DOCSLIB.ORG

Interpreting the Molecular Mechanisms of Yinchenhao Decoction on Hepatocellular Carcinoma Through Absorbed Components Based on Network Pharmacology

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Interpreting the Molecular Mechanisms of Yinchenhao Decoction on Hepatocellular Carcinoma Through Absorbed Components Based on Network Pharmacology Hindawi BioMed Research International Volume 2021, Article ID 6616908, 22 pages https://doi.org/10.1155/2021/6616908 Research Article Interpreting the Molecular Mechanisms of Yinchenhao Decoction on Hepatocellular Carcinoma through Absorbed Components Based on Network Pharmacology Jijia Sun ,1 Tao Han,1 Tao Yang ,1,2 Yunhui Chen ,3 and Jihan Huang 1,2 1Center for Drug Clinical Research, Shanghai Traditional Chinese Medicine Health Service Collaborative Innovation Center, Shanghai University of Traditional Chinese Medicine, Shanghai 201203, China 2Department of Cardiology, Cardiovascular Research Institute, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine, Shanghai 201203, China 3College of Basic Medicine, Chengdu University of Traditional Chinese Medicine, Chengdu 610075, China Correspondence should be addressed to Tao Yang; [email protected] and Jihan Huang; [email protected] Received 11 December 2020; Revised 23 April 2021; Accepted 7 May 2021; Published 20 May 2021 Academic Editor: Li-kang SUN Copyright © 2021 Jijia Sun et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. To investigate the mechanisms through which Yinchenhao decoction (YCHD) inhibits hepatocellular carcinoma (HCC), we analyzed YCHD ingredients absorbed into the bloodstream by using network pharmacology. We conducted a weighted gene coexpression network analysis on gene expression data collected from the Gene Expression Omnibus and The Cancer Genome Atlas databases to derive an HCC gene set; moreover, we used four online prediction system databases to predict the potential targets of YCHD ingredients absorbed into the bloodstream. We discovered that YCHD directly interfered with 17 HCC-related disease targets. Subsequent gene ontology enrichment analyses of these 17 disease targets revealed that YCHD exhibited effects through 17 biological processes, 7 molecular functions, and 9 cellular components. Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses indicated 14 pathways through which YCHD inhibits HCC. We observed similar trends in how the 17 small molecules interfered with the key target set. We surmised that YCHD inhibits HCC by regulating inflammatory and metabolic pathways. Network pharmacological analysis of YCHD ingredients absorbed into the bloodstream may provide new insights and serve as a new method for discovering the molecular mechanisms through which YCHD inhibits HCC. 1. Introduction Introduced in Shanghan Lun (Treatise on Cold Damage Diseases), Yinchenhao decoction (YCHD)—which consists Hepatocellular carcinoma (HCC) is the fourth most com- of yinchen (Artemisiae Scopariae Herba), dahuang (Radix mon cancer and the third most deadly cancer in China, et Rhizoma Rhei), and zhizi (Gardeniae Fructus)—is a popu- accounting for 85%–90% of primary malignant liver tumors lar remedy in TCM and is commonly used to treat yang jaun- [1]. Although the multikinase inhibitor sorafenib has been dice. A study identified 160 potential targets related to 16 approved as a first-line treatment for late-stage HCC because diseases, including cancer; of these targets, 96 were related of its favorable antiangiogenesis effects, it increases patients’ to cancer [4]. Concerning oral TCM compounds (i.e., medi- survival time by only a few months [2]. Traditional Chinese cine comprising two or more ingredients), the ingredients medicine (TCM), which has a long history of clinical appli- must undergo absorption, distribution, metabolism, and cation, exhibits