
Hedblom E, Kirkness EF (1997) A novel class of GABAA receptor subunit in tissues of the reproductive system. J Biol Chem 272:15346-15350.
Heuser JE, Anderson RG (1989) Hypertonic media inhibit receptor-mediated endocytosis by blocking clathrin-coated pit formation. J Cell Biol 108:389-400.
Hill DR, Bowery NG (1981) 3H-baclofen and 3H-GABA bind to bicuculline-insensitive GAB A B sites in rat brain. Nature 290:149-152.
150 Hollmann M, Heinemann S (1994) Cloned glutamate receptors. Annu Rev Neurosci 17:31-108.
Husi H, Ward MA, Choudhary JS, Blackstock WP, Grant SO (2000) Proteomic analysis of NMDA receptor-adhesion protein signaling complexes [see comments]. Nat Neurosci 3:661-669.
Item C, Sieghart W (1994) Binding of gamma-aminobutyric acidA receptors to tubulin. J Neurochem 63:1119-1125.
Iversen LL, Neal MJ (1968) The uptake of [3HJGABA by slices of rat cerebral cortex. J Neurochem 15:1141-1149.
Iversen LL, Mitchell JF, Neal MJ, Srinivasan V (1970) The effect of stimulation of inhibitory pathways on the release of endogenous gamma-aminobutyric acid from the rat cerebral cortex. Br J Pharmacol 38:452P-453P.
Jahn R (1998) Synaptic transmission: two players team up for a new tune. Curr Biol 8:R856-858.
Jones A, Korpi ER, McKernan RM, Pelz R, Nusser Z, Makela R, Mellor JR, Pollard S, Bahn S, Stephenson FA, Randall AD, Sieghart W, Somogyi P, Smith AJ, Wisden W (1997) Ligand-gated ion channel subunit partnerships: GABAA receptor alpha6 subunit gene inactivation inhibits delta subunit expression. J Neurosci 17:1350-1362.
Kamdar KP, Primus JP, Shelton ME, Archangeli LL, Wittle AE, Finnerty V (1997) Structure of the molybdenum cofactor genes in Drosophila. Biochem Soc Trans 25:778- 783.
Kannenberg K, Baur R, Sigel E (1997) Proteins associated with alpha 1-subunit- containing GABAA receptors from bovine brain. J Neurochem 68:1352-1360.
Kannenberg K, Sieghart W, Reuter H (1999) Clusters of GABAA receptors on cultured hippocampal cells correlate only partially with functional synapses. Eur J Neurosci 11:1256-1264.
Kano M (1995) Plasticity of inhibitory synapses in the brain: a possible memory mechanism that has been overlooked. Neurosci Res 21:177-182.
151 Kato K (1990) Novel GABAA receptor alpha subunit is expressed only in cerebellar granule cells. J Mol Biol 214:619-624.
Kaupmann K, Huggel K, Heid J, Flor PJ, Bischoff S, Mickel SJ, McMaster G, Angst C, Bittiger H, Froestl W, Bettler B (1997) Expression cloning of GABA(B) receptors uncovers similarity to metabotropic glutamate receptors . Nature 386:239-246.
Kaupmann K, Malitschek B, Schuler V, Heid J, Froestl W, Beck P, Mosbacher J, Bischoff S, Kulik A, Shigemoto R, Karschin A, Bettler B (1998) GABA(B)-receptor subtypes assemble into functional heteromeric complexes. Nature 396:683-687.
Kennedy MB (1997) The postsynaptic density at glutamatergic synapses. Trends Neurosci 20:264-268.
Khan ZU, Gutierrez A, De Bias AL (1996) The alpha 1 and alpha 6 subunits can coexist in the same cerebellar GABAA receptor maintaining their individual benzodiazepine- binding specificities . J Neurochem 66:685-691.
Khrestchatisky M, MacLennan AJ, Chiang MY, Xu WT, Jackson MB, Brecha N, Stemini C, Olsen RW, Tobin AJ (1989) A novel alpha subunit in rat brain GABAA receptors. Neurone 3:745-753.
Kim E, Naisbitt S, Hsueh YP, Rao A, Rothschild A, Craig AM, Sheng M (1997) GKAP, a novel synaptic protein that interacts with the gu an y late kinase- like domain of the PSD- 95/SAP90 family of channel clustering molecules. J Cell Biol 136:669-678.
Kim JH, Liao D, Lau LF, Huganir RL (1998) SynGAP: a synaptic RasGAP that associates with the PSD-95/SAP90 protein family. Neurone 20:683-691.
Kins S, Betz H, Kirsch J (2000) Collybistin, a newly identified brain-specific GEF, induces submembrane clustering of gephyrin. Nat Neurosci 3:22-29.
Kirchhausen T, Bonifacino JS, Riezman H (1997) Linking cargo to vesicle formation: receptor tail interactions with coat proteins. Curr Opin Cell Biol 9:488-495.
Kirkness EF, Fraser CM (1993) A strong promoter element is located between alternative exons of a gene encoding the human gamma-aminobutyric acid-type A receptor beta 3 subunit (GABRB3). J Biol Chem 268:4420-4428.
152 Kirsch J, Langosch D, Prior P, Littauer UZ, Schmitt B, Betz H (1991) The 93-kDa glycine receptor-associated protein binds to tubulin. J Biol Chem 266:22242-22245.
Kirsch J, Wolters I, Triller A, Betz H (1993) Gephyrin antisense oligonucleotides prevent glycine receptor clustering in spinal neurones. Nature 366:745-748.
Kirsch J, Betz H (1995) The postsynaptic localisation of the glycine receptor-associated protein gephyrin is regulated by the cytoskeleton. J Neurosci 15:4148-4156.
