Biallelic Expression of Tssc4, Nap1l4, Phlda2 and Osbpl5 in Adult Cattle

Total Page:16

File Type:pdf, Size:1020Kb

Load more

c Indian Academy of Sciences RESEARCH ARTICLE Biallelic expression of Tssc4, Nap1l4, Phlda2 and Osbpl5 in adult cattle MENGNAN WANG1, DONGJIE LI2, MINGYUE ZHANG1, WENZHI YANG1, GUOJIANG WU1, YALI CUI1 and SHIJIE LI1∗ 1College of Life Science, Agricultural University of Hebei, Baoding 071001, People’s Republic of China 2College of Life Science and Life Engineering, Science and Technology University of Hebei, Shijiazhuang 050018, People’s Republic of China Abstract Genomic imprinting of the Cdkn1c/Kcnq1ot1 region shows lack of conservation between human and mouse. This region has been reported to be associated with Beckwith–Wiedemann syndrome (BWS) and cancer. To increase our understanding of imprinted genes in bovine Cdkn1c/Kcnq1ot1 imprinting cluster, we assessed the imprinting status of four cattle genes (Tssc4, Nap1l4, Phlda2 and Osbpl5) in seven types of tissues: heart, liver, spleen, lung, kidney, skeletal muscle and subcutaneous fat using polymorphism-based sequencing approach. It was found that all the four genes showed biallelic expression in tissues in which transcripts were detected. Nap1l4 and Tssc4 were detected in all examined tissues, while the expression of Phlda2 and Osbpl5 was tissue-specific. Phlda2 was not detected in heart and subcutaneous fat, and Osbpl5 was not detected in spleen and skeletal muscle. In addition, identification of species-specific imprinted genes is necessary to understand the evolution of genomic imprinting and to elucidate mechanisms leading to allele-specific expression. [Wang M., Li D., Zhang M., Yang W., Wu G., Cui Y. and Li S. 2015 Biallelic expression of Tssc4, Nap1l4, Phlda2 and Osbpl5 in adult cattle. J. Genet. 94, 391–395] Introduction Characterization of the allele-specific expression profile of imprinted genes at different developmental stages is neces- Genomic imprinting is an epigenetic process where imprin- sary to understand the function of imprinted genes and to ted genes are expressed monoallelically depending on their elucidate the mechanisms behind imprinting. parental origin (see Morison et al. 2005; Hasan et al. 2007). The Cdkn1c/Kcnq1ot1 region is one of the largest known At present, around 200 genes are known to be imprin- imprinted clusters. In humans, it is located on chromosome ted in mice and humans, but only a few have been iden- 11p15.5 and in mouse, on distal chromosome 7. It also har- tified in cattle (http://otago.ac.nz/IGC/). The imprinting bours multiple imprinted genes (Reik et al. 2003). Altered status of many genes is conserved among mammalian imprinting of this region is associated with human diseases species, but some genes show species-specific imprinting such as Beckwith–Wiedemann syndrome (BWS) and many (Paulsen et al. 2000). Examining the extent of genetic types of tumours (Mitsuya et al. 1999). Cattle are a better imprinting among mammalian species is useful in under- model organism than mouse, since shorter evolutionary dis- standing the evolution of genomic imprinting. Many tance to human and similar timing of preimplantation devel- imprinted genes play significant roles in embryonic growth, opment. In the present study, the imprinting status of four development, adult behaviour, meat yield, lean meat percent- genes (Tssc4, Nap1l4, Phlda2 and Osbpl5) was investigated age and feed efficiency in mammals. In addition, imprinted in cattle. Tumour suppressing subtransferable candidate 4 genes are closely related to disease susceptibility and immu- (Tssc4), an important tumour-suppressor gene, plays a role in nity (Reik and Walter 2001;Reiket al. 2003; Kawahara malignancies and diseases that involve the Cdkn1c/Kcnq1ot1 and Kono 2012). Currently, imprinting status is gener- region (Paulsen et al. 2000). Nucleosome assembly protein ally studied in mammalian embryos and placental tissues. 1-like 4 (Nap1l4) also known as NAP-2, encodes a nucleo- Some imprinted genes exhibit development stage-specific some assembly protein that belongs to the NAPs family of imprinting patterns (Ohlsson et al. 1994;Leeet al. 1997). proteins (Rodriguez et al. 1997; Okuwaki et al. 2010). Pleck- strin homology-like domain, family A, member 2 (Phlda2), ∗For correspondence. E-mail: [email protected]. also known as Ipl or Tssc3, encodes a cytoplasmic protein Keywords. bovine; Tssc4; Nap1l4; Phlda2; Osbpl5; allele-specific expression; imprinting. Journal of Genetics, Vol. 94, No. 3, September 2015 391 Mengnan Wang et al. and negatively controls placental development (Frank et al. identified in heterozygous individuals were used to assess 2002; Salas et al. 2004; Tunster et al. 2010). Oxysterol- genomic imprinting. binding protein-like 5 (Osbpl5) play a key role in maintain- ing the cholesterol balance in the body. These four genes are known to be maternally imprinted in mouse placenta at the Total RNA extraction and reverse transcription Cdkn1c/Kcnq1ot1 region. Total RNA was isolated from tissue samples of heterozygous calves using the Trizol RNA Extracted Kit (Invitrogen, Shanghai, China) and treated with RNase-free DNase to Materials and methods remove possible