bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 -GTP is non-essential to activate NuMA for spindle pole focusing,

2 but dynamically polarizes HURP to control mitotic spindle length

3

4

5 Kenta Tsuchiya1#, Hisato Hayashi1#, Momoko Nishina1#, Masako Okumura1#,

6 Yoshikatsu Sato1, Masato T. Kanemaki2,3, Gohta Goshima1, Tomomi Kiyomitsu1,2,4*

7

8 1 Division of Biological Science, Graduate School of Science, Nagoya University, 9 Chikusa-ku, Nagoya 464-8602, Japan.

10 2 Precursory Research for Embryonic Science and Technology (PRESTO) Program, 11 Japan Science and Technology Agency, 4-1-8 Honcho Kawaguchi, Saitama 332-0012, 12 Japan. 13 3 Department of Science, National Institute of Genetics, Research 14 Organization of Information and Systems (ROIS), and Department of Genetics, 15 SOKENDAI (The Graduate University of Advanced Studies), Yata 1111, Mishima, 16 Shizuoka 411-8540, Japan.

17 4 Okinawa Institute of Science and Technology Graduate University, 1919-1 Tancha, 18 Onna-son, Kunigami-gun, Okinawa 904-0495, Japan

19

20 # These authors contributed equally to this work. 21 * Corresponding author: 22 E-mail: [email protected] 23 Phone & Fax: +81-98-966-1609 24 Characters: 5,173 words 25

1 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

26 Abstract

27 During mitosis, a bipolar spindle is assembled around to efficiently

28 capture chromosomes. Previous work proposed that a chromosome-derived Ran-GTP

29 gradient promotes spindle assembly around chromosomes by liberating spindle

30 assembly factors (SAFs) from inhibitory . However, Ran’s dual functions in

31 nucleocytoplasmic transport and mitotic spindle assembly have made it

32 difficult to assess its mitotic roles in somatic cells. Here, using auxin-inducible degron

33 technology in human cells, we developed acute mitotic degradation assays to dissect

34 Ran’s mitotic roles systematically and separately from its interphase function. In

35 contrast to the prevailing model, we found that the Ran pathway is not essential for

36 spindle assembly activities that occur at sites spatially separated from chromosomes,

37 including activating NuMA for spindle pole focusing or for targeting TPX2. In contrast,

38 Ran-GTP is required to localize HURP and HSET specifically at chromosome-proximal

39 regions. We demonstrated that Ran-GTP and -β coordinately promote HURP’s

40 dynamic binding-dissociation cycle near chromosomes, which results in

41 stable kinetochore-fiber formation. Intriguingly, this pathway acts to establish proper

42 spindle length preferentially during prometaphase, rather than metaphase. Together, we

43 propose that the Ran pathway is required to activate SAFs specifically near

44 chromosomes, but not generally during human mitotic spindle assembly. Ran-

45 dependent spindle assembly is likely coupled with parallel pathways to activate SAFs,

46 including NuMA, for spindle pole focusing away from chromosomes.

47

2 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

48 Highlights

49 ・ Using auxin-inducible degron technology, we developed mitotic degradation assays

50 for the Ran pathway in human cells.

51 ・ The Ran pathway is non-essential to activate NuMA for spindle pole focusing.

52 ・ The Ran pathway dynamically polarizes HURP and defines mitotic spindle length

53 preferentially during prometaphase.

54 ・ Ran-GTP is required to activate SAFs specifically near chromosomes, but not

55 generally, in human mitotic cells.

56

57

3 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

58 Introduction

59 During cell division, a microtubule-based spindle structure is assembled around

60 chromosomes to efficiently capture and segregate duplicated chromosomes into

61 daughter cells [1, 2]. To assemble a spindle around chromosomes, chromosomes

62 generate a gradient of Ran-GTP, a GTP-bound form of Ran, in animal cells [3, 4]. Ran-

63 GTP is produced by regulator of chromosome condensation 1 (RCC1), a guanine

64 nucleotide exchange factor for Ran [5], and is hydrolyzed to Ran-GDP by RanGAP1, a

65 GTPase-activating for Ran [6]. Because RCC1 and RanGAP1 mainly localize on

66 chromosomes and in cytoplasm, respectively, these opposing enzymes create a

67 chromosome-derived Ran-GTP gradient after the nuclear envelope breaks down (Fig.

68 2A). During interphase, these enzymes generate different Ran-GTP concentrations in

69 the nucleus and cytoplasm, which drives nucleocytoplasmic transport [4]. The Ran-GTP

70 gradient has been best characterized in Xenopus egg extracts [7, 8], but is also found in

71 other meiotic and mitotic cell types [9-11]. Recent studies indicate that Ran-GTP is

72 essential for acentrosomal spindle assembly in female meiosis [9, 12, 13], but the

73 significance of Ran-GTP in mitotic spindle assembly has been debated [10, 11, 14]. The

74 dual functions of Ran in both interphase and mitosis have made it difficult to identify its

75 mitotic roles in somatic cells.

76 As in mechanisms in nucleocytoplasmic transport, Ran-GTP binds to importin-β

77 and releases inhibitory importins from SAFs, thereby activating SAFs near

78 chromosomes (Fig. 2A) [15-18]. Once activated, most SAFs interact with

79 and spatially regulate , dynamics, transport, and cross-linking, to

80 create specialized local structures of the spindle [3, 4]. For instance, nuclear mitotic

4 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

81 apparatus protein (NuMA) recognizes minus-ends of microtubules and transports and

82 crosslinks microtubules in cooperation with cytoplasmic dynein, a minus-end-directed

83 motor, to focus spindle microtubules at the poles of mammalian cells [19-22]. The

84 targeting protein for Xklp2 (TPX2) is required for spindle pole organization [23, 24] and

85 stimulates microtubule nucleation in a Ran- and importin-α-regulated manner [25-27].

86 Kinesin-14 HSET/XCTK2 cross-links both parallel and anti-parallel microtubules near

87 chromosomes, but preferentially cross-links parallel microtubules near the spindle poles

88 [28-30]. Hepatoma upregulated protein (HURP) accumulates on microtubules near

89 chromosomes to form stabilized kinetochore-fibers (k-fibers) [31].

90 Most SAFs, including NuMA,TPX2, and HSET contain a nuclear localization

91 sequence/signal (NLS) [28, 32, 33]. The NLS is specifically recognized by importin-α,

92 which forms hetero-dimer with importin-β through an importin-β binding (IBB) domain

93 (Fig. 2A). On the other hand, some SAFs, such as HURP, are directly recognized by

94 importin-β (Fig. 2A) [31]. Because SAFs represent a small fraction of NLS-bearing

95 nuclear and need to be regulated effectively and selectively in mitosis, each

96 SAF interacts with importins in specific ways to reduce competition with other nuclear

97 proteins and SAFs [32, 33].

98 In mitotic human cells, NuMA localizes to the spindle poles and the polar cell

99 cortex, where it facilitates spindle-pole focusing and astral microtubule capture/pulling,

100 respectively [19, 20, 34]. Recent structural and in vitro studies have demonstrated that

101 NuMA’s microtubule-binding activities are inhibited by steric blockage of importin-β,

102 mediated by importin-α [32], but this model has not been rigorously tested in cells. In

103 addition, given that the Ran-GTP gradient diminishes with increasing distances from

5 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

104 chromosomes, it is unclear whether and how the Ran-GTP gradient activates NuMA at

105 the spindle poles.

106 To precisely understand mechanisms and significance of Ran-based regulation

107 of SAFs, it is critical to separate Ran’s mitotic roles from its interphase

108 nucleocytoplasmic transport function. To achieve this, we developed mitotic depletion

109 assays for the Ran pathway in human cells by combining mitotic drugs with auxin-

110 inducible degron (AID) technology [35], which allows us to degrade mAID-tag fusion

111 proteins with a half-life of 20 min. In contrast to the prevailing model, we found that

112 degradation of RCC1, RanGAP1, or importin-β does not substantially affect localization

113 and function of NuMA at the spindle poles, even if these proteins were degraded during

114 mitosis. In sharp contrast, the Ran pathway polarizes both HURP and importin-β on k-

115 fibers near chromosomes, where HURP stabilizes k-fibers independently of importin-β.

116 Based on our results, we propose that the Ran-Importin pathway is required to activate

117 SAFs specifically near chromosomes, but not generally, in human mitotic cells.

118

6 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

119 Results

120 In human cells, NuMA focuses spindle microtubules at spindle poles using its C-

121 terminal conserved microtubule-binding domain

122 NuMA functions in spindle microtubule focusing in cultured mammalian cells [19-22].

123 Silk et al. demonstrated that NuMA’s C-terminal microtubule-binding domain (MTBD1)

124 adjacent to a NLS is required for spindle pole focusing in mouse fibroblasts [22] (Fig.

125 1A). However, this domain is dispensable for spindle pole focusing in mouse

126 keratinocytes [36]. In addition, NuMA has a second microtubule-binding domain

127 (MTBD2) at the C-terminal end (Fig. 1A) [32, 37], which has stronger microtubule-

128 binding activity and is sterically inhibited by importin-β in vitro [32]. To understand which

129 domain of NuMA is required for spindle pole focusing in mitotic human cells, we

130 replaced endogenous NuMA with C-terminal truncation mutants in HCT116 cells (Fig.

131 1A). Endogenous NuMA was visualized by integrating an mAID-mClover-FLAG (mACF)

132 tag into both alleles of the NuMA [20]. NuMA-mACF was depleted using the auxin

133 inducible degradation (AID) system following Dox and IAA treatment (S1A) [20, 35], and

134 mCherry-tagged NuMA mutants were simultaneously expressed from the Rosa 26 locus

135 by Dox treatment (Fig. 1B-C, S1B) [20]. Like endogenous NuMA, mCherry-tagged

136 NuMA wild type (WT) accumulated in interphase nuclei (Fig. 1B) and at mitotic spindle

137 poles (Fig. 1C #1) and was able to rescue pole-focusing defects caused by NuMA

138 depletion (Fig. 1C-D #1). NuMA-ΔNLS mutants were unable to localize at nuclei in

139 interphase (Fig. 1B, S1C), but were able to accumulate at spindle poles to rescue pole-

140 focusing defects (Fig. 1C-D #2). As expected, NuMA ΔC-ter mutants, which lack both

141 MTBDs, diffused into the cytoplasm during metaphase (Fig. 1C #5), and were unable to

7 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

142 rescue the spindle-pole focusing defect (Fig. 1C-D #5). In contrast, NuMA

143 Δ(NLS+MTBD2) mutants localized around spindle-poles to rescue the focusing defects

144 (Fig. 1C-D #4). However, NuMA Δex24 mutants, which lack NLS and the part of MTBD1

145 containing the well-conserved NLM motif (Fig. S1D) [38, 39], were unable to fully rescue

146 focusing defects, while localizing around the spindle-poles (Fig. 1C-D #3). These results

147 indicate that NuMA’s MTBD1, but not MTBD2, is essential for spindle pole focusing in

148 human cells.

149

150 NuMA localizes at the spindle poles and participates in spindle pole focusing

151 independently of RCC1

152 NuMA’s MTBD1 is located next to NLS, which is recognized by importin-α [32]. A recent

153 study indicated that the importin-α/β complex sterically inhibits NuMA’s microtubule-

154 binding activity, but is released from NuMA by Ran-GTP in vitro [32] (Fig. 2A). To test

155 this model in cells, we next depleted RCC1 (RanGEF) by integrating mAID-mClover

156 (mAC) tag (Fig. 2B, S2A) [35]. In contrast to the model, NuMA accumulated normally

157 around the spindle poles, and spindle microtubules were properly focused in RCC1-

158 depleted cells (Fig. 2B, D, Fig. S2B-C), although metaphase spindle length diminished

159 (Fig. 2B-C), and mitotic duration was slightly delayed (Fig. S2D-F).

160 To further analyze functions of NuMA in RCC1-depleted cells, we next co-

161 depleted RCC1 and NuMA. Following treatment with Dox and IAA, both RCC1-mAC

162 and NuMA-mAID-mCherry were degraded, and spindle microtubules were not properly

163 focused (Fig. 2D-E, S2G-H). These results indicate that NuMA acts at spindle poles,

164 even in the absence of Ran-GTP in human mitotic cells.

