Biallelic Expression of Tssc4, Nap1l4, Phlda2 and Osbpl5 in Adult Cattle

c Indian Academy of Sciences

RESEARCH ARTICLE

Biallelic expression of Tssc4, Nap1l4, Phlda2 and Osbpl5 in adult cattle

MENGNAN WANG1, DONGJIE LI2, MINGYUE ZHANG1, WENZHI YANG1, GUOJIANG WU1, YALI CUI1 and SHIJIE LI1∗

1College of Life Science, Agricultural University of Hebei, Baoding 071001, People’s Republic of China 2College of Life Science and Life Engineering, Science and Technology University of Hebei, Shijiazhuang 050018, People’s Republic of China

Abstract Genomic imprinting of the Cdkn1c/Kcnq1ot1 region shows lack of conservation between human and mouse. This region has been reported to be associated with Beckwith–Wiedemann syndrome (BWS) and cancer. To increase our understanding of imprinted genes in bovine Cdkn1c/Kcnq1ot1 imprinting cluster, we assessed the imprinting status of four cattle genes (Tssc4, Nap1l4, Phlda2 and Osbpl5) in seven types of tissues: heart, liver, spleen, lung, kidney, skeletal muscle and subcutaneous fat using polymorphism-based sequencing approach. It was found that all the four genes showed biallelic expression in tissues in which transcripts were detected. Nap1l4 and Tssc4 were detected in all examined tissues, while the expression of Phlda2 and Osbpl5 was tissue-specific. Phlda2 was not detected in heart and subcutaneous fat, and Osbpl5 was not detected in spleen and skeletal muscle. In addition, identification of species-specific imprinted genes is necessary to understand the evolution of genomic imprinting and to elucidate mechanisms leading to allele-specific expression.

[Wang M., Li D., Zhang M., Yang W., Wu G., Cui Y. and Li S. 2015 Biallelic expression of Tssc4, Nap1l4, Phlda2 and Osbpl5 in adult cattle. J. Genet. 94, 391–395]

Introduction Characterization of the allele-specific expression profile of imprinted genes at different developmental stages is neces- Genomic imprinting is an epigenetic process where imprin- sary to understand the function of imprinted genes and to ted genes are expressed monoallelically depending on their elucidate the mechanisms behind imprinting. parental origin (see Morison et al. 2005; Hasan et al. 2007). The Cdkn1c/Kcnq1ot1 region is one of the largest known At present, around 200 genes are known to be imprin- imprinted clusters. In humans, it is located on chromosome ted in mice and humans, but only a few have been iden- 11p15.5 and in mouse, on distal chromosome 7. It also har- tified in cattle (http://otago.ac.nz/IGC/). The imprinting bours multiple imprinted genes (Reik et al. 2003). Altered status of many genes is conserved among mammalian imprinting of this region is associated with human diseases species, but some genes show species-specific imprinting such as Beckwith–Wiedemann syndrome (BWS) and many (Paulsen et al. 2000). Examining the extent of genetic types of tumours (Mitsuya et al. 1999). Cattle are a better imprinting among mammalian species is useful in under- model organism than mouse, since shorter evolutionary dis- standing the evolution of genomic imprinting. Many tance to human and similar timing of preimplantation devel- imprinted genes play significant roles in embryonic growth, opment. In the present study, the imprinting status of four development, adult behaviour, meat yield, lean meat percent- genes (Tssc4, Nap1l4, Phlda2 and Osbpl5) was investigated age and feed efficiency in mammals. In addition, imprinted in cattle. Tumour suppressing subtransferable candidate 4 genes are closely related to disease susceptibility and immu- (Tssc4), an important tumour-suppressor gene, plays a role in nity (Reik and Walter 2001;Reiket al. 2003; Kawahara malignancies and diseases that involve the Cdkn1c/Kcnq1ot1 and Kono 2012). Currently, imprinting status is gener- region (Paulsen et al. 2000). Nucleosome assembly protein ally studied in mammalian embryos and placental tissues. 1-like 4 (Nap1l4) also known as NAP-2, encodes a nucleo- Some imprinted genes exhibit development stage-specific some assembly protein that belongs to the NAPs family of imprinting patterns (Ohlsson et al. 1994;Leeet al. 1997). proteins (Rodriguez et al. 1997; Okuwaki et al. 2010). Pleck- strin homology-like domain, family A, member 2 (Phlda2), ∗For correspondence. E-mail: [email protected]. also known as Ipl or Tssc3, encodes a cytoplasmic protein

Keywords. bovine; Tssc4; Nap1l4; Phlda2; Osbpl5; allele-speciﬁc expression; imprinting.