contaminating genomic DNA. The quality and quantity of the RNA was tested using a ND-1000 spectro- Animals and tissues photometer (NanoDrop, Wilmington, USA). Approximately Tissue samples of heart, liver, spleen, lung, kidney, skele- 2 µg RNA was reverse transcribed using an RT kit (Promega, tal muscle and subcutaneous fat of 32 dairy cattle (Holstein) Beijing, China). The RT reaction was conducted according to were collected from a local abattoir. After collecting all tissue the manufacturer’s guidelines using oligo (dT) primers and 5 samples, they were immediately frozen in liquid nitrogen and units of Superscript RT enzyme in 20 µL total volume. stored at –70◦C until further analysis. All protocols involving use of animals were approved by the Agriculture Research Animal Care Committee of Hebei Agriculture University. RT-PCR RT-PCR was used to determine the expression patterns of Tssc4, Nap1l4, Phlda2 and Osbpl5 in tissues: heart, liver, DNA extraction and PCR amplification spleen, lung, kidney, skeletal muscle and subcutaneous fat. Genomic DNA was extracted from liver tissues of 32 All primers were designed according to the retrieved adult cattle using DNA Extraction Kit (Sangon Biotech, sequences of Tssc4 (GenBank accession no. NM_0010754 Shanghai, China) following the manufacturer’s instruction. 10), Nap1l4 (GenBank accession no. NM_001038094), Single-nucleotide polymorphisms (SNPs) were identified in Phlda2 (GenBank accession no. NM_001076521) and heterozygous individuals and confirmed by sequencing the Osbpl5 (GenBank accession no. XM_002699428) in cat- PCR products. All primers were designed using Primer5 and tle. In RT-PCR reactions, all primers were designed to Oligo6 (table 1). PCR sample mixtures were as follows: 1 µL cross introns to exclude genomic DNA. A 367 bp fragment primers (10 µM), 1 µL genomic DNA, 9.5 µL ddH2Oand of the Gapdh gene was amplified as the internal control 12.5 µL ES Tap MasterMix (CWBio, Beijing, China). PCR using primers (Gap-F: GCACAGTCAAGGCAGAA AC and amplification conditions were as follows: initial denaturation Gap-R: GCGTGGACAGTGGTCATAAG) designed based at 94◦C for 5 min, followed by 35 cycles of denaturation at on the GenBank sequence (accession no. BTU85042). The 94◦C for 30 s, annealing at 56◦CforTssc4,50◦CforNap1l4 cDNA of Tssc4, Nap1l4, Phlda2, Osbpl5 and Gapdh were 48◦CforPhlda2 and 53◦CforOsbpl5 for 30 s, elongation amplified using the following programme: initial denatura- at 72◦C for 70 s, and a final extension at 72◦C for 10 min. tion at 94◦C for 5 min, followed by 35 cycles of denatu- Table 1 shows the primer sequences used to amplify the ration at 94◦C for 30 s, annealing at 56◦CforTssc4,47◦C genomic DNA and the expected PCR product sizes. SNPs for Nap1l4,48◦CforPhlda2,55◦CforOsbpl5 and 50◦C Table 1. Primer sequences and PCR information. Gene Primers (5′–3′) Annealing temp. (◦C) PCR size (bp) Product type Tssc4 Tss-Fg: CCTTCGTCAGCATTCA 56 1453 DNA Tss-Rg: TGGTCCACACAGATACAC Tss-F: CCTTCGTCAGCATTCA 56 752 cDNA Tss-R: TCCTGGATACCCTCTTC Nap1l4 Nap-Fg : GCTGGAGAAGCGAAGTGACA 50 1119 DNA Nap-Rg: ACTCTGGAGGCTCAGTGAAT Nap-F: AGGGGATGGAGAATCACTGG 47 751 cDNA Nap-R: TTGGAGGACAAGCGAGAGAG Phlda2 Phl-Fg: AGCTGGATAAGCGAAGTGAC 48 937 DNA Phl-Rg: AGAAAAGAGAATGAACCGAG Phl-F: GCTGGAGAAGCGAAGTGACA 48 539 cDNA Phl-R: ACTCTGGAGGCTCAGTGAAT Osbpl5 Osb-Fg: CTCCGTTTTCACCAGA 53 946 DNA Osb-Rg: GAAGGGAAGATCGTGC Osb-F: GTCACCGAGAGCAGCG 55 825 cDNA Osb-R: AGAGGGCAGAAGGAAGC 392 Journal of Genetics, Vol. 94, No. 3, September 2015 Expression of bovine Tssc4, Nap1l4, Phlda2 and Osbpl5 for Gapdh for 30 s, elongation at 72◦C for 50 s, and a final extension at 72◦C for 10 min. The PCR reaction mixture (25 µL) contained 1 µL primers (10 µM), 1 µL cDNA, 9.5 µL ddH2O and 12.5 µL ES Tap MasterMix (CWBio). Table 1 shows the primer sequences used to amplify the cDNA and the expected PCR product sizes. The PCR prod- ucts were purified using UNIQ-10 column DNA gel extrac- tion kit (Sangon, China) and sequenced directly using the dideoxy chain-termination method. Allele-specific imprinting patterns analysis For imprinting assays, 12 heterozygous individuals (three heterozygous individuals per line per time point) of Tssc4, Figure 2. Expression analysis of cattle Tssc4, Nap1l4, Phlda2 and Nap1l4, Phlda2 and Osbpl5 were slaughtered to extract Osbpl5 genes. M, DNA marker DL2000 (1000, 750, 500 and 250 RNA samples. All cDNA samples were reverse transcribed bp). Lanes 1–7 are RT-PCR products obtained from heart, liver, spleen, lung, kidney, muscle and subcutaneous fat. The size of from total RNA prepared from the organs of three heterozy- RT-PCR production were 367bp for GADPH. gous animals. PCR products were purified and sequenced directly. Imprinted genes are expected to exhibit hemizy- Nap1l4, Phlda2 and Osbpl5 genes were expressed virtually gosity, whereas a biallelically-expressed gene would exhibit in all analysed tissues, with the exception of Phlda2,which heterozygosity at the SNP. was not detected in heart and subcutaneous fat tissues, as well as Osbpl5, which was not detected in spleen and skeletal Results muscle tissues (figure 2).
Recommended publications
  • Aberrant Methylation Underlies Insulin Gene Expression in Human Insulinoma

