sign in sign up
<<
Home , Steviol glycoside

World Research Journal of Agricultural Sciences

Vol. 8(1), pp. 292-297, April, 2021. © www.premierpublishers.org. ISSN: 2326-3997

Research Article

Transcript level of genes involved in “” pathway under Gibberellic acid treatment in

Mahboobeh Sasaninezhad1*, Behzad Sorkhi-laleloo2, Bahram Malekie-zanjani3, Farid Soleymani4

1*Master of science, University of Zanjan. 2Seed and Plant improvement Institute, Department of Genetic Research and National Gene Bank, Iran. 3Zanjan university, Department of Plant Engineering and Plant Genetics. 4Topaz Gene Company, Karaj, Iran.

Stevia rebaudiana Bertoni is a plant which has recently been used widely as a sweetener. This medicinal plant has some components such as diterpenoid called glycosides [SGs]. Rebaudioside A is a diterpenoid steviol which is 300 times sweeter than table sugar. This study was done to investigate the effect of GA3 (50 mg/L) on the expression of 14 genes involved in Rebaudioside A biosynthesis pathway in under in vitro conditions. The expression of DXS remarkably decreased by day 3. Also, probably because of the negative feedback of GA3 on MEP-drived , GGDS transcript level reached its lowest amount after GA3 treatment. The abundance of DXR, CMS, CMK, MCS, and CDPS transcripts showed a significant increase at various days after this treatment. A significant drop in the expression levels of KS and UGT85C2 is detected during the first day. However, expression changes of HDR and KD were not remarkable. Results revealed that the level of transcript of UGT74G1 and UGT76G1 up regulated significantly 4 and 2 times higher than control, respectively. However, more research needs to shed more light on the mechanism of GA3 on gene expression of MEP pathway.

Key words: Stevia rebaudiana, steviol glycosides, Rebaudioside A, Transcript level, MEP pathway

INTRODUCTION

S. rebaudiana B, is a small branching shrub that belongs pathway in its primary steps of biosynthesis [Lucho et al, to the Asteraceae family.It is native to the Amambay region 2018]. SGs are formed through 2-C-methyld- in northeast Paraguay, butrecently cultivated in many erythritol-4-phosphate [MEP] pathway followed by tropical and subtropical countries and has been in great hydroxylation of kaurenoic acid and of steviol demand in food and beverages industries due to its low- [Lucho et al, 2018], in which 15 genes are involved [figure calorie sweetening metabolites [Gupta et al, 2015; 1]. Kinghorn et al, 2002; Yadav and Guleria, 2012; Ceunen S, Geuns, 2013]. Stevia is a source of a sweetened diterpene *Corresponding Author: Mahboobeh Sasaninezhad, glycoside called “Rebaudioside A” which is sweeter 300 Master of Science, University of Zanjan. times more than table sugar [Modi et al, 2015]. Among the Email: [email protected] 230 of Stevia genus, only the Robediana and Philobophila Co-Authors 2Email: [email protected] produce steviol glycosides [Brandle and Telmer, 2007]. 3Email: [email protected] Steviol glycosides [SGs] are synthesized in the leaves and 4Email: [email protected] have a common precursor with gibberellins

Transcript level of genes involved in “Rebaudioside A” biosynthesis pathway under Gibberellic acid treatment in Stevia

Figure 1. The principal pathways for “rebaudioside A” biosynthesis in Stevia. The responsible are as follows: 1- deoxy-D-xylulose 5-phosphate synthase [DXS], 1-deoxy-D-xylulose 5-phosphate reductoisomerase [DXR], 4- diphosphocytidyl-2-C-methyl-D-erythritol synthase [CMS], 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase [CMK], 2C- methyl-D-erythritol 2,4-cyclodiphosphate synthase [MCS], [E]-4-hydroxy-3-methylbut-2-enyl diphosphate synthase [HDS], [E]-4-hydroxy-3-methylbut-2-enyl diphosphate reductase [HDR], geranylgeranyl diphosphate synthase [GGDS], copalyl pyrophosphate synthase [CDPS], kaurene synthase [KS], ent-kaurene oxidase [KO], Kaurenoic acid hydroxylase [KAH], UDP-glycosyltransferase 85C2 [UGT85C2], UDP-glycosyltransferase 74G1 [UGT74G1], UDPglycosyltransferase 76G1 [UGT76G1].

