DOCSLIB.ORG

Supplementary Table 1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Table 1 SUPPLEMENTARY DATA Supplementary Table 1. Polyphenolic composition of the red grape extract used during the study. Powder humidity (%) 4.2 Total Polyphenols as catechin equivalent (eq) (%) 108.2 Total Polyphenols as gallic acid equivalent (%) 64.4 (Folin–Ciocalteu method) Procyanidins as catechin equivalent (%) 17.9 (Vanillin method) Procyanidins profile by High Performance Liquid Chromatography (HPLC) (%): Catechin as catechin eq 2.07 Epicatechin as epicatechin eq 0.53 Procyanidin dimer B1 as dimer B1 eq 1.97 Procyanidin dimer B1 as dimer B2 eq 1.11 Anthocyanins (Ribereau Gayon method) (%) 4.3 Anthocyanins profile by (HPLC) (%): Delphinidin as delphinidin eq 0.08 Cyanidin as cyanidin eq 0.014 Petunidin as petunidin eq 0.1 Peonidin as peonidin eq 0.11 Malvidin as malvidin eq 0.1 Resveratrol by HPLC as trans resveratrol eq (ppm) 533 Pesticides (ppm) In compliance with (Liste Pharmacopée Européenne 5ème Ed) European regulations ©2012 American Diabetes Association. Published online at http://care.diabetesjournals.org/lookup/suppl/doi:10.2337/dc12-1652/-/DC1 SUPPLEMENTARY DATA Supplementary Table 2. RT-PCR primer sequences. CKMT2 forward : CTCATCGATGACCACTTTCTG CKMT2 reverse : ATTCCACATGAACTCCCAGC CPT1b forward :TACAACAGGTGGTTTGACA CPT1b reverse: CAGAGGTGCCCAATGATG UCP3 forward: ATGGACGCCTACAGAACCAT UCP3 reverse: CTGGGCCACCATCTTTATCA PGC1a forward: TCCTCTGACCCCAGAGTCAC PGC1a reverse: CTTGGTTGGCTTTATGAGGAGG NRF1 forward: GCTGCTGCTGTGGCAACAGG NRF1 reverse: TTGGGTTTGGAGGGTGAGAT NRF2 forward: CCAAGTCCTGCATTGGGTGG NRF2 reverse: GCAAAAACTGCCATAGTTGG PPARa forward: GCTATCATTACGGAGTCCACG PPARa reverse: AGCTGCGGTCGCACTTGTCA PPARb forward: ACTGCCGCTTCCAGAAGTGC PPARb reverse: GCCACCAGCTTCCTCTTCTC ©2012 American Diabetes Association. Published online at http://care.diabetesjournals.org/lookup/suppl/doi:10.2337/dc12-1652/-/DC1 SUPPLEMENTARY DATA Supplementary Table 3. Systemic and muscle antioxidant defenses: vitamin E, plasma SOD, GSH/GSSG (18PCB/20PP); muscle Gpx, Mn- SOD, SOD, catalase activities (9PCB/10PP). There were no significant differences among groups. Values are given as means ± SEM (18PCB/20PP). Post 8wk Post 6d Fructose after 8wk Baseline supplementation supplementation PCB PP PCB PP PCB PP Plasma vitamin E (µmol/L) 26.3 ± 1.4 25.3 ± 1.9 25.0 ± 1.8 24.3 ± 1.1 25.0 ± 1.8 25.5 ± 1.8 SOD activity (U/mg Hb) 1.60 ± 0.11 1.64 ± 0.06 1.61 ± 0.05 1.50 ± 0.09 1.67 ± 0.09 1.62 ± 0.07 GSH/GSSG 20.85 ± 2.78 18.59 ± 2.31 20.92 ± 3.41 16.73 ± 1.62 18.60 ± 2.62 18.59 ± 2.02 GPx (mU/g wet weight) 6518 ± 500 6390 ± 890 6598 ± 533 6220 ± 482 5916 ± 521 6904 ± 635 Mn-SOD (U/g wet weight) 58 ± 4 63 ± 7 66 ± 5 64 ± 6 73 ± 9 66 ± 6 SOD (U/g wet weight) 264 ± 14 272 ± 18 265 ± 15 