Kirsch J, Betz H (1998) Glycine-receptor activation is required for receptor clustering in spinal neurones. Nature 392:717-720.
Kittler JT, Wang J, Connolly CN, Vicini S, Smart TG, Moss SJ (2000a) Analysis of GABAA receptor assembly in mammalian cell lines and hippocampal neurons using y2 suunit green fluorescent protein chimeras. Mol Cell Neuorsci in press.
Kittler JT, Delmas P, Jovanovic JN, Brown DA, Smart TG, Moss SJ (2000b) Constitutive endocytosis of GABAA receptors by an association with the adaptin AP2 complex modulates inhibitory synaptic currents in hippocampal neurons. J Neurosci in press.
Klausberger T, Fuchs K, Mayer B, Ehya N, Sieghart W (2000) GABA(A) receptor assembly. Identification and structure of gamma(2) sequences forming the intersubunit contacts with alpha(l) and beta(3) subunits. J Biol Chem 275:8921-8928.
Kneussel M, Brandstatter JH, Laube B, Stahl S, Muller U, Betz H (1999) Loss of postsynaptic GABA(A) receptor clustering in gephyrin-deficient mice. J Neurosci 19:9289-9297.
Kneussel M, Betz H (2000a) Receptors, gephyrin and gephyrin-associated proteins: novel insights into the assembly of inhibitory postsynaptic membrane specializations. J Physiol (Lond) 525 Pt 1:1-9.
Kneussel M, Betz H (2000b) Clustering of inhibitory neurotransmitter receptors at developing postsynaptic sites: the membrane activation model. Trends Neurosci 23:429- 435.
Kneussel M, Haverkamp S, Fuhrmann JC, Wang H, Wassle H, Olsen RW, Betz H (2000) The gamma-aminobutyric acid type A receptor (GABAAR)-associated protein
153 GABARAP interacts with gephyrin but is not involved in receptor anchoring at the synapse. Proc Natl Acad Sci U S A 97:8594-8599.
Kofuji P, Wang JB, Moss SJ, Huganir RL, Burt DR (1991) Generation of two forms of the gamma-aminobutyric acidA receptor gamma 2-subunit in mice by alternative splicing. J Neurochem 56:713-715.
Komatsu Y (1994) Age-dependent long-term potentiation of inhibitory synaptic transmission in rat visual cortex. J Neurosci 14:6488-6499.
Kornau HC, Schenker LT, Kennedy MB, Seeburg PH (1995) Domain interaction between NMDA receptor subunits and the postsynaptic density protein PSD-95. Science 269:1737- 1740.
Korpi ER, Kuner T, Kristo P, Kohler M, Herb A, Luddens H, Seeburg PH (1994) Small N-terminal deletion by splicing in cerebellar alpha 6 subunit abolishes GABAA receptor function. J Neurochem 63:1167-1170.
Koulen P, Sassoe-Pognetto M, Grunert U, Wassle H (1996) Selective clustering of GABA(A) and glycine receptors in the mammalian retina. J Neurosci 16:2127-2140.
Krishek BJ, Moss SJ, Smart TG (1996) Homomeric beta 1 gamma-aminobutyric acid A receptor-ion channels: evaluation of pharmacological and physiological properties. Mol Pharmacol 49:494-504.
Krnjevic K, Schwartz S (1966) Is gamma-aminobutyric acid an inhibitory transmitter? Nature 211:1372-1374.
Krusek J, Zemkova H (1994) Effect of ivermectin on gamma-aminobutyric acid-induced chloride currents in mouse hippocampal embryonic neurones. Eur J Pharmacol 259:121- 128.
Lang T, Schaeffeler E, Bernreuther D, Bredschneider M, Wolf DH, Thumm M (1998) Aut2p and Aut7p, two novel microtubule-associated proteins are essential for delivery of autophagic vesicles to the vacuole. Embo J 17:3597-3607.
Langosch D, Thomas L, Betz H (1988) Conserved quaternary structure of ligand-gated ion channels: the postsynaptic glycine receptor is a pentamer. Proc Natl Acad Sci U S A 85:7394-7398.
154 Lasham A, Vreugdenhil E, Bateson AN, Barnard EA, Darlison MG (1991) Conserved organization of gamma-aminobutyric acidA receptor genes: cloning and analysis of the chicken beta 4-subunit gene. J Neurochem 57:352-355.
Laurie DJ, Seeburg PH, Wisden W (1992a) The distribution of 13 GABAA receptor subunit mRNAs in the rat brain. II. Olfactory bulb and cerebellum. J Neurosci 12:1063- 1076.
Laurie DJ, Wisden W, Seeburg PH (1992b) The distribution of thirteen GABAA receptor subunit mRNAs in the rat brain. III. Embryonic and postnatal development. J Neurosci 12:4151-4172.
Lee SH, Sheng M (2000) Development of neurone-neurone synapses. Curr Opin Neurobiol 10:125-131.
Lee HK, Barbarosie M, Kameyama K, Bear ME, Huganir RL (2000) Regulation of distinct AMPA receptor phosphorylation sites during bidirectional synaptic plasticity. Nature 405:955-959.
Legesse-Miller A, Sagiv Y, Porat A, Elazar Z (1998) Isolation and characterization of a novel low molecular weight protein involved in intra-Golgi traffic. J Biol Chem 273:3105-3109.
Leonard AS, Davare MA, Horne MC, Gamer CC, Hell JW (1998) SAP97 is associated with the alpha-amino-3-hydroxy-5-methylisoxazole-4- propionic acid receptor GluRl subunit. J Biol Chem 273:19518-19524.
Lendvai B, Stern EA, Chen B, Svoboda K (2000) Experience-dependent plasticity of dendritic spines in the developing rat barrel cortex in vivo. Nature 404:876-881.