There are 8 genes involved in MEP pathway to produce In order to obtain a sufficient plant sample for experiments, geranylgeranyl diphosphate [GGDP] inclouding HDR, a number of Stevia cuttings, containing two buds, were MCS, CMS, DXS, DXR, CMK, HDS, and GGDS. In the provided from National Plant Gene-Bank of IRAN and next step, GGDP is convert to kaurenoic acid through cultured in MS medium [Murashige, Skoog, 1962], Then, copalyl diphosphate synthase [CPPS], kaurene synthase new shoots were again reproduced in sterile conditions of [KS]; kaurene is then transformed to steviol by ent-kaurene MS medium, in order to avoid diversity of individuals. Next, oxidase [KO], Kaurenoic acid hydroxylase [KAH] and Shoots containing 8 leaves [4 pairs of leaves] were cut and finally uridine-diphosphate-dependentglycosyltransferases replaced on liquid MS medium containing 10 μM [UGTs] including UDP-glycosyltransferase 85C2 Gibberellic acid [Sigma Aldrig company, Germany] and set [UGT85C2], UDP-glycosyltransferase 74G1 [UGT74G1], up under growth conditions of 16 h light and 8 h dark at 25 UDPglycosyltransferase 76G1 [UGT76G1] produce °C. Leaves from the untreated [control] and treated plants Rebaudioside A by C-19 carboxylation and C-13 alcohol were excised at 1, 3 and 5 days after treatment. oxygenation of steviol [Richman et al, 2005; Humphrey et Extraction of RNA, cDNA synthesis, primer design and al, 2006; Shibata et al, 1991; Shibata et al, 1995; Lucho et qRT-PCR reaction al, 2019; Abdelsalam et al, 2019]. Total RNA was extracted from the Stevia leaves using Gibberellins belong to tetracyclic diterpene plant GeneAll® RiboEx ™kit [BioFrontier, Korea] according to hormones produced through plastidial GGPP derived from the manufacturer’s protocol, and then its quality was the MEP pathway and have a significant effect on the assessed by 1% agarose gel electrophoresis. In order to biosynthesis of secondary metabolites plant cells synthesis the first strand cDNA, Fermentas kit [Revert Aid [Soleymani et al, 2017]. There are eight enzymatic ™ First Strand cDNA Synthesis Kit] was used. Primer pairs reactions in the MEP pathway to transfer GGPP To GA. of genes of DXS, DXR, CMS, CMK, MCS, HDS, HDR, Studies clarified new insights into the regulation of GA GGDS, CDPS, KS, KD, UGT85C2, UGT74G1, and concentration in plants through analyzing gene expression UGT76G1 were designed with online primer Quest in GA biosynthesis pathway [Olszewski et al, 2002]. This software according [Table 1]. The qRT-PCR performed study was carried out to investigate the effect of time- using RealQ Plus Master Mix [Ampliqon] Master mix and course application of Gibberellic acid on Stevia under in Real-Time PCR Detection System [Biorad] under the vitro conditions in terms of 14 gene expression level following conditions: 95°C for 30 s followed by 40 cycles involved in Rebaudioside A biosynthesis pathway. 95°C for 15 s, 60°C for 20 s and 72°C for 20 s. The genes' relative expression levels were calculated by the ΔΔCT MATERIALS AND METHODS method and the Relative Expression Software Tool Plant Materials, GA3 Treatment and Samplings [REST]® [Pfaffl, 2001].

Transcript level of genes involved in “Rebaudioside A” biosynthesis pathway under Gibberellic acid treatment in Stevia