Journal of Genetics, Vol. 94, No. 3, September 2015 391 Mengnan Wang et al. and negatively controls placental development (Frank et al. identified in heterozygous individuals were used to assess 2002; Salas et al. 2004; Tunster et al. 2010). Oxysterol- genomic imprinting. binding protein-like 5 (Osbpl5) play a key role in maintain- ing the cholesterol balance in the body. These four genes are known to be maternally imprinted in mouse placenta at the Total RNA extraction and reverse transcription Cdkn1c/Kcnq1ot1 region. Total RNA was isolated from tissue samples of heterozygous calves using the Trizol RNA Extracted Kit (Invitrogen, Shanghai, China) and treated with RNase-free DNase to Materials and methods remove possible contaminating genomic DNA. The quality and quantity of the RNA was tested using a ND-1000 spectro- Animals and tissues photometer (NanoDrop, Wilmington, USA). Approximately Tissue samples of heart, liver, spleen, lung, kidney, skele- 2 µg RNA was reverse transcribed using an RT kit (Promega, tal muscle and subcutaneous fat of 32 dairy cattle (Holstein) Beijing, China). The RT reaction was conducted according to were collected from a local abattoir. After collecting all tissue the manufacturer’s guidelines using oligo (dT) primers and 5 samples, they were immediately frozen in liquid nitrogen and units of Superscript RT enzyme in 20 µL total volume. stored at –70◦C until further analysis. All protocols involving use of animals were approved by the Agriculture Research Animal Care Committee of Hebei Agriculture University. RT-PCR RT-PCR was used to determine the expression patterns of Tssc4, Nap1l4, Phlda2 and Osbpl5 in tissues: heart, liver, DNA extraction and PCR amplification spleen, lung, kidney, skeletal muscle and subcutaneous fat. Genomic DNA was extracted from liver tissues of 32 All primers were designed according to the retrieved adult cattle using DNA Extraction Kit (Sangon Biotech, sequences of Tssc4 (GenBank accession no. NM_0010754 Shanghai, China) following the manufacturer’s instruction. 10), Nap1l4 (GenBank accession no. NM_001038094), Single-nucleotide polymorphisms (SNPs) were identified in Phlda2 (GenBank accession no. NM_001076521) and heterozygous individuals and confirmed by sequencing the Osbpl5 (GenBank accession no. XM_002699428) in cat- PCR products. All primers were designed using Primer5 and tle. In RT-PCR reactions, all primers were designed to Oligo6 (table 1). PCR sample mixtures were as follows: 1 µL cross introns to exclude genomic DNA. A 367 bp fragment primers (10 µM), 1 µL genomic DNA, 9.5 µL ddH2Oand of the Gapdh gene was amplified as the internal control 12.5 µL ES Tap MasterMix (CWBio, Beijing, China). PCR using primers (Gap-F: GCACAGTCAAGGCAGAA AC and amplification conditions were as follows: initial denaturation Gap-R: GCGTGGACAGTGGTCATAAG) designed based at 94◦C for 5 min, followed by 35 cycles of denaturation at on the GenBank sequence (accession no. BTU85042). The 94◦C for 30 s, annealing at 56◦CforTssc4,50◦CforNap1l4 cDNA of Tssc4, Nap1l4, Phlda2, Osbpl5 and Gapdh were 48◦CforPhlda2 and 53◦CforOsbpl5 for 30 s, elongation amplified using the following programme: initial denatura- at 72◦C for 70 s, and a final extension at 72◦C for 10 min. tion at 94◦C for 5 min, followed by 35 cycles of denatu- Table 1 shows the primer sequences used to amplify the ration at 94◦C for 30 s, annealing at 56◦CforTssc4,47◦C genomic DNA and the expected PCR product sizes. SNPs for Nap1l4,48◦CforPhlda2,55◦CforOsbpl5 and 50◦C

Table 1. Primer sequences and PCR information.