Levi S, Vannier C, Triller A (1998) Strychnine-sensitive stabilization of postsynaptic glycine receptor clusters. J Cell Sci 111:335-345.
Levitan ES, Schofield PR, Burt DR, Rhee LM, Wisden W, Kohler M, Fujita N, Rodriguez HP, Stephenson A, Darlison MG, et al. (1988a) Structural and functional basis for GABAA receptor heterogeneity. Nature 335:76-79.
155 Levitan ES, Blair LA, Dionne VE, Barnard EA (1988b) Biophysical and pharmacological properties of cloned GABAA receptor subunits expressed in Xenopus oocytes. Neurone 1:773-781.
Li M, De Bias AL (1997) Coexistence of two beta subunit isoforms in the same gamma- aminobutyric acid type A receptor. J Biol Chem 272:16564-16569.
Liao D, Hessler NA, Malinow R (1995) Activation of postsynaptically silent synapses during pairing-induced LTP in CAl region of hippocampal slice. Nature 375:400-404.
Linden DJ (1999) The return of the spike: postsynaptic action potentials and the induction of LTP and LTD. Neurone 22:661-666.
Lindstrom J, Merlie J, Yogeeswaran G (1979) Biochemical properties of acteylcholine receptor subunits from Torpedo califomica. Biochemistry 18:4465-4470.
Lu YM, Mansuy IM, Kandel ER, Roder J (2000) Calcineurin-mediated LTD of GABAergic inhibition underlies the increased excitability of CAl neurones associated with LTP. Neurone 26:197-205.
Luddens H, Pritchett DB, Kohler M, Killisch I, Keinanen K, Monyer H, Sprengel R, Seeburg PH (1990) Cerebellar GABAA receptor selective for a behavioural alcohol antagonist. Nature 346:648-651.
Luscher C, Xia H, Beattie EC, Carroll RC, von Zastrow M, Malenka RC, Nicoll RA (1999) Role of AMPA receptor cycling in synaptic transmission and plasticity. Neurone 24:649-658.
Luscher C, Nicoll RA, Malenka RC, Muller D (2000) Synaptic plasticity and dynamic modulation of the postsynaptic membrane. Nat Neurosci 3:545-550.
Luthi A, Chittajallu R, Duprat F, Palmer MJ, Benke TA, Kidd FL, Henley JM, Isaac JT, Collingridge GL (1999) Hippocampal LTD expression involves a pool of AMPARs regulated by the NSF-GluR2 interaction. Neurone 24:389-399.
Macdonald RL, Olsen RW (1994) GABAA receptor channels. Annu Rev Neurosci 17:569-602.
156 Malherbe P, Sigel E, Baur R, Persohn E, Richards JG, Mohler H (1990) Functional expression and sites of gene transcription of a novel alpha subunit of the GABAA receptor in rat brain. FEBS Lett 260:261-265.
Malinow R, Mainen ZF, Hayashi Y (2000) LTP mechanisms: from silence to four-lane traffic. Curr Opin Neurobiol 10:352-357.
Mamalaki C, Barnard EA, Stephenson FA (1989) Molecular size of the gamma- aminobutyric acidA receptor purified from mammalian cerebral cortex. J Neurochem 52:124-134.
Mammoto A, Sasaki T, Asakura T, Hotta I, Imamura H, Takahashi K, Matsuura Y, Shirao T, Takai Y (1998) Interactions of drebrin and gephyrin with profilin. Biochem Biophys Res Commun 243:86-89.
Man YH, Lin JW, Ju WH, Ahmadian G, Liu L, Becker LE, Sheng M, Wang YT (2000) Regulation of AMPA receptor-mediated synaptic transmission by clathrin- dependent receptor internalisation. Neurone 25:649-662.
Margeta-Mitrovic M, Jan YN, Jan LY (2000) A trafficking checkpoint controls GABA(B) receptor heterodimerization. Neuron 27:97-106.
Maricq AV, Peterson AS, Brake AJ, Myers RM, Julius D (1991) Primary structure and functional expression of the 5HT3 receptor, a serotonin-gated ion channel. Science 254:432-437.
Marks B, McMahon HT (1998) Calcium triggers calcineurin-dependent synaptic vesicle recycling in mammalian nerve terminals. Curr Biol 8:740-749.
Marsh M, McMahon HT (1999) The stmctural era of endocytosis. Science 285:215-220.
Martin SJ, Grim wood PD, Morris RG (2000) Synaptic plasticity and memory: an evaluation of the hypothesis. Annu Rev Neurosci 23:649-711.
McDonald BJ, Amato A, Connolly CN, Benke D, Moss SJ, Smart TG (1998) Adjacent phosphorylation sites on GABAA receptor beta subunits determine regulation by cAMP- dependent protein kinase. Nat Neurosci 1:23-28.
157 McDonald PH, Cote NL, Lin FT, Fremont RT, Pitcher JA, Lefkowitz RJ (1999) Identification of NSF as a beta-arrestinl-binding protein. Implications for beta2- adrenergic receptor regulation. J Biol Chem 274:10677-10680.
McKernan RM, Quirk K, Prince R, Cox PA, Gillard NP, Ragan CI, Whiting P (1991) GABAA receptor subtypes immunopurified from rat brain with alpha subunit-specific antibodies have unique pharmacological properties. Neurone 7:667-676.
McKernan RM, Whiting PJ (1996) Which GAB A A-receptor subtypes really occur in the brain? Trends Neurosci 19:139-143.
McKinley DD, Lennon DJ, Carter DB (1995) Cloning, sequence analysis and expression of two forms of mRNA coding for the human beta 2 subunit of the GABAA receptor. Brain Res Mol Brain Res 28:175-179.