269 ± 13 283 ± 14 298 ± 12 Catalase (U/g wet weight) 9553 ± 1626 8851 ± 1745 8570 ± 1352 8191 ± 1661 7246 ± 1439 8009 ± 1189 ©2012 American Diabetes Association. Published online at http://care.diabetesjournals.org/lookup/suppl/doi:10.2337/dc12-1652/-/DC1 SUPPLEMENTARY DATA Supplementary Table 4. Inflammatory cytokines and adipokines throughout study exploration visits; plasma inflammatory cytokines and adipokines of reruited subjects. There were no significant differences among groups.Values are given as means ± SEM (18PCB/20PP). Post 6d Fructose after 8wk Baseline Post 8wk supplementation supplementation PCB PP PCB PP PCB PP IL-1ɑ (pg/ml) 1.10 ± 0.25 1.08 ± 0.12 1.10 ± 0.22 0.93 ± 0.06 1.06 ± 0.18 1.01 ± 0.08 IL-1β (pg/ml) 1.40 ± 0.06 1.48 ± 0.07 1.44 ± 0.06 1.64 ± 0.17 1.45 ± 0.08 1.49 ± 0.06 IL-6 (pg/ml) 1.73 ± 0.26 1.84 ± 0.28 1.56 ± 0.18 1.57 ± 0.25 1.46 ± 0.14 1.64 ± 0.19 IL-4 (pg/ml) 2.05 ± 0.20 2.51 ± 0.20 2.35 ± 0.22 2.40 ± 0.20 2.41 ± 0.22 2.27 ± 0.33 TNF-ɑ (pg/ml) 2.51 ± 0.19 2.86 ± 0.21 2.50 ± 0.17 2.70 ± 0.22 2.84 ± 0.27 2.79 ± 0.19 Interferon-ɣ (pg/ml) 2.28 ± 0.19 2.68 ± 0.30 2.26 ± 0.23 2.32 ± 0.16 2.04 ± 0.05 2.29 ± 0.20 Adiponectin (µg/ml) 9.6 ± 1.1 7.3 ± 0.7 9.9 ± 1.1 7.8 ± 1.1 9.3 ± 1.0 7.5 ± 1.0 Leptin (ng/ml) 25.7 ± 4.8 22.6 ± 4.1 27.5 ± 4.8 24.9 ± 5.0 28.6 ± 5.5 25.3 ± 4.6 Ghrelin (pg/ml) 439 ± 66 307 ± 46 387 ± 52 349 ± 43 441 ± 49 354 ± 46 Resistin (ng/ml) 3.6 ± 0.4 3.9 ± 0.3 3.7 ± 0.5 3.6 ± 0.4 3.8 ± 0.6 3.5 ± 0.3 ©2012 American Diabetes Association. Published online at http://care.diabetesjournals.org/lookup/suppl/doi:10.2337/dc12-1652/-/DC1 SUPPLEMENTARY DATA Supplementary Table 5. List of the differentially regulated genes in reponse to Polyphenols/Placebo between the 2 groups. Symbol Gene Name Gene ID FC PCB FC PP ratio PCB/PP p-value ARHGEF26 Rho guanine nucleotide exchange factor (GEF) 26 26084 1.28 ± 0.07 0.93 ± 0.05 1.38 0.0007 SEL1L3 sel-1 suppressor of lin-12-like 3 (C. elegans) 23231 1.16 ± 0.03 0.92 ± 0.04 1.26 0.0007 NELL1 NEL-like 1 (chicken) 4745 0.63 ± 0.11 1.30 ± 0.14 0.48 0.002 ZNF44 zinc finger protein 44 51710 1.08 ± 0.06 0.77 ± 0.06 1.41 0.002 ENO1 enolase 1, (alpha) 2023 0.79 ± 0.07 1.33 ± 0.14 0.60 0.002 ABLIM3 actin binding LIM protein family, member 3 22885 1.16 ± 0.03 0.95 ± 0.04 1.22 0.002 FAM217A family with sequence similarity 217, member A 222826 0.66 ± 0.11 1.35 ± 0.15 0.49 0.002 DLEU2L deleted in lymphocytic leukemia 2-like 79469 0.80 ± 0.12 1.67 ± 0.21 0.48 0.002 BC067907 clone IMAGE 30330955 0.78 ± 0.07 1.08 ± 0.06 0.73 0.002 IGFN1 immunoglobulin-like and fibronectin type III domain containing 1 91156 1.29 ± 0.28 0.47 ± 0.09 2.75 0.003 SMG6 Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans) 23293 1.19 ± 0.07 0.93 ± 0.03 1.29 0.003 TUSC3 tumor suppressor candidate 3 7991 1.21 ± 0.07 