    Aberrant Methylation Underlies Insulin Gene Expression in Human Insulinoma

    ARTICLE https://doi.org/10.1038/s41467-020-18839-1 OPEN Aberrant methylation underlies insulin gene expression in human insulinoma Esra Karakose1,6, Huan Wang 2,6, William Inabnet1, Rajesh V. Thakker 3, Steven Libutti4, Gustavo Fernandez-Ranvier 1, Hyunsuk Suh1, Mark Stevenson 3, Yayoi Kinoshita1, Michael Donovan1, Yevgeniy Antipin1,2, Yan Li5, Xiaoxiao Liu 5, Fulai Jin 5, Peng Wang 1, Andrew Uzilov 1,2, ✉ Carmen Argmann 1, Eric E. Schadt 1,2, Andrew F. Stewart 1,7 , Donald K. Scott 1,7 & Luca Lambertini 1,6 1234567890():,; Human insulinomas are rare, benign, slowly proliferating, insulin-producing beta cell tumors that provide a molecular “recipe” or “roadmap” for pathways that control human beta cell regeneration. An earlier study revealed abnormal methylation in the imprinted p15.5-p15.4 region of chromosome 11, known to be abnormally methylated in another disorder of expanded beta cell mass and function: the focal variant of congenital hyperinsulinism. Here, we compare deep DNA methylome sequencing on 19 human insulinomas, and five sets of normal beta cells. We find a remarkably consistent, abnormal methylation pattern in insu- linomas. The findings suggest that abnormal insulin (INS) promoter methylation and altered transcription factor expression create alternative drivers of INS expression, replacing cano- nical PDX1-driven beta cell specification with a pathological, looping, distal enhancer-based form of transcriptional regulation. Finally, NFaT transcription factors, rather than the cano- nical PDX1 enhancer complex, are predicted to drive INS transactivation. 1 From the Diabetes Obesity and Metabolism Institute, The Department of Surgery, The Department of Pathology, The Department of Genetics and Genomics Sciences and The Institute for Genomics and Multiscale Biology, The Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA.
  • Research Article Characterization, Tissue Expression, and Imprinting Analysis of the Porcine CDKN1C and NAP1L4 Genes