Gene Primers (5′–3′) Annealing temp. (◦C) PCR size (bp) Product type

Tssc4 Tss-Fg: CCTTCGTCAGCATTCA 56 1453 DNA Tss-Rg: TGGTCCACACAGATACAC Tss-F: CCTTCGTCAGCATTCA 56 752 cDNA Tss-R: TCCTGGATACCCTCTTC Nap1l4 Nap-Fg : GCTGGAGAAGCGAAGTGACA 50 1119 DNA Nap-Rg: ACTCTGGAGGCTCAGTGAAT Nap-F: AGGGGATGGAGAATCACTGG 47 751 cDNA Nap-R: TTGGAGGACAAGCGAGAGAG Phlda2 Phl-Fg: AGCTGGATAAGCGAAGTGAC 48 937 DNA Phl-Rg: AGAAAAGAGAATGAACCGAG Phl-F: GCTGGAGAAGCGAAGTGACA 48 539 cDNA Phl-R: ACTCTGGAGGCTCAGTGAAT Osbpl5 Osb-Fg: CTCCGTTTTCACCAGA 53 946 DNA Osb-Rg: GAAGGGAAGATCGTGC Osb-F: GTCACCGAGAGCAGCG 55 825 cDNA Osb-R: AGAGGGCAGAAGGAAGC

392 Journal of Genetics, Vol. 94, No. 3, September 2015 Expression of bovine Tssc4, Nap1l4, Phlda2 and Osbpl5 for Gapdh for 30 s, elongation at 72◦C for 50 s, and a ﬁnal extension at 72◦C for 10 min. The PCR reaction mixture (25 µL) contained 1 µL primers (10 µM), 1 µL cDNA, 9.5 µL ddH2O and 12.5 µL ES Tap MasterMix (CWBio). Table 1 shows the primer sequences used to amplify the cDNA and the expected PCR product sizes. The PCR products were puriﬁed using UNIQ-10 column DNA gel extraction kit (Sangon, China) and sequenced directly using the dideoxy chain-termination method.

Allele-specific imprinting patterns analysis For imprinting assays, 12 heterozygous individuals (three heterozygous individuals per line per time point) of Tssc4, Figure 2. Expression analysis of cattle Tssc4, Nap1l4, Phlda2 and Nap1l4, Phlda2 and Osbpl5 were slaughtered to extract Osbpl5 genes. M, DNA marker DL2000 (1000, 750, 500 and 250 RNA samples. All cDNA samples were reverse transcribed bp). Lanes 1–7 are RT-PCR products obtained from heart, liver, spleen, lung, kidney, muscle and subcutaneous fat. The size of from total RNA prepared from the organs of three heterozy- RT-PCR production were 367bp for GADPH. gous animals. PCR products were purified and sequenced directly. Imprinted genes are expected to exhibit hemizy- Nap1l4, Phlda2 and Osbpl5 genes were expressed virtually gosity, whereas a biallelically-expressed gene would exhibit in all analysed tissues, with the exception of Phlda2,which heterozygosity at the SNP. was not detected in heart and subcutaneous fat tissues, as well as Osbpl5, which was not detected in spleen and skeletal Results muscle tissues (figure 2).