multimolecule, multitarget, and synergistic excretion before they enter the bloodstream; only molecules effects. TCM has subsequently become a valuable alternative that complete this process are considered active. These mol- for HCC treatment. Therefore, the effectiveness of TCM in ecules merge with targets in the organism and then exhibit inhibiting HCC merits further investigation [3]. medicinal effects. In a preliminary study, we obtained active 2 BioMed Research International Hepatocellular carcinoma Active ingredients YCHD DEGs analysis of WGCNA analysis of YCHD ingredient data GEO & TCGA GEO & TCGA ADMET evaluation 670 HCC genes DEGs WGCNA HCC YCHD Targets prediction & identification 457 36 177 653 17 88 of YCHD Network construction GO & pathway Survival analysis Survival analysis and analysis enrichment analysis 17 HCC targets of 26 key HCC genes YCHD Effective ingredient regulatory network analysis Figure 1: Network pharmacology-based flowchart depicting how YCHD inhibits HCC. chemical molecules by using oral bioavailability (OB) screen- used the highly sensitive ultraperformance liquid chromatog- ing [5], drug-likeness (DL) assessments [6], and intestinal raphy–tandem mass technology to identify the 69 com- epithelial permeability (Caco-2) screening. In that study, we pounds in YCHD, among which 41 were absorbed into the were able to predict which molecules were beneficial; how- bloodstream [7]. Wu et al. conducted a study on major ever, their effects were minimal if the molecule content was anti-HCC components in YCHD in vitro and in vivo [8]. low or if the molecules were metabolized quickly. Sun et al. Nevertheless, the active molecules in YCHD compounds BioMed Research International 3 20 .val) P (adj. 10 10 –Log 0 –4 –2 0 24 Log2 FC Significant Down Not Up (a) Type SLCO1B3 KANK4 3 C9 APOF LPA BBOX1 SRD5A2 GBA3 HAO2 CYP2A6 SLC22A1 GYS2 AKR1D1 GHR MT 1M LINC00844 FLJ22763 NAT2 2 IGJ FOSB FOS CNTN3 CLEC4G CLEC4M CRHBP CLEC1B FCN3 OIT3 CXCL 14 CDHR2 HAMP SRPX CXCL12 BCO2 1 HGFAC SLC25A47 GPR 128 LINC01093 IDO2 KCNN2 ZGPAT CYP26A1 CNDP1 TTC36 TMEM27 CYP1A2 BCHE CLRN3 FREM2 THRSP 0 ST8SIA6–AS1 MAGEA6 COX7B2 LINC01419 ESM1 CRNDE APOBEC3B FAM83D HMMR NDC80 NCAPG KIF4A ANLN NUF2 CDKN3 PBK –1 EZH2 CENPK RAD51AP1 ZWINT GINS1 NUSAP1 RRM2 CCNB1 KIF20A BUB1B PRC1 TOP2A UHRF1 TTK ASPM CENPW –2 UBE2T RACGAP1 S100P CCL20 SPINK1 DKK1 ACSL4 GPC3 ROBO1 ZIC2 CTHRC1 COL15A1 SPP1 LCN2 RBM24 –3 CAP2 LOC344887 AKR1B10 Type N T (b) Figure 2: Continued. 4 BioMed Research International 20 .val) P (adj. 10 10 –Log 0 –4 –2 0 24 Log2 FC Significant Down Not Up (c) Type 4 FREM2 MUC6 CHST4 SFRPS SLC5A1 CD5L SLCO1B3 CYP1A2 CYP3A4 C9 MT1H MT1M MT1F MT1G MT1E PZP SYT9 KCNN2 CYP26A1 INS–IGF2 FCN2 VIPR1 FOSB HAMP MARCO 2 FCN3 CRHBP BMPER STAB2 GDF2 CLEC1B CLEC4G CLEC4M HHIP COLEC10 CCBE1 CXCL 14 RSPO3 SLC22A1 HAO2 HSD17B13 THRSP ADRA1A MFSD2A TTC36 NAT2 SLC25A47 UROC1 CNDP1 IGFALS 0 GPC3 TRIM71 IGF2BP1 TGM3 CPLX2 PGC REG3A MUC13 SFN EPS8L3 MAGEA1 TERT ZIC2 CDKN2A IQGAP3 ASPM KIF20A ANLN CENPF DEPDC1 MELK KIF4A NUF2 NEK2 TTK –2 KIF18B TOP2A CDK1 NCAPG E2F 1 MYBL2 UBE2C CCNB2 KIFC1 HJURP TROAP BIRC5 KIF2C CDC20 CDKN3 CDC25C SKA1 ISX HOXA13 COL15A1 GABRD APLN ESM1 EBF2 THBS4 –4 Type N T (d) Figure 2: Continued. BioMed Research International 5 GEO TCGA 87 493 2220 (e) Figure 2: (a) Volcano map of the GEO-based DEG analysis. (b) Heat map of the GEO-based DEG analysis. (c) Volcano map of TCGA-based DEG analysis. (d) Heat map of TCGA-based DEG analysis. (e) Venn diagram of the intersection between the GEO and TCGA DEGs. and the mechanisms through which these compounds miti- database and collected disease-related gene expression profile gate HCC remain relatively unknown. chips. After analyzing and comparing the different chips, we TCM incorporates complex chemical compositions, and selected the GSE121248 chip for