    Research Article Characterization, Tissue Expression, and Imprinting Analysis of the Porcine CDKN1C and NAP1L4 Genes

    Hindawi Publishing Corporation Journal of Biomedicine and Biotechnology Volume 2012, Article ID 946527, 7 pages doi:10.1155/2012/946527 Research Article Characterization, Tissue Expression, and Imprinting Analysis of the Porcine CDKN1C and NAP1L4 Genes Shun Li,1 Juan Li,1 Jiawei Tian,1 Ranran Dong,1 Jin Wei,1 Xiaoyan Qiu,2 and Caode Jiang2 1 School of Life Science, Southwest University, Chongqing 400715, China 2 College of Animal Science and Technology, Southwest University, Chongqing 400715, China Correspondence should be addressed to Caode Jiang, [email protected] Received 4 August 2011; Revised 25 October 2011; Accepted 15 November 2011 Academic Editor: Andre Van Wijnen Copyright © 2012 Shun Li et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. CDKN1C and NAP1L4 in human CDKN1C/KCNQ1OT1 imprinted domain are two key candidate genes responsible for BWS (Beckwith-Wiedemann syndrome) and cancer. In order to increase understanding of these genes in pigs, their cDNAs are characterized in this paper. By the IMpRH panel, porcine CDKN1C and NAP1L4 genes were assigned to porcine chromosome 2, closely linked with IMpRH06175 and with LOD of 15.78 and 17.94, respectively. By real-time quantitative RT-PCR and polymorphism-based method, tissue and allelic expression of both genes were determined using F1 pigs of Rongchang and Landrace reciprocal crosses. The transcription levels of porcine CDKN1C and NAP1L4 were significantly higher in placenta than in other neonatal tissues (P<0.01) although both genes showed the highest expression levels in the lung and kidney of one- month pigs (P<0.01).
  • Snps) Distant from Xenobiotic Response Elements Can Modulate Aryl Hydrocarbon Receptor Function: SNP-Dependent CYP1A1 Induction S

    Snps) Distant from Xenobiotic Response Elements Can Modulate Aryl Hydrocarbon Receptor Function: SNP-Dependent CYP1A1 Induction S

    Supplemental material to this article can be found at: http://dmd.aspetjournals.org/content/suppl/2018/07/06/dmd.118.082164.DC1 1521-009X/46/9/1372–1381$35.00 https://doi.org/10.1124/dmd.118.082164 DRUG METABOLISM AND DISPOSITION Drug Metab Dispos 46:1372–1381, September 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Single Nucleotide Polymorphisms (SNPs) Distant from Xenobiotic Response Elements Can Modulate Aryl Hydrocarbon Receptor Function: SNP-Dependent CYP1A1 Induction s Duan Liu, Sisi Qin, Balmiki Ray,1 Krishna R. Kalari, Liewei Wang, and Richard M. Weinshilboum Division of Clinical Pharmacology, Department of Molecular Pharmacology and Experimental Therapeutics (D.L., S.Q., B.R., L.W., R.M.W.) and Division of Biomedical Statistics and Informatics, Department of Health Sciences Research (K.R.K.), Mayo Clinic, Rochester, Minnesota Received April 22, 2018; accepted June 28, 2018 ABSTRACT Downloaded from CYP1A1 expression can be upregulated by the ligand-activated aryl fashion. LCLs with the AA genotype displayed significantly higher hydrocarbon receptor (AHR). Based on prior observations with AHR-XRE binding and CYP1A1 mRNA expression after 3MC estrogen receptors and estrogen response elements, we tested treatment than did those with the GG genotype. Electrophoretic the hypothesis that single-nucleotide polymorphisms (SNPs) map- mobility shift assay (EMSA) showed that oligonucleotides with the ping hundreds of base pairs (bp) from xenobiotic response elements AA genotype displayed higher LCL nuclear extract binding after (XREs) might influence AHR binding and subsequent gene expres- 3MC treatment than did those with the GG genotype, and mass dmd.aspetjournals.org sion.
  • Letters to the Editor J Med Genet: First Published As 10.1136/Jmg.37.3.231 on 1 March 2000