McLean HA, Gaillard O, Ben-Ari Y, Gaiarsa JL (1996) Bidirectional plasticity expressed by GABAergic synapses in the neonatal rat hippocampus. J Physiol (Lond) 496:471-477.
Mellman I, Warren G (2000) The road taken: past and future foundations of membrane traffic. Cell 100:99-112.
Mertens S, Benke D, Mohler H (1993) GABAA receptor populations with novel subunit combinations and drug binding profiles identified in brain by alpha 5- and delta-subunit- specific immunopurification. J Biol Chem 268:5965-5973.
Meyer G, Kirsch J, Betz H, Langosch D (1995) Identification of a gephyrin binding motif on the glycine receptor beta subunit. Neurone 15:563-572.
Meyer DK, Olenik C, Hofmann F, Barth H, Leemhuis J, Brunig I, Aktories K, Norenberg W (2000) Regulation of somatodendritic GABAA receptor channels in rat hippocampal neurones: evidence for a role of the small GTPase racl. J Neurosci 20:6743-6751.
Mihic SJ, Ye Q, Wick MJ, Koltchine VV, Krasowski MD, Finn SE, Mascia MP, Valenzuela CF, Hanson KK, Greenblatt EP, Harris RA, Harrison NL (1997) Sites of alcohol and volatile anaesthetic action on GABA(A) and glycine receptors [see comments]. Nature 389:385-389.
Mitra AK, McCarthy MP, Stroud RM (1989) Three-dimensional structure of the nicotinic acetylcholine receptor and location of the major associated 43-kD cytoskeletal protein,
158 determined at 22 A by low dose electron microscopy and x-ray diffraction to 12.5 A. J Cell Biol 109:755-774.
Moss SJ, Smart TG, Blackstone CD, Huganir RL (1992) Functional modulation of GABAA receptors by cAMP-dependent protein phosphorylation. Science 257:661-665.
Moss SJ, Gorrie GH, Amato A, Smart TG (1995) Modulation of GABAA receptors by tyrosine phosphorylation. Nature 377:344-348.
Moss SJ, Smart TG (1996) Modulation of amino acid-gated ion channels by protein phosphorylation. Int Rev Neurobiol 39:1-52.
Mossier B, Togel M, Fuchs K, Sieghart W (1994) Immunoaffinity purification of gamma- aminobutyric acidA (GABAA) receptors containing gamma 1-subunits. Evidence for the presence of a single type of gamma-subunit in GABAA receptors. J Biol Chem 269:25777-25782.
Naisbitt S, Kim E, Tu JC, Xiao B, Sala C, Valtschanoff J, Weinberg RJ, Worley PF, Sheng M (1999) Shank, a novel family of postsynaptic density proteins that binds to the NMDA receptor/PSD-95/GKAP complex and cortactin. Neuron 23:569-582.
Nayeem N, Green TP, Martin XL, Barnard EA (1994) Quaternary structure of the native GABAA receptor determined by electron microscopic image analysis. J Neurochem 62:815-818.
Neal MJ, Iversen LL (1969) Subcellular distribution of endogenous and (3H) gamma- aminobutyric acid in rat cerebral cortex. J Neurochem 16:1245-1252.
Newland CF, Cull-Candy SG (1992) On the mechanism of action of picrotoxin on GAB A receptor channels in dissociated sympathetic neurones of the rat. J Physiol (Lond) 447:191-213.
Nicoll RA, Malenka RC (1995) Contrasting properties of two forms of long-term potentiation in the hippocampus. Nature 377:115-118.
Niethammer M, Valtschanoff JG, Kapoor TM, Allison DW, Weinberg TM, Craig AM, Sheng M (1998) CRIPT, a novel postsynaptic protein that binds to the third PDZ domain of PSD-95/SAP90. Neuron 20:693-707.
159 Nishimune A, Isaac JT, Molnar E, Noel J, Nash SR, Tagaya M, Collingridge GL, Nakanishi S, Henley JM (1998) NSF binding to GluR2 regulates synaptic transmission. Neuron 21:87-97.
Noda M, Takahashi H, Tanabe T, Toyosato M, Furutani Y, Hirose T, Asai M, Inayama S, Miyata T, Numa S (1982) Primary structure of alpha-subunit precursor of Torpedo califomica acetylcholine receptor deduced from cDNA sequence. Nature 299:793-797.
Noel J, Ralph GS, Pickard L, Williams J, Molnar B, Uney JB, Collingridge GL, Henley JM (1999) Surface expression of AMPA receptors in hippocampal neurones is regulated by an NSF-dependent mechanism. Neuron 23:365-376. Nusser Z, Sieghart W, Benke D, Fritschy JM, Somogyi P (1996a) Differential synaptic localization of two major gamma-aminobutyric acid type A receptor alpha subunits on hippocampal pyramidal cells. Proc Natl Acad Sci U S A 93:11939-11944.
Nusser Z, Sieghart W, Stephenson FA, Somogyi P (1996b) The alpha 6 subunit of the GABAA receptor is concentrated in both inhibitory and excitatory synapses on cerebellar granule cells. J Neurosci 16:103-114.
Nusser Z, Cull-Candy S, Farrant M (1997) Differences in synaptic GABA(A) receptor number underlie variation in GAB A mini amplitude. Neuron 19:697-709.
Nusser Z, Hajos N, Somogyi P, Mody I (1998a) Increased number of synaptic GABA(A) receptors underlies potentiation at hippocampal inhibitory synapses. Nature 395:172-177.
Nusser Z, Sieghart W, Somogyi P (1998b) Segregation of different GABAA receptors to synaptic and extrasynaptic membranes of cerebellar granule cells. J Neurosci 18:1693- 1703.