analysis. This chip origi- effective research methods for examining these compositions nated from the GPL570 [HG-U133_Plus_2] Affymetrix are limited; additionally, the pharmacological mechanisms Human Genome U133 Plus 2.0 Array platform, which con- governing TCM have yet to be systematically explained [9]. tains 70 liver cancer samples and 37 normal samples. TCGA Systems pharmacology [10] is an emerging discipline that is a joint project initiated by the American National Cancer involves systematically studying the interaction between Institute and the National Human Genome Research Insti- medicine and organisms as well as the patterns, effects, and tute in 2006. TCGA is the largest cancer gene database world- mechanisms of such medicine. Network pharmacology [11] wide and contains a wealth of clinical information [16]. We is used to study active substances in TCM, identify the targets searched TCGA for (and subsequently downloaded) liver affected by these substances, determine the relationships cancer-related RNA-seq gene expression data and the corre- between effective substances and diseases, and elucidate the sponding clinical data files, which contained 373 tumor sam- molecular mechanisms governing the activities of TCM com- ples and 49 normal samples. pounds. Therefore, systems pharmacology- and network pharmacology-based studies offer new perspectives and 2.2. DEG-Based Disease Gene Analysis. We used the limma insights into TCM compounds. Regarding the use of network package (version: 3.42.2) in R language to analyze DEGs pharmacology to study TCM, our laboratory has performed identified in the GSE121248 and TCGA data. Subsequently, numerous experiments and explored the pharmacological we filtered out upregulated and downregulated DEGs from mechanisms governing zuojin pills [12], huanglian jiedu the GEO and TCGA chip data by using the following j j : :p: : decoction [13], and huachansu capsules [14] in the treatment conditions: log2FC >10 and adj value < 0 05. Finally, we of HCC. employed the ggplot2 package (version: 3.3.1) and
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Association Analyses of Known Genetic Variants with Gene
    ASSOCIATION ANALYSES OF KNOWN GENETIC VARIANTS WITH GENE EXPRESSION IN BRAIN by Viktoriya Strumba A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Bioinformatics) in The University of Michigan 2009 Doctoral Committee: Professor Margit Burmeister, Chair Professor Huda Akil Professor Brian D. Athey Assistant Professor Zhaohui S. Qin Research Statistician Thomas Blackwell To Sam and Valentina Dmitriy and Elizabeth ii ACKNOWLEDGEMENTS I would like to thank my advisor Professor Margit Burmeister, who tirelessly guided me though seemingly impassable corridors of graduate work. Throughout my thesis writing period she provided sound advice, encouragement and inspiration. Leading by example, her enthusiasm and dedication have been instrumental in my path to becoming a better scientist. I also would like to thank my co-advisor Tom Blackwell. His careful prodding always kept me on my toes and looking for answers, which taught me the depth of careful statistical analysis. His diligence and dedication have been irreplaceable in most difficult of projects. I also would like to thank my other committee members: Huda Akil, Brian Athey and Steve Qin as well as David States. You did not make it easy for me, but I thank you for believing and not giving up. Huda’s eloquence in every subject matter she explained have been particularly inspiring, while both Huda’s and Brian’s valuable advice made the completion of this dissertation possible. I would also like to thank all the members of the Burmeister lab, both past and present: Sandra Villafuerte, Kristine Ito, Cindy Schoen, Karen Majczenko, Ellen Schmidt, Randi Burns, Gang Su, Nan Xiang and Ana Progovac.