SNP detection Imprinting status of the candidate genes SNPs were detected by direct sequencing of PCR products. The imprinting status of the four candidate genes was anal- The primer pairs used to amplify the transcript region of ysed by comparing the heterozygosity of the sequencing the four target genes in the gDNA and cDNA are shown chromatograms between the gDNA and cDNA sequences in table 1. We detected c.294C>T SNP in exon 3 of Tssc4, from the same sample. The c.294C>TSNPinTssc4, c.1573T>A SNP in exon 15 of Nap1l4, c.569A>TSNPin c.1573T>ASNPinNap1l4, c.569A>TSNPinPhlda2 and exon 2 of Phlda2 and c.2965C>T SNP in exon 20 of Osbpl5 c.2965C>TSNPinOsbpl5 were used to distinguish between (ﬁgure 1). Heterozygous animals were used for imprinting monoallelic and biallelic expressions. Total RNA extracted analysis of Tssc4, Nap1l4, Phlda2 and Osbpl5. from three heterozygous animals was used for RT-PCR analysis. The RT-PCR products were sequenced directly in all the tissues where expression was detected. The results showed that Expression of candidate genes all the four genes, Tssc4, Nap1l4, Phlda2 and Osbpl5 were RT-PCR was performed to study the expression of Tssc4, biallelically expressed in all examined tissues (ﬁgure 3). Nap1l4, Phlda2 and Osbpl5 in seven types of tissues: heart, liver, spleen, lung, kidney, skeletal muscle and subcutaneous Discussion fat. Total RNA extracted from three animals was used for RT-PCR analysis. The primers Tss-F/Tss-R, Nap-F/Nap-R, In this study, the imprinting status of four genes in Phl-F/Phl-R and Osb-F/Osb-R spanned more than 1 exon and Cdkn1c/Kcnq1ot1 imprinting cluster was analysed in adult were used to amplify a 752 bp fragment of Tssc4, a 751 bp cattle tissues using a sequencing-based approach. The results fragment of Nap1l4, a 539 bp fragment of Phlda2 and a showed that Tssc4, Nap1l4, Phlda2 and Osbpl5 are bialleli- 825 bp fragment of Osbpl5. Our results showed that Tssc4, cally expressed in all analysed tissues.

Figure 1. Identiﬁcation of SNPs in bovine Tssc4, Nap1l4, Phlda2 and Osbpl5 genes. Sequence chromatograms of gDNA obtained from the hybrid cattle.

Journal of Genetics, Vol. 94, No. 3, September 2015 393 Mengnan Wang et al.

Figure 3. Allele-speciﬁc expression of Tssc4, Nap1l4, Phlda2 and Osbpl5 genes in bovine. The arrows indicate SNP sites.

In adult cattle, Tssc4 transcripts were detected in seven identified as biallelically expressed in mouse placenta and types of tissues: heart, liver, spleen, lung, kidney, skeletal other embryonic tissues (Umlauf et al. 2004). Similarly, in muscle and fat using RT-PCR. In previous studies, Tssc4 has humans and pigs, biallelic expression of Nap1l4 was present been reported to be expressed in a wide range of foetal and in all tissues (Higashimoto et al. 2006; Frost et al. 2010; Li adult tissues of cattle (Zaitoun and Khatib 2008) and humans et al. 2012). There are no related reports on imprinting status (Lee et al. 1999), which may imply that Tssc4 plays a ubiq- of Nap1l4 gene in cattle. Similar to the previous findings in uitous role. In mice (Umlauf et al. 2004) and cattle (Zaitoun mice, humans and pigs, biallelic transcription of Nap1l4 was and Khatib 2008), Tssc4 is maternally expressed in placen- detected in heart, liver, spleen, lung, kidney, muscle and sub- tal tissues and biallelically expressed in nonplacental tissues. cutaneous fat of adult cattle by direct sequencing of RT-PCR But in humans, Tssc4 was reported to not be imprinted (Lee products. et al. 1999; Monk et al. 2006). In this study, our imprinting Phlda2 gene was first identified in humans on chromo- analysis revealed that Tssc4 is biallelically expressed in adult some 11p15.5 and was found to be maternally expressed bovine tissues, which is consistent with the report of Zaitoun in the placenta (Frank et al. 1999). Phlda2 gene has been and Khatib (2008). Based on the aforementioned studies in shown to be imprinted in pigs (Bischoff et al. 2009) and mice humans, mice and cattle, Tssc4 gene has been demonstrated (Qian et al. 1997). Phlda2 is monoallelically expressed in to be a species-specific imprinted gene. cattle foetal tissues and placenta (Sikora et al. 2012). In this The Nap1l4 gene plays a role in mediating nucleosome study, Phlda2 gene was found to be biallelically expressed formation and mainly localizes in cytoplasm of humans in liver, spleen, lung, kidney and muscle tissues of adult cat- (Okuwaki et al. 2010). Nap1l4 was ubiquitously expressed tle, which indicate that the imprinting of cattle Phlda2 is in human and porcine tissues (Hu et al. 1996; Li et al. development-stage-specific. 2012). Similarly, our work also showed that Nap1l4 was Osbpl5 has shown to be maternally expressed only in expressed in all seven analysed cattle tissues. There are some the placenta of human and mice (Umlauf et al. 2004; existing reports on the imprinting of Nap1l4. Nap1l4 was Higashimoto et al. 2006). But Frost et al. (2010) reported