    Letters to the Editor J Med Genet: First Published As 10.1136/Jmg.37.3.231 on 1 March 2000

    210 Letters Letters to the Editor J Med Genet: first published as 10.1136/jmg.37.3.231 on 1 March 2000. Downloaded from J Med Genet 2000;37:210–212 No evidence of germline PTEN three reasons: somatic mutations have been found in PTEN in prostate tumours; germline mutations in Cowden mutations in familial prostate cancer disease produce a phenotype (although with no evidence of an associated susceptibility to prostate cancer); and PTEN deficient mice exhibit prostate abnormalities. We have therefore screened the Cancer Research Campaign/British EDITOR—Prostate cancer is the second most common Prostate Group (CRC/BPG) UK Familial Prostate Cancer cause of male cancer mortality in the UK.1 Current indica- Study samples for evidence of PTEN mutations. tions are that like many common cancers, prostate cancer The CRC/BPG UK Familial Prostate Cancer Study has has an inherited component.2 Segregation analysis has led collected lymphocyte DNA from 188 subjects from 50 to the proposed model of at least one highly penetrant, prostate cancer families. These families were chosen dominant gene (with an estimated 88% penetrance for because each contained three or more cases of prostate prostate cancer by the age of 85 in the highly susceptible cancer at any age or related sib pairs where at least one man population). Such a gene or genes would account for an was less than 67 (original criterion was 65) years old at estimated 43% of cases diagnosed at less than 55 years.2 diagnosis. In fact, the majority of the clusters consist of One prostate cancer susceptibility locus (HPC1) has been aVected sib pairs, with DNA often only available from reported on 1q24-253 and confirmed by Cooney et al4 and cases.
  • The Title of the Article

    The Title of the Article

    Mining the literature for genes associated with placenta-mediated maternal diseases Laritza M. Rodriguez, MD, PhD, Stephanie M. Morrison, MPH, Kathleen Greenberg, PhD, Dina Demner Fushman, MD, PhD Lister Hill National Center for Biomedical Communications, National Library of Medicine, National Institutes of Health, Bethesda, MD Abstract Automated literature analysis could significantly speed up understanding of the role of the placenta and the impact of its development and functions on the health of the mother and the child. To facilitate automatic extraction of information about placenta-mediated disorders from the literature, we manually annotated genes and proteins, the associated diseases, and the functions and processes involved in the development and function of placenta in a collection of PubMed/MEDLINE abstracts. We developed three baseline approaches to finding sentences containing this information: one based on supervised machine learning (ML) and two based on distant supervision: 1) using automated detection of named entities and 2) using MeSH. We compare the performance of several well-known supervised ML algorithms and identify two approaches, Support Vector Machines (SVM) and Generalized Linear Models (GLM), which yield up to 98% recall precision and F1 score. We demonstrate that distant supervision approaches could be used at the expense of missing up to 15% of relevant documents. Introduction The placenta is the most important organ in human pregnancy. It plays the role of lungs and kidneys for the developing fetus, supplies substrates for its development, and regulates complex immune functions to allow the cohabitation of two different organisms - the mother and the fetus- during the pregnancy. Defects in the placentation process are known to be associated with a wide range of pregnancy related complications such as preeclampsia, uterine growth restriction, and premature rupture of membranes, fetal growth retardation, placenta abruption, spontaneous abortion, and fetal death.
  • Mclean, Chelsea.Pdf