    [Show full text]
  • Recombinant Human Carbonic Anhydrase XIII Protein Catalog Number: ATGP3059
    Recombinant human Carbonic Anhydrase XIII protein Catalog Number: ATGP3059 PRODUCT INPORMATION Expression system E.coli Domain 1-262aa UniProt No. Q8N1Q1 NCBI Accession No. NP_940986.1 Alternative Names Carbonic anhydrase 13, CAXIII PRODUCT SPECIFICATION Molecular Weight 31.8 kDa (285aa) confirmed by MALDI-TOF Concentration 0.5mg/ml (determined by Bradford assay) Formulation Liquid in. Phosphate-Buffered Saline (pH 7.4) containing 10% glycerol, 1mM DTT Purity > 90% by SDS-PAGE Biological Activity Specific activity is > 2,500pmol/min/ug, and is defined as the amount of enzyme that hydrolyze 1.0pmole of 4- nitrophenyl acetate to 4-nitrophenol per minute at pH 7.5 at 37C. Tag His-Tag Application SDS-PAGE, Enzyme Activity Storage Condition Can be stored at +2C to +8C for 1 week. For long term storage, aliquot and store at -20C to -80C. Avoid repeated freezing and thawing cycles. BACKGROUND Description CA13 also known as carbonic anhydrase 13 belongs to the alpha-carbonic anhydrase family. The carbonic anhydrase from a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that occurs relatively slowly in the absence of catalyst. The active 1 Recombinant human Carbonic Anhydrase XIII protein Catalog Number: ATGP3059 site of most carbonic anhydrases contains a zinc ion; they are claasified as metalloenzymes. There are at least five distinct CA families (alpha, beta, gamma, delta, and epsilon). These families have no significant amino acid sequence similarity and in most cases are thought to be an example of convergent evolution. The alpha-CAs are found in humans.
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Steroid-Dependent Regulation of the Oviduct: a Cross-Species Transcriptomal Analysis
    University of Kentucky UKnowledge Theses and Dissertations--Animal and Food Sciences Animal and Food Sciences 2015 Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis Katheryn L. Cerny University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Cerny, Katheryn L., "Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis" (2015). Theses and Dissertations--Animal and Food Sciences. 49. https://uknowledge.uky.edu/animalsci_etds/49 This Doctoral Dissertation is brought to you for free and open access by the Animal and Food Sciences at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Animal and Food Sciences by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
    [Show full text]
  • P-Glycoprotein-Mediated Chemoresistance Is Reversed by Carbonic Anhydrase XII Inhibitors
    www.impactjournals.com/oncotarget/ Oncotarget, Advance Publications 2016 P-glycoprotein-mediated chemoresistance is reversed by carbonic anhydrase XII inhibitors Joanna Kopecka1, Gregory M. Rankin2, Iris C. Salaroglio1, Sally-Ann Poulsen2,*, Chiara Riganti1,* 1Department of Oncology, University of Torino, 10126 Torino, Italy 2Eskitis Institute for Drug Discovery, Griffith University, Brisbane, Nathan, Queensland, 4111, Australia *These authors contributed equally to this work Correspondence to: Sally-Ann Poulsen, email: [email protected] Chiara Riganti, email: [email protected] Keywords: carbonic anhydrase XII, P-glycoprotein, doxorubicin, chemoresistance, intracellular pH Received: August 26, 2016 Accepted: October 28, 2016 Published: November 03, 2016 ABSTRACT Carbonic anhydrase XII (CAXII) is a membrane enzyme that maintains pH homeostasis and sustains optimum P-glycoprotein (Pgp) efflux activity in cancer cells. Here, we investigated a panel of eight CAXII inhibitors (compounds 1–8), for their potential to reverse Pgp mediated tumor cell chemoresistance. Inhibitors (5 nM) were screened in human and murine cancer cells (colon, lung, breast, bone) with different expression levels of CAXII and Pgp. We identified three CAXII inhibitors (compounds 1, 2 and 4) that significantly (≥ 2 fold) increased the intracellular retention of the Pgp-substrate and chemotherapeutic doxorubicin, and restored its cytotoxic activity. The inhibitors lowered intracellular pH to indirectly impair Pgp activity. Ca12-knockout assays confirmed that the chemosensitizing property of the compounds was dependent on active CAXII. Furthermore, in a preclinical model of drug-resistant breast tumors compound 1 (1900 ng/kg) restored the efficacy of doxorubicin to the same extent as the direct Pgp inhibitor tariquidar. The expression of carbonic anhydrase IX had no effect on the intracellular doxorubicin accumulation.