8 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

165

166 Mitotic degradation of RCC1 does not affect localization and function of NuMA at

167 spindle poles

168 NuMA is transported into the nucleus during interphase (Fig. 1B) [32, 40], where it is

169 likely released from importins by nuclear Ran-GTP. Because we found that NuMA is

170 maintained in the nucleus following RCC1 degradation in interphase (Fig. S2E, t = -

171 0:10), the majority of NuMA may already have been liberated from importins by RCC1

172 before its degradation and may have been maintained in an active form in the nucleus,

173 thereby producing no aberrant phenotypes in the subsequent mitosis in RCC1-depleted

174 cells. To exclude this possibility, we next depleted RCC1 in nocodazole-arrested cells

175 and analyzed the behavior of NuMA following nocodazole washout (For procedure, see

176 Fig. S2I).

177 In RCC1-positive control cells, NuMA diffused into the cytoplasm during

178 nocodazole arrest (Fig. 2F, t = -90), but rapidly accumulated near chromosome masses

179 following nocodazole washout (Fig. 2F, t = 10). NuMA localized at the poles of

180 metaphase spindles within 60 min (Fig. 2F, t = 60) and entered the nucleus following

181 mitotic exit (Fig. 2F, t = 85). Importantly, NuMA accumulated similarly at focused spindle

182 poles, even if RCC1 was degraded during nocodazole arrest. RCC1-mAC signals were

183 initially detectable on chromosome masses during nocodazole-arrest (Fig. 2G, t = -90,

184 arrow), but were reduced to undetectable levels after addition of IAA (Fig. 2G, t = 0).

185 After nocodazole-washout, NuMA localized to focused spindle poles after ~60 min (Fig.

186 2G, t = 55), as observed in control cells. Cells entered anaphase with timing similar to

9 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

187 that of control cells (Fig. S2J), but NuMA was not recruited to the nucleus after mitotic

188 exit (Fig. 2G, t = 80).

189 As observed when RCC1 was degraded in asynchronous culture (Fig. 2C), the

190 metaphase spindle became shorter when RCC1 was depleted during nocodazole-arrest

191 (Fig. 2H). In addition, the metaphase spindle was not properly oriented to the attached

192 culture dishes (Fig. 2I) Taken together, these results indicate that RCC1 participates in

193 some fashion in spindle assembly in human mitotic cells, but is dispensable for NuMA

194 localization and function at spindle poles, even if RCC1 is degraded during mitosis.

195

196 NuMA localized at spindle poles is released from importins independently of Ran-

197 GTP

198 Our results suggest that NuMA is liberated from importins in the absence of Ran-GTP

199 (Fig. 3A). To confirm this, we next analyzed importin localization. Because importin-α

200 has several isoforms in human cells [41], we first examined localization of endogenous

201 importin-β in living cells by fusing it with mCherry (Fig. S3A). Unexpectedly, importin-β-

202 mCh accumulated on kinetochore-microtubules (k-fibers) near chromosomes, but not at

203 metaphase spindle poles (Fig. 3B top). Although this is inconsistent with the reported

204 spindle-pole localization of importin-β [42], this result was confirmed by other

205 visualization methods using a mAC tag and anti-importin-β antibodies (Fig. S3B,C).

206 Importantly, RCC1 depletion diminished importin-β from k-fibers, but did not cause

207 importin-β accumulation at the spindle poles (Fig. 3B, bottom) where NuMA localized

208 (Fig. 2B). This suggests that NuMA is released from importin-β at the spindle poles,

209 even in the absence of Ran-GTP (Fig. 3A).

10 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

210 To further test whether Ran-independent pathways exist for NuMA activation,

211 we next analyzed localizations of importin-α wild type (WT) and ΔIBB mutants, which

212 lack the importin-β-binding (IBB) domain. Importin-α ΔIBB mutants are insensitive to

213 Ran-GTP due to the lack of an IBB domain, but are still able to interact with NuMA and

214 partially inhibit NuMA’s microtubule-binding activity in vitro (Fig. 3A) [32]. However,

215 importin-α ΔIBB diffused into cytoplasm similarly to importin-α WT, and neither affected

216 NuMA’s spindle-pole localization nor colocalized with NuMA at the spindle poles in our

217 experimental conditions (Fig. 3C, S3D). These results suggest that NuMA is released

218 from the importin-α/β complex in a Ran-GTP-independent manner and that it localizes

219 at spindle poles.

220

221 Ran-GAP1 and importin-β degradation do not affect NuMA localization and

222 function at spindle poles

223 Although RCC1 depletion does not affect NuMA localization and functions, degradation

224 of Ran-GAP1 or importin-β may cause abnormal activation of NuMA throughout human

225 cells, resulting in spindle assembly defects. To test this, we next degraded either Ran-

226 GAP1 or importin-β using AID technology (Fig. 3D-E). Ran-GAP1 degradation caused

227 few mitotic phenotypes (Fig. 3D, S3E-I) and did not affect NuMA’s spindle-pole

228 localization (Fig. 3D bottom). Similarly, importin-β degradation did not affect NuMA’s

229 localization and function at spindle poles (Fig. 3E bottom), although importin-β

230 degradation caused short spindles and mitotic delay (Fig. S3J-N). These results indicate

231 that Ran-dependent spatial regulation is dispensable for NuMA localization and function

232 at spindle poles in cultured human cells.

11 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

233

234 RCC1 regulates chromosome-proximal localization of HURP and HSET

235 RCC1 depletion caused shorter mitotic spindles (Fig. 2B, C, F, H), suggesting that Ran-

236 GTP serves some function in spindle assembly in human cells. To identify spindle

237 assembly factors (SAFs) regulated by Ran-GTP, we next analyzed the localization of 3

238 other major SAFs: TPX2, HSET, and HURP. mCherry-tagged TPX2 colocalized with

239 SiR- signals in metaphase (Fig. 4A top, Fig. S4A), and its localization was

240 virtually unaffected in RCC1-depleted cells (Fig. 4A bottom), as observed for NuMA

241 (Fig. 2B). In contrast, mCherry-tagged HSET localized everywhere along spindle

242 microtubules (Fig. 4B top, Fig. S4B) [30], and its spindle localization was selectively

243 reduced near chromosomes following RCC1 depletion, although HSET still localized

244 along spindle fibers farther away from chromosomes (Fig. 4B bottom). On the other

245 hand, mCherry-tagged HURP accumulated at k-fibers near chromosomes, but localized

246 weakly on spindle microtubules following RCC1 depletion (Fig. 4C and Fig. S4C). These

247 results suggest that in human mitotic cells, the chromosome-derived Ran-GTP gradient

248 regulates SAF localization preferentially near chromosomes, regardless of the presence

249 of NLS (Fig. 4D).

250

251 HURP, but not importin-β, is required to stabilize k-fibers

252 Importin-β inhibits HURP’s microtubule-binding activities by masking one of HURP’s

253 microtubule-binding domains (MTBD2) [43] (Fig. 5J). To understand the relationship

254 between HURP and importin-β for k-fiber localization and function, we next sought to

12 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

255 degrade endogenous HURP using AID (Fig. 5A and Fig. S5A-B). Endogenous HURP-

256 mACF accumulated at k-fibers near chromosomes (Fig. 5A top), as observed with anti-

257 HURP antibodies [31]. HURP depletion resulted in diminished importin-β localization to

258 k-fibers (Fig. 5A-B, S5C) and reduced mitotic spindle length (Fig. 5C). Because k-fibers

259 are resistant to cold treatment [31], we next incubated cells with ice-cold medium for 20

260 min and analyzed cold-stable microtubules. HURP localized to cold-stable microtubules

261 (Fig. 5D, top), which were disrupted by HURP depletion (Fig. 4D bottom), consistent

262 with a previous study [31].

263 We next depleted importin-β and analyzed effects of this depletion on HURP and

264 k-fibers (Fig. 5E, S5D). Importin-β depletion caused a remarkable re-localization of

265 HURP from k-fibers near chromosomes to spindle microtubules (Fig. 5E-F). Although k-

266 fiber localization of HURP was unclear in importin-β-depleted cells due to the relatively

267 strong accumulation of HURP on spindle microtubules around spindle poles (Fig. 5E

268 bottom), HURP was clearly detected on cold-stable k-fibers in importin-β-depleted cells

269 (Fig. 5G bottom). These results suggest that HURP acts in k-fiber stabilization,

270 independently of importin-β.

271

272 HURP and importin-β localize throughout the spindle in RanGAP1-depleted cells

273 Whereas HURP and importin-β have different roles in k-fiber stabilization (Fig. 5D, G),

274 both proteins accumulate at k-fibers near chromosomes downstream of RCC1 (Fig. 3B,

275 4C). To better understand mechanisms of Ran-based spatial regulation of HURP and

276 importin-β, we next analyzed behavior of HURP and importin-β in RanGAP1-depleted

277 cells, in which Ran-GTP should exist throughout cells. Interestingly, both HURP and

13 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

278 importin-β localized throughout the spindle with increased intensities in RanGAP1-

279 depleted cells (Fig. 5H-I, S5E). These results suggest that HURP and importin-β act

280 together and interact with microtubules preferentially in the presence of Ran-GTP (Fig.

281 5J).

282

283 HURP dynamically associates with k-fibers in the presence of importin-β.

284 Based on our results, we developed a local cycling model for activation and polarization

285 of HURP (Fig. 5J). In this model, importin-β inhibits HURP globally, including at k-fibers,

286 by masking HURP’s 2nd microtubule-binding domain (MTBD2). The resulting HURP-

287 importin-β complex binds weakly to microtubules through HURP’s MTBD1 [43], but the

288 Ran-GTP gradient locally releases importin-β from HURP, resulting in full activation of

289 HURP near chromosomes (Fig. 5J). To test this model, we first performed fluorescence

290 recovery after photobleaching (FRAP) for HURP, and analyzed its dynamics on spindle

291 microtubules in the presence and absence of importin-β. In control cells, HURP was

292 quickly recovered at k-fibers after bleaching (Fig. 6A top, 6B black, S6A t1/2 = 20.5 sec).

293 In contrast, HURP’s fluorescent signals were hardly seen on the spindle in importin-β-

294 depleted cells (Fig. 6A bottom, 6B red, S6B). These results indicate that HURP

295 dynamically associates with k-fibers in the presence of importin-β, whereas HURP binds

296 tightly to spindle microtubules in the absence of importin-β.

297

298 HURP is dynamically maintained at k-fibers during metaphase

14 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

299 mAID-tag fusion proteins can be rapidly degraded with a half-life of 20 min [35]. To

300 confirm the dynamic regulation of HURP by importin-β and Ran-GTP, we next sought to

301 degrade importin-β during metaphase by combining AID-mediated degradation with

302 APC/C inhibitors [44] (Fig. 6C). Following treatment with the APC/C inhibitors, Apcin

303 and proTAME, cells arrested at metaphase, in which both importin-β and HURP

304 accumulated at k-fibers near chromosomes (Fig. 6 D, t = 0). Importantly, importin-β-

305 mAC signals diminished to undetectable levels 60-90 min after addition of IAA (Fig. 6D,

306 arrows), and HURP relocated from k-fibers to spindle microtubules in response to the

307 reduction of importin-β signals (Fig. 6D, E).

308 To confirm these results, we next acutely degraded RCC1 in metaphase-arrested

309 cells. As with importin-β degradation, HURP dissociated from k-fibers and localized

310 weakly on the spindle in response to degradation of RCC1 (Fig. 7A, B). Unexpectedly,

311 in contrast to the prometaphase degradation assay (Fig. 2H), spindle length appeared

312 normal when RCC1 was degraded in the metaphase-arrested condition (Fig. 7C).

313 Together, these results indicate that HURP is dynamically maintained at k-fibers near

314 chromosomes by the Ran-Importin pathway, even in metaphase, but HURP is critical for

315 spindle length regulation primarily during prometaphase.

316

317

318

15 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

319 Discussion

320 NuMA is liberated from importins independently of Ran-GTP for spindle-pole

321 focusing in human mitotic cells

322 In contrast to the prevailing model (Fig. 2A), we demonstrated that the Ran-Importin

323 pathway is dispensable for localization and functions of NuMA at the spindle poles in

324 human HCT116 cells (Fig. 2, 3, 7D right). This is consistent with the recent observation

325 that NuMA is less sensitive to Ran-GTP level than to HSET/XCTK2 [29]. Although we

326 do not exclude the possibility that Ran-GTP liberates NuMA from importin-α/β

327 complexes near chromosomes, we favor the idea that parallel pathways exist to activate

328 NuMA in mitotic human cells. In fact, recent studies indicate that importin-α/β-binding

329 TPX2 can be activated not only by Ran-GTP, but also by Golgi- or palmitoylation-

330 dependent sequestration of importin-α [45, 46]. In addition, mitotic spindles contain

331 , which may generate special signals that liberate NuMA from inhibitory

332 importins (Fig. 7D). Interestingly, NuMA is broadly distributed on a bundle-like structure

333 between the poles in human acentrosomal cells [47]. It is necessary to analyze whether

334 NuMA is preferentially regulated by Ran-GTP in acentrosomal cells, especially in

335 oocytes, where Ran-GTP governs meiotic spindle assembly [12].