    Mclean, Chelsea.Pdf

    COMPUTATIONAL PREDICTION AND EXPERIMENTAL VALIDATION OF NOVEL MOUSE IMPRINTED GENES A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by Chelsea Marie McLean August 2009 © 2009 Chelsea Marie McLean COMPUTATIONAL PREDICTION AND EXPERIMENTAL VALIDATION OF NOVEL MOUSE IMPRINTED GENES Chelsea Marie McLean, Ph.D. Cornell University 2009 Epigenetic modifications, including DNA methylation and covalent modifications to histone tails, are major contributors to the regulation of gene expression. These changes are reversible, yet can be stably inherited, and may last for multiple generations without change to the underlying DNA sequence. Genomic imprinting results in expression from one of the two parental alleles and is one example of epigenetic control of gene expression. So far, 60 to 100 imprinted genes have been identified in the human and mouse genomes, respectively. Identification of additional imprinted genes has become increasingly important with the realization that imprinting defects are associated with complex disorders ranging from obesity to diabetes and behavioral disorders. Despite the importance imprinted genes play in human health, few studies have undertaken genome-wide searches for new imprinted genes. These have used empirical approaches, with some success. However, computational prediction of novel imprinted genes has recently come to the forefront. I have developed generalized linear models using data on a variety of sequence and epigenetic features within a training set of known imprinted genes. The resulting models were used to predict novel imprinted genes in the mouse genome. After imposing a stringency threshold, I compiled an initial candidate list of 155 genes.
  • Is Associated with Hypomethylation At

    Is Associated with Hypomethylation At

    797 ORIGINAL ARTICLE J Med Genet: first published as 10.1136/jmg.40.11.797 on 19 November 2003. Downloaded from Silencing of CDKN1C (p57KIP2) is associated with hypomethylation at KvDMR1 in Beckwith–Wiedemann syndrome N Diaz-Meyer, C D Day, K Khatod, E R Maher, W Cooper, W Reik, C Junien, G Graham, E Algar, V M Der Kaloustian, M J Higgins ............................................................................................................................... J Med Genet 2003;40:797–801 Context: Beckwith–Wiedemann syndrome (BWS) arises by several genetic and epigenetic mechanisms affecting the balance of imprinted gene expression in chromosome 11p15.5. The most frequent alteration associated with BWS is the absence of methylation at the maternal allele of KvDMR1, an intronic CpG island within the KCNQ1 gene. Targeted deletion of KvDMR1 suggests that this locus is an imprinting control region (ICR) that regulates multiple genes in 11p15.5. Cell culture based enhancer blocking assays indicate that KvDMR1 may function as a methylation modulated chromatin insulator and/or silencer. See end of article for Objective: To determine the potential consequence of loss of methylation (LOM) at KvDMR1 in the authors’ affiliations ....................... development of BWS. Methods: The steady state levels of CDKN1C gene expression in fibroblast cells from normal individuals, Correspondence to: and from persons with BWS who have LOM at KvDMR1, was determined by both real time quantitative M J Higgins, Department of Cancer Genetics, polymerase chain reaction (qPCR) and ribonuclease protection assay (RPA). Methylation of the CDKN1C Roswell Park Cancer promoter region was assessed by Southern hybridisation using a methylation sensitive restriction Institute, Buffalo, NY endonuclease. 14263, USA; michael.higgins@ Results: Both qPCR and RPA clearly demonstrated a marked decrease (86–93%) in the expression level of roswellpark.org the CDKN1C gene in cells derived from patients with BWS, who had LOM at KvDMR1.
  • Maternal Diet During Pregnancy Induces Gene Expression and DNA Methylation Changes in Fetal Tissues in Sheep

    Maternal Diet During Pregnancy Induces Gene Expression and DNA Methylation Changes in Fetal Tissues in Sheep

    CORE Metadata, citation and similar papers at core.ac.uk ORIGINAL RESEARCH ARTICLE Provided by Frontiers - Publisher Connector published: 05 April 2013 doi: 10.3389/fgene.2013.00049 Maternal diet during pregnancy induces gene expression and DNA methylation changes in fetal tissues in sheep Xianyong Lan1,2, Evan C. Cretney 2, Jenna Kropp 2, Karam Khateeb2, Mary A. Berg 2, Francisco Peñagaricano2, Ronald Magness 3, Amy E. Radunz 2* and Hasan Khatib2* 1 College of Animal Science and Technology, Northwest Agriculture and Forestry University, Yangling, China 2 Department of Animal Sciences, University of Wisconsin-Madison, Madison, WI, USA 3 Department of Obstetrics and Gynecology, University of Wisconsin-Madison, Madison, WI, USA Edited by: Studies in rats and mice have established that maternal nutrition induces epigenetic modifi- Peter Dovc, University of Ljubljana, cations, sometimes permanently, that alter gene expression in the fetus, which in turn leads Slovenia to phenotypic changes. However, limited data is available on the influence of maternal diet Reviewed by: Ikhide G. Imumorin, Cornell on epigenetic modifications and gene expression in sheep.Therefore, the objectives of this University, USA study were to investigate the impact of different maternal dietary energy sources on the Hsiao-Ching Liu, North Carolina State expression of imprinted genes in fetuses in sheep. Ewes were naturally bred to a single sire University, USA and from days 67 ± 3 of gestation until necropsy (days 130 ± 1), they were fed one of three *Correspondence: diets of alfalfa haylage (HY; fiber), corn (CN; starch), or dried corn distiller’s grains (DG; fiber Amy E. Radunz and Hasan Khatib, Department of Animal Sciences, plus protein plus fat).
  • Supplementary Data