O'Brien RJ, Kamboj S, Ehlers MD, Rosen KR, Fischbach GD, Huganir RL (1998) Activity-dependent modulation of synaptic AMPA receptor accumulation. Neuron 21:1067-1078.
O'Brien RJ, Xu D, Petralia RS, Steward O, Huganir RL, Worley P (1999) Synaptic clustering of AMPA receptors by the extracellular immediate- early gene product Narp. Neuron 23:309-323.
Ogurusu T, Shingai R (1996) Cloning of a putative gamma-aminobutyric acid (GABA) receptor subunit rho 3 cDNA. Biochim Biophys Acta 1305:15-18.
160 Osten P, Srivastava S, Inman GJ, Vilim FS, Khatri L, Lee LM, States BA, Einheber S, Milner TA, Hanson PI, Ziff BE (1998) The AMPA receptor GIuR2 C terminus can mediate a reversible, ATP- dependent interaction with NSF and alpha- and beta-SNAPs. Neuron 21:99-110.
Osten P, Khatri L, Perez JL, Kohr G, Giese G, Daly C, Schulz TW, Wensky A, Lee LM, Ziff BE (2000) Mutagenesis reveals a role for AE P/GRIP binding to GluR2 in synaptic surface accumulation of the AMPA receptor. Neuron 27:313-325.
Passafaro M, Sheng M (1999) Synaptogenesis: The MAP location of GAEA receptors. CurrEiol9:R261-263.
Pfeiffer F, Graham D, Eetz H (1982) Purification by affinity chromatography of the glycine receptor of rat spinal cord. J Eiol Chem 257:9389-9393.
Phillips WD, Maimone MM, Merlie JP (1991) Mutagenesis of the 43-kD postsynaptic protein defines domains involved in plasma membrane targeting and AChR clustering. J Cell Eiol 115:1713-1723.
Pitcher JA, Freedman NJ, Lefkowitz RJ (1998) G protein-coupled receptor kinases. Annu Rev Biochem 67:653-692.
Pollard S, Duggan MJ, Stephenson FA (1993) Further evidence for the existence of alpha subunit heterogeneity within discrete gamma-aminobutyric acidA receptor subpopulations. J Eiol Chem 268:3753-3757.
Prior P, Schmitt E, Grenningloh G, Pribilla I, Multhaup G, Eeyreuther K, Maulet Y, Werner P, Langosch D, Kirsch J, et al. (1992) Primary structure and alternative splice variants of gephyrin, a putative glycine receptor-tubulin linker protein. Neuron 8:1161- 1170.
Pritchett DE, Luddens H, Seeburg PH (1989a) Type I and type II GAEAA- benzodiazepine receptors produced in transfected cells. Science 245:1389-1392.
Pritchett DE, Sontheimer H, Shivers ED, Ymer S, Kettenmann H, Schofield PR, Seeburg PH (1989b) Importance of a novel GAEA A receptor subunit for benzodiazepine pharmacology. Nature 338:582-585.
161 Qian H, Dowling JE (1993) Novel GAB A responses from rod-driven retinal horizontal cells. Nature 361:162-164.
Qu ZC, Moritz E, Huganir RL (1990) Regulation of tyrosine phosphorylation of the nicotinic acetylcholine receptor at the rat neuromuscular junction. Neuron 4:367-378.
Quirk K, Gillard NP, Ragan Cl, Whiting PJ, McKernan RM (1994a) gamma- Aminobutyric acid type A receptors in the rat brain can contain both gamma 2 and gamma 3 subunits, but gamma 1 does not exist in combination with another gamma subunit. Mol Pharmacol 45:1061-1070.
Quirk K, Gillard NP, Ragan Cl, Whiting PJ, McKernan RM (1994b) Model of subunit composition of gamma-aminobutyric acid A receptor subtypes expressed in rat cerebellum with respect to their alpha and gamma/delta subunits. J Biol Chem 269:16020- 16028.
Rabow LE, Russek SJ, Farb DH (1995) From ion currents to genomic analysis: recent advances in GABAA receptor research. Synapse 21:189-274.
Ramarao MK, Cohen JB (1998) Mechanism of nicotinic acetylcholine receptor cluster formation by rapsyn. Proc Natl Acad Sci U S A 95:4007-4012.
Ramming M, Kins S, Werner N, Hermann A, Betz H, Kirsch J (2000) Diversity and phytogeny of gephyrin: tissue-specific splice variants, gene structure, and sequence similarities to molybdenum cofactor- synthesizing and cytoskeleton-associated proteins. Proc Natl Acad Sci U S A 97:10266-10271.
Rando RR, Bangerter FW, Farb DH (1981) The inactivation of gamma-aminobutyric acid transaminase in dissociated neuronal cultures from spinal cord. J Neurochem 36:985-990.
Richmond JF, Jorgensen EM (1999) One GAB A and two acetylcholine receptors function at the C. elegans neuromuscular junction. Nat Neurosci 2:791-797.
Robinson LJ, Aniento F, Gruenberg J (1997) NSF is required for transport from early to late endosomes. J Cell Sci 110:2079-2087.
162 Rossi DJ, Hamann M (1998) Spillover-mediatted transmission at inhibitory synapses promoted by high affinity alphab subunit GABAV(A) receptors and glomerular geometry. Neuron 20:783-795.
Rothman IE (1994) Mechanisms of intracellular protein transport. Nature 372:55-63.
Rousselet A, Cartaud J, Devaux PF, Changeux JJP (1982) The rotational diffusion of the acetylcholine receptor in Torpeda marmorata miembrane fragments studied with a spin- labelled alpha-toxin: importance of the 43 000 pnotein(s). Embo J 1:439-445.