0.90 ± 0.07 1.35 0.003 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 144983 1.07 ± 0.04 0.87 ± 0.03 1.23 0.003 LRRK2 leucine-rich repeat kinase 2 120892 0.88 ± 0.05 1.18 ± 0.07 0.74 0.003 AGAP2 ArfGAP with GTPase domain, ankyrin repeat and PH domain 2 116986 1.01 ± 0.04 1.27 ± 0.06 0.80 0.003 DAZAP2 DAZ associated protein 2 9802 1.10 ± 0.05 0.87 ± 0.04 1.26 0.003 ART3 ADP-ribosyltransferase 3 419 1.01 ± 0.07 1.56 ± 0.17 0.65 0.004 TMEM214 transmembrane protein 214 54867 1.08 ± 0.04 0.89 ± 0.03 1.22 0.004 SCIMP SLP adaptor and CSK interacting membrane protein 388325 0.64 ± 0.12 1.21 ± 0.20 0.53 0.004 HPYR1 Helicobacter pylori responsive 1 93668 0.78 ± 0.09 1.77 ± 0.37 0.44 0.004 HGS hepatocyte growth factor-regulated tyrosine kinase substrate 9146 1.10 ± 0.05 0.89 ± 0.03 1.24 0.004 GZF1 GDNF-inducible zinc finger protein 1 64412 1.08 ± 0.05 0.88 ± 0.03 1.23 0.005 SUB1 SUB1 homolog (S. cerevisiae) 10923 1.10 ± 0.04 0.92 ± 0.02 1.20 0.005 ©2012 American Diabetes Association. Published online at http://care.diabetesjournals.org/lookup/suppl/doi:10.2337/dc12-1652/-/DC1 SUPPLEMENTARY DATA Symbol Gene Name Gene ID FC PCB FC PP ratio PCB/PP p-value TGIF1 TGFB-induced factor homeobox 1 7050 0.88 ± 0.11 1.39 ± 0.14 0.64 0.005 TRB@ T cell receptor beta locus 6957 0.80 ± 0.06 1.20 ± 0.11 0.66 0.005 MTMR1 myotubularin related protein 1 8776 1.40 ± 0.16 0.84 ± 0.09 1.66 0.005 ECHDC1 enoyl CoA hydratase domain containing 1 55862 1.08 ± 0.04 0.88 ± 0.04 1.23 0.005 SLC16A6 solute carrier family 16, member 6 (monocarboxylic acid transporter 7) 9120 0.71 ± 0.10 1.19 ± 0.14 0.60 0.005 CHN2 chimerin (chimaerin) 2 1124 0.78 ± 0.09 1.40 ± 0.22 0.56 0.005 DRAM1 DNA-damage regulated autophagy modulator 1 55332 1.10 ± 0.04 0.90 ± 0.04 1.22 0.006 HSD11B1 hydroxysteroid (11-beta) dehydrogenase 1 3290 1.25 ± 0.13 0.86 ± 0.05 1.46 0.006 PGM3 phosphoglucomutase 3 5238 1.14 ± 0.04 0.94 ± 0.03 1.21 0.006 RNGTT RNA guanylyltransferase and 5'-phosphatase 8732 0.70 ± 0.07 1.03 ± 0.08 0.68 0.006 AATF apoptosis antagonizing transcription factor 26574 1.05 ± 0.03 0.89 ± 0.03 1.19 0.006 ABLIM3 actin binding LIM protein family, member 3 22885 1.17 ± 0.06 0.92 ± 0.05 1.27 0.006 AIM2 absent in melanoma 2 9447 0.57 ± 0.11 1.57 ± 0.36 0.36 0.007 LBX1 ladybird homeobox 1 10660 0.92 ± 0.04 1.17 ± 0.06 0.79 0.007 KPNB1 karyopherin (importin) beta 1 3837 1.16 ± 0.04 0.94 ± 0.04 1.23 0.007 LIMD1 LIM domains containing 1 8994 0.84 ± 0.07 1.51 ± 0.24 0.56 0.007 TTC37 tetratricopeptide repeat domain 37 9652 0.92 ± 0.04 1.14 ± 0.05 0.81 0.007 GRM7 glutamate receptor, metabotropic 7 2917 0.65 ± 0.06 1.42 ± 0.39 0.46 0.007 COL19A1 collagen, type XIX, alpha 1 1310 1.35 ± 0.50 7.49 ± 3.88 0.18 0.007 CRB1 crumbs homolog 1 (Drosophila) 23418 1.28 ± 0.15 0.72 ± 0.14 1.79 0.007 ERO1L ERO1-like (S.