394 Journal of Genetics, Vol. 94, No. 3, September 2015 Expression of bovine Tssc4, Nap1l4, Phlda2 and Osbpl5 that the expression of Osbpl5 was biallelic in human tro- Beckwith–Wiedemann syndrome chromosomal rearrangements. phoblast stem cells (EB-TS), as well as undifferentiated Nat. Genet. 15, 181–185. human embryonic stem cells (hES) and first trimester human Lee M. P., Brandenburg S., Landes G. M., Adams M., Miller G. and Feinberg A. P. 1999 Two novel genes in the center of the 11p15 foetal placenta. While there are no existing reports on its imprinted domain escape genomic imprinting. Hum. Mol. Genet. imprinting status in cattle, our results show that Osbpl5 is 8, 683–690. biallelically expressed in heart, liver, lung, kidney and fat tis- Li S., Li J., Tian J., Dong R., Wei J., Qiu X. et al. 2012 Char- sues of adult cattle which indicate that Osbpl5 gene is not acterization, tissue expression, and imprinting analysis of the imprinted in those tissues. porcine CDKN1C and NAP1L4 genes. J. Biomed. Biotechnol. 2012, 946527. The results of this study have increased our understanding Mitsuya K., Meguro M., Lee M. P., Katoh M., Schulz T. C., of the Cdkn1c/Kcnq1ot1 imprinting cluster and provide data Kugoh H. et al. 1999 LIT1, an imprinted antisense RNA in the for further investigations into the functions of cattle Tssc4, human KvLQT1 locus identified by screening for differentially Nap1l4, Phlda2 and Osbpl5 genes. expressed transcripts using monochromosomal hybrids. Hum. Mol. Genet. 8, 1209–1217. Monk D., Arnaud P., Apostolidou S., Hills F. A., Kelsey G., Stanier P. et al. 2006 Limited evolutionary conservation of imprinting in Acknowledgement the human placenta. Proc. Natl. Acad. Sci. USA 103, 6623–6628. Morison I. M., Ramsay J. P. and Spencer H. G. 2005 A census of This study was supported by National Natural Science Foundation mammalian imprinting. Trends Genet. 21, 457–465. of China (31372312). Ohlsson R., Hedborg F., Holmgren L., Walsh C. and Ekström T. J. 1994 Overlapping patterns of IGF2 and H19 expression during human development: biallelic IGF2 expression correlates with a References lack of H19 expression. Development 120, 361–368. Okuwaki M., Kato K. and Nagata K. 2010 Functional characteri- Bischoff S. R., Tsai S., Hardison N., Motsinger-Reif A. A., Freking zation of human nucleosome assembly protein 1-like proteins as B. A. and Piedrahita J. A. 2009 Functional genomic approaches histone chaperones. Genes Cells 15, 13–27. for the study of fetal/placental development in swine with spe- Paulsen M., El-Maarri O., Engemann S., Strödicke M., Franck O., cial emphasis on imprinted genes. Soc. Reprod. Fertil. Suppl. 66, Davies K. et al. 2000 Sequence conservation and variability of 245–264. imprinting in the Beckwith–Wiedemann syndrome gene cluster Frank D., Mendelsohn C. L., Ciccone E., Svensson K., Ohlsson in human and mouse. Hum. Mol. Genet. 