Sabatini DM, Barrow RK, Blackshaw S, Burniett PE, Lai MM, Field ME, Bahr BA, Kirsch J, Betz H, Snyder SH (1999) Interactiom of RAFTl with gephyrin required for rapamycin-sensitive signaling. Science 284:1161-1164.
Sagiv Y, Legesse-Miller A, Porat A, Elazar Z (2000) GATE-16, a membrane transport modulator, interacts with NSF and the Golgi v-SNARE GOS-28. Embo J 19:1494-1504.
Sanes JR, Lichtman JW (1999) Development of the vertebrate neuromuscular junction. Annu Rev Neurosci 22:389-442.
Sassoe-Pognetto M, Kirsch J, Grunert U, Greferath U, Fritschy JM, Mohler H, Betz H, Wassle H (1995) Colocalization of gephyrin and GABAA-receptor subunits in the rat retina. J Comp Neurol 357:1-14.
Sassoe-Pognetto M, Panzanelli P, Sieghart W, Fritschy JM (2000) Colocalization of multiple GABA(A) receptor subtypes with gephyrin at postsynaptic sites. J Comp Neurol 420:481-498.
Saxena NC, Macdonald RL (1994) Assembly of GABAA receptor subunits: role of the delta subunit. J Neurosci 14:7077-7086.
Scheiffele P, Fan J, Choih J, Fetter R, Serafini T (2000) Neuroligin expressed in nonneuronal cells triggers presynaptic development in contacting axons. Cell 101:657- 669.
Schiavo G, Gmachl MJ, Stenbeck G, Sollner TH, Rothman JE (1995) A possible docking and fusion particle for synaptic transmission. Nature 378:733-736.
163 Schmid SL (1997) Clathrin-coated vesicle formation and protein sorting: an integrated process. Annu Rev Biochem 66:511-548.
Schmitt B, Knaus P, Becker CM, Betz H (1987) The Mr 93,000 polypeptide of the postsynaptic glycine receptor complex is a peripheral membrane protein. Biochemistry 26:805-811.
Schofield PR, Darlison MG, Fujita N, Burt DR, Stephenson FA, Rodriguez H, Rhee LM, Ramachandran J, Reale V, Glencorse TA, et al. (1987) Sequence and functional expression of the GAB A A receptor shows a ligand-gated receptor super-family. Nature 328:221-227.
Schwarz G, Boxer DH, Mendel RR (1997) Molybdenum cofactor biosynthesis. The plant protein Cnxl binds molybdopterin with high affinity. J Biol Chem 272:26811-26814.
Serpinskaya AS, Feng G, Sanes JR, Craig AM (1999) Synapse formation by hippocampal neurones from agrin-deficient mice. Dev Biol 205:65-78.
Sheng M, Pak DT (2000) Ligand-gated ion channel interactions with cytoskeletal and signaling proteins. Annu Rev Physiol 62:755-778.
Sheng M, Lee SH (2000) Growth of the NMDA receptor industrial complex. Nat Neurosci 3:633-635.
Shi SH, Hayashi Y, Petralia RS, Zaman SH, Wenthold RJ, Svoboda K, Malinow R (1999) Rapid spine delivery and redistribution of AMPA receptors after synaptic NMDA receptor activation. Science 284:1811-1816.
Shimada S, Cutting G, Uhl GR (1992) gamma-Aminobutyric acid A or C receptor? gamma-Aminobutyric acid rho 1 receptor RNA induces bicuculline-, barbiturate-, and benzodiazepine- insensitive gamma-aminobutyric acid responses in Xenopus oocytes. Mol Pharmacol 41:683-687.
Shiratori T, Miyatake S, Ohno H, Nakaseko C, Isono K, Bonifacino JS, Saito T (1997) Tyrosine phosphorylation controls internalisation of CTLA-4 by regulating its interaction with clathrin-associated adaptor complex AP- 2. Immunity 6:583-589.
164 Shivers BD, Killisch I, Sprengel R, Sontheimer H, Kohler M, Schofield PR, Seeburg PH (1989) Two novel GABAA receptor subunits exist in distinct neuronal subpopulations. Neuron 3:327-337.
Sigel E, Mamalaki C, Barnard EA (1982) Isolation of a GAB A receptor from bovine brain using a benzodiazepine affinity column. FEBS Lett 147:45-48.
Sigel E, Stephenson FA, Mamalaki C, Barnard EA (1983) A gamma-aminobutyric acid/benzodiazepine receptor complex of bovine cerebral cortex. J Biol Chem 258:6965- 6971.
Sigel E, Barnard EA (1984) A gamma-aminobutyric acid/benzodiazepine receptor complex from bovine cerebral cortex. Improved purification with preservation of regulatory sites and their interactions. J Biol Chem 259:7219-7223.
Smart TG (1992) A novel modulatory binding site for zinc on the GABAA receptor complex in cultured rat neurones. J Physiol (Lond) 447:587-625.
Sobel A, Weber M, Changeux JP (1977) Large-scale purification of the acetylcholine- receptor protein in its membrane-bound and detergent-extracted forms from Torpedo marmorata electric organ. Eur J Biochem 80:215-224.
Sollner T, Whiteheart SW, Brunner M, Erdjument-Bromage H, Geromanos S, Tempst P, Rothman JE (1993) SNAP receptors implicated in vesicle targeting and fusion [see comments]. Nature 362:318-324.
Song I, Kamboj S, Xia J, Dong H, Liao D, Huganir RL (1998) Interaction of the N- ethylmaleimide-sensitive factor with AMPA receptors. Neuron 21:393-400.
Srinivasan S, Nichols CJ, Lawless GM, Olsen RW, Tobin AJ (1999) Two invariant tryptophans on the alpha 1 subunit define domains necessary for GABA(A) receptor assembly. J Biol Chem 274:26633-26638.