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • (PI3K(P110 )) Directly Regulates Key Components of the Z-Disc And
    THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 286, NO. 35, pp. 30837–30846, September 2, 2011 © 2011 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Phosphoinositide 3-Kinase (PI3K(p110␣)) Directly Regulates Key Components of the Z-disc and Cardiac Structure*□S Received for publication, June 13, 2011, and in revised form, July 7, 2011 Published, JBC Papers in Press, July 11, 2011, DOI 10.1074/jbc.M111.271684 Ashley J. Waardenberg‡§, Bianca C. Bernardo¶, Dominic C. H. Ngʈ, Peter R. Shepherd**‡‡, Nelly Cemerlang¶, Mauro Sbroggio` §§, Christine A. Wells‡¶¶, Brian P. Dalrymple§, Mara Brancaccio§§, Ruby C. Y. Linʈʈ1, and Julie R. McMullen¶1,2 From the ‡Eskitis Institute for Cell and Molecular Therapies, Griffith University, Nathan, Queensland, 4111, Australia, §Commonwealth Scientific and Industrial Research Organisation, Food Futures Flagship, Queensland Bioscience Precinct, St. Lucia, Queensland, 4067, Australia, the ¶Baker IDI Heart and Diabetes Institute, Melbourne, Victoria, 8008, Australia, the ʈDepartment of Biochemistry and Molecular Biology, Bio21 Institute, University of Melbourne, Melbourne, Victoria, 3010, Australia, the **Department of Molecular Medicine, University of Auckland, Grafton, Auckland, 1142, New Zealand, the ‡‡Maurice Wilkins Centre for Molecular Biodiscovery, University of Auckland, Grafton, Auckland, 1142, New Zealand, the §§Department of Genetics, Biology, and Biochemistry, University of Torino, Molecular Biotechnology Center, Torino, 10126, Italy, the ¶¶Australian Institute for Bioengineering and Nanotechnology, The University of Queensland, Brisbane, Queensland, 4072, Australia, and the ʈʈRamaciotti Centre for Gene Function Analysis and the School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, New South Wales, 2052, Australia Downloaded from Maintenance of cardiac structure and Z-disc signaling are key from PI3K transgenic mice.