Table 1, Sequence, Tm and Product size of Primers used in this study. Gene Primer sequence [5'-3'] TM[°C] Product size [bp] ACT F TCTGTTCCAACCGTCTTTG 60 124 R CCACTGAGCACGATGTTAC 60 DXS F GGTTCCCAAGAGGCAATG 60 120 R CCGTATCCCAATATCGCAAC 60 DXR F TCCCGATAATGTGAAATACCC 60 110 R ACATCTCAACCGCTTTCTC 60 CMS F ACTTGGTGTTCCTGCTAAAG 60 111 R TTGATGACCTGTGGAGTTTG 60 CMK F GAATGGTCTGGTGAGATTGG 60 112 R CAAACGGTACAGGTGAAGG 60 MCS F ATGGCTACTTCTTCGTCGTG 60 120 R AATGGGAGAGCGTCTGTTG 60 HDS F CAGGATGGTCTTGGTGATAC 60 121 R CCACGCCTTGTTGAATTTG 60 HDR F GGGAGAAACAGAGGAAATTGG 60 122 R GTCGTTCTTGAGTAGCATCAC 60 GGDS F CAATAAGCCACAAGGTGTACG 60 122 R TCGGACGATCCTGTCTTTG 60 CDPS F CTACACGGCTTCGCTTTG 60 119 R TCCGCTGTCACATCTACTC 60 KS F AACGGAGAAAGTGGGAAAG 60 122 R GCTCTAGGAACAATGCTACC 60 KO F GGTGGCGATGAGTGATTATG 60 112 R CATGATGTCCCTATGGATGC 60 KAH F CATCGAGAGCTTGTCTGC 60 123 R TTCACTTTGGTTCCCATCTC 60 UGT85C2 F CATCGAGAGCTTGTCTGC 60 123 R TTCACTTTGGTTCCCATCTC 60 UGT74G1 F TTAGCACACGAATCAGTAGG 60 128 R AGCTTGGCATTTGTAGTTTG 60 UGT76G1 F TCAGGAGTCATCTGGAACTC 60 122 R CTGGAAGAGGCTGTCAAATG 60 RESULTS AND DISCUSSION signalings would increase the expression level of genes involved in Rebaudioside A biosynthetic pathway in Stevia. The 28s and 18s ribosomal RNA bands in 1% agarose gel Therefore, 14 genes [DXS, DXR, CMS, CMK, MCS, HDS, electrophoresis clearly showed the extracted RNA quality HDR, GGDS, CDPS, KS, KD, UGT85C2, UGT74G1, and [Figure 2]. The extracted RNA and synthesized cDNA was UGT76G1 ] which are identified till now, were selected for measured in term of concentratration using NanoDrop® their expression analysis in GA3 treated and control plants which was 200-400 and 1500-2000 ng/µl respectively. by qRT-PC.

During time-course GA3 elicitation, the abundance of studied genes transcripts was remarkably different comparing with each other. Accordingly, the transcript level of DXS , a key which catalyzes the first reaction of the MEP pathway, after 3 days of GA3 treatment had a remarkable decrease [approximately 5 times lower than those in the control] while at the same time, DXR and CMK genes transcript reached to their highest level [41 and 23 fold respectively].

A significant drop in the expression levels of CMS was Figure 2, RNA samples on a 1% agarose gel. found at 5 days post-treatment. The MCS mRNA level

Expression of genes involved in Rebaudioside A increased slightly within 3 and 5 days [which were 2 and biosynthetic pathway 2.5 fold higher than control] whereas, the amount of HDS mRNA had a drop in all times which just at 5 days was Elicitors have a stimulant effect on terpenoid biosynthesis, significant. There was no considerable change in HDR so it is of interest looking for wether these molecular gene expression [Figure 3].

Transcript level of genes involved in “Rebaudioside A” biosynthesis pathway under Gibberellic acid treatment in Stevia