    [Show full text]
  • High-Throughput Screening Studies of Inhibition of Human Carbonic Anhydrase II and Bacterial Flagella Antimicrobial Activity
    Western Michigan University ScholarWorks at WMU Dissertations Graduate College 5-2010 High-Throughput Screening Studies of Inhibition of Human Carbonic Anhydrase II and Bacterial Flagella Antimicrobial Activity Albert A. Barrese III Western Michigan University Follow this and additional works at: https://scholarworks.wmich.edu/dissertations Part of the Biochemistry, Biophysics, and Structural Biology Commons, and the Biology Commons Recommended Citation Barrese, Albert A. III, "High-Throughput Screening Studies of Inhibition of Human Carbonic Anhydrase II and Bacterial Flagella Antimicrobial Activity" (2010). Dissertations. 500. https://scholarworks.wmich.edu/dissertations/500 This Dissertation-Open Access is brought to you for free and open access by the Graduate College at ScholarWorks at WMU. It has been accepted for inclusion in Dissertations by an authorized administrator of ScholarWorks at WMU. For more information, please contact [email protected]. HIGH-THROUGHPUT SCREENING STUDIES OF INHIBITION OF HUMAN CARBONIC ANHYDRASE II AND BACTERIAL FLAGELLA ANTIMICROBIAL ACTIVITY by Albert A. Barrese III A Dissertation Submitted to the Faculty of The Graduate College in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Department of Biological Sciences Advisor: Brian C. Tripp, Ph.D. Western Michigan University Kalamazoo, Michigan May 2010 UMI Number: 3410393 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. UMT Dissertation Publishing UMI 3410393 Copyright 2010 by ProQuest LLC.