9, 1829–1841. R. and Tycko B. 1999 A novel pleckstrin homology-related Qian N., Frank D., O’Keefe D., Dao D., Zhao L., Yuan L. et al. 1997 gene family defined by Ipl/Tssc3, TDAG51, and Tih1: tissue- The IPL gene on chromosome 11p15.5 is imprinted in humans specific expression, chromosomal location, and parental imprint- and mice and is similar to TDAG51, implicated in Fas expression ing. Mamm. Genome 10, 1150–1159. and apoptosis. Hum. Mol. Genet. 6, 2021–2029. Frank D., Fortino W., Clark L., Musalo R., Wang W., Saxena A. Reik W. and Walter J. 2001 Genomic imprinting: parental influence et al. 2002 Placental overgrowth in mice lacking the imprinted on the genome. Nat. Rev. Genet. 2, 21–32. gene Ipl. Proc. Natl. Acad. Sci. USA 99, 7490–7495. Reik W., Santos F. and Dean W. 2003 Mammalian epigenomics: Frost J. M., Udayashankar R., Moore H. D. and Moore G. E. 2010 reprogramming the genome for development and therapy. Therio- Telomeric NAP1L4 and OSBPL5 of the KCNQ1 cluster, and the genology 59, 21–32. DECORIN gene are not imprinted in human trophoblast stem Rodriguez P., Munroe D., Prawitt D., Chu L. L., Bric E., Kim cells. PLoS One 5, e11595. J. et al. 1997 Functional characterization of human nucleo- Higashimoto K., Soejima H., Saito T., Okumura K. and Mukai some assembly protein-2 (NAP1L4) suggests a role as a histone T. 2006 Imprinting disruption of the CDKN1C/KCNQ1OT1 chaperone. Genomics 44, 253–265. domain: the molecular mechanisms causing Beckwith– Salas M., John R., Saxena A., Barton S., Frank D., Fitzpatrick G. Wiedemann syndrome and cancer. Cytogenet. Genome Res. 113, et al. 2004 Placental growth retardation due to loss of imprinting 306–312. of Phlda2. Mech. Dev. 121, 1199–1210. Hu R. J., Lee M. P., Johnson L. A. and Feinberg A. P. 1996 A Sikora K. M., Magee D. A., Berkowicz E. W., Lonergan P., Evans novel human homologue of yeast nucleosome assembly pro- A. C., Carter F. et al. 2012 PHLDA2 is an imprinted gene in tein, 65 kb centromeric to the p57(KIP2) gene, is biallelically cattle. Anim. Genet. 43, 587–590. expressed in fetal and adult tissues. Hum. Mol. Genet. 5, 1743– Tunster S. J., Tycko B. and John R. M. 2010 The imprinted Phlda2 1748. gene regulates extraembryonic energy stores. Mol. Cell. Biol. 30, Kawahara M. and Kono T. 2012 Roles of genes regulated by two 295–306. paternally methylated imprinted regions on chromosomes 7 and Umlauf D., Goto Y., Cao R., Cerqueira F., Wagschal A., Zhang Y. 12 in mouse ontogeny. J. Reprod. Dev. 58, 175–179. et al. 2004 Imprinting along the Kcnq1 domain on mouse Khatib H., Zaitoun I. and Kim E. S. 2007 Comparative analysis of chromosome 7 involves repressive histone methylation and sequence characteristics of imprinted genes in human, mouse and recruitment of polycomb group complexes. Nat. Genet 36, cattle. Mamm. Genome 18, 538–547. 1296–1300. Lee M. P., Hu R. J., Johnson L. A. and Feinberg A. P. 1997 Human Zaitoun I. and Khatib H. 2008 Comparative genomic imprinting and KvLQT1 gene shows tissue specific imprinting and encompasses expression analysis of six cattle genes. J. Anim. Sci. 86, 25–32.

Received 17 January 2015, in revised form 5 February 2015; accepted 6 February 2015 Unedited version published online: 6 February 2015 Final version published online: 13 July 2015

Journal of Genetics, Vol. 94, No. 3, September 2015 395