336 Although NLS-containing SAFs are recognized by importin-α, structural studies

337 indicate that importin-α binds to NuMA and TPX2 with slightly different binding patches

338 [32]. In addition, whereas TPX2-NLS and NLS-binding sites of importin-α are well

339 conserved in vertebrates, NLS of NuMA is not well conserved in fish (Fig. S1D-F).

340 Furthermore, NLS is lacking in other NuMA-like proteins in lower eukaryotes, such as

341 Caenorhabditis elegans LIN-5, Drosophila Mud, and yeast Num1 [38, 48, 49],

16 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

342 suggesting that NuMA acquired NLS in higher animals and is likely to be regulated

343 differently than TPX2. Future research should be undertaken to understand how the

344 NuMA-importin interaction is regulated in a Ran-independent manner, and why NLS-

345 dependent regulation of NuMA was acquired in higher animals.

346

347 The Ran-Importin pathway locally activates and polarizes HURP by promoting its

348 microtubule binding-dissociation cycle near chromosomes

349 In contrast to NuMA, we demonstrated that HURP is preferentially regulated by the

350 Ran-Importin pathway in mitotic human cells (Fig. 4C, 5E, H). Although HURP has been

351 identified previously as a downstream target of Ran-GTP [31], we unexpectedly found

352 that HURP also colocalizes with importin-β on k-fibers near chromosomes (Fig. S3C,

353 Fig. 5A, E), and stabilizes k-fibers independently of importin-β (Fig. 5D, G). In addition,

354 HURP’s spindle distribution is sensitive to levels of Ran-GTP and importin-β (Fig. 4C,

355 5E, H), and is dynamically and spatially maintained during metaphase in a Ran-

356 pathway-dependent manner (Fig. 6A, B, D, 7A). Based on these results, we propose a

357 local cycling model for establishment and maintenance of HURP’s polarized localization

358 to spindle microtubules (Fig. 5J, 7D left). After nuclear envelope breakdown (NEBD),

359 HURP strongly interacts with microtubules through its two microtubule-binding domains

360 (MTBD1 and MTBD2 in Fig. 5J) [31, 43]. Since importin-β is localized diffusely

361 throughout cells (Fig. 3E, 5E), it binds to HURP on microtubules, and then dissociates

362 HURP from the microtubules by masking HURP’s MTBD2 domain [43]. However, in the

363 vicinity of chromosomes, Ran-GTP releases HURP from importin-β [31], and the

364 liberated HURP interacts strongly with microtubules around chromosomes. By repeating

17 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

365 this local binding-dissociation cycle, HURP, but not importin-β, stabilizes microtubules

366 and generates stable k-fibers near chromosomes (Fig. 5D, G).This dynamic regulation

367 is similar to that of HSET/XCTK2 [50] and would be suitable for bundling short

368 microtubules around kinetochores during prometaphase [51] and for coupling HURP’s

369 polarized localization with microtubule flux on the metaphase spindle.

370

371 RCC1 is required to define proper spindle length during prometaphase

372 RCC1 depletion causes shortened bipolar spindles in human cells (Fig. 2B, C, F, H).

373 This is probably due to multiple defects in spindle assembly processes, including the

374 lack of HURP-based k-fiber formation (Fig. 5C, D) and HSET-dependent microtubule-

375 sliding (Fig. 4B) [28]. Intriguingly, our mitotic degradation assays indicate that Ran-GTP

376 controls spindle length primarily during prometaphase, rather than in metaphase (Fig.

377 2H, 7C). Once metaphase spindles are assembled, other k-fiber localized proteins, such

378 as clathrin, TACC3, and ch-TOG [52], may be able to maintain bundled-k-fibers during

379 metaphase in a Ran-independent manner.

380 In addition, our mitotic degradation assay revealed that RCC1-depletion does

381 not affect mitotic progression (Fig. S2J). This suggests that the mitotic delay observed

382 in RCC1 depletion in asynchronous culture (Fig. S2F) is a secondary defect caused by

383 loss of interphase RCC1 activity. In fact, ectopically expressed HSET-NLS mutants

384 localize in cytoplasm and causes abnormal cytoplasmic microtubule-bundling in

385 interphase [30]. Numerous similar defects would be created by RCC1 depletion in

386 interphase and would affect subsequent mitotic progression.

18 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

387

388 A new toolkit and mitosis-specific degradation assays to dissect mitotic roles of

389 the Ran-importin pathway

390 As discussed above, mitotic inactivation is critical to precisely analyze mitotic functions

391 of Ran-GTP and importins. Previously, tsBN2, a temperature-sensitive RCC1 mutant

392 hamster cell line [53, 54] and a small molecule inhibitor, importazole [55], have been

393 developed to acutely inhibit functions of RCC1 and importin-β, respectively. Here, we

394 established three human AID-cell lines for RCC1, RanGAP1, and importin-β [35], and

395 succeeded in degrading RCC1 and importin-β specifically in prometaphase (Fig. 2C-F)

396 or metaphase (Fig. 6C-E, 7A-B). Because these AID-cell lines and mitotic degradation

397 assays are applicable to other Ran-regulated SAFs/cortical proteins [4, 54, 56] and

398 other multi-functional proteins such as dynein and NuMA [20, 35], respectively, these

399 toolkits and assays will further advance our understanding of mechanisms and roles of

400 spindle assembly, maintenance, and positioning in animal cells.

401

19 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

402 Acknowledgments

403 We thank Iain M. Cheeseman for critical reading of the manuscript, and Yuki Tsukada, 404 Rie Inaba and Kiyoko Murase for technical assistance. This work was supported by 405 grants from the PRESTO program (JPMJPR13A3) of the Japan Science and 406 Technology agency (JST) for T.K, a Career Development Award of the Human Frontier 407 Science Program (CDA00057/2014-C) for T.K., KAKENHI (16K14721 and 17H05002 408 for T.K, 17H01431 for G.G.) of the Japan Society for Promotion of Science (JSPS), 409 NIG-JOINT (2014B-B-3, 2015-A1-19, 2016-A1-22 for T.K.) of National Institute of 410 Genetics (NIG), the Naito Foundation for T.K, and JSPS and DFG under the Joint 411 Research Projects-LEAD with UKRI for G.G. 412

413

414 Author contributions

415 Conceptualization, TK; Investigation, TK, KT, HH, MN, and MO; Formal analysis, TK

416 and KT; Methodology, TK, YS, and MK; Writing, TK; Supervision, TK and GG; Funding

417 Acquisition, TK and GG.

418

419 Declaration of interests

420 The authors declare no competing interests.

421

422

20 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

423 Figure Legends 424 425 Figure 1. NuMA acts in spindle pole focusing using its conserved microtubule- 426 binding domain in human cells. (A) Full length NuMA and tested NuMA truncation 427 fragments. NLS and a microtubule-binding domain (MTBD) are shown in magenta and 428 green, respectively. (B and C) Interphase (B) and metaphase (C) Metaphase NuMA- 429 mACF cell lines showing live fluorescent images of NuMA-mACF, NuMA-mCh WT or 430 mutants, SiR-DNA and SiR-700 tubulin (TUB) after 24 hr following treatment with Dox 431 and IAA. Arrows in C indicate unfocused microtubules. (D) Quantification of cells with 432 unfocused spindles in each condition from data in (C). Bars indicate means ± SEMs. N 433 = 47 (-/-), 75 (-/+), 31 (#1/+), 30 (#2/+), 31 (#3/+), 30 (#4/+), and 48 (#5/+) from 3 434 independent experiments. p-values calculated using Dunnett’s multiple comparisons 435 test after one-way ANOVA (F (3,6) = 33.81, p = 0.0004). 436 437 Figure 2. NuMA functions in spindle pole focusing independently of RCC1. (A) 438 The prevailing model of SAF inhibition and activation by importins and Ran-GTP. (B) 439 Metaphase RCC1-mAC cells showing live fluorescent images of RCC1mAC, NuMA- 440 mCherry (mCh), and SiR-TUB after 24 hr following Dox and IAA treatment. (C) 441 Scatterplots of the ratio of spindle length and cell diameter in controls (0.54 ± 0.04, n = 442 32) and RCC1-depleted (0.47 ± 0.04, n = 23) cells. Bars indicate means ± SDs from >3 443 independent experiments. * indicates statistical significance according to Welch’s t-test 444 (p < 0.0001). (D) Quantification of cells with unfocused spindles in each condition from 445 data in (C) and (E). Bars indicate means ± SEMs. N = 27, 34, 37, and 113 from >4 446 independent experiments. p-values calculated using Dunnett’s multiple comparisons 447 test after one-way ANOVA (F (3,14) = 36.40, p < 0.0001). * indicates p < 0.0001. (E) 448 Live fluorescent images of SiR-DNA, RCC1-mAC, NuMA-mAID-mCherry, and SiR700- 449 TUB in RCC1-mAC and NuMA-mAID-mCh double knock-in cells following 24 hr of Dox 450 and IAA treatment. Two cells with or without RCC1 and NuMA signals were analyzed in 451 the same field. Eight z-section images were acquired using 1.0-μm spacing. Maximum 452 intensity projection images are shown. (F, G) Live fluorescent images of RCC1-mAC 453 and NuMA-mCh in RCC1-positive control (F) and RCC1-negative cells (G) treated with 454 nocodazole and IAA, as described in Fig. S2I. * indicates RCC1-undegraded cells. (H) 455 Scatterplots of the ratio of spindle length and cell diameter in control (0.57 ± 0.05, n = 456 35) and RCC1-depleted (0.50 ± 0.06, n = 30) cells. Bars indicate means ± SDs from >3 457 independent experiments. * indicates statistical significance according to Welch’s t-test 458 (p < 0.0001). (I) Quantification of spindle orientation on the x-z plane in control (n = 43) 459 and RCC1-depleted (n = 42) cells from 2 independent experiments. See Methods for 460 the definition of parallel and tilted orientations. * indicates statistical significance 461 according to Z-test (significance level 0.1). Scale bars = 10 μm. 462 463 Figure 3. NuMA is liberated from importins at spindle poles independently of Ran- 464 GTP. (A) A model showing NuMA liberation from importins in RCC1 depleted cells. (B) 465 Metaphase RCC1-mAC cells showing live fluorescent images of RCC1-mAC, importin- 466 β-mCh, and SiR-TUB and after 24 hr following treatment with Dox and IAA. Right:

21 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

467 Quantification of cells with k-fiber localization of importin-β in control (n > 40) and 468 RCC1-depleted (n > 40) cells from 3 independent experiments. * indicates statistical 469 significance according to Z-test (significance level 0.0001). (C) Live fluorescent images 470 of NuMA-mClover-FLAG (mCF, left) and importin-α (right) wild type (WT, top) and a 471 ΔIBB mutant (bottom). (D-E) Metaphase RanGAP1-mAC (D) and importin-β-mAC (E) 472 cells showing live fluorescent images of NuMA-mCherry (mCh), SiR-tubulin (SiR-TUB), 473 and RanGAP1-mAC (D) or importin-β-mAC (E) after 24 hr following treatment with Dox 474 and IAA. * in E indicates cells with importin-β signals in the presence of Dox and IAA. 475 Scale bars = 10 μm. 476 477 Figure 4. RCC1 regulates chromosome-proximal localization of HURP and HSET. 478 (A-C) Left: Metaphase RCC1-mAC cells showing live fluorescent images of RCC1- 479 mAC, SiR-TUB and TPX2-mCh (A), mCh-HSET (B), and HURP-mCh (C) after 24 hr 480 following treatment with Dox and IAA. Right: Quantification of throughout spindle or k- 481 fiber localization of HSET or HURP in control (n > 30) and RCC1-depleted (n > 40) cells 482 from 2 or 3 independent experiments. * indicates statistical significance according to Z- 483 test (significance level 0.0001). (D) A list summarizing localization of SAFs in control 484 and RCC1-depleted cells. Scale bars = 10 μm. 485 486 Figure 5. HURP, but not importin-β, is required to stabilize k-fibers. (A) Metaphase 487 HURP-mACF cells showing live fluorescent images of HURP-mACF, importin-β-mCh 488 and SiR-TUB after 24 hr following Dox and IAA treatment. (B) Quantification of k-fiber 489 localization of importin-β in control (n = 49) and HURP-depleted (n = 46) cells from 3 490 independent experiments. (C) Scatterplots of the ratio of spindle length and cell 491 diameter in control (0.64 ± 0.05, n = 49) and HURP-depleted (0.52 ± 0.06, n = 43) cells. 492 * indicates statistical significance according to Welch’s t-test (p < 0.0001). (D) 493 Fluorescent images of HURP-mACF, TUB, and DNA (Hoechst 33342 staining) in 494 metaphase fixed cells treated with ice-cold medium for 20 min. Two cells with or without 495 HURP signals were analyzed in the same field. (E) Metaphase importin-β-mAC cells 496 showing live fluorescent images of importin-β-mAC, HURP-SNAP and SiR-TUB after 24 497 hr following treatment with Dox and IAA. (F) Quantification of spindle localization of 498 HURP in control (n = 49) and importin-β-depleted (n = 43) cells from 3 independent 499 experiments. (G) Fluorescent images of importin-β-mAC, HURP-SNAP, TUB, and DNA 500 (Hoechst 33342 staining) in metaphase fixed cells treated with ice-cold medium for 20 501 min. Five z-section images were obtained using 0.5-μm spacing and maximum intensity 502 projection images are shown in (D) and (G). (H-I) Left: metaphase RanGAP1-mAC cells 503 showing live fluorescent images of RanGAP1-mAC, SiR-TUB and HURP-mCh (H) or 504 importin-β-mCh (I) after 24 hr following Dox and IAA treatment. Right: quantification of 505 k-fiber localization of HURP or importin-β in control (n = 45) and RanGAP1-depleted (n 506 > 45) cells from 3 independent experiments. * in (B), (F), (H) and (I) indicates statistical 507 significance according to Z-test (significance level 0.0001). (J) A local cycling model of 508 HURP on k-fibers regulated by Ran-GTP and importin-β. See text for details. Scale bars 509 = 10 μm. 510