    [Show full text]
  • Quantigene Flowrna Probe Sets Currently Available
    QuantiGene FlowRNA Probe Sets Currently Available Accession No. Species Symbol Gene Name Catalog No. NM_003452 Human ZNF189 zinc finger protein 189 VA1-10009 NM_000057 Human BLM Bloom syndrome VA1-10010 NM_005269 Human GLI glioma-associated oncogene homolog (zinc finger protein) VA1-10011 NM_002614 Human PDZK1 PDZ domain containing 1 VA1-10015 NM_003225 Human TFF1 Trefoil factor 1 (breast cancer, estrogen-inducible sequence expressed in) VA1-10016 NM_002276 Human KRT19 keratin 19 VA1-10022 NM_002659 Human PLAUR plasminogen activator, urokinase receptor VA1-10025 NM_017669 Human ERCC6L excision repair cross-complementing rodent repair deficiency, complementation group 6-like VA1-10029 NM_017699 Human SIDT1 SID1 transmembrane family, member 1 VA1-10032 NM_000077 Human CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) VA1-10040 NM_003150 Human STAT3 signal transducer and activator of transcripton 3 (acute-phase response factor) VA1-10046 NM_004707 Human ATG12 ATG12 autophagy related 12 homolog (S. cerevisiae) VA1-10047 NM_000737 Human CGB chorionic gonadotropin, beta polypeptide VA1-10048 NM_001017420 Human ESCO2 establishment of cohesion 1 homolog 2 (S. cerevisiae) VA1-10050 NM_197978 Human HEMGN hemogen VA1-10051 NM_001738 Human CA1 Carbonic anhydrase I VA1-10052 NM_000184 Human HBG2 Hemoglobin, gamma G VA1-10053 NM_005330 Human HBE1 Hemoglobin, epsilon 1 VA1-10054 NR_003367 Human PVT1 Pvt1 oncogene homolog (mouse) VA1-10061 NM_000454 Human SOD1 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2003/0082511 A1 Brown Et Al
    US 20030082511A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2003/0082511 A1 Brown et al. (43) Pub. Date: May 1, 2003 (54) IDENTIFICATION OF MODULATORY Publication Classification MOLECULES USING INDUCIBLE PROMOTERS (51) Int. Cl." ............................... C12O 1/00; C12O 1/68 (52) U.S. Cl. ..................................................... 435/4; 435/6 (76) Inventors: Steven J. Brown, San Diego, CA (US); Damien J. Dunnington, San Diego, CA (US); Imran Clark, San Diego, CA (57) ABSTRACT (US) Correspondence Address: Methods for identifying an ion channel modulator, a target David B. Waller & Associates membrane receptor modulator molecule, and other modula 5677 Oberlin Drive tory molecules are disclosed, as well as cells and vectors for Suit 214 use in those methods. A polynucleotide encoding target is San Diego, CA 92121 (US) provided in a cell under control of an inducible promoter, and candidate modulatory molecules are contacted with the (21) Appl. No.: 09/965,201 cell after induction of the promoter to ascertain whether a change in a measurable physiological parameter occurs as a (22) Filed: Sep. 25, 2001 result of the candidate modulatory molecule. Patent Application Publication May 1, 2003 Sheet 1 of 8 US 2003/0082511 A1 KCNC1 cDNA F.G. 1 Patent Application Publication May 1, 2003 Sheet 2 of 8 US 2003/0082511 A1 49 - -9 G C EH H EH N t R M h so as se W M M MP N FIG.2 Patent Application Publication May 1, 2003 Sheet 3 of 8 US 2003/0082511 A1 FG. 3 Patent Application Publication May 1, 2003 Sheet 4 of 8 US 2003/0082511 A1 KCNC1 ITREXCHO KC 150 mM KC 2000000 so 100 mM induced Uninduced Steady state O 100 200 300 400 500 600 700 Time (seconds) FIG.
    [Show full text]
  • An Update on the Metabolic Roles of Carbonic Anhydrases in the Model Alga Chlamydomonas Reinhardtii
    H OH metabolites OH Review An Update on the Metabolic Roles of Carbonic Anhydrases in the Model Alga Chlamydomonas reinhardtii Ashok Aspatwar 1,* ID , Susanna Haapanen 1 and Seppo Parkkila 1,2 1 Faculty of Medicine and Life Sciences, University of Tampere, FI-33014 Tampere, Finland; [email protected].fi (S.H.); [email protected].fi (S.P.) 2 Fimlab, Ltd., and Tampere University Hospital, FI-33520 Tampere, Finland * Correspondence: [email protected].fi; Tel.: +358-46-596-2117 Received: 11 January 2018; Accepted: 10 March 2018; Published: 13 March 2018 Abstract: Carbonic anhydrases (CAs) are metalloenzymes that are omnipresent in nature. − + CAs catalyze the basic reaction of the reversible hydration of CO2 to HCO3 and H in all living organisms. Photosynthetic organisms contain six evolutionarily different classes of CAs, which are namely: α-CAs, β-CAs, γ-CAs, δ-CAs, ζ-CAs, and θ-CAs. Many of the photosynthetic organisms contain multiple isoforms of each CA family. The model alga Chlamydomonas reinhardtii contains 15 CAs belonging to three different CA gene families. Of these 15 CAs, three belong to the α-CA gene family; nine belong to the β-CA gene family; and three belong to the γ-CA gene family. The multiple copies of the CAs in each gene family may be due to gene duplications within the particular CA gene family. The CAs of Chlamydomonas reinhardtii are localized in different subcellular compartments of this unicellular alga. The presence of a large number of CAs and their diverse subcellular localization within a single cell suggests the importance of these enzymes in the metabolic and biochemical roles they perform in this unicellular alga.