    Supplementary Data

    Supplemental figures Supplemental figure 1: Tumor sample selection. A total of 98 thymic tumor specimens were stored in Memorial Sloan-Kettering Cancer Center tumor banks during the study period. 64 cases corresponded to previously untreated tumors, which were resected upfront after diagnosis. Adjuvant treatment was delivered in 7 patients (radiotherapy in 4 cases, cyclophosphamide- doxorubicin-vincristine (CAV) chemotherapy in 3 cases). 34 tumors were resected after induction treatment, consisting of chemotherapy in 16 patients (cyclophosphamide-doxorubicin- cisplatin (CAP) in 11 cases, cisplatin-etoposide (PE) in 3 cases, cisplatin-etoposide-ifosfamide (VIP) in 1 case, and cisplatin-docetaxel in 1 case), in radiotherapy (45 Gy) in 1 patient, and in sequential chemoradiation (CAP followed by a 45 Gy-radiotherapy) in 1 patient. Among these 34 patients, 6 received adjuvant radiotherapy. 1 Supplemental Figure 2: Amino acid alignments of KIT H697 in the human protein and related orthologs, using (A) the Homologene database (exons 14 and 15), and (B) the UCSC Genome Browser database (exon 14). Residue H697 is highlighted with red boxes. Both alignments indicate that residue H697 is highly conserved. 2 Supplemental Figure 3: Direct comparison of the genomic profiles of thymic squamous cell carcinomas (n=7) and lung primary squamous cell carcinomas (n=6). (A) Unsupervised clustering analysis. Gains are indicated in red, and losses in green, by genomic position along the 22 chromosomes. (B) Genomic profiles and recurrent copy number alterations in thymic carcinomas and lung squamous cell carcinomas. Gains are indicated in red, and losses in blue. 3 Supplemental Methods Mutational profiling The exonic regions of interest (NCBI Human Genome Build 36.1) were broken into amplicons of 500 bp or less, and specific primers were designed using Primer 3 (on the World Wide Web for general users and for biologist programmers (see Supplemental Table 2) [1].
  • Complete Hydatidiform Mole Retaining a Chromosome 11 of Maternal Origin: Molecular Genetic Analysis of a Case

    Complete Hydatidiform Mole Retaining a Chromosome 11 of Maternal Origin: Molecular Genetic Analysis of a Case

    Modern Pathology (2004) 17, 1155–1160 & 2004 USCAP, Inc All rights reserved 0893-3952/04 $30.00 www.modernpathology.org Complete hydatidiform mole retaining a chromosome 11 of maternal origin: molecular genetic analysis of a case Rosemary A Fisher1, Marisa R Nucci2, Harshwardhan M Thaker3, Stanislawa Weremowicz2, David R Genest2 and Diego H Castrillon2,* 1Department of Cancer Medicine, Faculty of Medicine, Imperial College London, Charing Cross Hospital, London, UK; 2Division of Women’s and Perinatal Pathology, Department of Pathology, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA, USA and 3Department of Pathology, Columbia University College of Physicians & Surgeons, New York, NY, USA Hydatidiform moles are pregnancies characterized by abnormal development of both embryonic and extraembryonic tissues and are associated with the misexpression of imprinted genes. The vast majority of complete hydatidiform moles are diploid and androgenetic, whereas partial hydatidiform moles are triploid, with an extra set of chromosomes of paternal origin. Here, we present an unusual complete mole that showed strong expression of two imprinted, maternally transcribed genes, CDKN1C (encoding p57KIP2) and PHLDA2 (TSSC3/ IPL), both part of a large imprinted gene domain on chromosome 11. Using microsatellite genotyping and fluorescent in situ hybridization, we show that this paradoxical gene expression was due to retention of a maternal copy of chromosome 11 in addition to the two paternal copies normally present in complete moles. These findings demonstrate that, despite being predominantly androgenetic, some complete moles contain small amounts of DNA of maternal origin. Furthermore, these results provide an explanation for rare false negatives that can arise when p57KIP2 is used as a diagnostic marker for complete moles.
  • Associated with Spherical Equivalent