22 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

511 Figure 6. HURP dynamically accumulates on metaphase k-fibers in an importin-β- 512 dependent manner. (A) Live fluorescent images of HURP-SNAP visualized with TMR- 513 star (magenta) and SiR-tubulin (TUB) in control (top) and importin-β-depleted cells 514 (bottom). Fluorescent signals were bleached in the indicated box region at t = 0, and the 515 fluorescence recoveries were monitored for 120 sec. (B) A graph showing fluorescence 516 recovery after photobleaching. An average of 7 samples was plotted. Bars indicate SDs. 517 (C) Schematic diagram of the metaphase degradation assay. Following release from 518 RO-3336-mediated G2 arrest, proTAME and Apcin were added to arrest cells in 519 metaphase. Auxin (IAA) was added (indicated by the red line) to induce RCC1 520 degradation during metaphase. (D) Live fluorescent images of SiR-DNA, importin-β- 521 mAC, HURP-mCh, and SiR-700-tubulin (TUB). IAA was added at t = 0. Arrows indicate 522 a cell showing a reduction of importin-β signal during metaphase. (E) Enlarged images 523 from (D) showing a re-localization of HURP-mCh from k-fibers (t = 0) to the spindle (t 524 =90). Scale bars = 10 μm. 525 526 Figure 7. Models of local activation mechanisms for HURP and NuMA in mitosis. 527 (A) Live fluorescent images of SiR-DNA, RCC1-mAC, HURP-mCh, and SiR-700-tubulin 528 (TUB). IAA was added at t = 0. (B) Enlarged images of indicated regions in (A) showing 529 a reduction of HURP-mCh from k-fibers in response to degradation of RCC1. (C) 530 Spindle length measurement (n = 6) at t = -5 and 60 min in (A). (D) Left: in the vicinity of 531 chromosomes, Ran-GTP and importin-β promote the microtubule binding and 532 dissociation cycle of HURP, resulting in polarized HURP accumulation and stable k-fiber 533 formation. Right: chromosome-derived Ran-GTP is not required to activate NuMA at the 534 spindle poles in mitotic human cells. A Ran-independent, parallel pathway would exist to 535 activate NuMA away from chromosomes. See text for details. Scale bars = 10 μm. 536 537

23 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

538 Materials and Methods 539 540 ・ Plasmid Construction 541 Plasmids for CRISPR/Cas9-mediated genome editing and auxin-inducible degron 542 were constructed according to protocols of Natsume et al. [35] and Okumura et al., 543 [20]. To construct donor plasmids containing homology arms for RCC1 (~500-bp 544 homology arms), RanGAP1 (~500-bp), importin-β (~500-bp), HURP (~200-bp), TPX2 545 (~200-bp), and HSET (~200-bp), gene synthesis services from Eurofins Genomics 546 K.K. (Tokyo, Japan) or Genewiz (South Plainsfield, NJ) were used. Plasmids and 547 sgRNA sequences used in this study are listed in Supplementary Tables S1 and S2, 548 and will be deposited in Addgene. 549 550 ・ Cell Culture, Cell Line Generation, and Antibodies 551 HCT116 cells were cultured as described previously [20]. Knock-in cell lines were 552 generated according to procedures described in Okumura et al. [20]. To activate auxin- 553 inducible degradation, cells were treated with 2 µg/mL Dox and 500 µM indoleacetic 554 acid (IAA) for 20–24 hr. Cells with undetectable signals for mAID-fusion proteins were 555 analyzed. Flip-In T-REx 293 cells were used in Figure 3C to express mCherry-tagged 556 importin-α constructs. Cell lines were created according to procedures described in 557 Kiyomitsu et al. [57]. To induce transgenes, cells were incubated with 1 µg/mL 558 tetracycline (MP Biomedicals). Cell lines and primers used in this study are listed in 559 Tables S1 and S3, respectively. 560 Antibodies against tubulin (DM1A, Sigma-Aldrich, 1:2,000), NuMA (Abcam, 561 1:1,000), RCC1 (Cell Signaling Technology, D15H6, Rabbit mAb, 1:100), RanGAP1 562 (Santa Cruz Biotechnology, H-180, 1:200), importin-β (GeneTex, 3E9 Mouse mAb, 563 1:100), and HURP (E. Nigg laboratory, 1：200) were used for western blotting. For 564 RCC1 immunoblots, membranes were incubated with anti-RCC1 antibody overnight 565 at 4 °C. 566 567 ・ Microscope System 568 Imaging was performed using spinning-disc confocal microscopy with a 60× 1.40 569 numerical aperture objective lens (Plan Apo λ, Nikon, Tokyo, Japan). A CSU-W1 570 confocal unit (Yokogawa Electric Corporation, Tokyo, Japan) with five lasers (405, 488, 571 561, 640, and 685 nm, Coherent, Santa Clara, CA) and an ORCA-Flash 4.0 digital 572 CMOS camera (Hamamatsu Photonics, Hamamatsu City, Japan) were attached to an 573 ECLIPSE Ti-E inverted microscope (Nikon) with a perfect focus system. DNA images 574 in Figure 2A/B or Figure 4D/G were obtained using either a SOLA LED light engine 575 (Lumencor, Beaverton, OR) or a 405-nm laser, respectively. 576 577 ・ Immunofluorescence and Live Cell Imaging 578 For immunofluorescence in Figure S1K, HURP-mACF cells were fixed with PBS 579 containing 3% paraformaldehyde and 2% sucrose for 10 min at room temperature. 580 Fixed cells were permeabilized with 0.5% Triton X-100™ for 5 min on ice, and 581 pretreated with PBS containing 1% BSA for 10 min at room temperature after washing 582 with PBS. Importin-β was visualized using anti-importin-β antibody (1:500). Images of 583 multiple z-sections were acquired by spinning-disc confocal microscopy using 0.5-μm

24 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

584 spacing and camera binning 2. Maximally projected images from 3 z-sections are 585 shown. 586 For live cell imaging, cells were cultured on glass-bottomed dishes 587 (CELLview™, #627860 or #627870, Greiner Bio-One, Kremsmünster, Austria) and 588 maintained in a stage-top incubator (Tokai Hit, Fujinomiya, Japan) to maintain the 589 same conditions used for cell culture (37° C and 5% CO2). In most cases, three to five 590 z-section images using 0.5-μm spacing were acquired and single z-section images 591 are shown, unless otherwise specified. Microtubules were stained with 50 nM SiR- 592 tubulin or SiR700-tubulin (Spirochrome) for >1 hr prior to image acquisition. DNA was 593 stained with 50 ng/mL Hoechst® 33342 (Sigma-Aldrich) or 20 nM SiR-DNA 594 (Spirochrome) for > 1 hr before observation. To visualize SNAP-tagged HURP in Fig. 595 4E, cells were incubated with 0.1 μM TMR-Star (New England BioLabs) for > 2 hr, and 596 TMR-Star were removed before observation. To optimize image brightness, the same 597 linear adjustments were applied using Fiji and Photoshop. 598 599 ・ Prometaphase degradation assay and nocodazole washout 600 To degrade mAID-tagged proteins during nocodazole arrest, cells were treated with 2 601 μg/mL Dox and 3.3 μM nocodazole at the indicated times (Fig. 2C). Five hours after 602 addition of nocodazole, cell culture dishes were moved to the stage of a microscope 603 equipped with a peristaltic pump (SMP-21S, EYELA, Tokyo Rikakikai). Two z-section 604 images were acquired using 2-μm spacing at three different (X.Y) positions and at 5- 605 min intervals, with 500 μM IAA added during the first interval. After 90 min, the 606 nocodazole-containing medium was completely replaced with fresh medium using the 607 peristaltic pump at a velocity of 20 sec/mL for 15 min. Images were acquired for a 608 further 2 hr and maximum intensity projection images are shown in Figure 2D-F. To 609 analyze spindle orientation in Figure 2I, we took five z-section images using 2-μm 610 spacing. When both spindle poles are included within three z-section images, we 611 judged the spindle as having parallel orientation. 612 613 ・ Metaphase degradation assay 614 To degrade mAID-tagged proteins in metaphase-arrested cells, cells were treated with 615 50 μM Apcin (I-444, Boston Biochem) and 20 μM proTAME (I-440, Boston Biochem) 616 at the indicated times (Fig. 5A). Three z-section images were acquired using 1-μm 617 spacing at six different (X,Y) positions and at 5-min intervals, with 500 μM IAA added 618 during the first interval. Maximum intensity projection images are shown in Figure 5B. 619 620 ・ Cold treatment assay 621 To increase the number of cells in metaphase, cells were treated with 20 μM MG132 622 (C2211, Sigma-Aldrich) for 90 min. To visualize SNAP-tagged HURP (Fig. 4G), cells 623 were incubated with 0.1 μM TMR-Star (S9105S, New England BioLabs) for at least 624 30 min. Before fixation, cells were incubated in ice-cold medium for 20 min [31] to 625 depolymerize non-kinetochore microtubules. 626 627 ・ FRAP 628 FRAP was conducted with a microscope (LEM 780, Carl Zeiss MicroImaging, Inc.), 629 using a 63 x objective lens. Images were acquired every 5 sec before and after

25 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

630 photobleaching. The bleached area (BA) was set as it covers half spindle and 631 illuminated at t = 0 using 560 nm laser (20 mW) with the following setting: speed 4.0 632 and iteration 1. Metaphase cells that orient parallel to the bottom cover-glass were 633 selected. HURP (TMR-Star) intensity of BA was normalized using the intensity of non- 634 bleached area (NBA) that covers the remaining half spindle. Corrected relative 635 intensity at time tn was calculated as (BAn – BGn) / (BA-1 – BG-1) x (NBA-1 – BG-1) / 636 (NBAn – BGn), where t = -1 represents the first time point of image acquisition before 637 bleaching. BG means background [58]. Curve fitting and analyses shown in Fig. S6 638 were performed using Fiji. 639 640 ・ Statistical Analysis 641 To determine the significance of differences between the mean values obtained for 642 two experimental conditions, Welch’s t-tests (Prism 6; GraphPad Software, La Jolla, 643 CA) or a Z-test for proportions (epitools.ausvet.com.au/ztesttwo) were used, as 644 indicated in figure legends. 645