Srivastava S, Osten P, Vilim FS, Khatri L, Inman G, States B, Daly C, DeSouza S, Abagyan R, Valtschanoff JG, Weinberg RJ, Ziff EB (1998) Novel anchorage of GluR2/3 to the postsynaptic density by the AMPA receptor-binding protein ABP. Neuron 21:581- 591.
165 Stallmeyer B, Nerlich A, Schiemann J, Brinkmann H, Mendel RR (1995) Molybdenum co-factor biosynthesis: the Arabidopsis thaliana cDNA cnxl encodes a multifunctional two-domain protein homologous to a mammalian neuroprotein, the insect protein Cinnamon and three Escherichia coli proteins. Plant J 8:751-762.
Stallmeyer B, Schwarz G, Schulze J, Nerlich A, Reiss J, Kirsch J, Mendel RR (1999) The neurotransmitter receptor-anchoring protein gephyrin reconstitutes molybdenum cofactor biosynthesis in bacteria, plants, and mammalian cells. Proc Natl Acad Sci U S A 96:1333- 1338.
Stephens DJ, Crump CM, Clarke AR, Banting G (1997) Serine 331 and tyrosine 333 are both involved in the interaction between the cytosolic domain of TGN38 and the mu2 subunit of the AP2 clathrin adaptor complex. J Biol Chem 272:14104-14109.
Stephenson FA (1995) The GABAA receptors. Biochem J 310:1-9.
Studier FW, Rosenberg AH, Dunn JJ, Dubendorff JW (1990) Use of T7 RNA polymerase to direct expression of cloned genes. Methods Fnzymol 185:60-89.
Study RF, Barker JL (1981) Diazepam and (—)-pentobarbital: fluctuation analysis reveals different mechanisms for potentiation of gamma-aminobutyric acid responses in cultured central neurones. Proc Natl Acad Sci U S A 78:7180-7184.
Sur C, McKernan R, Triller A (1995) Subcellular localization of the GABAA receptor gamma 2 subunit in the rat spinal cord. Fur J Neurosci 7:1323-1332.
Taylor PM, Thomas P, Gorrie GH, Connolly CN, Smart TG, Moss SJ (1999) Identification of amino acid residues within GABA(A) receptor beta subunits that mediate both homomeric and heteromeric receptor expression. J Neurosci 19:6360-6371.
Taylor PM, Connolly CN, Kittler JT, Gorrie GH, Hosie A, Smart TG, Moss SJ (2000) Identification of residues within GABA(A) receptor alpha subunits that mediate specific assembly with receptor beta subunits. J Neurosci 20:1297-1306.
Tehrani MH, Baumgartner BJ, Barnes FM, Jr. (1997a) Clathrin-coated vesicles from bovine brain contain uncoupled GABAA receptors. Brain Res 776:195-203.
166 Tehrani MH, Barnes EM, Jr. (1997b) Sequestration of gamma-aminobutyric acidA receptors on clathrin-coated vesicles during chronic benzodiazepine administration in vivo. J Pharmacol Exp Ther 283:384-390.
Thompson SM, Capogna M, Scanziani M (1993) Presynaptic inhibition in the hippocampus. Trends Neurosci 16:222-227.
Todd AJ, Watt C, Spike RC, Sieghart W (1996) Colocalization of GAEA, glycine, and their receptors at synapses in the rat spinal cord. J Neurosci 16:974-982.
Toyoshima C, Unwin N (1988) Ion channel of acetylcholine receptor reconstructed from images of postsynaptic membranes. Nature 336:247-250.
Tretter V, Ehya N, Fuchs K, Sieghart W (1997) Stoichiometry and assembly of a recombinant GABAA receptor subtype. J Neurosci 17:2728-2737.
Triller A, Cluzeaud F, Pfeiffer F, Betz H, Korn H (1985) Distribution of glycine receptors at central synapses: an immunoelectron microscopy study. J Cell Biol 101:683-688.
Triller A, Cluzeaud F, Korn H (1987) gamma-Aminobutyric acid-containing terminals can be apposed to glycine receptors at central synapses. J Cell Biol 104:947-956.
Tsien RY (1998) The green fluorescent protein. Annu Rev Biochem 67:509-544.
Tu JC, Xiao B, Naisbitt S, Yuan JP, Petralia RS, Brakeman P, Doan A, Aakalu VK, Fan ah an AA, Sheng M, Worley PF (1999) Coupling of mGluR/Homer and PSD-95 complexes by the Shank family of postsynaptic density proteins. Neuron 23:583-592.
Twyman RF, Macdonald RL (1992) Neurosteroid regulation of GABAA receptor single channel kinetic properties of mouse spinal cord neurones in culture. J Physiol (Lond) 456:215-245.
Unwin N, Toyoshima C, Kubalek F (1988) Arrangement of the acetylcholine receptor subunits in the resting and desensitized states, determined by cryoelectron microscopy of crystallized Torpedo postsynaptic membranes. J Cell Biol 107:1123-1138.
Unwin N (1993) Nicotinic acetylcholine receptor at 9 A resolution. J Mol Biol 229:1101- 1124.
167 Unwin N (1995) Acetylcholine receptor channel imaged in the open state. Nature 373:37- 43.
Vannier C, Triller A (1997) Biology of the postsynaptic glycine receptor. Int Rev Cytol 176:201-244.
Wafford KA, Whiting P, Kemp JA (1992) Functional modulation of cloned GABAA receptors expressed in Xenopus oocytes. Adv Biochem Psychopharmacol 47:75-79.