    [Show full text]
  • Progressive Increase in Mtdna 3243A>G Heteroplasmy Causes Abrupt
    Progressive increase in mtDNA 3243A>G PNAS PLUS heteroplasmy causes abrupt transcriptional reprogramming Martin Picarda, Jiangwen Zhangb, Saege Hancockc, Olga Derbenevaa, Ryan Golhard, Pawel Golike, Sean O’Hearnf, Shawn Levyg, Prasanth Potluria, Maria Lvovaa, Antonio Davilaa, Chun Shi Lina, Juan Carlos Perinh, Eric F. Rappaporth, Hakon Hakonarsonc, Ian A. Trouncei, Vincent Procaccioj, and Douglas C. Wallacea,1 aCenter for Mitochondrial and Epigenomic Medicine, Children’s Hospital of Philadelphia and the Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, PA 19104; bSchool of Biological Sciences, The University of Hong Kong, Hong Kong, People’s Republic of China; cTrovagene, San Diego, CA 92130; dCenter for Applied Genomics, Division of Genetics, Department of Pediatrics, and hNucleic Acid/Protein Research Core Facility, Children’s Hospital of Philadelphia, Philadelphia, PA 19104; eInstitute of Genetics and Biotechnology, Warsaw University, 00-927, Warsaw, Poland; fMorton Mower Central Research Laboratory, Sinai Hospital of Baltimore, Baltimore, MD 21215; gGenomics Sevices Laboratory, HudsonAlpha Institute for Biotechnology, Huntsville, AL 35806; iCentre for Eye Research Australia, Royal Victorian Eye and Ear Hospital, East Melbourne, VIC 3002, Australia; and jDepartment of Biochemistry and Genetics, National Center for Neurodegenerative and Mitochondrial Diseases, Centre Hospitalier Universitaire d’Angers, 49933 Angers, France Contributed by Douglas C. Wallace, August 1, 2014 (sent for review May
    [Show full text]
  • Replication of FTO Gene Associated with Lean Mass in a Meta
    www.nature.com/scientificreports OPEN Replication of FTO Gene associated with lean mass in a Meta-Analysis of Genome-Wide Association Studies Shu Ran1, Zi-Xuan Jiang1, Xiao He1, Yu Liu1, Yu-Xue Zhang1, Lei Zhang2,3, Yu-Fang Pei3,4, Meng Zhang5, Rong Hai6, Gui-Shan Gu7, Bao-Lin Liu1, Qing Tian8, Yong-Hong Zhang3,4, Jing-Yu Wang7 & Hong-Wen Deng8* Sarcopenia is characterized by low skeletal muscle, a complex trait with high heritability. With the dramatically increasing prevalence of obesity, obesity and sarcopenia occur simultaneously, a condition known as sarcopenic obesity. Fat mass and obesity-associated (FTO) gene is a candidate gene of obesity. To identify associations between lean mass and FTO gene, we performed a genome-wide association study (GWAS) of lean mass index (LMI) in 2207 unrelated Caucasian subjects and replicated major fndings in two replication samples including 6,004 unrelated Caucasian and 38,292 unrelated Caucasian. We found 29 single nucleotide polymorphisms (SNPs) in FTO signifcantly associated with sarcopenia (combined p-values ranging from 5.92 × 10−12 to 1.69 × 10−9). Potential biological functions of SNPs were analyzed by HaploReg v4.1, RegulomeDB, GTEx, IMPC and STRING. Our results provide suggestive evidence that FTO gene is associated with lean mass. Sarcopenia is a complex disease described as the age-associated loss of skeletal muscle mass, strength and func- tion impairment1,2. Te low skeletal muscle mass will lead to many public health problems such as sarcopenia, osteoporosis and increased mortality3,4, especially in the elderly. Skeletal muscle is heritable with heritability esti- mates of 30–85% for muscle strength and 45–90% for muscle mass5.