    [Show full text]
  • The Effects of Betaine Treatment on Rats Fed an Acute Bolus of Ethanol at 3 and 12 H Post Bolus: a Microarray Analysis
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by PubMed Central Genes Nutr (2010) 5:321–329 DOI 10.1007/s12263-010-0173-y RESEARCH PAPER The effects of betaine treatment on rats fed an acute bolus of ethanol at 3 and 12 h post bolus: a microarray analysis J. Li • F. Bardag-Gorce • J. Oliva • B. A. French • J. Dedes • S. W. French Received: 24 November 2009 / Accepted: 19 February 2010 / Published online: 19 March 2010 Ó The Author(s) 2010. This article is published with open access at Springerlink.com Abstract Betaine, a methyl donor active in methionine Introduction metabolism, is effective in preventing and reversing experimental alcohol liver disease. The metabolic and Ethanol, given as a bolus of 6 g/kg body weight, increases molecular biologic mechanisms involved in this prevention the blood and urinary alcohol to a high level at 3 h post are only partially known. To further investigate how betaine bolus. At 12 h, the blood and urinary alcohol levels return modifies the effects of ethanol on the liver, rats were given to low a level [2]. At these 2 time points, there are major an acute ethanol bolus with or without betaine and the changes in gene expression in the liver but only minimal results were compared to isocaloric dextrose-fed controls. evidence of epigenetic changes [2]. Only at 12 h is there a Livers were subjected to microarray analysis, and functional decrease in global DNA methylation [2]. pathways and individual gene expression changes were Previously, in using this model, S-adenosylmethionine analyzed.
    [Show full text]
  • And Primate Evolution Gene Copy Number Variation Spanning 60
    Downloaded from genome.cshlp.org on January 27, 2009 - Published by Cold Spring Harbor Laboratory Press Gene copy number variation spanning 60 million years of human and primate evolution Laura Dumas, Young H. Kim, Anis Karimpour-Fard, et al. Genome Res. 2007 17: 1266-1277 originally published online July 31, 2007 Access the most recent version at doi:10.1101/gr.6557307 Supplemental http://genome.cshlp.org/content/suppl/2007/07/26/gr.6557307.DC1.html Material References This article cites 51 articles, 20 of which can be accessed free at: http://genome.cshlp.org/content/17/9/1266.full.html#ref-list-1 Article cited in: http://genome.cshlp.org/content/17/9/1266.full.html#related-urls Email alerting Receive free email alerts when new articles cite this article - sign up in the box at the service top right corner of the article or click here To subscribe to Genome Research go to: http://genome.cshlp.org/subscriptions Copyright © 2007, Cold Spring Harbor Laboratory Press Downloaded from genome.cshlp.org on January 27, 2009 - Published by Cold Spring Harbor Laboratory Press Article Gene copy number variation spanning 60 million years of human and primate evolution Laura Dumas,1 Young H. Kim,2 Anis Karimpour-Fard,3 Michael Cox,1,4,5 Janet Hopkins,1,4,5 Jonathan R. Pollack,2 and James M. Sikela1,4,5,6 1Human Medical Genetics Program, University of Colorado at Denver and Health Sciences Center, Aurora, Colorado 80045, USA; 2Department of Pathology, Stanford University, Stanford, California 94305, USA; 3Department of Preventative Medicine and Biometrics,
    [Show full text]