26 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

646 Supplemental Information 647 648 Supplemental Figure Legends 649 Figure S1. Generation of cell lines that conditionally degrade endogenous NuMA 650 and express NuMA mutants. (A) Schematic of the auxin-inducible degradation (AID) 651 system. OsTIR1, an F-box protein expressed following Dox treatment, forms SCF E3 652 ligase complexes. Following auxin (IAA) treatment, mAID-fusion protein was 653 poly-ubiquitinated by SCFOsTIR1 and degraded by proteasomes with a half-life of ~20 654 min. (B) Genomic PCR showing clone genotypes after hygromycin (Hygro) selection. 655 Clones used in this study are listed in Table S1. (C) Interphase NuMA-mACF cell lines 656 showing live fluorescent images of NuMA-mACF, NuMA-mCh mutants, and SiR-DNA 657 after 24 hr following treatment with Dox and IAA. Endogenous NuMA-mACF signals 658 were undetectable, whereas ectopically expressed NuMA mutants were detected in 659 cytoplasm. NuMA-mCh Δ(NLS+MTBD2) appeared to accumulate on microtubules 660 around centrosomes. (D) Amino acid sequence alignment of the NLS of NuMA proteins 661 in H. sapiens (NP_006176), R. norvegicus (NP_001094161), M. musculus 662 (NP_598708), G. gallus (NP_001177854), X. laevis (NP_001081559), D. rerio 663 (NP_001316910), O. latipes (XP_020564048), and A. ocellaris (XM_023273896) 664 aligned by ClustalWS. NLSs are not well conserved in fish, although NuMA clustering 665 motif (shown in orange) and NLM motif (sky blue) are highly conserved in vertebrates. 666 In the NLS alignment, key amino acids that interact with importin-α [32] are boxed in 667 red, whereas positively charged amino acids in fish are boxed in green. (E) Amino acid 668 sequence alignment of the major (i) and minor (ii) NLS-binding site of importin-α 669 proteins in H. sapiens (NP_001307540), M. musculus (NP_034785), G. gallus 670 (NP_001006209), X. laevis (NP_001080459), D. rerio (NP_001002335), and O. latipes 671 (XP_023816136) aligned by ClustalWS. (F) Amino acid sequence alignment of the NLS 672 of TPX2 proteins in H. sapiens (NP_036244), M. musculus (NP_001135447), G. gallus 673 (NP_989768), X. laevis (AAH68637), D. rerio (NP_001314674), and O. latipes 674 (XP_020557297) aligned by ClustalWS. Key amino acids interact with importin-α [33] 675 are boxed in red. 676 677 Figure S2. Generation of cell lines for auxin-inducible degradation of endogenous 678 RCC1. (A) Genomic PCR showing clone genotypes after neomycin (Neo) selection. 679 Clone No.1 was used as a parental cell in subsequent selections. * indicates a non- 680 specific band. (B) Genomic PCR showing clone genotypes after hygromycin (Hygro) 681 selection. Clone No.1 was used in this study. (C) Immunoblotting for anti-NuMA, anti- 682 RCC1, and anti-α-tubulin (TUB, loading control) showing bi-allelic insertion of the 683 indicated tags. (D-E) Live fluorescent images of DNA (Hoechst 33342 staining), RCC1- 684 mAC, NuMA-mCh, and SiR-TUB in control (D) and RCC1-depleted (E) cells. (F) 685 Scatterplots of mitotic duration (NEBD to anaphase onset) in control (34.1 ± 7.6, n=32) 686 and RCC1-depleted cells (47.2 ± 10.5, n=27). Bars indicate means ± SDs from >3 687 independent experiments. * indicates statistical significance according to Welch’s t-test 688 (p<0.0001). (G) Genomic PCR showing clone genotype after hygromycin (Hygro) 689 selection. Clone No.3 was selected for further use. (H) Live fluorescent images of SiR- 690 DNA, RCC1-mAC, NuMA-mAID-mCh, and SiR-TUB. A spindle-pole focusing defect

27 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

691 (indicated by the arrow in panel 2) and abnormal spindle formation (panel 3) were 692 observed in RCC1-mAC and NuMA-mAID-mCh co-depleted cells 20-24 hr after Dox 693 and IAA treatment. Five z-section images were acquired using 1.0-μm spacing and 694 maximum intensity projection images are shown. (I) (C) Schematic diagram of the 695 prometaphase degradation assay. Nocodazole was added to arrest the cells in 696 prometaphase, and then Auxin (IAA) was added to induce RCC1 degradation during 697 nocodazole-arrest. Nocodazole were washed out by changing medium for 15 min with 698 peristaltic pumps, while recording the cells. See Methods for details. (J) Scatterplots of 699 mitotic duration (from nocodazole wash-out to anaphase onset) in RCC1-positive 700 control (68.7 ± 2.1, n=46) and RCC1-depleted cells (61.5 ± 1.4, n=47). Bars indicate 701 means ± SDs from >3 independent experiments. * indicates statistical significance 702 according to Welch’s t-test (p = 0.0061). Scale bars = 10 μm. 703 704 Figure S3. Generation of cell lines for auxin-inducible degradation of endogenous 705 Ran-GAP1 and importin-β. (A) Genomic PCR showing clone genotypes after 706 hygromycin (Hygro) selection. Clones No.6 were used. (B) Metaphase importin-β-mAC 707 cells showing live fluorescent images of importin-β-mAC, and SiR-TUB. Single z-section 708 images are shown. (C) Immunofluorescence images of fixed metaphase cells showing 709 k-fiber localization endogenous importin-β and mAID-tagged HURP (HURP-mACF). 710 Maximally projected images from 3 z-sections are shown. (D) Immunoblotting for anti- 711 importin-α and anti-α-tubulin (TUB, loading control) showing ectopic expression of the 712 importin-α wild type (WT, right) and a ΔIBB mutant (left) following Dox treatment. * 713 indicates endogenous importin-α. (E) Genomic PCR showing clone genotypes after 714 neomycin (Neo) selection. Clone No.9 was used as a parental cell in the second 715 selections. (F) Genomic PCR showing clone genotypes after hygromycin (Hygro) 716 selection. Clone No.3 (NuMA-mCh) was selected. (G) Immunoblotting for anti-NuMA, 717 anti-RanGAP1 and anti-α-tubulin (TUB, loading control) showing bi-allelic insertion of 718 the indicated tags. * and ** indicate RanGAP1 and SUMO-1 conjugated RanGAP1, 719 respectively. (H) Scatterplots of the ratio of spindle length and cell diameter in control 720 (0.54 ± 0.04, n=26) and RanGAP1-depleted (0.52 ± 0.07, n=19) cells. (I) Scatterplots of 721 mitotic duration (NEBD to anaphase onset) in control (35.5 ± 9.0, n=29) and RanGAP1- 722 depleted (39.1 ± 10.1, n=23) cells. Bars in (H) and (I) indicate means ± SDs from >3 723 independent experiments. Differences were not statistically significant based on Welch’s 724 t-test in H (p=0.2108) and I (p=0.1851). (J) Genomic PCR showing clone genotypes 725 after neomycin (Neo) selection. Clone No.7 was used as a parental cell in the second 726 selections. (K) Genomic PCR showing clone genotype after hygromycin (Hygro) 727 selection. Clone No.1 was selected for further use. (L) Western blot detection using anti- 728 NuMA, anti-importin-β and anti-α-tubulin antibodies (TUB, loading control) showing bi- 729 allelic insertion of the indicated tags. (M) Scatterplots of the ratio of spindle length and 730 cell diameter in control (0.49 ± 0,05, n=26) and importin-β-depleted (0.44 ± 0.07, n=17) 731 cells. (N) Scatterplots of mitotic duration (NEBD to anaphase onset) in control (41.9 ± 732 16.3, n=27) and importin-β-depleted (66.7 ± 26.7, n=12) cells. Bars in (M) and (N) 733 indicate mean ± SD from >3 independent experiments. * indicates statistical significance 734 according to Welch’s t-test (p<0.05) in (M) and (N). Scale bars = 10 µm. 735

28 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

736 Figure S4. Generation of double knock-in cell lines that express RCC1-mAC and 737 mCherry-fused TPX2, HSET, or HURP. (A-C) Genomic PCR showing clone genotypes 738 after hygromycin (Hygro) selections. Clones No.1 (A), No. 1 (B), and No.8 (C) were 739 used. The mCherry cassette was inserted into only one copy of TPX2 gene loci (A). 740 741 Figure S5. Generation of cell lines that degrade or visualize endogenous HURP. 742 (A) Genomic PCR showing the clone genotype after neomycin (Neo) selection. Clone 743 No.13 was used as a parental cell in subsequent selections. (B) Immunoblotting for anti- 744 HURP and anti-α-tubulin (TUB, loading control) showing bi-allelic insertion of the 745 indicated tags. (C-E) Genomic PCR showing clone genotypes after hygromycin (Hygro) 746 selection. Clone No.14 (C), No. 3 (D), No. 5 (E: HURP-mCh), and No. 12 (E: importin-β) 747 were used, respectively. The SNAP cassette was inserted into only one copy of HURP 748 gene loci (D). 749 750 751 Figure S6. Fluorescent recovery kinetics of HURP in the presence or absence of 752 importin-β. (A-B) Graphs showing a fitted curve or a straight line on each plot. 753 Formulas and parameters are also indicated. 754 755 756 757

29 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

758 Table S1: Cell lines used in this study.

No. Name Description Clo Plasmids used Pare Reference ne ntal No. cell 1 HCT116 tet- AAVS1::PTRE3G OsTIR1 (Puro) pAAVS1 T2 and [35] OsTIR1 MK243 (Addgene#7283 5) 2 NuMA-mACF + AAVS1::PTRE3G OsTIR1 (Puro), NuMA1:: 7 hROSA26 [20] DHC-SNAP + NuMA-mAID-mClover-3FLAG (Neo), DHC1:: CRISPR-pX330 mCh-NuMA WT DHC-SNAP (BSD), Rosa26:: PTRE3G and pTK503 mCherry-NuMA WT (Hygro) 3 NuMA-mACF + AAVS1::PTRE3G OsTIR1 (Puro), NuMA1:: 1 hROSA26 2 This study DHC-SNAP + NuMA-mAID-mClover-3FLAG (Neo), DHC1:: CRISPR-pX330 mCh-NuMA ΔNLS DHC-SNAP (BSD), Rosa26:: PTRE3G and pTK699 mCherry-NuMA ΔNLS (Hygro) 4 NuMA-mACF + AAVS1::PTRE3G OsTIR1 (Puro), NuMA1:: 1 hROSA26 2 This study DHC-SNAP + NuMA-mAID-mClover-3FLAG (Neo), DHC1:: CRISPR-pX330 mCh-NuMAΔex24 DHC-SNAP (BSD), Rosa26:: PTRE3G and pTK700 mCherry-NuMA Δex24 (Hygro) 5 NuMA-mACF + AAVS1::PTRE3G OsTIR1 (Puro), NuMA1:: 1 hROSA26 2 This study DHC-SNAP + NuMA-mAID-mClover-3FLAG (Neo), DHC1:: CRISPR-pX330 mCh-NuMA DHC-SNAP (BSD), Rosa26:: PTRE3G and pTK509 Δ(NLS +MTBD2) mCherry-NuMA Δ(NLS+MTBD2) (Hygro) 6 NuMA-mACF + AAVS1::PTRE3G OsTIR1 (Puro), NuMA1:: 3 hROSA26 2 This study DHC-SNAP + NuMA-mAID-mClover-3FLAG (Neo), DHC1:: CRISPR-pX330 mCh-NuMA ΔC- DHC-SNAP (BSD), Rosa26:: PTRE3G and pTK510 ter mCherry-NuMA ΔC-ter (Hygro) 7 Flip-In T-REx 293 Invitrogen [57] 8 Flip-In T-REx 293 Flip-In:: importin-α-WT mCherry (hygro) Poly pOG44 and 7 This study importin-α-WT clon pTK960 mCherry al 9 Flip-In T-REx 293 Flip-In:: importin-α-ΔIBB mCherry (hygro) Poly pOG44 and 7 This study importin-α-ΔIBB clon pTK961 mCherry al 10 RCC1-mAC AAVS1::PTRE3G OsTIR1 (Puro), RCC1:: 1 pTK361+ 1 This study RCC1-mAID-mClover (Neo) pHH45 11 RCC1-mAC + AAVS1::PTRE3G OsTIR1 (Puro), RCC1:: 1 pTK372+ 10 This study NuMA-mCh RCC1-mAID-mClover (Neo), NuMA1:: pTK435 NuMA-mCh (Hygro) 12 RanGAP1-mAC AAVS1::PTRE3G OsTIR1 (Puro), 9 pHH49 + 1 This study RanGAP1:: RanGAP1-mAID-mClover (Neo) pHH51 13 RanGAP1-mAC + AAVS1::PTRE3G OsTIR1 (Puro), 5 pTK372+ 12 This study NuMA-mCh RanGAP1:: RanGAP1-mAID-mClover (Neo), pTK435 NuMA1:: NuMA-mCh (Hygro) 14 importin-β-mAC AAVS1::PTRE3G OsTIR1 (Puro), importin- 7 pHH50 + 1 This study β:: importin-β-mAID-mClover (Neo) pHH57 15 importin-β-mAC + AAVS1::PTRE3G OsTIR1 (Puro), importin- 1 pTK372+ 14 This study NuMA-mCh β:: importin-β-mAID-mClover (Neo), pTK435 NuMA1:: NuMA-mCh (Hygro) 16 RCC1-mAC + AAVS1::PTRE3G OsTIR1 (Puro), RCC1:: 6 pHH50 + 10 This study importin-β-mCh RCC1-mAID-mClover (Neo), NuMA1:: pTK481 NuMA-mCh (Hygro)