    [Show full text]
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals
    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
    [Show full text]
  • Table 1 Gene Name Increased Or Decreased in LTD
    Table_1 gene_name increased or decreased in LTD protein_id description keep_supernatant keep_pellet comparison sample hit_annotation_methodpvalue fdr hit hit_annotation 2010300C02RIK increased E9Q3M9 Protein 2010300C02Rik OS=Mus musculus GN=2010300C02Rik PE=1 SV=1 TRUE TRUE NMDA - control pellet fdrtool 0,074667 0,584087 FALSE trend 2310035C23RIK|KIAA1468increased A0A087WSS1|E9QM90|Q148V7|Q148V7-2 Protein 2310035C23Rik OS=Mus musculus GN=2310035C23Rik PE=1 SV=1|Protein 2310035C23Rik OS=Mus musculusTRUE GN=2310035C23Rik PE=1 SV=2|LisH FALSE domain NMDAand HEAT - control repeat-containing protein KIAA1468 supernatant OS=Mus musculus GN=Kiaa1468 fdrtoolPE=1 SV=1|Isoform 0,080056 2 of 0,589077LisH domain FALSEand HEAT trend repeat-containing protein KIAA1468 OS=Mus musculus GN=Kiaa1468 ABR increased E9PUE7|Q5SSL4|Q5SSL4-2|Q5SSL4-3|Q5SSL4-4 Active breakpoint cluster region-related protein OS=Mus musculus GN=Abr PE=1 SV=1|Isoform 2 of Active breakpointTRUE cluster region-related protein TRUE OS=Mus musculus NMDA GN=Abr|Isoform - control 3 of Active breakpoint supernatant cluster region-related protein OS=Mus fdrtool musculus 0,08128 GN=Abr|Isoform 0,592743 4 of Active FALSE breakpoint trend cluster region-related protein OS=Mus musculus GN=Abr ADAM22 increased D3YUP9|Q9R1V6|Q9R1V6-10|Q9R1V6-11|Q9R1V6-12|Q9R1V6-13|Q9R1V6-14|Q9R1V6-15|Q9R1V6-17|Q9R1V6-4|Q9R1V6-5|Q9R1V6-6|Q9R1V6-7|Q9R1V6-8Disintegrin and metalloproteinase domain-containing protein 22 OS=Mus musculus GN=Adam22 PE=1 SV=1|DisintegrinFALSE and metalloproteinase domain-containing TRUE
    [Show full text]
  • Stimulating the Expression of Sphingosine Kinase 1 (Sphk1) Is BeneCial to Reduce Acrylamide-Induced Nerve Cell Damage
    Stimulating the Expression of Sphingosine Kinase 1 (SphK1) is Benecial to Reduce Acrylamide-Induced Nerve Cell Damage Yong-Hui Wu ( [email protected] ) Harbin Medical University https://orcid.org/0000-0002-4838-2947 Sheng-Yuan Wang Harbin Medical University Xiao-Li Wang Harbin Medical University Rui Xin Harbin Medical University Ye Xin Harbin Medical University Rui Wang Harbin Medical University Kun Ma Harbin Medical University Cui-Ping Yu Harbin Medical University Dan Zhang Harbin Medical University Xiao-Rong Zhou Harbin Medical University Wei-Wei Ma Harbin Medical University Chao Wang Harbin Medical University Research Keywords: Acrylamide, SphKl, Neurotoxicity, Apoptosis, MAPK pathway Posted Date: September 28th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-80914/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Stimulating the expression of sphingosine kinase 1 (SphK1) is beneficial to reduce acrylamide-induced nerve cell damage Sheng-Yuan Wang1, Xiao-Li Wang1, Rui Xin1, Ye Xin1, Rui Wang1, Kun Ma2, Cui-Ping Yu1, Dan Zhang1, Xiao-Rong Zhou1, Wei-Wei Ma3, Chao Wang4, Yong-Hui Wu1* 1 Department of Occupational Health, Public Health College, Harbin Medical University, Harbin, P. R. 2 Department of Hygienic Toxicology, Public Health College, Harbin Medical University, Harbin, P. R. 3 Harbin Railway Center for Disease Control and Prevention, Harbin, P. R. 4 Health Commission of Heilongjiang Province. * Address correspondence to this author at: The Department of Occupational Health, Public Health College, Harbin Medical University, 157 Baojian Road, Nan gang District, Harbin, People’s Republic of China 150086. Phone: +86-451-8750-2827, Fax: +86-451-8750-2827, E-mail: [email protected].