    Associated with Spherical Equivalent

    Molecular Vision 2016; 22:783-796 <http://www.molvis.org/molvis/v22/783> © 2016 Molecular Vision Received 20 August 2015 | Accepted 12 July 2016 | Published 14 July 2016 Variation in PTCHD2, CRISP3, NAP1L4, FSCB, and AP3B2 associated with spherical equivalent Fei Chen,1 Priya Duggal,1 Barbara E.K. Klein,2 Kristine E. Lee,2 Barbara Truitt,3 Ronald Klein,2 Sudha K. Iyengar,3 Alison P. Klein1,4,5 1Department of Epidemiology, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD; 2Department of Ophthalmology and Visual Sciences, University of Wisconsin School of Medicine and Public Health, Madison, WI; 3Department of Epidemiology and Biostatistics, Case Western Reserve University, Cleveland, OH; 4Department of Oncology, Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, Baltimore, MD; 5Department of Pathology, Johns Hopkins School of Medicine, Baltimore, MD Purpose: Ocular refraction is measured in spherical equivalent as the power of the external lens required to focus images on the retina. Myopia (nearsightedness) and hyperopia (farsightedness) are the most common refractive errors, and the leading causes of visual impairment and blindness in the world. The goal of this study is to identify rare and low-frequency variants that influence spherical equivalent. Methods: We conducted variant-level and gene-level quantitative trait association analyses for mean spherical equiva- lent, using data from 1,560 individuals in the Beaver Dam Eye Study. Genotyping was conducted using the Illumina exome array. We analyzed 34,976 single nucleotide variants and 11,571 autosomal genes across the genome, using single-variant tests as well as gene-based tests. Results: Spherical equivalent was significantly associated with five genes in gene-based analysis: PTCHD2 at 1p36.22 (p = 3.6 × 10−7), CRISP3 at 6p12.3 (p = 4.3 × 10−6), NAP1L4 at 11p15.5 (p = 3.6 × 10−6), FSCB at 14q21.2 (p = 1.5 × 10−7), and AP3B2 at 15q25.2 (p = 1.6 × 10−7).
  • The Detailed 3D Multi-Loop Aggregate/Rosette Chromatin Architecture and Functional Dynamic Organization of the Human and Mouse G

    The Detailed 3D Multi-Loop Aggregate/Rosette Chromatin Architecture and Functional Dynamic Organization of the Human and Mouse G

    bioRxiv preprint doi: https://doi.org/10.1101/064642; this version posted August 15, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The Detailed 3D Multi-Loop Aggregate/Rosette Chromatin Architecture and Functional Dynamic Organization of the Human and Mouse Genomes Tobias A. Knoch1*, Malte Wachsmuth2, Nick Kepper1,4, Michael Lesnussa1, Anis Abuseiris1, A. M. Ali Imam1,3, Petros Kolovos1,3, Jessica Zuin5, Christel E. M. Kockx6, Rutger W. W. Brouwer6, Harmen J. G. van de Werken3, Wilfred F. J. van IJken6, Kerstin S. Wendt5, and Frank G. Grosveld3 1Biophysical Genomics, Dept. Cell Biology & Genetics, Erasmus MC, Wytemaweg 80, 3015 CN Rotterdam, The Netherlands 2Cell Biology & Biophysics Unit, European Molecular Biology Laboratory, Meyerhofstr. 1, 69117 Heidelberg, Germany 3Cell Biology, Dept. Cell Biology & Genetics, Erasmus MC, Dr. Molewaterplein 50, 3015 GE Rotterdam, The Netherlands 4Genome Organization & Function, BioQuant & German Cancer Research Center, Im Neuenheimer Feld 267, 69120 Heidelberg, Germany 5Cohesin in Chromatin Structure and Gene Regulation, Dept. Cell Biology & Genetics, Erasmus MC, Dr. Molewaterplein 50, 3015 GE Rotterdam, The Netherlands 6Center for Biomics, Dept. Cell Biology & Genetics, Erasmus MC, Dr. Molewaterplein 50, 3015 GE Rotterdam, The Netherlands * corresponding author: [email protected] Knoch et al. 1 bioRxiv preprint doi: https://doi.org/10.1101/064642; this version posted August 15, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract: The dynamic three-dimensional chromatin architecture of genomes and its co- evolutionary connection to its function – the storage, expression, and replication of genetic information – is still one of the central issues in biology.