30 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

17 RCC1-mAC + AAVS1::PTRE3G OsTIR1 (Puro), RCC1:: 8 pTK532+ 10 This study HURP-mCh RCC1-mAID-mClover (Neo), HURP:: HURP- pTK541 mCh (Hygro) 18 RCC1-mAC + AAVS1::PTRE3G OsTIR1 (Puro), RCC1:: 1 pTK527+ 10 This study TPX2-mCh RCC1-mAID-mClover (Neo), TPX2:: TPX2- pTK502 mCh (Hygro) 19 RCC1-mAC + AAVS1::PTRE3G OsTIR1 (Puro), RCC1:: 1 pTK523+ 10 This study mCh-HSET RCC1-mAID-mClover (Neo), HSET:: mCh- pTK531 HSET (Hygro) 20 RanGAP1-mAC + AAVS1::PTRE3G OsTIR1 (Puro), 5 pTK532+ 12 This study HURP-mCh RanGAP1:: RanGAP1-mAID-mClover (Neo), pTK541 HURP:: HURP-mCh (Hygro) 21 RanGAP1-mAC + AAVS1::PTRE3G OsTIR1 (Puro), 12 pHH50 + 12 This study importin-β-mCh RanGAP1:: RanGAP1-mAID-mClover (Neo), pTK481 importin-β:: importin-β-mCh (Hygro) 22 importin-β-mAC + AAVS1::PTRE3G OsTIR1 (Puro), importin- 3 pTK532+ 14 This study HURP-SNAP β:: importin-β-mAID-mClover (Neo), HURP:: pTK589 HURP-SNAP (Hygro) 23 HURP-mACF AAVS1::PTRE3G OsTIR1 (Puro), HURP:: 13 pTK532+ 1 This study HURP-mAID-mClover-3FLAG (Neo) pTK596 24 HURP-mACF + AAVS1::PTRE3G OsTIR1 (Puro), HURP:: 14 pHH50 + 23 This study importin-β-mCh HURP-mAID-mClover-3FLAG (Neo), pTK481 importin-β:: importin-β-mCh (Hygro) 759 760

31 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

761 Table S2: sgRNA sequences for CRISPR/Cas9-mediated genome editing Gene locus sgRNA (5’-3’) PAM Plasmid Name NuMA1 (C-terminus) gtggggccactcactggtac tgg pTK372 [20] RCC1 (C-terminus) gactgtatgctggcccccgc tgg pTK361 RanGAP1 (C-terminus) tctgctgcagacgctgtaca agg pHH49 importin-β (C-terminus) agttcgagccgccgcccgaa agg pHH50 HURP caaaattctcctggttgtag agg pTK532 TPX2 tgcggataccgcccggcaat ggg pTK527 HSET tgcattcccccggcgcgtgt ggg pTK523 762 763 Table S3: PCR primers used to confirm gene editing Gene Primer sequence Primer name Figures RCC1 gaatgccattccaggcag oHH88 Figure S2A RCC1 ttctgcacgttcctctgg oHH89 Figure S2A NUMA1 gagcctcaaagaaggccc oTK542 Figure S2B, S2G, S3F, S3K NUMA1 agcaggaaccagggcctac oTK566 Figure S2B, S2G, S3F, S3K RanGAP1 gctgccgcaggaccagggcttggtg oHH93 Figure S3E RanGAP1 attccctggcctatgtctgctggaa oHH94 Figure S3E HURP ctcttgatggatactttactg oTK749 Figure S4C, S5A, S5D, S5E HURP cccttgagaaagagtatatcta oTK750 Figure S4C, S5A, S5D, S5E importin-β ggagtaaggagttttgagagtatcg oHH97 Figure S3A, S3J, S5C, S5E importin-β aaatcttctctagagctaggcaacg oHH98 Figure S3A, S3J, S5C, S5E TPX2 tctgacatccctctcactg oTK660 Figure S4A TPX2 ggagtctaatcgagacattc oTK661 Figure S4A HSET ggccctcggctgtggc oTK766 Figure S4B HSET ctccccgggtgctctaag oTK767 Figure S4B Rosa 26 ggtgggaggcgcttgttc oTK846 Figure S1B mCherry-NuMA ctgtggggtctgcaggat oTK445 Figure S1B 764

765

32 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

766 References 767

768 1. Reber, S., and Hyman, A.A. (2015). Emergent Properties of the Metaphase Spindle. Cold Spring Harb 769 Perspect Biol 7, a015784. 770 2. Heald, R., and Khodjakov, A. (2015). Thirty years of search and capture: The complex simplicity of mitotic 771 spindle assembly. J Cell Biol 211, 1103-1111. 772 3. Kalab, P., and Heald, R. (2008). The RanGTP gradient - a GPS for the mitotic spindle. J Cell Sci 121, 773 1577-1586. 774 4. Forbes, D.J., Travesa, A., Nord, M.S., and Bernis, C. (2015). Reprint of "Nuclear transport factors: global 775 regulation of mitosis". Curr Opin Cell Biol 34, 122-134. 776 5. Bischoff, F.R., and Ponstingl, H. (1991). Catalysis of guanine nucleotide exchange on Ran by the mitotic 777 regulator RCC1. Nature 354, 80-82. 778 6. Bischoff, F.R., Klebe, C., Kretschmer, J., Wittinghofer, A., and Ponstingl, H. (1994). RanGAP1 induces 779 GTPase activity of nuclear Ras-related Ran. Proc Natl Acad Sci U S A 91, 2587-2591. 780 7. Kalab, P., Weis, K., and Heald, R. (2002). Visualization of a Ran-GTP gradient in interphase and mitotic 781 Xenopus egg extracts. Science 295, 2452-2456. 782 8. Kalab, P., Pralle, A., Isacoff, E.Y., Heald, R., and Weis, K. (2006). Analysis of a RanGTP-regulated 783 gradient in mitotic somatic cells. Nature 440, 697-701. 784 9. Dumont, J., Petri, S., Pellegrin, F., Terret, M.E., Bohnsack, M.T., Rassinier, P., Georget, V., Kalab, P., 785 Gruss, O.J., and Verlhac, M.H. (2007). A centriole- and RanGTP-independent spindle assembly pathway in 786 meiosis I of vertebrate oocytes. J Cell Biol 176, 295-305. 787 10. Moutinho-Pereira, S., Stuurman, N., Afonso, O., Hornsveld, M., Aguiar, P., Goshima, G., Vale, R.D., and 788 Maiato, H. (2013). involved in -independent mitotic spindle assembly in Drosophila S2 789 cells. Proc Natl Acad Sci U S A 110, 19808-19813. 790 11. Hasegawa, K., Ryu, S.J., and Kalab, P. (2013). Chromosomal gain promotes formation of a steep RanGTP 791 gradient that drives mitosis in aneuploid cells. J Cell Biol 200, 151-161. 792 12. Holubcova, Z., Blayney, M., Elder, K., and Schuh, M. (2015). Human oocytes. Error-prone chromosome- 793 mediated spindle assembly favors chromosome segregation defects in human oocytes. Science 348, 1143- 794 1147. 795 13. Drutovic, D., Duan, X., Li, R., Kalab, P., and Solc, P. (2020). RanGTP and importin beta regulate meiosis I 796 spindle assembly and function in mouse oocytes. EMBO J 39, e101689. 797 14. Furuta, M., Hori, T., and Fukagawa, T. (2016). binding of RCC1 during mitosis is important for 798 its nuclear localization in interphase. Mol Biol Cell 27, 371-381. 799 15. Nachury, M.V., Maresca, T.J., Salmon, W.C., Waterman-Storer, C.M., Heald, R., and Weis, K. (2001). 800 Importin beta is a mitotic target of the small GTPase Ran in spindle assembly. Cell 104, 95-106. 801 16. Wiese, C., Wilde, A., Moore, M.S., Adam, S.A., Merdes, A., and Zheng, Y. (2001). Role of importin-beta 802 in coupling Ran to downstream targets in microtubule assembly. Science 291, 653-656. 803 17. Gruss, O.J., Carazo-Salas, R.E., Schatz, C.A., Guarguaglini, G., Kast, J., Wilm, M., Le Bot, N., Vernos, I., 804 Karsenti, E., and Mattaj, I.W. (2001). Ran induces spindle assembly by reversing the inhibitory effect of 805 importin alpha on TPX2 activity. Cell 104, 83-93. 806 18. Stewart, M. (2007). Molecular mechanism of the nuclear protein import cycle. Nat Rev Mol Cell Biol 8, 807 195-208. 808 19. Hueschen, C.L., Kenny, S.J., Xu, K., and Dumont, S. (2017). NuMA recruits dynein activity to microtubule 809 minus-ends at mitosis. Elife 6. 810 20. Okumura, M., Natsume, T., Kanemaki, M.T., and Kiyomitsu, T. (2018). Dynein-Dynactin-NuMA clusters 811 generate cortical spindle-pulling forces as a multi-arm ensemble. Elife 7. 812 21. Gaglio, T., Saredi, A., and Compton, D.A. (1995). NuMA is required for the organization of microtubules 813 into aster-like mitotic arrays. J Cell Biol 131, 693-708. 814 22. Silk, A.D., Holland, A.J., and Cleveland, D.W. (2009). Requirements for NuMA in maintenance and 815 establishment of mammalian spindle poles. J Cell Biol 184, 677-690. 816 23. Wittmann, T., Wilm, M., Karsenti, E., and Vernos, I. (2000). TPX2, A novel xenopus MAP involved in 817 spindle pole organization. J Cell Biol 149, 1405-1418. 818 24. Garrett, S., Auer, K., Compton, D.A., and Kapoor, T.M. (2002). hTPX2 is required for normal spindle 819 morphology and centrosome integrity during vertebrate cell division. Curr Biol 12, 2055-2059.