Wafford KA, Bain CJ, Quirk K, McKernan RM, Wingrove PB, Whiting PJ, Kemp JA (1994) A novel allosteric modulatory site on the GABAA receptor beta subunit. Neuron 12:775-782.
Walker JH, Boustead CM, Witzemann V (1984) The 43-K protein, vl, associated with acetylcholine receptor containing membrane fragments is an actin-binding protein. Embo J 3:2287-2290.
Wall MJ, Usowicz MM (1997) Development of action potential-dependent and independent spontaneous GABAA receptor-mediated currents in granule cells of postnatal rat cerebellum. Eur J Neurosci 9:533-548.
Wallace BG (1989) Agrin-induced specializations contain cytoplasmic, membrane, and extracellular matrix-associated components of the postsynaptic apparatus. J Neurosci 9:1294-1302.
Wan Q, Xiong ZG, Man HY, Ackerley CA, Braunton J, Lu WY, Becker LE, MacDonald JF, Wang YT (1997) Recruitment of functional GABA(A) receptors to postsynaptic domains by insulin. Nature 388:686-690.
Wang TL, Guggino WB, Cutting GR (1994) A novel gamma-aminobutyric acid receptor subunit (rho 2) cloned from human retina forms bicuculline-insensitive homooligomeric receptors in Xenopus oocytes. J Neurosci 14:6524-6531.
Wang H, Bedford FK, Brandon NJ, Moss SJ, Olsen RW (1999) GABA(A)-receptor- associated protein links GABA(A) receptors and the cytoskeleton. Nature 397:69-72.
Wang H, Olsen RW (2000) Binding of the GABA(A) receptor-associated protein (GABARAP) to microtubules and microfilaments suggests involvement of the cytoskeleton in GABARAPGABA(A) receptor interaction. J Neurochem 75:644-655.
168 Wang YT, Linden DJ (2000) Expression of cerebellar long-term depression requires postsynaptic clathrin-mediated endocytosis. Neuron 25:635-647.
Wechsler A, Teichberg VI (1998) Brain spectrin binding to the NMDA receptor is regulated by phosphorylation, calcium and calmodulin. Embo J 17:3931-3939.
Whiting P, McKernan RM, Iversen LL (1990) Another mechanism for creating diversity in gamma-aminobutyrate type A receptors: RNA splicing directs expression of two forms of gamma 2 phosphorylation site. Proc Natl Acad Sci U S A 87:9966-9970.
Whiting PJ, McAllister G, Vassilatis D, Bonnert TP, Heavens RP, Smith DW, Hewson L, O'Donnell R, Rigby MR, Sirinathsinghji DJ, Marshall G, Thompson SA, Wafford KA, Vasilatis D (1997) Neuronally restricted RNA splicing regulates the expression of a novel GABAA receptor subunit conferring atypical functional properties. J Neurosci 17:5027- 5037.
Wigge P, Vallis Y, McMahon HT (1997a) Inhibition of receptor-mediated endocytosis by the amphiphysin SH3 domain. Curr Biol 7:554-560.
Wigge P, Kohler K, Vallis Y, Doyle CA, Owen D, Hunt SP, McMahon HT (1997b) Amphiphysin heterodimers: potential role in clathrin-mediated endocytosis. Mol Biol Cell 8:2003-2015.
Wigge P, McMahon HT (1998) The amphiphysin family of proteins and their role in endocytosis at the synapse. Trends Neurosci 21:339-344.
Williams BM, Temburni MK, Levey MS, Bertrand S, Bertrand D, Jacob MH (1998) The long internal loop of the alpha 3 subunit targets nAChRs to subdomains within individual synapses on neurones in vivo. Nat Neurosci 1:557-562.
Wilson-Shaw D, Robinson M, Gambarana C, Siegel RE, Sikela JM (1991) A novel gamma subunit of the GABAA receptor identified using the polymerase chain reaction. FEBS Lett 284:211-215.
Wisden W, Seeburg PH (1992) GABAA receptor channels: from subunits to functional entities. Curr Opin Neurobiol 2:263-269.
169 Wooltorton JR, Moss SJ, Smart TG (1997) Pharmacological and physiological characterization of murine homomeric beta3 GABA(A) receptors. Eur J Neurosci 9:2225- 2235.
Wyszynski M, Lin J, Rao A, Nigh B, Beggs AH, Craig AM, Sheng M (1997) Competitive binding of alpha-actinin and calmodulin to the NMDA receptor. Nature 385:439-442.
Xia J, Zhang X, Staudinger J, Huganir RL (1999) Clustering of AMPA receptors by the synaptic PDZ domain-containing protein PICKl. Neuron 22:179-187.
Ye B, Liao D, Zhang X, Zhang P, Dong H, Huganir RL (2000) GRASP-1: a neuronal RasGEF associated with the AMPA receptor/GRIP complex. Neuron 26:603-617.
Ymer S, Draguhn A, Kohler M, Schofield PR, Seeburg PH (1989) Sequence and expression of a novel GABAA receptor alpha subunit. FEBS Lett 258:119-122.
Ymer S, Schofield PR, Draguhn A, Werner P, Kohler M, Seeburg PH (1989) GABAA receptor beta subunit heterogeneity: functional expression of cloned cDNAs. Embo J 8:1665-1670.
Ymer S, Draguhn A, Wisden W, Werner P, Keinanen K, Schofield PR, Sprengel R, Pritchett DB, Seeburg PH (1990) Structural and functional characterization of the gamma 1 subunit of GABAA/benzodiazepine receptors. Embo J 9:3261-3267.
Zimprich F, Zezula J, Sieghart W, Lassmann H (1991) Immunohistochemical localization of the alpha 1, alpha 2 and alpha 3 subunit of the GABAA receptor in the rat brain. Neurosci Lett 127:125-128.
170