Transcript level changes of GGDS [Catalysing the terpens in Arabidopsis [Estévez et al, 2001], and in M. conversion Dimethylallyl diphosphate to Geranylgeranyl piperita [Mahmoud and Croteau, 2003]. The current study diphosphate] in plants exposed to GA3 were slightly demonstrated that the trasncript level of DXS gene different. This gene expression at all days of post- decreased during 3 days after GA3 treatment which lead treatment had a considerable decrease, which was 30, 22, to reduction of expression of downstream genes like HDS, and 18 fold lower than control at 1, 3, and 5 days, GGDS, KS, UGT85C2 and uneffected transcript level of respectively. In contrast, the CDPS showed a continuous HDR and KD genes. However, there were some up- and significant increase within all days of GA3 treatment regulated genes including DXR, CMS, CMK, and MCS. reaching maximum levels at 5 days. While the level of Also in piperita, GA3 along with an elicitor resulted transcript of KD was unaffected by GA3, a decrease in in down-regulating of genes [MNMR and MMR] involved in transcription of KS and UGT85C2 detected by 3 and 1-day later stage of biosynthesis pathway [Soleymani et post-treatment, respectively. For UGT74G1, the al, 2017]. By decreasing the DXS acivity, the synthesis of expression level sharply up regulated at 5 days. Also, plastidic isoprenoids drived from MEP pathway after UGT76G [Catalysing the transformation of to exogenous application of GA3 has been limited in Rebaudioside A] showed a drop at 1 day and then plant [Mansouri et al, 2011]. Gibberellins are also accumulated rapidly having its highest transcript at 5 days a diterpen produced through GGPP derived from MEP [2 times higher than that in the control] [figure 4]. pathway. Studies confirmed that the expression of genes involved in GA3 biosynthesis pathway are regulated by feedback control of GA3 exogenous application [Soleymani et al, 2017; Ross et al, 1999]. Therefore, it is likely that the biosynthesis of secondary metabolites drived from the MEP pathway and the expression of related genes may be affected by the self-regulating effect of this hormone. An interest consequence in present study was detected that the transcript level of GGDS reached to its lowest amount in treated plant which was paralel with previous study (Soleymani et al, 2017). However, the expression of CDPS [catalising the transformation of Geranylgeranyl diphosphate to Copalyl diphosphate] dramatically increased in GA3 treated plant. This study Figure 3, The relative expression rate of DXS, DXR, CMS, also revealed that UGT74G1 and UGT76G1 genes are key CMK, MCS, HDS, and HDR genes in 1, 3 and 5 day after regulatory enzymes at the last step of Rebaudioside A applying GA3 treatment in Stevia. **, * and “ns” indicate biosynthesis pathway [Lucho et al, 2018] transcript level significant differences respectively at [P < 0.01], [P<0.05] upregulated by GA3. Therefore, probably the amount of and non- significant differences between control and Rebaudioside A in treated plant had an increase compared treated plants. with control. However, more investigations still need to deeply find out a scrutinize the effect of GA3 negative feedback mechanism in MEP-drived terpenes.

ACKNOWLEDGMENTS

The authors would like to acknowledge the Seed and Plant improvement Institute, Department of Genetic Research and National Gene Bank for providing the necessary laboratory facilities.

REFERENCES Figure 4, The relative expression rate of GGDS, CDPS, KS, KD, UGT85C2, UGT74G1, and UGT76G1 genes in 1, Abdelsalam N. R, Botros W. A, Khaled A. E., Ghonema M. 3 and 5 day after applying GA3 treatment in Stevia. **, * A., Hussein S. G., Ali, H. M, & Elshikh, M. S. (2019). and “ns” indicate significant differences respectively at [P Comparison of uridine diphosphate-glycosyltransferase < 0.01], [P<0.05] and non- significant differences between UGT76G1 genes from some varieties of Stevia control and treated plants. rebaudiana Bertoni. Scientific reports, 9(1), 8559. Brandle, J. E., & Telmer, P. G. (2007). Steviol glycoside In transgenic plants in which DXS is upregulated, the biosynthesis. Phytochemistry, 68(14), 1855-1863. synthesis of downstream terpenes of MEP cascade Ceunen S, Geuns JMC. (2013). Steviol glycosides: controls DXS expression. Studies claimed a positive chemical diversity, metabolism, and function. J Nat correlation between DXS expression and MEP-derived Prod 76:1201–1228.

Transcript level of genes involved in “Rebaudioside A” biosynthesis pathway under Gibberellic acid treatment in Stevia