33 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

820 25. Petry, S., Groen, A.C., Ishihara, K., Mitchison, T.J., and Vale, R.D. (2013). Branching microtubule 821 nucleation in Xenopus egg extracts mediated by augmin and TPX2. Cell 152, 768-777. 822 26. Roostalu, J., Cade, N.I., and Surrey, T. (2015). Complementary activities of TPX2 and chTOG constitute 823 an efficient importin-regulated microtubule nucleation module. Nat Cell Biol 17, 1422-1434. 824 27. King, M.R., and Petry, S. (2020). Phase separation of TPX2 enhances and spatially coordinates microtubule 825 nucleation. Nat Commun 11, 270. 826 28. Ems-McClung, S.C., Zheng, Y., and Walczak, C.E. (2004). Importin alpha/beta and Ran-GTP regulate 827 XCTK2 microtubule binding through a bipartite nuclear localization signal. Mol Biol Cell 15, 46-57. 828 29. Ems-McClung, S.C., Emch, M., Zhang, S., Mahnoor, S., Weaver, L.N., and Walczak, C.E. (2020). 829 RanGTP induces an effector gradient of XCTK2 and importin alpha/beta for spindle microtubule cross- 830 linking. J Cell Biol 219. 831 30. Cai, S., Weaver, L.N., Ems-McClung, S.C., and Walczak, C.E. (2009). Kinesin-14 family proteins 832 HSET/XCTK2 control spindle length by cross-linking and sliding microtubules. Mol Biol Cell 20, 1348- 833 1359. 834 31. Sillje, H.H., Nagel, S., Korner, R., and Nigg, E.A. (2006). HURP is a Ran-importin beta-regulated protein 835 that stabilizes kinetochore microtubules in the vicinity of chromosomes. Curr Biol 16, 731-742. 836 32. Chang, C.C., Huang, T.L., Shimamoto, Y., Tsai, S.Y., and Hsia, K.C. (2017). Regulation of mitotic spindle 837 assembly factor NuMA by Importin-beta. J Cell Biol 216, 3453-3462. 838 33. Giesecke, A., and Stewart, M. (2010). Novel binding of the mitotic regulator TPX2 (target protein for 839 Xenopus kinesin-like protein 2) to importin-alpha. J Biol Chem 285, 17628-17635. 840 34. Kiyomitsu, T. (2019). The cortical force-generating machinery: how cortical spindle-pulling forces are 841 generated. Curr Opin Cell Biol 60, 1-8. 842 35. Natsume, T., Kiyomitsu, T., Saga, Y., and Kanemaki, M.T. (2016). Rapid Protein Depletion in Human 843 Cells by Auxin-Inducible Degron Tagging with Short Homology Donors. Cell Rep 15, 210-218. 844 36. Seldin, L., Muroyama, A., and Lechler, T. (2016). NuMA-microtubule interactions are critical for spindle 845 orientation and the morphogenesis of diverse epidermal structures. Elife 5. 846 37. Gallini, S., Carminati, M., De Mattia, F., Pirovano, L., Martini, E., Oldani, A., Asteriti, I.A., Guarguaglini, 847 G., and Mapelli, M. (2016). NuMA Phosphorylation by Aurora-A Orchestrates Spindle Orientation. Curr 848 Biol 26, 458-469. 849 38. Siller, K.H., Cabernard, C., and Doe, C.Q. (2006). The NuMA-related Mud protein binds Pins and 850 regulates spindle orientation in Drosophila neuroblasts. Nat Cell Biol 8, 594-600. 851 39. Du, Q., Stukenberg, P.T., and Macara, I.G. (2001). A mammalian Partner of inscuteable binds NuMA and 852 regulates mitotic spindle organization. Nat Cell Biol 3, 1069-1075. 853 40. Tang, T.K., Tang, C.J., Chao, Y.J., and Wu, C.W. (1994). Nuclear mitotic apparatus protein (NuMA): 854 spindle association, nuclear targeting and differential subcellular localization of various NuMA isoforms. J 855 Cell Sci 107 ( Pt 6), 1389-1402. 856 41. Kohler, M., Speck, C., Christiansen, M., Bischoff, F.R., Prehn, S., Haller, H., Gorlich, D., and Hartmann, 857 E. (1999). Evidence for distinct substrate specificities of importin alpha family members in nuclear protein 858 import. Mol Cell Biol 19, 7782-7791. 859 42. Ciciarello, M., Mangiacasale, R., Thibier, C., Guarguaglini, G., Marchetti, E., Di Fiore, B., and Lavia, P. 860 (2004). Importin beta is transported to spindle poles during mitosis and regulates Ran-dependent spindle 861 assembly factors in mammalian cells. J Cell Sci 117, 6511-6522. 862 43. Song, L., Craney, A., and Rape, M. (2014). Microtubule-dependent regulation of mitotic protein 863 degradation. Mol Cell 53, 179-192. 864 44. Sackton, K.L., Dimova, N., Zeng, X., Tian, W., Zhang, M., Sackton, T.B., Meaders, J., Pfaff, K.L., 865 Sigoillot, F., Yu, H., et al. (2014). Synergistic blockade of mitotic exit by two chemical inhibitors of the 866 APC/C. Nature 514, 646-649. 867 45. Wei, J.H., Zhang, Z.C., Wynn, R.M., and Seemann, J. (2015). GM130 Regulates Golgi-Derived Spindle 868 Assembly by Activating TPX2 and Capturing Microtubules. Cell 162, 287-299. 869 46. Brownlee, C., and Heald, R. (2019). Importin alpha Partitioning to the Plasma Membrane Regulates 870 Intracellular Scaling. Cell 176, 805-815 e808. 871 47. Chinen, T., Yamamoto, S., Takeda, Y., Watanabe, K., Kuroki, K., Hashimoto, K., Takao, D., and 872 Kitagawa, D. (2020). NuMA assemblies organize microtubule asters to establish spindle bipolarity in 873 acentrosomal human cells. EMBO J 39, e102378.

34 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

874 48. Lorson, M.A., Horvitz, H.R., and van den Heuvel, S. (2000). LIN-5 is a novel component of the spindle 875 apparatus required for chromosome segregation and plane specification in Caenorhabditis elegans. 876 J Cell Biol 148, 73-86. 877 49. Greenberg, S.R., Tan, W., and Lee, W.L. (2018). Num1 versus NuMA: insights from two functionally 878 homologous proteins. Biophys Rev 10, 1631-1636. 879 50. Weaver, L.N., Ems-McClung, S.C., Chen, S.H., Yang, G., Shaw, S.L., and Walczak, C.E. (2015). The Ran- 880 GTP gradient spatially regulates XCTK2 in the spindle. Curr Biol 25, 1509-1514. 881 51. Sikirzhytski, V., Renda, F., Tikhonenko, I., Magidson, V., McEwen, B.F., and Khodjakov, A. (2018). 882 Microtubules assemble near most kinetochores during early prometaphase in human cells. J Cell Biol 217, 883 2647-2659. 884 52. Booth, D.G., Hood, F.E., Prior, I.A., and Royle, S.J. (2011). A TACC3/ch-TOG/clathrin complex stabilises 885 kinetochore fibres by inter-microtubule bridging. EMBO J 30, 906-919. 886 53. Nishimoto, T., Eilen, E., and Basilico, C. (1978). Premature of chromosome condensation in a ts DNA- 887 mutant of BHK cells. Cell 15, 475-483. 888 54. Kiyomitsu, T., and Cheeseman, I.M. (2012). Chromosome- and spindle-pole-derived signals generate an 889 intrinsic code for spindle position and orientation. Nat Cell Biol 14, 311-317. 890 55. Soderholm, J.F., Bird, S.L., Kalab, P., Sampathkumar, Y., Hasegawa, K., Uehara-Bingen, M., Weis, K., 891 and Heald, R. (2011). Importazole, a small molecule inhibitor of the transport receptor importin-beta. ACS 892 Chem Biol 6, 700-708. 893 56. Kiyomitsu, T., and Cheeseman, I.M. (2013). Cortical dynein and asymmetric membrane elongation 894 coordinately position the spindle in anaphase. Cell 154, 391-402. 895 57. Kiyomitsu, T., Murakami, H., and Yanagida, M. (2011). Protein interaction domain mapping of human 896 kinetochore protein Blinkin reveals a consensus motif for binding of spindle assembly checkpoint proteins 897 Bub1 and BubR1. Mol Cell Biol 31, 998-1011. 898 58. Goshima, G., Nedelec, F., and Vale, R.D. (2005). Mechanisms for focusing mitotic spindle poles by minus 899 end-directed motor proteins. J Cell Biol 171, 229-240. 900

35 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure 1

A NuMA B mCh-NuMA - WT ΔNLS 1 213 1700 NLS 2115 +Dox+IAA - + + coiled-coil 1 2 Spindle Rescue of MTBD pole unfocused

accumulation spindle NuMA

Rescue constructs -mACF #1. WT Yes Yes (Endogenous)

#2. ΔNLS NLS (aa: 1984-1989) Yes Yes -NuMA mCherry #3. Δex24 Yes No construct ex24 (aa: 1944-2033) Δ(NLS+ #4. 1985 Yes MTBD2) Yes

#5. ΔC-ter 1700 No No SiR-DNA

C NuMA-mAID-mClover-FLAG (mACF) +/- mCh-NuMA WT/Mutants D WT ΔNLS Δex24 Δ(NLS ΔC-ter mCh-NuMA -- +MTBD2) +Dox+IAA - + + + + + + 100 p = 0.0004

p = 0.0004 p = 0.0018

80 NuMA -mACF (Endogenous)

#1 #2 #3 #4 #5 60 -NuMA mCherry construct 40

Unfocused spindle (%) 20 -TUB SiR700

0 mCh-NuMA - - #1 #2 #3 #4 #5

SiR-DNA +Dox+IAA - + + + + + +

Figure 1. NuMA acts in spindle pole focusing usign its conserved microtubule-binding domain in human cells. bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure 2

Spindle length RCC1-mAC NuMA-mCh SiR-TUB A Chromosome Cytoplasm B C 0.8 Ran-GTP gradient * RCC1 (Ran-GEF) RanGAP1

Ran-GTP 0.6 importin-β Control importin-β α α NuMA NLS 0.4 NuMA NLS importin-β HURP HURP +Dox+IAA 0.2 Ratio of spindle length/cell diameter Control RCC1 [Active] [Inhibitted] depleted

RCC1-mAC + NuMA-mAID-mCh cell line, +Dox +IAA (~ 24hr) 40 * D * E SiR-DNA RCC1-mAC NuMA-mAID-mCh SiR700-TUB 30

20 RCC1 (+) NuMA (+)

10

Unfocused spindle (%) 0 RCC1 (-) +Dox +IAA - + - + NuMA (-) RCC-mAC RCC-mAC +NuMA-mCh +NuMA-mAID-mCh

F [Control: RCC1-positive cells] H +IAA Noc arrest Noc Wash Spindle length 0.8 *

0.7

-mAC 0.6 RCC1

0.5

0.4

0.3 -mCh NuMA RCC1 -90 0 10 60 85 Control 75 Ratio of spindle length/cell diameter degraded (min)

G [RCC1-degraded cells during Noc-arrest] Spindle orientation +IAA Noc arrest Noc Wash I z Parallel x

100 z Tilted x 80 * -mAC RCC1 * * * * * * 60

40

F Frequency (%) 20 -mCh NuMA 0 -90 0 10 55 70 80 RCC1 (min) Control degraded

Figure 2. NuMA functions in spindle pole focusing independently of RCC1. bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure 3

importin-β importin-β -mCh A B RCC1-mAC -mCh SiR-TUB SiR-TUB Enlarged imp-β localization importin-β K-fiber RCC1 depleted cells IBB importin-α 100 * NuMA ? NLS Control 75 importin-β Ran-GTP Other factor? 50 ? IBB 25

importin-α (%) Frequency

NuMA 0 Control RCC1 Microtubule Spindle pole +Dox+IAA depleted

293 Flip-In TRex cell importin-β C NuMA importin-α D RanGAP1 E importin-β -mAC -mClover-Flag -mCherry -mAC NuMA-mCh -mAC NuMA-mCh NuMA-mCh WT Control Control

ΔIBB * +Dox+IAA +Dox+IAA * *

Figure 3. NuMA is liberated from importins at spindle poles independently of Ran-GTP. bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure 4

HSET localization A TPX2-mCh B mCh-HSET RCC1-mAC TPX2-mCh SiR-TUB SiR-TUB RCC1-mAC mCh-HSET SiR-TUB SiR-TUB Throughout spindle Reduced near chromosomes * 100 Control Control

75

50

Frequency (%) Frequency 25 +Dox +IAA +Dox +IAA 0 Control RCC1 depleted

HURP localization C HURP-mCh K-fiber D Localization of SAFs Spindle RCC1-mAC HURP-mCh SiR-TUB SiR-TUB SAFs Control RCC1-depleted * 100 NuMA Spindle pole Not affected

75 Control TPX2 Spindle Not affected 50 Partially affected

NLS-bearing HSET Spindle near chromosomes

Frequency (%) Frequency 25 k-fibers HURP Affected 0 near chromosomes

+Dox +IAA Control RCC1 depleted

Figure 4. RCC1 regulates chromosome-proximal localization of HURP and HSET. bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure 5

imp-β localization A B K-fiber C D Cold treatment (20 min on ice) HURP-mACF importin-β-mCh SiR-TUB Spindle length Cytoplasm HURP-mACF anti-TUB DNA * * 100 0.8

Control 75 0.6 HURP (+) HURP 50 0.4 /cell diameter Frequency (%) Frequency 25 Ratio of spindle length 0 0.2 HURP (-) HURP +Dox +IAA Control HURP Control HURP depleted depleted

HURP localization Cold treatment (20 min on ice) F K-fiber E importin-β-mAC HURP-SNAP SiR-TUB G importin-β-mAC HURP-SNAP anti-TUB DNA Spindle * 100

Control 75 imp-β (+)

50

Frequency (%) Frequency 25

0 imp-β (-) +Dox +IAA Control importin-β depleted

HURP localization RanGAP1 H RanGAP1 K-fiber I imp-β localization -mAC HURP-mCh SiR-TUB -mAC importin-β-mCh SiR-TUB Spindle Spindle * * 100 100

Control 75 Control 75

50 50

Frequency (%) Frequency 25 Frequency (%) Frequency 25

0 0 +Dox +IAA +Dox +IAA Control RanGAP1 Control RanGAP1 depleted depleted

MTBD1 Microtubule Microtubule J HURP MTBD1 MTBD1 HURP MTBD2 HURP importin-β Ran +Ran-GTP GTP