    [Show full text]
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • An Animal Model with a Cardiomyocyte-Specific Deletion of Estrogen Receptor Alpha: Functional, Metabolic, and Differential Netwo
    Washington University School of Medicine Digital Commons@Becker Open Access Publications 2014 An animal model with a cardiomyocyte-specific deletion of estrogen receptor alpha: Functional, metabolic, and differential network analysis Sriram Devanathan Washington University School of Medicine in St. Louis Timothy Whitehead Washington University School of Medicine in St. Louis George G. Schweitzer Washington University School of Medicine in St. Louis Nicole Fettig Washington University School of Medicine in St. Louis Attila Kovacs Washington University School of Medicine in St. Louis See next page for additional authors Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Devanathan, Sriram; Whitehead, Timothy; Schweitzer, George G.; Fettig, Nicole; Kovacs, Attila; Korach, Kenneth S.; Finck, Brian N.; and Shoghi, Kooresh I., ,"An animal model with a cardiomyocyte-specific deletion of estrogen receptor alpha: Functional, metabolic, and differential network analysis." PLoS One.9,7. e101900. (2014). https://digitalcommons.wustl.edu/open_access_pubs/3326 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Authors Sriram Devanathan, Timothy Whitehead, George G. Schweitzer, Nicole Fettig, Attila Kovacs, Kenneth S. Korach, Brian N. Finck, and Kooresh I. Shoghi This open access publication is available at Digital Commons@Becker: https://digitalcommons.wustl.edu/open_access_pubs/3326 An Animal Model with a Cardiomyocyte-Specific Deletion of Estrogen Receptor Alpha: Functional, Metabolic, and Differential Network Analysis Sriram Devanathan1, Timothy Whitehead1, George G. Schweitzer2, Nicole Fettig1, Attila Kovacs3, Kenneth S.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Download The
    PROBING THE INTERACTION OF ASPERGILLUS FUMIGATUS CONIDIA AND HUMAN AIRWAY EPITHELIAL CELLS BY TRANSCRIPTIONAL PROFILING IN BOTH SPECIES by POL GOMEZ B.Sc., The University of British Columbia, 2002 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Experimental Medicine) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) January 2010 © Pol Gomez, 2010 ABSTRACT The cells of the airway epithelium play critical roles in host defense to inhaled irritants, and in asthma pathogenesis. These cells are constantly exposed to environmental factors, including the conidia of the ubiquitous mould Aspergillus fumigatus, which are small enough to reach the alveoli. A. fumigatus is associated with a spectrum of diseases ranging from asthma and allergic bronchopulmonary aspergillosis to aspergilloma and invasive aspergillosis. Airway epithelial cells have been shown to internalize A. fumigatus conidia in vitro, but the implications of this process for pathogenesis remain unclear. We have developed a cell culture model for this interaction using the human bronchial epithelium cell line 16HBE and a transgenic A. fumigatus strain expressing green fluorescent protein (GFP). Immunofluorescent staining and nystatin protection assays indicated that cells internalized upwards of 50% of bound conidia. Using fluorescence-activated cell sorting (FACS), cells directly interacting with conidia and cells not associated with any conidia were sorted into separate samples, with an overall accuracy of 75%. Genome-wide transcriptional profiling using microarrays revealed significant responses of 16HBE cells and conidia to each other. Significant changes in gene expression were identified between cells and conidia incubated alone versus together, as well as between GFP positive and negative sorted cells.
    [Show full text]
  • Biochemical and Cellular Studies of Vertebrate Globins
    Biochemical and Cellular Studies of Vertebrate Globins By Shun Wilford Tse Thesis submitted for the degree of Doctor of Philosophy School of Biological Sciences University of East Anglia September 2015 © This copy of the thesis has been supplied on condition that anyone who consults it is understood to recognise that its copyright rests with the author and that no quotations from the thesis, nor any information derived there-from may be published without the author's prior, written consent. Abstract Human cytoglobin is a small heme-containing protein in the globin superfamily with a wide range of tissue and organ distribution. Although several cellular functions have been proposed for cytoglobin, the exact physiological function is still not fully defined. Recently, cytoglobin has been implicated to have a regulatory role in cancer cells to control cell proliferation and migration depending on cellular oxygen level. In order to gain a better understanding of a structure-to-function relationship of cytoglobin as a heme-protein and to evaluate its possible physiological function(s) in cancer cells, a combination of techniques, including protein engineering and advanced spectroscopies, was deployed. In this study, recombinant human cytoglobin purified from E.coli was purified as a monomeric protein, but displayed a dimeric property in solution. An intra-molecular disulphide bond is formed within the protein which has a redox potential at ca -280 mV. Advanced spectroscopic studies confirmed a low-spin bis-histidyl heme in cytoglobin in both ferric and ferrous state regardless of the state of the disulphide bond. Furthermore, nitrite reductase activitiy in globins was investigated in detail using myoglobin as a model to explore the biochemical basis of the distal histidine residue in determining activity.
    [Show full text]