Estévez J.M, Cantero A, Reindl A, Reichler S,and León P. Richman A, Swanson A, Humphrey T, Chapman R, (2001). 1-Deoxy-D-xylulose 5-phosphate synthase, a McGarvey, B, Pocs R, & Brandle J. (2005). Functional limiting enzyme for plastidic isoprenoid biosynthesis in genomics uncovers three glucosyltransferases plants, J. Biol. Chem, vol. 276, no. 25, pp. 22 901–22 involved in the synthesis of the major sweet 909. of Stevia rebaudiana. The Plant Journal, 41(1), 56-67. Gupta P, Sharma S, Saxena S. (2015). Biomass yield and Ross J. J, MacKenzie‐Hose A. K, Davies P. J, Lester D. R, steviol glycoside production in callus and suspension Twitchin B, & Reid J. B. (1999). Further evidence for culture of Stevia rebaudiana treated with proline and feedback regulation of gibberellin biosynthesis in pea. polyethylene glycol. Applied biochemistry and Physiologia Plantarum, 105(3), 532-538. biotechnology, 176(3), 863-874. Shibata H, Sawa Y, Oka T. A, Sonoke S, Kim K. K, & Humphrey T. V, Richman A. S, Menassa R. & Brandle J. Yoshioka M. (1995). Steviol and steviol-glycoside: E. (2006). Spatial organization of four enzymes from glucosyltransferase activities in Stevia rebaudiana Stevia rebaudiana that are involved in steviol glycoside Bertoni-purification and partial characterization. synthesis. Plant Molecular. Biol. 61, 47–62, Archives of biochemistry and biophysics, 321(2), 390- Kinghorn, A. D, & Soejarto DD. (2002). Discovery of 396. terpenoid and phenolic sweeteners from plants. Pure Shibata H, Sonoke S, Ochiai H, Nishihashi H, & Yamada, and Applied Chemistry, 74(7), 1169-1179. M. (1991). Glucosylation of steviol and steviol- Lucho S. R, do Amaral M. N, Auler P. A, Bianchi V. J, glucosides in extracts from Stevia rebaudiana Bertoni. Ferrer M. Á, Calderón A. A, & Braga E. J. B. (2019). Plant Physiol, 95, 152–156, Salt Stress-Induced Changes in In Vitro Cultured Stevia Soleymani F, Taheri H, & Shafeinia A. R. (2017). Relative rebaudiana Bertoni: Effect on Metabolite Contents, expression of genes of menthol biosynthesis pathway Antioxidant Capacity and Expression of Steviol in peppermint (Mentha piperita L.) after chitosan, Glycosides-Related Biosynthetic Genes. Journal of gibberellic acid and methyl jasmonate treatments. Plant Growth Regulation, 1-13. Russian journal of plant physiology, 64(1), 59-66. Lucho S. R, do Amaral M. N, Milech C, Ferrer M. Á, Yadav SK, Guleria P. (2012). Steviol glycosides from Calderón A. A, Bianchi V. J, & Braga E. J. B. (2018). Stevia: biosynthesis pathway review and their Elicitor-induced transcriptional changes of genes of the application in foods and medicine. Crit Rev Food Sci steviol glycoside biosynthesis pathway in Stevia Nutr 52:988–998. rebaudiana Bertoni. Journal of plant growth regulation, 37(3), 971-985. Lucho S. R, do Amaral M. N, Milech C, Ferrer MÁ, Calderón AA, Bianchi V. J, & Braga, E. J. B. (2018). Elicitor-induced transcriptional changes of genes of the steviol glycoside biosynthesis pathway in Stevia rebaudiana Bertoni. Journal of plant growth regulation, 37(3), 971-985. Mahmoud S. S, & Croteau R. B. (2003). Menthofuran regulates essential oil biosynthesis in peppermint by controlling a downstream monoterpene reductase. Proceedings of the National Academy of Sciences, 100(24), 14481-14486. Accepted 5 March 2021 Mansouri H., Asrar, Z, & Amarowicz R. (2011). The response of terpenoids to exogenous gibberellic acid in Citation: Sasaninezhad M, Sorkhi-laleloo B, Malekie- Cannabis sativa L. at vegetative stage. Acta zanjani B, Soleymani F (2021). Transcript Level of Genes Physiologiae Plantarum, 33(4), 1085-1091. Involved in “Rebaudioside A” Biosynthesis Pathway under Modi A, Litoriya N, Prajapati V, Rafalia R, Narayanan S Gibberellic Acid Treatment in Stevia. World Research (2014). Transcriptional profiling of genes involved in Journal of Agricultural Sciences, 8(1): 292-297. steviol glycoside biosynthesis in Stevia rebaudiana bertoni during plant hardening. Dev Dyn 243:1067– 1073. Copyright: © 2021 Sasaninezhad et al. This is an open- Murashige T, & Skoog F. (1962). A revised medium for access article distributed under the terms of the Creative rapid growth and bio assays with tissue Commons Attribution License, which permits unrestricted cultures. Physiologia plantarum, 15(3), 473-497. use, distribution, and reproduction in any medium, Olszewski N, Sunand T.P, and Gubler F. (2002). provided the original author and source are cited. Gibberellin signaling: biosynthesis, catabolism, and response pathways, Plant Cell, vol. 14, pp. 61–80. Pfaffl M, (2001). A new mathematical for relative quantification in realtime RT-PCR. Nucleic acids Res 29(9):e45.

Transcript level of genes involved in “Rebaudioside A” biosynthesis pathway under Gibberellic acid treatment in Stevia