Stabilized MTBD1 HURP K-fiber MTBD2 + importin-β HURP

Ran-GTP gradient Near chromosome Distant from chromosomes

Figure 5. HURP, but not importin-β, is requierd to stabilize k-fibers. bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure 6 importin-β-mAC cells B Control (n=7) A HURP-SNAP(TMR-star) SiR-TUB +Dox+IAA (n=7) 1.0 Bleach t = -5 t = 0 t = 115 (sec)

Control 0.5

+Dox+IAA

importin-β 0

depleted Relative intensity of HURP-SNAP 0 50 100 Time (sec) C Metaphase degradation assay Live cell imaging +RO-3306 Prestaining Wash & release Move to the +SiR-DNA +SiR-DNA + SiR700-TUB microscope Plate cells +Dox +SiR700-TUB +Apcin + proTAME stage +IAA

Time 0 24 43 44 45 45.5 47.5 (hr) G2 Metaphase

Degradation

+IAA (t=0) 0 30 60 90 (min) D E SiR-DNA HURP-mCh SiR700-TUB

importin-β -mAC t = 0 HURP-mCh

t = 90 SiR700-TUB HURP-mCh SiR700-TUB

Figure 6. HURP dynamically accumulates on metaphase k-fibers in an importin-β dependent manner. Figure 7 bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

+IAA (t=0) -5 30 60 90 (min) A B t = -5 +IAA t = 60 SiR-DNA (t=0) HURP-mCh SiR700-TUB RCC1-mAC

11

HURP-mCh C Cell 1 10 Cell 2 9 Cell 3 8 Cell 4 SiR700-TUB 7 Cell 5 Spindle leng th (μm) 6 Cell 6 -50 30 60 HURP-mCh SiR700-TUB Time (min)

D 1. DynamicRCC1 local activation of HURP 2. Parallel pathways to liberate NuMA

Ran-GTP Ran-GTP X Ran Ran X GTP GTP α HURP ? ? HURP importin-β NuMA α Microtubule HURP Centrosome NuMA Microtubule NLS

importin-β Chromosome Spindle pole

Ran-GTP gradient

Figure 7. Models of local activation mechanisms for HURP and NuMA in mitosis. bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Supplemental Figure S1

Parent: tet-OsTIR1+NuMA-mACF+DHC-SNAP No.18 mCherry-NuMA mutants A B ΔNLS Δex24 C NuMA-mACF + mCh-NuMA Mutants (mACF) (Kb) Parent No.1 5 No.1 3 8 10.0 Δ(NLS 8.0 mCh-NuMA Δex24 ΔC-ter NuMA mAID mClover FLAG 6.0 +MTBD2) 5.0 4.0 2.0 3.0 kb +Dox+IAA + + + OsTIR1 2.0 Skp1 1.5 1.0 Cul1 0.5 NuMA

Auxin Rbx1 -mACF

(IAA) Δ(NLS+MTBD2) ΔC-ter (Endogenous) OsTIR1 (Kb) Parent No.1 4 No.1 2 3 SCF 10.0 8.0 6.0 5.0 4.0 2.0 3.0 OsTIR1 kb -NuMA mCherry

2.0 construct NuMA mAID mClover FLAG 1.5 1.0

0.5 Poly-Ubiquitination E2 Tet-inducible promoter

PTRE3G mCherry-NuMA mutants Hygro PCR SiR-DNA Primer products Primer 2.0 kb Rosa 26 locus Degradation Rosa 26 locus 0.0 kb

Clustering motif NLS (1768-1777) (1984-1989) D NuMA C-ter 1700 MTBD 1 MTBD 2 2115 NLM motif (1922-1957) (i) Alignment of NuMA NLS NLS

H.sapiens/1959-2016 R.norvegicus/1939-1996 M.musculus/1941-1998 G.gallus/1983-2054 X.laevis/2063-2139 D.rerio/2240-2351 O.latipes/1979-2074 A.ocellaris/2060-2153 (ii) Alignment of NuMA clustering motif (iii) Alignment of NuMA NLM motif

H.sapiens H.sapiens R.norvegicus R.norvegicus M.musculus M.musculus G.gallus G.gallus X.laevis X.laevis D.rerio D.rerio O.latipes O.latipes A.ocellaris A.ocellaris

E (i) Alignment of importin-α major NLS-binding site H.sapiens M.musculus G.gallus X.laevis D.rerio O.latipes (ii) Alignment of importin-α minor NLS-binding site

H.sapiens M.musculus G.gallus X.laevis D.rerio O.latipes

F (i) Alignment of TPX2 NLS H.sapiens M.musculus G.gallus X.laevis D.rerio O.latipes

Figure S1. Generation of cell lines that conditionally degrade endogenous NuMA and express NuMA mutants. bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Supplemental Figure S2

Parent: tet-OsTIR1(Puro) Parent: RCC1-mAC No.1 NuMA- A RCC1-mAC B NuMA-mCh C mCh (Kb) (Kb) Parent No.1 54 Parent No.1 54 6.0 (kD) 6.0 5.0 Parent RCC1-mAC 4.0 4.2 kb 5.0 3.0 4.0 4.2 kb 2.0 3.0 1.5 2.0 1.0 α-NuMA 250 1.5 0.9 kb 0.5 1.0 * 1.0 kb 75 α-RCC1 3.2 kb 3.3 kb mAID-mClover Neo PCR mCherry Hygro PCR 50 products products RCC1 gene NuMA gene 4.2 kb 4.2 kb Primer Primer Primer Primer α-TUB 50 RCC1 gene 1.0 kb NuMA gene 0.9 kb

D Control E +DOX+IAA F 1st Int NEBD Prometa Meta Ana Telo/Cyto 1st Int NEBD Prometa Meta Ana Telo/Cyto RCC1 degradation in asynchronous culture 80

DNA DNA * -0:10 0:00 0:05 0:20 0:35 0:45 -0:10 0:00 0:05 0:20 0:50 1:00

60 RCC1-mAC RCC1-mAC 40

20 NuMA-mCh NuMA-mCh NEBD to anaphse onset (min) 0 Control RCC1

SiR-TUB SiR-TUB depleted

(hr:min) (hr:min)

NuMA- SiR-DNA RCC1-mAC mAID-mCh SiR700-TUB G H Parent: RCC1-mAC No.1 Control NuMA-mAID-mCh 3.5 kb (Kb) mAID-mCherry Hygro Parent No.1 2 3 4 PCR 10.0 8.0 products 6.0 5.0 NuMA gene 4.0 4.4 kb 4.4 kb 3.0 Primer 2.0 Primer 1.5 1.0 NuMA gene 0.9 kb 0.9 kb 0.5 +Dox+IAA

RCC1 degradation Prometaphase degradation assay Live cell imaging in prometaphase I J 120 +IAA (t= -90 min) * Noc Wash (t=0-15 min) 100 +Nocodazole Move to the Start imaging Plate cells +Dox + SiR-DNA microscope stage (t= -95) 80 Time 0 24 42 47 48 49.5 51.5 (hr) 60 Prometaphase Metaphase Anaphase onset (min) 40 RCC1 degradation Control RCC1 Noc release to anaphse Noc release depleted

Figure S2. Generation of cell lines for auxin-inducible degradation of endogenous RCC1. bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Supplemental Figure S3

importin-β-mAC importin-β-mAC SiR-TUB Parent: RCC1-mAC No.1 SiR-TUB A importin-β-mCh B D importin-α-mCherry expression (Kb) Parent No.5 6 in 293 Flip-In TRex cells 6.0 5.0 4.0 4.1 kb 3.0 ΔIBB WT 2.0 1.5 Living cell tet +- +- (kD) 1.0 100 0.8 kb anti-importin-β α-importin-α 75 anti-importin-β HURP-mACF 3.3 kb HURP-mACF 50 mCherry Hygro PCR C * products Importin-β gene 4.1 kb α-TUB 50 Primer Primer Importin-β gene

0.8 kb Fixed cell

E Parent: tet-OsTIR1(Puro) G NuMA- H I RanGAP1-mAC mCh Spindle length Mitotic duration (Kb) (kD) 6.0 Parent No.1 9 10 Parent RanGAP1-mAC 5.0 n.s. 4.0 4.1 kb 3.0 n.s. 2.0 1.5 α-NuMA 250 1.0 0.9 kb 150 100 Parent: RanGAP1-mAC No.9 α-Ran F GAP1 ** NuMA-mCh 75 (Kb) 6.0 Parent No.3 4 * 5.0 4.0 3.0 4.2 kb

2.0 NEBD to anaphse onset (min) 1.5 50 1.0 α-TUB Ratio of spindle length/cell diameter 0.9 kb Control RanGAP1 Control RanGAP1 depleted depleted

Parent: tet-OsTIR1(Puro) J importin-β-mAC L M N NuMA-mCh Spindle length Mitotic duration (Kb) Parent No.6 7 6.0 5.0 importin-β * 4.0 (kD) * 3.0 -mAC 2.0 4.1 kb Parent 1.5 1.0 α-NuMA 0.5 0.9 kb 250

Parent: Importin-β-mAC No.7 α-importin-β NuMA-mCh 100 K (Kb) Parent No.1 10.0 8.0 6.0 α-TUB 50 5.0 4.0 4.2 kb NEBD to anaphse onset (min) 3.0 2.0 1.5 Ratio of spindle length/cell diameter Control importin-β Control importin-β 1.0 0.9 kb depleted depleted 0.5

Figure S3. Generation of cell lines for auxin-inducible degradation of endogenous Ran-GAP1 and importin-β. bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Supplemental Figure S4

A Parent: RCC1-mAC No.1 B Parent: RCC1-mAC No.1 C Parent: RCC1-mAC No.1 TPX2-mCh mCh-HSET HURP-mCh

(Kb) No.1 2 Parent Parent No.1 2 3 4 (Kb) Parent No.1 82 6.0 6.0 5.0 (Kb) 5.0 4.0 3.6 kb 6.0 4.0 3.6 kb 3.0 5.0 3.0 2.0 4.0 2.0 1.5 3.0 2.2 kb 1.5 1.0 2.0 1.5 1.0 0.5 0.3 kb 1.0 0.5 0.4 kb 0.3 kb 0.5

3.3 kb 1.8 kb 3.3 kb Hygro mCherry mCherry Hygro mCherry Hygro PCR P2A PCR PCR products products products HSET gene HURP gene TPX2 gene 2.2 kb 3.6 kb 3.6 kb Primer Primer Primer Primer Primer Primer HSET gene HURP gene TPX2 gene 0.3 kb 0.4 kb 0.3 kb

Figure S4. Generation of double knock-in cell lines that express RCC1-mAC and mCherry-fused TPX2, HSET, or HURP. bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Supplemental Figure S5

A Parent: tet-OsTIR1(Puro) B C Parent: HURP-mACF No.13 HURP-mACF importin-β-mCh HURP- (Kb) Parent No.1 13 Parent mACF (kD) (Kb) Parent No.13 14 15 6.0 6.0 5.0 5.0 4.0 4.1 kb 4.0 3.7 kb 150 3.0 3.0 2.0 α-HURP 2.0 1.5 1.5 1.0 1.0 100 0.8 kb 0.5 0.5 α-TUB 0.4 kb 50

3.3 kb 3.3 kb mCherry Hygro mAID-mClover-3xFLAG Neo PCR PCR products products Importin-β gene HURP gene 4.1 kb 3.7 kb Primer Primer Primer Primer Importin-β gene 0.8 kb HURP gene 0.4 kb

D Parent: Importin-β-mAC No.7 E Parent: RanGAP1-mAC No.9 HURP-SNAP HURP-mCh importin-β-mCh (Kb) Parent No.1 2 3 (Kb) (Kb) Parent No.3 54 6.0 Parent No.1112 6.0 6.0 5.0 5.0 5.0 4.0 4.1 kb 4.0 3.4 kb 4.0 3.0 3.0 3.0 2.0 2.0 3.7 kb 1.5 2.0 1.5 1.5 1.0 1.0 0.8 kb 1.0 0.5 0.5 0.5 0.4 kb 0.4 kb

3.1 kb 3.3 kb SNAP Hygro PCR mCherry Hygro PCR products products HURP importin-β HURP gene Target gene 3.4 kb 3.7 kb 4.1 kb Primer Primer Primer Primer HURP gene 0.4 kb Target gene 0.4 kb 0.8 kb

Figure S5. Generation of cell lines that degrade or visualize endogenous HURP. bioRxiv preprint doi: https://doi.org/10.1101/473538; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Supplemental Figure S6

B A Control (Exponential recovery) +Dox+IAA (Straight line)

0.6 0.25

0.4 0.20

0.2

Figure S6. Fluorescent recovery kinetics of HURP in the presence or absence of importin-β